Mutated genes for the catalytic protein of Oplophorus luciferase and use thereof
10377995 ยท 2019-08-13
Assignee
Inventors
Cpc classification
C12Y113/12013
CHEMISTRY; METALLURGY
C12Y113/12
CHEMISTRY; METALLURGY
International classification
Abstract
A novel luciferase that is distinct from conventional luciferase has been desired. A luciferase mutant comprising an amino acid sequence in which glutamic acid at position 4, arginine at position 11, leucine at position 18 and valine at position 27 are substituted with other amino acids, in the amino acid sequence of SEQ ID NO: 2.
Claims
1. A polynucleotide comprising a nucleotide sequence encoding a recombinant luciferase mutant of (a) or (b) below: (a) a recombinant luciferase mutant comprising the amino acid sequence of SEQ ID NO: 2 substituted at the amino acid positions consisting of: glutamic acid at position 4; arginine at position 11; leucine at position 18; and valine at position 27; or (b) a recombinant luciferase mutant comprising the amino acid sequence of SEQ ID NO: 2 substituted at the positions consisting of: glutamic acid at position 4; arginine at position 11; leucine at position 18; valine at position 27; and one or more amino acid(s) at position(s) other than positions 4, 11, 18, 27, 33, 43, 44, 54, 68, 72, 75, 90, 115, 124, 138, and 166 of the amino acid sequence of SEQ ID NO: 2, wherein the recombinant luciferase mutant has luciferase activity.
2. A recombinant vector comprising the polynucleotide of claim 1.
3. A transformant transformed with the recombinant vector of claim 2.
4. The polynucleotide of claim 1, wherein the recombinant luciferase mutant defined in (b) above is a recombinant luciferase mutant defined in (c) below: (c) a recombinant luciferase mutant comprising the amino acid sequence of SEQ ID NO: 2 substituted at the positions consisting of: glutamic acid at position 4; arginine at position 11; leucine at position 18; valine at position 27; and 1 to 16 amino acid(s) at position(s) other than positions 4, 11, 18, 27, 33, 43, 44, 54, 68, 72, 75, 90, 115, 124, 138, and 166 of the amino acid sequence of SEQ ID NO: 2, and wherein the recombinant luciferase mutant has luciferase activity.
5. The polynucleotide of claim 1, wherein glutamic acid at the amino position 4 is substituted with alanine, arginine at the amino acid position 11 is substituted with glutamine, leucine at the amino acid position 18 is substituted with glutamine, and valine at the amino acid position 27 is substituted with leucine.
6. The polynucleotide of claim 1, wherein the recombinant luciferase mutant defined in (a) or (b) above is a recombinant luciferase mutant defined in (d) or (e), respectively, below: (d) a recombinant luciferase mutant comprising the amino acid sequence of SEQ ID NO: 4; or, (e) a recombinant luciferase mutant comprising the amino acid sequence of SEQ ID NO: 4 in which one or more amino acid(s) at position(s) other than positions 4, 11, 18, 27, 33, 43, 44, 54, 68, 72, 75, 90, 115, 124, 138, and 166 of the amino acid sequence of SEQ ID NO: 4, and wherein the recombinant luciferase mutant has luciferase activity.
7. The polynucleotide of claim 6, wherein the recombinant luciferase mutant defined in (e) above is a recombinant luciferase mutant defined in (f) below: (f) a recombinant luciferase mutant comprising the amino acid sequence of SEQ ID NO: 4 substituted in which 1 to 16 amino acid(s) at position(s) other than positions 4, 11, 18, 27, 33, 43, 44, 54, 68, 72, 75, 90, 115, 124, 138, and 166 of the amino acid sequence of SEQ ID NO: 4, and wherein the recombinant luciferase mutant has luciferase activity.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
MODE FOR CARRYING OUT THE INVENTION
(3) The present invention will be described below in detail.
(4) 1. Luciferase Mutant of the Invention
(5) The term luciferase mutant of the present invention refers to a mutant of the protein with a molecular weight of 19 kDa of Oplophorus luciferase. Specifically, the luciferase mutant of the present invention is intended to mean a luciferase mutant having substantially the same activity as the luciferase mutant comprising an amino acid sequence in which glutamic acid at position 4, arginine at position 11, leucine at position 18 and valine at position 27 are substituted with other amino acids in the amino acid sequence of SEQ ID NO: 2.
(6) The term substantially the same activity is intended to mean at least one activity selected from luciferase activity, activity for extracellular secretion when expressed in animal cells in the presence or absence of secretory signal sequences derived from eukaryotes, and so on.
(7) The term luciferase activity is intended to mean the activity for catalyzing the luminescence reaction using a luciferin (e.g., coelenterazines analogues) which serves as a substrate, namely, the reaction in which luciferin (e.g., coelenterazines analogues) is oxidized with molecular oxygen to produce oxyluciferin in its excited state. The excited state of oxyluciferin produced emits visible light and converts to the ground state of oxyluciferin.
(8) Luminescence activity can be determined by the method described in, e.g., Inouye, S. & Shimomura, O. (1977) Biochem. Biophys. Res. Commun. 233, 349-353. Specifically, the luciferase mutant of the present invention is mixed with a luciferin to start the luminescence reaction, and the activity of catalyzing luminescence reaction can be determined using a luminometer. Commercially available luminometers, e.g., Luminescencer-PSN AB2200 (manufactured by Atto Corp.) or Centro 960 luminometer (manufactured by Berthold Inc.) may be used as luminometers.
(9) The luciferin used in the present invention may be any luciferin as far as it serves as a substrate for the luciferase mutants of the present invention. Specifically, the luciferin used in the present invention includes a coelenterazine analogue containing the imidazopyrazinone ring as the backbone.
(10) The coelenterazine analogue is used to mean coelenterazine or its analogues. Coelenterazine analogues include, for example, bis-coelenterazine, deoxyfuran-coelenterazine (furimazine), h-coelenterazine, hcp-coelenterazine, cp-coelenterazine, f-coelenterazine, fcp-coelenterazine, n-coelenterazine, MeO-coelenterazine, e-coelenterazine, cl-coelenterazine, ch-coelenterazine, 3iso-coelenterazine, 3meo-coelenterazine, cf3-coelenterazine, i-coelenterazine, et-coelenterazine, me-coelenterazine, 3me-coelenterazine, meh-coelenterazine 8-(1-naphthyl)-coelenterazine, 8-(2-naphthyl)-coelenterazine, 8-(2-thienyl)-coelenterazine, 6,8-di(2-thienyl)-coelenterazine, 8-(4-hydroxyphenyl)-coelenterazine, 8-(2-benzothienyl)-coelenterazine, 8-(b-styryl)-coelenterazine, 8-phenyl-coelenterazine, 6-deoxy-coelenterazine, 8-(3-thienyl)-coelenterazine and 8-(3-benzo[b]thienyl)-coelenterazine. Of these coelenterazines analogues, coelenterazine, h-coelenterazine or f-coelenterazine is particularly preferred in the present invention.
(11) These coelenterazine analogues could be synthesized by publicly known methods or may also be commercially available.
(12) The coelenterazine analogues could be synthesized by the methods described in, e.g., Shimomura et al. (1988) Biochem. J. 251, 405-410, Shimomura et al. (1989) Biochem. J. 261, 913-920, Shimomura et al. (1990) Biochem. J. 270, 309-312, Tetrahedron Lett. 38: 6405-6406, WO 2010/090319, Inouye et al. (2010) Anal. Biochem. 407, 247-252 or Inouye et al. (2013) Biocchem. Biophys. Res. Commun. 437, 23-28, or respective modifications thereof. Furimazine may be produced by the method described in Hall et al. (2012) ACS Chem. Biol. 16; 848-1857.
(13) The coelenterazines analogues which are commercially available include, for example, coelenterazine, cf3-coelenterazine and h-coelenterazine manufactured by JNC Corp.; hcp-coelenterazine, cp-coelenterazine, f-coelenterazine, fcp-coelenterazine and n-coelenterazine manufactured by Biotium Inc.; and bis-coelenterazine manufactured by Prolume Ltd. and coelenterazine, furimazine and h-coelenterazine manufactured by Promega Corp.
(14) The luminescence activity using a luciferin as a substrate refers to luminescence activity using preferably coelenterazines analogues as a substrate. Preferably, the luminescence activity using coelenterazines analogues as a substrate is the luminescence activity using which coelenterazine, h-coelenterazine or f-coelenterazine as the substrate.
(15) The term activity for extracellular secretion (secreting extracellularly) when expressed in animal cells in the presence or absence of secretory signal peptide sequences is intended to mean that when the protein is expressed in animal cells, the expressed protein is secreted extracellularly from the endoplasmic reticulum but not via the trans-Golgi network, despite having no secretory signal peptide. The term extracellular secretion (secreting extracellularly) refers specifically to extracellular secretion of the protein in an amount (by weight) of 5% or more, 10% or more, or 20% or more of the expressed protein. Specific examples of the animal cells are those later described.
(16) The luciferase mutant having substantially the same activity as the luciferase mutant comprising an amino acid sequence in which glutamic acid at position 4, arginine at position 11, leucine at position 18 and valine at position 27 are substituted with other amino acids in the amino acid sequence of SEQ ID NO: 2 includes, for example, a luciferase mutant of (a) or (b) described below.
(17) (a) A luciferase mutant comprising an amino acid sequence in which glutamic acid at position 4, arginine at position 11, leucine at position 18 and valine at position 27 are substituted with other amino acids, in the amino acid sequence of SEQ ID NO: 2; or,
(18) (b) A luciferase mutant comprising an amino acid sequence in which glutamic acid at position 4, arginine at position 11, leucine at position 18 and valine at position 27 are substituted with other amino acids and one or more amino acid(s) is/are substituted with other amino acid(s) at position(s) other than at positions 4, 11, 18, 27, 33, 43, 44, 54, 68, 72, 75, 90, 115, 124, 138 and 166, in the amino acid sequence of SEQ ID NO: 2, and having a luciferase activity.
(19) In (a) and (b) described above, the term glutamic acid at position 4, arginine at position 11, leucine at position 18 and valine at position 27 are substituted with other amino acids in the amino acid sequence of SEQ ID NO: 2 is intended to mean that the amino acid residues selected from the positions of 4, 11, 18 and 26 are substituted in the amino acid sequence of SEQ ID NO: 2.
(20) The term other amino acids substituted for glutamic acid at position 4 in the amino acid sequence of SEQ ID NO: 2 includes, for example, alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tryptophan and tyrosine, and preferably, alanine.
(21) The term other amino acids substituted for arginine at position 11 in the amino acid sequence of SEQ ID NO: 2 includes, for example, asparagine, glutamine, serine, threonine, cysteine, lysine, histidine, aspartic acid and glutamic acid, and preferably, glutamine.
(22) The term other amino acids substituted for leucine at position 18 in the amino acid sequence of SEQ ID NO: 2 includes, for example, asparagine, glutamine, serine, threonine, cysteine, lysine, arginine, histidine, aspartic acid and glutamic acid, and preferably, glutamine.
(23) The term other amino acids substituted for valine at position 27 in the amino acid sequence of SEQ ID NO: 2 includes, for example, alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tryptophan and tyrosine, and preferably, leucine.
(24) Where glutamic acid at position 4, arginine at position 11, leucine at position 18 and valine at position 27 are substituted with other amino acids in the amino acid sequence of SEQ ID NO: 2, substitutions with alanine at position 4, with glutamine at position 11, with glutamine at position 18 and with leucine at position 27 are most preferred.
(25) In (b) above, the term one or more amino acid(s) is/are substituted with other amino acid(s) is intended to mean that substitution(s) of one or a plurality of amino acid residues occur at an optional position(s) in the same sequence and at one or a plurality of positions in the amino acid sequence.
(26) The range of one or more in the one or more amino acids are substituted with other amino acids is, for example, 1 to 35, 1 to 34, 1 to 33, 1 to 32, 1 to 31, 1 to 30, 1 to 29, 1 to 28, 1 to 27, 1 to 26, 1 to 25, 1 to 24, 1 to 23, 1 to 22, 1 to 21, 1 to 20, 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2 or 1. In general, the less the number of amino acids substituted, the more preferred. Such proteins may be produced by site-directed mutagenesis described in Sambrook J. et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press (2001), Ausbel F. M. et al., Current Protocols in Molecular Biology, Supplement 1-38, John Wiley and Sons (1987-1997), Nuc. Acids. Res., 10, 6487 (1982), Proc. Natl. Acad. Sci. USA, 79, 6409 (1982), Gene, 34, 315 (1985), Nuc. Acids. Res., 13, 4431 (1985), Proc. Natl. Acad. Sci. USA, 82, 488 (1985), etc.
(27) The position(s) of the amino acids which are substituted at the positions other than at positions 4, 11, 18, 27, 33, 43, 44, 54, 68, 72, 75, 90, 115, 124, 138 and 166 in the amino acid sequence of SEQ ID NO: 2 are not particularly limited, and include position(s) 1 to 20, preferably, 1 to 16, more preferably, 1 to 14, much more preferably, 1 to 12, and most preferably, 1 to 9, selected from the group consisting of positions 1, 2, 3, 13, 14, 15, 25, 30, 36, 70, 83, 106, 128, 153, 156, 157, 159, 162, 163 and 169. In particular, the substitution positions can be position(s) 1 to 9, preferably, 1 to 8, more preferably, 1 to 7, much more preferably, 1 to 6, and most preferably, 1 to 5 (5 or less), selected from the group consisting of positions 1, 2, 3, 13, 14, 153, 159, 163 and 169.
(28) Examples of amino acid residues which are mutually substitutable are given below. Amino acid residues in the same group are mutually substitutable.
(29) Group A: leucine, isoleucine, norleucine, valine, norvaline, alanine, 2-aminobutanoic acid, methionine, o-methylserine, t-butylglycine, t-butylalanine and cyclohexylalanine;
(30) Group B: aspartic acid, glutamic acid, isoaspartic acid, isoglutamic acid, 2-aminoadipic acid and 2-aminosuberic acid;
(31) Group C: asparagine, glutamine, serine, threonine, cysteine, lysine, arginine, histidine, aspartic acid and glutamic acid;
(32) Group D: lysine, arginine, ornithine, 2,4-diaminobutanoic acid and 2,3-diaminopropionic acid;
(33) Group E: proline, 3-hydroxyproline and 4-hydroxyproline;
(34) Group F: serine, threonine and homoserine; and,
(35) Group G: phenylalanine and tyrosine.
(36) In a preferred embodiment of the invention, the luciferase mutant is a luciferase mutant comprising the amino acid sequence of SEQ ID NO: 4.
(37) The luciferase mutant of the present invention may further contain an additional peptide sequence at the N terminus and/or C terminus, preferably at the N terminus. The additional peptide sequence is at least one peptide sequence selected from the group consisting of a peptide sequence for purification, a peptide sequence for expressing the luciferase mutant of the present invention as a soluble protein and an epitope sequence capable of recognizing an antibody. The additional peptide sequence is preferably a peptide sequence for purification. In another preferred embodiment of the invention, the additional peptide sequence is at least one sequence selected from the group consisting of a peptide sequence for purification and a peptide sequence for expressing the luciferase mutant of the present invention as a soluble protein.
(38) Peptide sequences employed in the art may be used as the peptide sequence for purification. The peptide sequence for purification includes, for example, a histidine tag sequence with a consecutive amino acid sequence of at least 4 histidine residues and preferably at least 6 residues, an amino acid sequence with a binding domain of glutathione S-transferase into glutathione, the amino acid sequence of Protein A, etc.
(39) The peptide used to express the luciferase mutant of the present invention as a soluble protein includes, for example, polypeptides represented by formula (Z).sub.n. The amino acid sequences for the polypeptides represented by formula (Z).sub.n and the nucleic acid sequences encoding the same are described in, e.g., JPA KOKAI No. 2008-99669.
(40) Peptide sequences used in the art can be used as the epitope sequence capable of recognizing an antibody.
(41) In some embodiments of the present invention, the additional peptide sequence in the luciferase mutant does not carry any signal peptide sequence for secretion. The secretory signal peptide sequence includes a secretory peptide sequence of Gaussia luciferase, or the like.
(42) The method for acquiring the luciferase mutant of the invention is not particularly limited. The luciferase mutant of the invention may be a protein synthesized by chemical synthesis, or a recombinant protein produced by a genetic engineering technique. When the luciferase mutant of the invention is to be chemically synthesized, synthesis may be carried out by, for example, the Fmoc (fluorenylmethyloxycarbonyl) method or the tBoc (t-butyloxycarbonyl) method. In addition, peptide synthesizers available from Advanced ChemTech, PerkinElmer, Pharmacia, Protein Technology Instrument, Synthecell-Vega, PerSeptive, Shimadzu Corporation, etc. may also be used for chemical synthesis. When the luciferase mutant of the invention is to be produced by a genetic engineering technique, the mutant may be produced by a conventional genetic recombination technique. More specifically, the luciferase mutant of the invention may be produced by inserting a polynucleotide (e.g., DNA) encoding the luciferase mutant of the invention into a suitable expression system. The polynucleotide encoding the luciferase mutant of the invention, expression of the luciferase mutant of the invention in an expression system or the like will be later described.
(43) 2. Polynucleotide of the Invention
(44) The present invention also provides a polynucleotide comprising a polynucleotide encoding the luciferase mutant of the invention described above. The polynucleotide of the invention may be any polynucleotide so long as it has a nucleotide sequence encoding the luciferase mutant of the invention, and a DNA is preferred. Examples of the DNA include genomic DNA, genomic DNA library, cellular or tissue cDNA, cellular or tissue cDNA library, synthetic DNA, etc. Vectors used in the libraries are not particularly limited and may be any of bacteriophages, plasmids, cosmids, phagemids, etc. Also, these vectors may be amplified directly by a Reverse Transcription Polymerase Chain Reaction (hereinafter abbreviated as RT-PCR) using the total RNA or mRNA fraction prepared from the cell or tissue described above.
(45) The polynucleotide of the invention includes the following polynucleotides.
(46) (i) A polynucleotide comprising a polynucleotide encoding a luciferase mutant comprising an amino acid sequence in which glutamic acid at position 4, arginine at position 11, leucine at position 18 and valine at position 27 are substituted with other amino acids, in the amino acid sequence of SEQ ID NO: 2; or,
(47) (ii) A polynucleotide comprising a polynucleotide encoding a luciferase mutant comprising an amino acid sequence in which glutamic acid at position 4, arginine at position 11, leucine at position 18 and valine at position 27 are substituted with other amino acids and one or more amino acid(s) is/are substituted with other amino acid(s) at position(s) other than at positions 4, 11, 18, 27, 33, 43, 44, 54, 68, 72, 75, 90, 115, 124, 138 and 166, in the amino acid sequence of SEQ ID NO: 2, and having a luciferase activity.
(48) The luciferase mutants of (i) and (ii) above are as those described above.
(49) A polynucleotide encoding a protein having a given amino acid sequence, in which one or more amino acids are substituted in the amino acid sequence, can be obtained by using a site-specific mutagenesis technique (see, e.g., Gotoh, T. et al., Gene 152, 271-275 (1995), Zoller, M. J., and Smith, M., Methods Enzymol. 100, 468-500 (1983), Kramer, W. et al., Nucleic Acids Res. 12, 9441-9456 (1984), Kramer W, and Fritz H. J., Methods. Enzymol. 154, 350-367 (1987), Kunkel, T. A., Proc. Natl. Acad. Sci. USA. 82, 488-492 (1985), Kunkel, Methods Enzymol. 85, 2763-2766 (1988); etc.), the methods using amber mutation (see, e.g., the gapped duplex method, Nucleic Acids Res., 12, 9441-9456 (1984), etc.), etc.
(50) Alternatively, mutations may also be introduced into the polynucleotide by PCR (cf., e.g., Ho S. N. et al., Gene, 77, 51 (1989), etc.) using a pair of primers bearing on the respective 5 ends a sequence in which the targeted mutation (deletion, addition, substitution and/or insertion) has been introduced.
(51) Also, a polynucleotide encoding a partial fragment of protein, which is one type of the deletion mutant, can be obtained using as the primers an oligonucleotide having a sequence which matches the nucleotide sequence at the 5 end of the region encoding the partial fragment to be produced in the polynucleotide encoding the target protein and an oligonucleotide having a sequence complementary to the nucleotide sequence at the 3 end thereof, and performing PCR in which the polynucleotide encoding the target protein is used as a template.
(52) The polynucleotide of the present invention includes preferably a polynucleotide comprising a polynucleotide encoding the luciferase mutant comprising the amino acid sequence of SEQ ID NO: 4.
(53) The polynucleotide encoding the luciferase mutant comprising the amino acid sequence of SEQ ID NO: 4 includes a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3. In another embodiment of the invention, the polynucleotide is preferably a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3.
(54) The polynucleotide of the present invention may further contain a polynucleotide encoding an additional peptide sequence at the 5 end and/or 3 end, preferably at the 5 end. The polynucleotide encoding the additional peptide sequence includes a polynucleotide encoding at least one peptide sequence selected from the group consisting of a peptide sequence for purification, a peptide sequence for expressing the luciferase mutant of the present invention as a soluble protein, an epitope sequence capable of recognizing an antibody, and the like.
(55) Polynucleotides comprising nucleotide sequences encoding the peptide sequence for purification employed in the art can be used as the polynucleotide encoding the peptide sequence for purification. Examples of the peptide sequence for purification include those as described above.
(56) The polynucleotide encoding the peptide sequence used to express the luciferase mutant of the present invention as a soluble protein includes, for example, polypeptides represented by formula (Z).sub.n. The amino acid sequences for the polypeptides represented by formula (Z).sub.n and the nucleic acid sequences encoding the same are those as described above.
(57) Polynucleotides comprising nucleotide sequences encoding the epitope sequence capable of recognizing antibodies which are used in the art can be used as the polynucleotide encoding the antibody-recognizing epitope sequence.
(58) In some embodiments of the present invention, the polynucleotide encoding the additional peptide sequence does not include a polynucleotide encoding a secretory signal peptide sequence. The secretory signal peptide sequence includes those as described above.
(59) 3. Recombinant Vector and Transformant of the Invention
(60) The present invention further provides recombinant vectors and transformants comprising the polynucleotides of the present invention described above.
(61) Preparation of Recombinant Vector
(62) The recombinant vector of the invention can be obtained by ligating (inserting) the polynucleotide (DNA) of the invention to (into) an appropriate vector. More specifically, the recombinant vector can be obtained by digesting the purified polynucleotide (DNA) with a suitable restriction enzyme, then inserting into a suitable vector at the restriction enzyme site or multiple-cloning site, and ligating to the vector. The vector for inserting the polynucleotide of the invention is not particularly limited as long as it is replicable in a host, and includes plasmids, bacteriophages, animal viruses, etc. Examples of plasmids include plasmids from E. coli (e.g., pBR322, pBR325, pUC118, pUC119, etc.), plasmids from Bacillus subtilis (e.g., pUB110, pTP5, etc.) and plasmids from yeast (e.g., YEp13, YEp24, YCp50, etc.). Examples of bacteriophages include, e.g., phage. Examples of animal viruses include retroviruses, vaccinia viruses and insect viruses (e.g., baculoviruses). In addition, a pCold I vector, a pCold II vector, a pCold III vector and a pCold IV vector (all manufactured by Takara Bio Inc.), a pcDNA3 vector, a PICZa vector (manufactured by Invitrogen Inc.) and the like may also be suitably used.
(63) The polynucleotide of the present invention is generally ligated in an expressible manner downstream of a promoter in a suitable vector. When the host used for transformation is an animal cell, the promoter is preferably an SV40-derived promoter, retrovirus promoter, metallothionein promoter, heat shock promoter, cytomegalovirus promoter, SR promoter, CMV promoter, and so on. When the host is a bacterium of the genus Escherichia, Trp promoter, T7 promoter, lac promoter, recA promoter, PL promoter, lpp promoter, etc. are preferred. When the host is a bacterium of the genus Bacillus, SPO1 promoter, SPO2 promoter, penP promoter, etc. are preferred. When the host is yeast, PHO5 promoter, PGK promoter, GAP promoter, ADH1 promoter, GAL promoter, etc. are preferred. When the host is an insect cell, polyhedrin promoter, P10 promoter, etc. are preferred.
(64) A low-temperature expression-inducible promoter may also be suitably used. Examples of the low-temperature expression-inducible promoter include promoter sequences for cold shock genes. The cold shock gene includes, for example, E. coli cold shock genes (e.g., cspA, cspB, cspG, cspI and csdA), Bacillus caldolyticus cold shock genes (e.g., Bc-Csp), Salmonella enterica cold shock genes (e.g., cspE) and Erwinia carotovora cold shock genes (e.g., cspG). Among others, cspA promoter, cspB promoter, cspG promoter, cspI promoter, csdA promoter and the like can be advantageously used as the low-temperature expression-inducible promoter.
(65) In addition to the foregoing, the recombinant vector of the invention may further contain, if desired, an enhancer, a splicing signal, a polyA addition signal, a ribosome binding sequence (SD sequence), a selection marker, etc., and provided for use. The selection marker includes, for example, a dihydrofolate reductase gene, an ampicillin resistance gene, a neomycin resistance gene, etc.
(66) Preparation of Transformant
(67) The recombinant vector thus obtained comprising the polynucleotide of the invention is introduced into an appropriate host to prepare the transformant. The host is not particularly limited as long as it is capable of expressing the polynucleotide (DNA) of the invention, and may be bacteria of the genera Escherichia, Bacillus, Pseudomonas and Rhizobium, yeast, animal cells, insect cells, etc. Bacteria of the genus Escherichia include Escherichia coli, etc. Bacteria of the genus Bacillus include Bacillus subtilis, etc. Bacteria of the genus Pseudomonas include Pseudomonas putida, etc. Bacteria of the genus Rhizobium include Rhizobium meliloti, etc. Yeast includes Saccharomyces cerevisiae, Schizosaccharomyces pombe, etc. Animal cells include primary cell cultures, iPS cells, cultured cell lines (CHO cells, HEK293 cells, HL-60 cells, HeLa cells, MDCK cells, NIH3T3 cells, PC12 cells), etc. Insect cells include Sf9, Sf21, etc.
(68) The method of transfecting the recombinant vector into the host and the method of transformation by the same can be performed according to various general methods. The method for transfecting the recombinant vector into the host cell includes the calcium phosphate method (Virology, 52, 456-457 (1973)), the lipofection method (Proc. Natl. Acad. Sci. USA, 84, 7413 (1987)), the electroporation method (EMBO J., 1, 841-845 (1982)), etc. The method for transformation of the bacteria of the genus Escherichia includes the methods described in, e.g., Proc. Natl. Acad. Sci. USA, 69, 2110 (1972), Gene, 17, 107 (1982), etc. The method for transformation of the bacteria of the genus Bacillus includes the method described in Molecular & General Genetics, 168, 111 (1979), etc. The method for transforming yeast includes the method described in Proc. Natl. Acad. Sci. USA, 75, 1929 (1978), etc. The method for transformation of animal cells includes the method described in Virology, 52, 456 (1973), etc. The method for transformation of insect cells includes the method described in Bio/Technology, 6, 47-55 (1988), etc. Thus, the transformant transformed with the recombinant vector comprising the polynucleotide encoding the luciferase mutant of the invention (the polynucleotide of the invention) can be obtained.
(69) Expression Vector and Transformant Comprising Low-Temperature Expression-Inducible Promoter Sequence
(70) An expression vector comprising the low-temperature expression-inducible promoter sequence is preferred as the expression vector among others.
(71) Specifically, the expression vector comprising the low-temperature expression-inducible promoter sequence is intended to mean an expression vector comprising the following promoter sequence and coding sequence: (1) a low-temperature expression-inducible promoter sequence; and, (2) a coding sequence comprising the polynucleotide of the invention.
(72) The low-temperature expression-inducible promoter sequence is intended to mean a promoter sequence which is capable of inducing expression of the protein by lowering the temperature from the culture conditions under which host cells can grow. Examples of the low-temperature expression-inducible promoter are promoters for genes encoding cold shock proteins (cold shock genes). Examples of the cold shock gene promoters include those as described above.
(73) The temperature at which the low-temperature expression-inducible promoter used in the invention is capable of inducing expression is generally 30 C. or less, preferably 25 C. or less, more preferably 20 C. or less, and most preferably 15 C. or less. In order to induce the expression more efficiently, however, the expression induction is generally performed at 5 C. or more, preferably at 10 C. or more, and most preferably at approximately 15 C.
(74) In preparing the expression vector of the invention comprising the low-temperature expression-inducible promoter sequence, the pCold I vector, pCold II vector, pCold III vector and pCold IV vector (all manufactured by Takara Bio Inc.) can be suitably used as the vector for insertion of the polynucleotide of the invention. The protein can be produced as a soluble protein in the cytoplasm in a host cell when expression is performed in a prokaryotic host cell using these vectors.
(75) Prokaryotic cells are preferred as the host into which the expression vector comprising the low-temperature expression-inducible promoter sequence is introduced, more preferably, Escherichia coli, and particularly preferably, the BL21 and JM109 strains. Among others, the BL21 strain is most preferred.
(76) Temperatures for incubation at which the transformant carrying the expression vector comprising the low-temperature expression-inducible promoter sequence grows are generally 25 to 40 C. and preferably 30 to 37 C. Temperatures for inducing the expression are generally 4 to 25 C., preferably 10 to 20 C., more preferably 12 to 18 C., and most preferably 15 C.
(77) 4. Production of Luciferase Mutant of the Invention
(78) The present invention further provides a method for producing the luciferase mutant of the invention, which comprises the steps of culturing the transformant described above to produce the luciferase mutant of the invention. The luciferase mutant of the invention can be produced, for example, by culturing the transformant described above under conditions where the polynucleotide (DNA) encoding the luciferase mutant of the invention can be expressed, producing/accumulating and then separating/purifying the luciferase mutant of the invention.
(79) Incubation of Transformant
(80) The transformant of the invention can be incubated in a conventional manner used for incubation of a host. By the incubation, the luciferase mutant of the invention is produced by the transformant and accumulated within the transformant or in the culture medium.
(81) The medium used for culturing the transformant using bacteria of the genus Escherichia or the genus Bacillus as a host may be any of a natural medium and a synthetic medium as far as it is a medium which contains carbon sources, nitrogen sources, inorganic salts, etc. necessary for growth of the transformant, and in which the transformant can efficiently grow. Examples of carbon sources which can be used are carbohydrates such as glucose, fructose, sucrose, starch, etc.; organic acids such as acetic acid, propionic acid, etc.; alcohols such as ethanol, propanol, and the like. Examples of nitrogen sources which can be used include ammonia, ammonium salts of inorganic or organic acids such as ammonium chloride, ammonium sulfate, ammonium acetate, ammonium phosphate, etc., and other nitrogen-containing compounds, and further include peptone, meat extracts, corn steep liquor, and the like. Examples of inorganic salts include monobasic potassium phosphate, dibasic potassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate, etc. If necessary, antibiotics such as ampicillin or tetracycline can be added to the medium during incubation. Where the transformant transformed with the expression vector using an inducible promoter as the promoter is cultured, an inducer may also be added to the medium, if necessary. For example, when the transformant transformed with an expression vector using a Lac promoter is cultured, isopropyl--D-thiogalactopyranoside (IPTG), etc. may be added to the medium and indoleacrylic acid (IAA), etc. may be added to the medium in culturing the transformant transformed with an expression vector using a trp promoter.
(82) When the host is bacteria of the genus Escherichia, incubation is performed generally at approximately 15 to 43 C. for approximately 3 to 24 hours. If necessary, aeration and agitation may be applied. When the host is bacteria of the genus Bacillus, incubation is performed generally at approximately 30 to 40 C. for approximately 6 to 24 hours. If necessary, aeration and agitation may be applied.
(83) Culture medium for incubation of the transformant when the host is yeast include Burkholder's minimal medium (Proc. Natl. Acad. Sci. USA, 77, 4505 (1980)) and an SD medium containing 0.5% (w/v) Casamino acids (Proc. Natl. Acad. Sci. USA, 81, 5330 (1984)). Preferably, the pH of the medium is adjusted to approximately 5 to 8. Incubation is performed generally at approximately 20 to 35 C. for approximately 24 to 72 hours. If necessary, aeration and agitation may be applied.
(84) Culture medium for culturing the transformant when the host is an animal cell include MEM medium supplemented with approximately 5 to 20% (v/v) fetal calf serum (Science, 122, 501 (1952)), DMEM medium (Virology, 8, 396 (1959)), etc. Preferably, the pH of the medium is adjusted to approximately 6 to 8. Incubation is performed generally at approximately 30 to 40 C. for approximately 15 to 60 hours. If necessary, aeration and agitation may be applied.
(85) Culture medium for culturing the transformant when the host is an insect cell include Grace's insect medium (Nature, 195, 788 (1962)) to which additives such as 10% (v/v) immobilized bovine serum are suitably added. Preferably, the pH of the medium is adjusted to approximately 6.2 to 6.4. Incubation is performed generally at approximately 27 C. for approximately 3 to 5 days. If necessary, aeration and agitation may be applied.
(86) Temperatures for incubation at which the transformant transformed with the expression vector comprising the low-temperature expression-inducible promoter sequence and temperatures for expression induction are as described above.
(87) Separation/Purification of Luciferase Mutant of the Invention
(88) The luciferase mutant of the invention can be obtained by separating/purifying the luciferase mutant of the invention from the culture described above. As used herein, the culture is intended to mean any one of a culture broth, cultured cells or cultured bacteria and a cell lysate of the cultured cells or cultured bacteria. The luciferase mutant of the invention can be separated and purified in a conventional manner.
(89) Specifically, when the luciferase mutant of the invention accumulates in the cultured bacteria or cultured cells, after completion of the incubation the bacteria or cells are disrupted in a conventional manner (e.g., ultrasonication, lysozyme, freezing and thawing, etc.,) and then a crude extract of the luciferase mutant of the invention can be obtained in a conventional manner (e.g., centrifugation, filtration, etc.). When the luciferase mutant of the invention accumulates in the periplasmic space, after completion of the incubation the extract containing the luciferase mutant of the invention can be obtained in a conventional manner (e.g., the osmotic shock method, etc.). When the luciferase mutant of the invention accumulates in the culture broth, after completion of the incubation the culture supernatant containing the luciferase mutant of the invention can be obtained by separating the bacteria or cells and the culture supernatant in a conventional manner (e.g., centrifugation, filtration, etc.).
(90) The luciferase mutant of the invention contained in the extract or culture supernatant thus obtained can be purified by conventional methods of separation and purification. Examples of these methods for separation and purification which may be used include ammonium sulfate precipitation, gel filtration chromatography, ion-exchange chromatography, affinity chromatography, reversed phase high performance liquid chromatography, dialysis, ultrafiltration, etc., alone or in a suitable combination thereof. When the luciferase mutant of the invention contains the peptide sequence for purification described above, it is preferred to perform purification using the same. Specifically, when the luciferase mutant of the invention contains a histidine tag sequence, nickel chelate affinity chromatography may be used; when the luciferase mutant of the invention contains the binding domain of S-transferase to glutathione, affinity chromatography with a glutathione-binding gel may be used; when the luciferase mutant of the invention contains the amino acid sequence of Protein A, antibody affinity chromatography may be used.
(91) 5. Use of Luciferase Mutant of the Invention
(92) Use as Detection Marker by Luminescence
(93) The luciferase mutant of the invention can be used as a detection marker which emits luminescence in the presence of a luciferin (hereinafter detection marker of the present invention). The detection marker of the present invention can be utilized for detection of the target substance in, e.g., an immunoassay, a hybridization assay, etc.
(94) The luciferase mutant of the invention can be expressed, e.g., as a fusion protein with a target protein, and introduced into cells by means of the microinjection method, etc., and the resulting product can be used to determine distribution of the target protein described above. The distribution of such a target protein or the like can be determined by using detection methods such as luminescence imaging. In addition to the introduction into cells by means of the microinjection method or the like, the luciferase mutant of the invention can be expressed in cells to provide for use.
(95) The luminescence substrate (luciferin) used is preferably coelenterazines analogues, and particularly preferably, coelenterazine, h-coelenterazine or f-coelenterazine, as described above.
(96) Use as Reporter Protein
(97) The luciferase mutant of the invention may also be used as a reporter protein to assay the transcription activity of promoters, etc. In this case, the polynucleotide of the invention is used as a reporter gene and the luciferase mutant encoded by the reporter gene is contacted with luciferin. As used herein, the term contact is intended to mean that the luciferase mutant of the invention and a luciferin are allowed to be present in the same reaction system or culture system, which includes, for example, addition of a luciferin to a culture container charged with cells expressing the luciferase mutant of the invention, mixing the cells with a luciferin, and incubation of the cells in the presence of a luciferin. The polynucleotide encoding the luciferase mutant of the invention (i.e., the polynucleotide of the invention) is fused to a target promoter or some other expression control sequence (e.g., an enhancer, etc.) to construct a vector. By introducing the vector into a host cell and detecting the luminescence from the luciferase mutant of the invention in the presence of a luciferin (luminescence substrate), the activity of the target promoter or some other expression control sequence can be assayed. Furthermore, the expressed luciferase mutant is reacted with coelenterazine analogues and the luminescence generated may also be visualized in pictures by using a high-sensitive detector.
(98) The luciferin used is preferably coelenterazine analogues, and particularly preferably, coelenterazine, h-coelenterazine or f-coelenterazine, as described above.
(99) The cells used are preferably animal cells. In a preferred embodiment of the invention, the luciferase mutant is secreted outside of cells even in the case of animal cells.
(100) The polynucleotide of the invention can be used as a reporter gene in such a manner as described above.
(101) Material for Amusement Supplies
(102) The luciferase mutant of the invention has the activity of catalyzing the reaction where a luciferin is oxidized with oxygen molecules to form oxyluciferin in its excited state. The oxyluciferin in the excited state emits visible light to decay to the ground state. Accordingly, the luciferase mutant of the invention can be used preferably as a luminescent material for amusement supplies. Examples of such amusement supplies are luminescent soap bubbles, luminescent ice bars, luminescent candies, luminescent color paints, etc. These amusement supplies of the invention can be prepared in a conventional manner.
(103) The luciferin used is preferably coelenterazine analogues, and particularly preferably, coelenterazine, h-coelenterazine or f-coelenterazine, as described above.
(104) Bioluminescence Resonance Energy Transfer (BRET) Method
(105) By utilizing the principle of interaction between molecules by the bioluminescence resonance energy transfer (BRET) method, the luciferase mutant of the invention is available for analytical methods such as analysis of physiological functions, assay of enzyme activities, etc.
(106) For instance, when the luciferase mutant of the invention is used as a donor and the fluorescent substance (e.g., an organic compound, a fluorescent protein, etc.) is used as an acceptor, the interactions between the donor and acceptor above can be detected by inducing bioluminescence resonance energy transfer (BRET) between them.
(107) In an embodiment of the present invention, the organic compound used as an acceptor includes Hoechist3342, Indo-1, DAP1, etc. In another embodiment of the present invention, the fluorescent protein used as an acceptor includes a green fluorescent protein (GFP), a blue fluorescent protein (BFP), a muted GFP fluorescent protein, phycobilin, etc.
(108) In a preferred embodiment of the present invention, the physiological functions to be analyzed include an orphan receptor (especially, a G protein-coupled receptor), apoptosis, transcription regulation by gene expression, etc. In a further preferred embodiment of the present invention, the enzyme to be analyzed is protease, esterase, kinase, or the like.
(109) Analysis of the physiological functions by the BRET method can be performed by known methods, for example, by modifications of the method described in Biochem. J. 2005, 385, 625-637 or Expert Opin. Ther Tarets, 2007 11: 541-556. Enzyme activities may also be assayed by known methods, for example, by modifications of the method described in Nature Methods 2006, 3:165-174 or Biotechnol. J. 2008, 3:311-324.
(110) The luminescence substrate (luciferin) used is preferably coelenterazines analogues, and particularly preferably, coelenterazine, h-coelenterazine or f-coelenterazine, as described above.
(111) 6. Kit of the Invention
(112) The present invention also provides a kit comprising any one selected from the luciferase mutant of the invention, the polynucleotide of the invention, the recombinant vector of the invention and the transformant of the invention. The kit of the invention may further contain a luciferin.
(113) The luciferin is preferably coelenterazines analogues, and particularly preferably, coelenterazine, h-coelenterazine or f-coelenterazine, as described above.
(114) The kit of the present invention may be prepared with conventional materials by conventional methods. The kit of the present invention may further contain, e.g., sample tubes, plates, instructions for the kit user, solutions, buffers, reagents, and samples suitable for standardization or control samples. The kit of the present invention may further contain salts including halide ions.
(115) The kit of the present invention can be used for the aforesaid measurement using a reporter protein or a reporter gene, the detection marker with luminescence, or the analysis of physiological functions or measurement of enzyme activities by the BRET method. The kit can also be used in the method for luminescence reaction as described below.
(116) 7. Method for Luminescence Reaction
(117) Luminescence Activity
(118) The luciferase mutant of the invention has the ability of catalyzing the reaction which involves oxidization of a luciferin with oxygen molecules to form an oxyluciferin in its excited state. The oxyluciferin in the excited state emits light on returning to the ground state. That is, the luciferase mutant of the invention catalyzes the luminescence reaction in which a luciferin serves as a substrate to cause luminescence. This activity is sometimes referred to as the luminescence activity in the specification.
(119) Luminescence Reaction
(120) The luminescence reaction using the luciferase mutant of the invention in which a luciferin is used as a substrate can be performed by contacting the luciferase mutant of the invention with the luciferin. As used herein, the term contact is intended to mean that the luciferase mutant of the invention and a luciferin are allowed to be present in the same reaction system, which includes, for example, addition of the luciferase mutant of the invention to a container charged with a luciferin, addition of a luciferin to a container charged with the luciferase mutant of the invention and mixing the luciferase mutant of the invention with a luciferin. The reaction can be carried out under conditions conventionally used for the luminescence reaction using Oplophorus luciferase or under conditions modified therefrom.
(121) Specifically, solvents for the reaction which are employed are, for example, a buffer solution such as Tris-HCl buffer, sodium phosphate buffer, etc., water, and the like.
(122) Temperatures for the reaction are generally approximately 4 C. to 40 C. and preferably approximately 4 C. to 25 C. In the reaction solution, pH is generally approximately 5 to 10, preferably approximately 6 to 9, more preferably approximately 7 to 8 and most preferably approximately 7.5.
(123) The luciferin is preferably coelenterazines analogues, and particularly preferably, coelenterazine, h-coelenterazine or f-coelenterazine, as described above.
(124) The luciferin may also be added to the reaction system in the form of a solution in a polar solvent such as dimethylformamide, dimethylsulfoxide, etc., or in an alcohol such as methanol, ethanol, butanol, etc.
(125) Activation of Luminescence Activity
(126) Luciferase activity of the luciferase mutant of the invention can be activated by halide ions, nonionic surfactants, etc.
(127) Examples of the halide ions are fluorine ions, chlorine ions, bromine ions and iodine ions; preferred are chlorine ions, bromine ions and iodine ions.
(128) The concentration of halide ions is generally approximately 10 M to 100 mM, preferably approximately 100 M to 50 mM and particularly preferably approximately 1 mM to 20 mM.
(129) Addition of the halide ions to the reaction system is performed by a method which comprises adding the halide ions in a salt form. The salts used are alkali metal salts such as sodium salts, potassium salts, etc.; alkaline earth metal salts such as calcium salts, magnesium salts, barium salts, etc. More specific examples are NaF, NaCl, NaBr, NaI, KF, KCl, KBr, KI, CaF.sub.2, CaCl.sub.2, CaBr.sub.2, CaI.sub.2, MgF.sub.2, MgCl.sub.2, MgBr.sub.2, MgI.sub.2, etc.
(130) Examples of nonionic surfactants which are commercially available (trade name) include Tween 20 (polyoxyethylene sorbitan monolaurate), Tween 80 (polyoxyethylene sorbitan monooleate), Triton X-100 (polyethylene glycol-p-isooctylphenyl ether), Briji-58 (polyoxyethylene (20) cetyl ether), Nonidet P-40 (ethylphenolpoly(ethylene glycol ether)n), etc., and preferably, Tween 20, Triton X-100, etc.
(131) Concentration of the nonionic surfactant is generally approximately 0.0002% (w/v) to 0.2% (w/v), preferably, approximately 0.001% (w/v) to 0.1% (w/v), and particularly preferably, approximately 0.05% (w/v) to 0.02% (w/v).
(132) Regardless of their purposes, all of the documents and publications described in the specification are incorporated herein by reference, each in its entirety.
(133) Unless otherwise indicated with respect to the embodiments and working examples, the methods described in standard sets of protocols such as J. Sambrook, E. F. Fritsch & T. Maniatis (Ed.), Molecular cloning, a laboratory manual (4th edition), Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2012); F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl (Ed.), Current Protocols in Molecular Biology, John Wiley & Sons Ltd., etc. or modifications or variations thereof are used. When commercially available reagent kits or measuring apparatuses are used, protocols attached thereto are used unless otherwise indicated.
(134) The objects, characteristics and advantages of the present invention as well as the idea thereof are apparent to those skilled in the art from the descriptions given herein. Based on the description given herein, those skilled in the art can easily reproduce the present invention.
(135) It can be understood that the embodiments of the invention, specific working examples, etc. are disclosed as preferred embodiments of the present invention. These descriptions are only for illustrative and explanatory purposes and are not intended to restrict the invention thereto. It is further apparent to those skilled in the art that various modifications may be made based on the descriptions given herein within the intent and scope of the present invention disclosed herein.
EXAMPLES
(136) Hereinafter, the present invention will be described with reference to specific examples but is not deemed to be limited thereto.
Example 1: Preparation of NanoKAZ Gene with Mutation Introduced at the N-Terminal Region
(137) The nanoKAZ gene with mutation introduced at the N-terminal region was prepared by PCR in accordance with the procedure described in Ho et al., Gene (1989) 77: 51-59. Specifically, PCR was performed at two positions (cycle conditions: 25 cycles of 1 min/94 C., 1 min/50 C. and 1 min/72 C.) with a PCR kit (manufactured by Takara Bio Inc.) using as a temperate pcDNA3-GLsp-dnKAZ and four PCR primers. The second PCR was carried out using the two amplified DNA fragments as templates to prepare the mutant gene.
(138) Construction of pcDNA3-GLsp-dnKAZ used as a template was performed as follows.
(139) First, gene amplification was performed by PCR using a template of pCold-ZZ-P-nanoKAZ described in Inouye et al. (2013) Biochem. Biophys. Res. Commun. 437: 23-28 and the following primers. nanoKAZ-1N/EcoRI (5 gcgGAATTCTTCACCCTGGAGGACTTCGTCGGC 3: EcoRI sequence underlined) (SEQ ID NO: 9) nanoKAZ-3C/XbaI (5 gccTCTAGATTAGGCCAGGATTCTCTCGCACAGTCT 3: XbaI sequence underlined) (SEQ ID NO: 10)
(140) Next, a novel expression vector pcDNA3-GLsp in animal cultured cells was constructed. Specifically, the secretory signal peptide sequence of Gaussia luciferase was obtained from pcDNA3-GLuc vector (manufactured by Prolume Ltd.) by PCR using the following primers.
(141) TABLE-US-00001 GLsp-1R/EcoRI (SEQIDNO:11) (5 ggcGAATTCGGTGGGCTTGGCCTCGGCCAC3, EcoRIsequenceunderlined) T7 (SEQIDNO:12) (5 TAATACGACTCACTATAGGG3)
(142) The PCR was followed by digestion of the DNA fragment with HindIII/EcoRI and the resultant fragment was inserted into the HindIII-EcoRI site of pcDNA3 vector (manufactured by Invitrogen Inc.) to construct a novel expression vector pcDNA3-GLsp. The novel expression vector is under the control of the CMV promoter, followed by the Kozak sequence, the secretory signal peptide sequence of Gaussia luciferase and a multiple-cloning site sequence.
(143) The DNA fragment obtained by PCR using pCold-ZZ-P-nanoKAZ as a template was digested with the restriction enzymes of EcoRI/XbaI in a conventional manner and then ligated to the EcoRI-XbaI site of pcDNA3-GLsp to construct the expression vector pcDNA3-GLsp-dnKAZ. The gene sequence inserted was confirmed by sequencing using a DNA Sequencer (manufactured by ABI Inc.).
(144) For example, the nanoKAZ-AQQL gene with mutation introduced at the N-terminal region was constructed as follows. First, the DNA fragments amplified by the following primers were prepared using pcDNA3-GLsp-nanoKAZ as a template. Primers used to prepare the DNA fragment at the first position:
(145) TABLE-US-00002 T7 (SEQIDNO:12) (5 TAATACGACTCACTATAGGG3) nKAZ-2R/AQQL (SEQIDNO:13) (5 CAGGCTGCTCAAGCCGCCCTGCTCCAGGACCTG GTCTTGGTTGTAGCCGGCGGTCTGTTGCCAGTCGCC GACGAAGTCTGCCAGGGTGAAGAC3)
Primers used to prepare the DNA fragment at the second position:
(146) TABLE-US-00003 nKAZ-1F/AQQL (SEQIDNO:14) (5 TTCACCCTGGCAGACTTCGTCGGCGACTGGCAA CAGACCGCCGGCTACAACCAAGACCAGGTCCTGGAG CAGGGCGGCTTGAGCAGCCTGTTC3) BGH-R (SEQIDNO:15) (5 TAGAAGGCACAGTCGAGG3)
(147) The second PCR was carried out using the DNA fragments obtained above at the two positions and two PCR primers: T7 (SEQ ID NO: 12) and BGH-R (SEQ ID NO: 15). Thus, the nanoKAZ-AQQL gene with substitutions of glutamic acid at the amino acid position 4 to alanine, glutamine for arginine at amino acid position 11, glutamine for leucine at amino acid position 18 and leucine for valine at amino acid position 27, in the amino acid sequence of SEQ ID NO: 2 encoded by the nanoKAZ gene was prepared (the nucleotide sequence and amino acid sequence are shown by SEQ ID NO: 3 and SEQ ID NO: 4, respectively).
(148) The nanoKAZ-KVA gene (the nucleotide sequence and amino acid sequence are shown by SEQ ID NO: 5 and SEQ ID NO: 6, respectively) and the nanoKAZ-FLM gene (the nucleotide sequence and amino acid sequence are shown by SEQ ID NO: 7 and SEQ ID NO: 8, respectively) with mutations introduced at the N-terminal region using the primers listed in TABLE 1 were constructed in a similar manner.
(149) TABLE-US-00004 TABLE1 TemplatesandPCRprimersusedtoconstructthenanoKAZ-AQQL, nanoKAZ-KVAandnanoKAZ-FLMproteins Clone Template Primer Sequence pcDNA3- 1st pcDNA3- a T7 5 TAATACGACTCACTATAGGG3 (SEQIDNO:12) GLsp- PCR GLsp- b nKAZ-2R/ 5 CAGGCTGCTCAAGCCGCCCTGCTCCAGGACCTGGTCTTGGTTGTAGCC nKAZ- nanoKAZ- AQQL GGCGGTCTGTTGCCAGTCGCCGACGAAGTCTGCCAGGGTGAAGAC3 AQQL EX (SEQIDNO:13) pcDNA3- c nKAZ-1F/ 5 TTCACCCTGGCAGACTTCGTCGGCGACTGGCAACAGACCGCCGGCTAC GLsp- AQQL AACCAAGACCAGGTCCTGGAGCAGGGCGGCTTGAGCAGCCTGTTC3 nanoKAZ- (SEQIDNO:14) EX d BGH-R 5 TAGAAGGCACAGTCGAGG3 (SEQIDNO:15) 2nd 1stPCR a T7 5 TAATACGACTCACTATAGGG3 (SEQIDNO:12) PCR product d BGH-R 5 TAGAAGGCACAGTCGAGG3 (SEQIDNO:15) pcDNA3- 1st pcDNA3- a T7 5 TAATACGACTCACTATAGGG3 (SEQIDNO:12) GLsp- PCR GLsp- b nKAZ-4R/ 5 GTGGATGTCAGCCTTCAGGCCGTTCTCGCCGCTAAGGACAACTTTCTG nKAZ- nanoKAZ- KVA GATGGGGGT3 (SEQIDNO:16) KVA EX pcDNA3- c nKAZ-3F/ 5 CCCATCCAGAAAGTTGTCCTTAGCGGCGAGAACGGCCTGAAGGCT GLsp- KVA GACATCCACGTC3 (SEQIDNO:17) nanoKAZ- d BGH-R 5 TAGAAGGCACAGTCGAGG3 (SEQIDNO:15) EX 2nd 1stPCR a T7 5 TAATACGACTCACTATAGGG3 (SEQIDNO:12) PCR product d BGH-R 5 TAGAAGGCACAGTCGAGG3 (SEQIDNO:15) pcDNA3- 1st pcDNA3- a T7 5 TAATACGACTCACTATAGGG3 (SEQIDNO:12) GLsp- PCR GLsp- b nKAZ-6R/ 5 CTTGAAGATCATCTCGATTAGGCCCATCTGAAAGCCGCTCAGGCC3 nKAZ- nanoKAZ- FLM (SEQIDNO:18) FLM EX pcDNA3- c nKAZ-5F/ 5 CTGAGCGGCTTTCAGATGGGCCTAATCGAGATGATCTTCAAGGTC3 GLsp- FLM (SEQIDNO:19) nanoKAZ- d BGH-R 5 TAGAAGGCACAGTCGAGG3 (SEQIDNO:15) EX 2nd 1stPCR a T7 5 TAATACGACTCACTATAGGG3 (SEQIDNO:12) PCR product d BGH-R 5 TAGAAGGCACAGTCGAGG3 (SEQIDNO:15)
Example 2: Construction of E. Coli Expression Vectors for ZZ-Fused NanoKAZ Mutants
(150) The mutants were expressed in E. coli as a ZZ-fused protein. Specifically, the expression vector pCold-ZZ-P-X (described in Inouye & Sahara, Protein Express. Purif. (2009) 66:52-57) was used to express the nanoKAZ mutant proteins as soluble proteins in E. coli.
(151) The mutated gene fragment obtained in EXAMPLE 1 was purified using a PCR purification kit (manufactured by QIAGEN). After digestion with the restriction enzymes of EcoRI/XbaI, the fragment was ligated to the EcoRI-XbaI site of pCold-ZZ-X to construct the following expression vectors for the ZZ-fused nanoKAZ mutants: pCold-ZZ-P-nKAZ-AQQL, pCold-ZZ-P-nKAZ-KVA and pCold-ZZ-P-nKAZ-FLM. The gene sequence inserted was confirmed by sequencing using a DNA Sequencer (manufactured by ABI Inc.)
Example 3: Expression of ZZ-Fused NanoKAZ Mutants in Escherichia Coli
(152) The recombinant plasmids prepared in EXAMPLE 2 and pCold-ZZ-P-nanoKAZ as a control vector were used to express the ZZ-fused nanoKAZ mutants in Escherichia coli.
(153) The DNA fragment obtained in EXAMPLE 1 was digested with the restriction enzymes of EcoRI/XbaI in a conventional manner and then ligated to the EcoRI-XbaI site of pCold-ZZ-P-X to construct pCold-ZZ-P-nanoKAZ. The gene sequence inserted was confirmed by sequencing using a DNA Sequencer (manufactured by ABI Inc.).
(154) The E. coli BL21 strain (manufactured by Novagen) was used as a host cell. The strain was cultured in 10 mL of Luria-Bertani medium containing ampicillin (50 g/mL) at 37 C. for 18 hours. The seed culture was inoculated to 10 mL of LB medium and incubated for 3 hours, followed by cooling in an ice-water bath for 1 hour. IPTG was added to the culture medium at a final concentration of 0.2 mM, followed by incubation at 15 C. for further 20 hours. The E. coli cells were collected from 1 mL of the culture medium by centrifugation. The collected E. coli cells were suspended in 0.5 mL of 50 mM Tris-HCl (pH 7.6) containing 10 mM EDTA (manufactured by Wako Pure Chemical Industries, Ltd.). The cells were disrupted by sonication for 5 seconds using a Branson Model 250 Sonifire. The cells were subjected to high-speed centrifugation to recover 0.5 mL of the supernatant as a soluble fraction containing the ZZ-fused nanoKAZ mutant. This soluble fraction, 5 L, was subjected to SDS-PAGE electrophoresis to confirm expression of the proteins. The results are shown in
Example 4: Assay for Luminescence Activity of NanoKAZ Mutants
(155) After 5 L of the soluble fraction solution obtained in EXAMPLE 3 was added to 100 L, of 50 mM Tris-HCl (pH 7.6)-10 mM EDTA containing 1 g of coelenterazine (manufactured by JNC Corp.) or its analogue, a luminescence reaction was started. Luminescence activity was measured for 60 seconds using a luminometer (manufactured by Atto Inc.: AB2200). The relative maximum intensity of luminescence (I.sub.max) and the integrated values for 60 seconds within parentheses in terms of relative intensity of luminescence are shown in TABLE 2.
Example 5: Substrate Specificities for ZZ-Fused NanoKAZ Mutants
(156) The coelenterazine analogues used for substrate specificity studies were synthesized by the methods described in publications, respectively. Specifically, bis-coelenterazine was synthesized by the method described in Nakamura et al. (1997) Tetrahedron Lett. 38: 6405-6406, furimazine by the method described in Hall et al. (2012) ACS Chem. Biol. 16; 848-1857, h-coelenterazine by the method described in Inouye et al (2010) Anal. Biochem. 407:247-252 and 6h-coelenterazine and 6h-f-coelenterazine by the method described in Inouye et al (2013) Biochem. Biophys. Res. Commun. 437: 23-28. f-coelenterazine was purchased from Prolume Ltd. Luminescence activity of the ZZ-fused nanoKAZ mutants was measured by the method described in EXAMPLE 4.
(157) The results are shown in TABLE 2. The results of TABLE 2 reveal that when coelenterazine (CTZ) was used as the luminescence substrate, the maximum luminescence intensity of nanoKAZ-AQQL was approximately 20-fold higher than that of nanoKAZ. When h-coelenterazine and f-coelenterazine were used among coelenterazine analogues, nanoKAZ-AQQL showed approximately 30-fold higher and 20-fold higher than nanoKAZ, respectively, as compared to when coelenterazine (CTZ) was used as the substrate.
(158) TABLE-US-00005 TABLE 2 Luminescence substrate and substrate specificity of ZZ-fused nanoKAZ mutants expressed in E. coli Relative maximum intensity of luminescence I.sub.max (integrated values Luminescence of relative intensity of luminescence for 1 min) substrate nanoKAZ nanoKAZ-AQQL nanoKAZ-KVA nanoKAZ-FLM Coelenterazine 1.0 (1.0) 19.3 (11.6) 0.6 (0.6) 0.3 (0.3) (CTZ) bis-coelenterazine 9.0 (6.3) 4.8 (4.9) 11.1 (7.5) 5.7 (3.2) h-coelenterazine 14.2 (7.4) 28.9 (10.5) 9.1 (4.7) 9.5 (6.5) 6h-coelenterazine 0.6 (0.4) 5.4 (3.9) 0.1 (0.1) 0.2 (0.1) f-coelenterazine 20.2 (10.0) 21.0 (8.0) 17.4 (7.2) 10.9 (5.9) 6h-f-coelenterazine 7.9 (4.6) 4.6 (5.0) 11.9 (7.7) 9.0 (4.7) Furimazine 4.8 (3.7) 2.3 (2.6) 5.4 (3.6) 3.0 (2.3)
Example 6: Construction of Vectors for Secretory Expression of NanoKAZ Mutants in Animal Culture Cells Using Secretory Signal Peptide Sequence of Gaussia Luciferase
(159) Vectors for secretory expression of nanoKAZ mutants in animal culture cells were constructed as follows, using the secretory signal peptide sequence of Gaussia luciferase.
(160) The mutated gene fragment prepared in EXAMPLE 1 was purified using a PCR purification kit (manufactured by QIAGEN). After digestion with the restriction enzymes of EcoRI/XbaI in a conventional manner, the fragment was ligated to the EcoRI-XbaI site of pcDNA3-GLsp vector to construct the expression vectors of pcDNA3-GLsp-nanoKAZ-AQQL, pcDNA3-GLsp-nanoKAZ-KVA and pcDNA3-GLsp-nanoKAZ-FLM. The gene sequence inserted was confirmed by sequencing using a DNA Sequencer (manufactured by ABI Inc.).
Example 7: Construction of Vectors for Secretory Expression of NanoKAZ Mutants in Animal Culture Cells without Using Secretory Signal Peptide Sequences
(161) The pcDNA3-GLsp-nanoKAZ-AQQL, pcDNA3-GLsp-nanoKAZ-KVA and pcDNA3-GLsp-nanoKAZ-FLM vectors obtained in EXAMPLE 6 were digested with the restriction enzymes of Asp718/XbaI in a conventional manner and the resultant DNA fragment was ligated to the Asp718/XbaI site of pcDNA3 vector (manufactured by Invitrogen Inc.) to construct pcDNA3-nanoKAZ-AQQL, pcDNA3-nanoKAZ-KVA and pcDNA3-nanoKAZ-FLM. The gene sequence inserted was confirmed by sequencing using a DNA Sequencer (manufactured by ABI Inc.).
Example 8: Transfection of Vectors to Animal Culture Cells and Preparation of Enzyme for Assay
(162) (1) Purification of Expression Plasmid
(163) The recombinant plasmids obtained in EXAMPLES 6 and 7 were purified from E. coli JM83 host strain using a plasmid purification kit (manufactured by QIAGEN) and dissolved in sterile water. The firefly luciferase vector (pGL4.13 [Luc2/sv40]: manufactured by Promega Corp.) was similarly prepared and used as an internal standard.
(164) (2) Transfection and Preparation of Enzyme for Assay
(165) Chinese hamster ovary cell line CHO-K1 was cultured in Ham's F-12 medium (manufactured by Wako Pure Chemical Industries, Ltd.) supplemented with 10% (v/v) fetal bovine serum (manufactured by Biowest Inc.). The CHO-K1 cells were seeded in a 6-well plate in 210.sup.5 cells/well/2 mL medium (n=2) and cultured in an incubator at 37 C. in 5% (v/v) CO.sub.2. After 24 hours, the purified recombinant plasmid was transfected to CHO-K1 cells using a FuGene HD transfection kit (manufactured by Promega Corp.) and the cells were provided for subsequent experiment. Specifically, 1 g of the recombinant plasmid, 0.1 g of the internal standard vector pGL4.13 [Luc2/sv40] and 3.3 L of FuGene HD were added to 100 L of the medium and allowed to stand at room temperature for 15 minutes. Subsequently, 100 L of the DNA-FuGene complex solution was added to the cells in the 6-well plate. After incubation for 46 hours, the culture medium was collected.
Example 9: Assay for Luminescence Activity of NanoKAZ Mutants Expressed in the Medium of Animal Culture Cells
(166) The crude enzyme solution, 5 l, obtained in EXAMPLE 8 was added to 100 l of 30 mM Tris-HCl (pH 7.6)-10 mM EDTA (Wako Pure Chemical Industries, Ltd.) containing 1 g of coelenterazine (manufactured by JNC Corp.), and the luminescence reaction was started. Luminescence activity was measured for 60 seconds using a luminometer (manufactured by Atto Inc.: AB2200); the maximum intensity of luminescence (I.sub.max) and the integrated values for 60 seconds within parentheses in terms of relative intensity of luminescence are shown in TABLE 3.
(167) Regarding firefly luciferase used as an internal standard to confirm the efficiency of transfection, 5 L of the cell extract obtained in EXAMPLE 7 was added to 100 L of a reagent for enzyme assay (Promega Corp.) to start a luminescence reaction. Luminescence activity was measured for 10 seconds in terms of the maximum intensity of luminescence (I.sub.max), using a luminometer (manufactured by Atto Inc.: AB2200). It was confirmed by the results that the transfection efficiencies were almost the same. Therefore, the firefly luciferase was used as the internal standard to calculate the relative activity.
Example 10: Luminescence Activity and Substrate Specificity of NanoKAZ Mutants Secreted into the Culture Medium from Animal Culture Cells Using a Secretory Signal Peptide Sequences
(168) Luminescence activity of the nanoKAZ mutants secreted into the culture medium from animal cultured cells using the secretory signal peptide sequence was measured by the method described in EXAMPLE 9. The results are shown in TABLE 3. The results of TABLE 3 reveal that nanoKAZ-AQQL in the nanoKAZ mutants was secreted from the cells and showed approximately 20-fold higher luminescence activity than that of nanoKAZ when coelenterazine was used as the substrate. The nanoKAZ-AQQL mutant is secretable protein and can use coelenterazine as the most efficient substrate for the luminescence reaction.
(169) TABLE-US-00006 TABLE 3 Luminescence activity and substrate specificity of nanoKAZ mutants secreted into the culture medium from animal culture cells using a secretory signal peptide sequence Relative maximum intensity of luminescence I.sub.max (integrated values Luminescence of relative intensity of luminescence for 1 min) substrate nanoKAZ nanoKAZ-AQQL nanoKAZ-KVA nanoKAZ-FLM Coelenterazine 1.0 (1.0) 20.0 (15.9) 0.01 (0.004) 0.1 (0.1) (CTZ) bis-coelenterazine 11.1 (11.1) 1.8 (1.6) 0.1 (0.06) 3.4 (3.4) h-coelenterazine 16.4 (9.9) 13.9 (3.3) 0.1 (0.04) 4.8 (3.4) 6h-coelenterazine 0.8 (0.7) 2.3 (2.5) 0.001 (0.001) 0.1 (0.1) f-coelenterazine 21.6 (12.2) 9.7 (3.8) 0.2 (0.03) 8.1 (4.8) 6h-f-coelenterazine 11.7 (11.8) 1.1 (1.1) 0.1 (0.08) 5.5 (5.5) Furimazine 5.9 (6.2) 0.7 (0.7) 0.1 (0.05) 1.5 (1.6)
Example 11: Secretory Expression of NanoKAZ Mutants into the Culture Medium from Animal Culture Cells without Using a Secretory Signal Peptide Sequences
(170) Luminescence activity of the nanoKAZ mutants in culture medium, which were secreted from animal culture cells without using a secretory signal peptide sequence, was measured by the method described in EXAMPLE 9. The results are shown in TABLE 4. The results of TABLE 4 reveal that, among the nanoKAZ mutants carrying no signal peptide sequence for secretion, nanoKAZ-AQQL was secreted from the cells and showed approximately 18-fold higher luminescence activity than that of nanoKAZ, when coelenterazine was used as the substrate. This expression level of nanoKAZ-AQQL was similar to that of nanoKAZ-AQQL carrying the secretory signal peptide sequence described in TABLE 3, which shows about 20-fold activity of nanoKAZ. That is, nanoKAZ-AQQL is a secretable mutant in the absence of the secretory signal peptide sequence for secretion. As nanoKAZ secreted into the culture medium in the absence or presence of secretory signal peptide sequences is considered to have the similar basic structure in both proteins, their substrate specificities are likely to be the same. These results indicate that nanoKAZ-AQQL as a nanoKAZ mutant can be secreted from animal culture cells in the presence or absence of eukaryotic secretory signal peptide sequences and enables the most efficient use of coelenterazine as the substrate.
(171) TABLE-US-00007 TABLE 4 Luminescence activity of nanoKAZ mutants expressed in culture medium of animal culture cells without using a secretory signal peptide sequence Relative maximum intensity of luminescence I.sub.max (integrated Luminescence values of relative intensity of luminescence for 1 min) substrate nanoKAZ nanoKAZ-AQQL nanoKAZ-KVA nanoKAZ-FLM Coelenterazine 1.0 (1.0) 18.3 (15.2) 0.003 (0.001) 0.06 (0.1) (CTZ)
[Sequence Listing Free Text] [SEQ ID NO: 1] Nucleotide sequence of nanoKAZ. [SEQ ID NO: 2] Amino acid sequence of nanoKAZ. [SEQ ID NO: 3] Nucleotide sequence of nanoKAZ-AQQL. [SEQ ID NO: 4] Amino acid sequence of nanoKAZ-AQQL. [SEQ ID NO: 5] Nucleotide sequence of nanoKAZ-KVA. [SEQ ID NO: 6] Amino acid sequence of nanoKAZ-KVA. [SEQ ID NO: 7] Nucleotide sequence of nanoKAZ-FLM. [SEQ ID NO: 8] Amino acid sequence of nanoKAZ-FLM. [SEQ ID NO: 9] Nucleotide sequence of the primer used in EXAMPLES (nanoKAZ-1N/EcoRI). [SEQ ID NO: 10] Nucleotide sequence of the primer used in EXAMPLES (nanoKAZ-3C/XbaI). [SEQ ID NO: 11] Nucleotide sequence of the primer used in EXAMPLES (GLsp-1R/EcoRI) [SEQ ID NO: 12] Nucleotide sequence of the primer used in EXAMPLES (T7). [SEQ ID NO: 13] Nucleotide sequence of the primer used in EXAMPLES (nKAZ-2R/AQQL). [SEQ ID NO: 14] Nucleotide sequence of the primer used in EXAMPLES (nKAZ-1F/AQQL). [SEQ ID NO: 15] Nucleotide sequence of the primer used in EXAMPLES (BGH-R). [SEQ ID NO: 16] Nucleotide sequence of the primer used in EXAMPLES (nKAZ-4R/KVA). [SEQ ID NO: 17] Nucleotide sequence of the primer used in EXAMPLES (nKAZ-3F/KVA). [SEQ ID NO: 18] Nucleotide sequence of the primer used in EXAMPLES (nKAZ-6R/FLM). [SEQ ID NO: 19] Nucleotide sequence of the primer used in EXAMPLES (nKAZ-5F/FLM).