Compositions and methods for treating cancer, inhibiting cell proliferation, and inducing cell death
10370665 ยท 2019-08-06
Assignee
Inventors
- Donald M. Miller (Louisville, KY)
- Shelia D. Thomas (Louisville, KY, US)
- Alexandra Sokolova (Louisville, KY, US)
- Francine Rezzoug (Louisville, KY, US)
Cpc classification
C12N2310/18
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
Abstract
Quadruplex-forming guanine-rich nucleic acid sequences are useful in compositions and methods for inhibiting cellular growth and proliferation and inducing cell death. Compositions for treating a patient are provided, including (i) a safe and effective amount of a sequence having at least 80% nucleic acid identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 and combinations thereof, and (ii) a carrier, wherein the isolated oligonucleotide forms at least one quadruplex.
Claims
1. A composition comprising: (i) at least two different isolated oligonucleotides and each oligonucleotide has at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, (ii) a carrier, and (iii) a growth inhibiting agent.
2. The composition of claim 1, wherein the composition comprises at least three different isolated oligonucleotides and each oligonucleotide has at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.
3. The composition of claim 1, wherein at least one isolated oligonucleotide has at least 90% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.
4. The composition of claim 1, wherein at least one isolated oligonucleotide has at least 95% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.
5. The composition of claim 1, wherein at least one isolated oligonucleotide has at least 98% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.
6. The composition of claim 1, wherein at least one isolated oligonucleotide has at least 99% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.
7. The composition of claim 1, wherein at least one isolated oligonucleotide has a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.
8. The composition of claim 1, wherein at least one isolated oligonucleotide has at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, and SEQ ID NO: 8.
9. The composition of claim 1, wherein the growth inhibiting agent is a chemotherapeutic agent.
10. A method of inhibiting cell growth, comprising contacting a cell with the composition of claim 1.
11. A method of inhibiting telomerase activity of a cell, comprising contacting the cell with the composition of claim 1.
12. The method of claim 10, wherein the composition comprises an isolated oligonucleotide with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 8.
13. The method of claim 11, wherein the composition comprises an isolated oligonucleotide with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 8.
14. The method of claim 10, wherein the composition comprises an isolated oligonucleotide with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, and SEQ ID NO: 8.
15. The method of claim 10, wherein the composition comprises an isolated oligonucleotide with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, and SEQ ID NO: 8.
16. The composition of claim 1, wherein the composition comprises an isolated oligonucleotide with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, and SEQ ID NO: 8.
17. The composition of claim 1, wherein the composition comprises (a) two or more isolated oligonucleotides selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, and SEQ ID NO: 8 and (b) a chemotherapeutic agent.
18. The composition of claim 1, wherein the composition comprises an isolated oligonucleotide with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 8.
19. The composition of claim 1, wherein the composition comprises (a) two or more isolated oligonucleotides selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 8 and (b) a chemotherapeutic agent.
20. The composition of claim 2, wherein the composition comprises (a) two or more isolated oligonucleotides selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 8 and (b) a chemotherapeutic agent.
21. The composition of claim 1, wherein at least one oligonucleotide is no more than 68 nucleotides long.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION
(10) The following terms are used in the present application:
(11) The term patient, as used herein, refers to any mammalian subject, including humans.
(12) The term safe and effective amount refers to an amount of a composition high enough to significantly positively modify the symptoms and/or condition to be treated, such as by inhibiting or reducing the proliferation of, or inducing cell death (for example, by inducing apoptosis) of dysplastic, hyperproliferative, or malignant cells, but low enough to avoid serious side effects (at a reasonable risk/benefit ratio), within the scope of sound medical judgment. The safe and effective amount of oligonucleotides for use in the compositions and methods of the invention herein will vary with the particular condition being treated, the age and physical condition of the patient to be treated, the severity of the condition, the duration of the treatment, the nature of concurrent therapy, the particular oligonucleotide(s) being employed, the particular pharmaceutically-acceptable carriers utilized, and like factors within the knowledge and expertise of the attending physician.
(13) As used herein, the term oligonucleotide refers to a molecule comprising two or more deoxyribonucleotides or ribonucleotides. The exact size depends on a number of factors including the specificity and binding affinity to target ligands. In referring to bases or nucleotides, the terms include both deoxyribonucleic acids and ribonucleic acids.
(14) The terms guanosine-rich promoter gene oligonucleotide, G-rich promoter gene oligonucleotide, or GPGO, as used herein, refer to oligonucleotides that include the G-rich promoter sequences of the gene human telomerase reverse transcriptase (hTERT), which form at least one quadruplex, and any oligonucleotide which includes a sequence having at least 80% nucleic acid sequence identity with the G-rich promoter sequence of the gene hTERT, and which forms at least one quadruplex. Quadruplex formation may be determined by circular dichroism spectroscopy (see, for example,
(15) The term quadruplex, as used herein, refers to nucleic acid sequences capable of forming four-stranded conformations. These quadruplex structures are comprised of a series of quartets of hydrogen-bonded guanines, which together create a roughly cubical structure. Many cancer-related genes have quadruplex forming sequences in their G-rich promoter regions. These genes include, but are not limited to, the hTERT, c-Myc, c-Myb, VEGF, RET, PDGF-A, Bcl-2, c-Kit, BCL-1, K-ras, Rb and HIF1- genes.
(16) Percent (%) nucleic acid sequence identity with respect to sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the sequence of interest, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
(17) The term carrier, as used herein, includes pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN, polyethylene glycol (PEG), and PLURONICS.
(18) The terms treat, treatment, and treating, as used herein, refer to a method of alleviating or abrogating a disease, disorder, and/or symptoms thereof.
(19) A chemotherapeutic agent is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside (Ara-C), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e.g., paclitaxel (Taxol, Bristol-Myers Squibb Oncology, Princeton, N.J.), and doxetaxel (Taxotere, Rhone-Poulenc Rorer, Antony, France), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, caminomycin, aminopterin, dactinomycin, mitomycins, esperamicins (see U.S. Pat. No. 4,675,187), melphalan and other related nitrogen mustards. Also included in this definition are hormonal agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapristone. Suitable chemotherapeutic agents are listed by the National Cancer Institute at the National Institutes of Health, A to Z List of Cancer Drugs, available at http://www.cancer.gov/cancertopics/druginfo/alphalist (last accessed Mar. 2, 2015), incorporated herein by reference in its entirety.
(20) A growth inhibitory agent when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any of the genes identified herein, either in vitro or in vivo. Thus, the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase. Examples of growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce G1-arrest and M-phase arrest. Classical M-phase blockers include the vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. Those agents that arrest G1 also spill over into S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C. Further information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, eds., Chapter 1, entitled Cell cycle regulation, oncogens, and antineoplastic drugs by Murakami et al. (W B Saunders: Philadelphia, 1995), especially p. 13. Also included in the term growth inhibitory agent are chemotherapeutic agents.
(21) The terms inhibiting cell development or inhibiting cell growth refer to inhibiting growth of a cell, especially a cancer cell overexpressing any of the genes identified herein, either in vitro or in vivo. Inhibiting cell growth or cell development includes blocking cell cycle progression (at a place other than S phase), for example, G1-arrest or M-phase arrest.
(22) The term gene expression profile, as used herein, refers to the measurement of the activity of multiple genes at once to create a global picture of cellular function.
(23) The term overexpress or overexpressed as used herein, refer to a gene product which is expressed at levels greater than normal endogenous expression for that gene product.
(24) The isolated oligonucleotides of the present invention, GPGOs, are rich in guanosine and are capable of forming quadruplexes, or G-quartet structures. Specifically, the oligonucleotides of the present invention are primarily comprised of thymidine and guanosine with at least one contiguous guanosine repeat in the sequence of each oligonucleotide. The G-rich oligonucleotides are stable and can remain undegraded in serum for prolonged periods of time and retain their growth inhibiting effects.
(25) The novel oligonucleotides of the present invention, GPGOs, can be used to inhibit the proliferation of, or induce cell death in, malignant, dysplastic and/or hyperproliferative cells. Table 1 provides the sequences of GPGOs useful in the compositions and methods of the present invention.
(26) TABLE-US-00001 TABLE1 GPGOSequences(Boldednucleotides representmutatedsequences) hTERTWT SEQIDNO:1 SEQ5 GGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGAC CCGGGAGGGGTCGGGACGGGGCGGGG3 hTERT-2M SEQIDNO:2 SEQ5 GGGGAGGGGCTGGGAGGGCCCGGAAAGGGCTGGGCCGGGGAC CCGGGAGGGGTCGGGACGGGGCGGGG3 hTERT+ 2E SEQIDNO:3 SEQ5 GGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGAAAC CCGGGAGGGGTCGGGACGGGGCGGGG3 hTERT+ 1 SEQIDNO:4 SEQ5 GGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGAAAC CCGGAAGGGGTCGGGACGGGGCGGGG3 hTERTMM SEQIDNO:5 SEQ5 GGGAGGGGTCGGGACGGGG3 hTERT4/6 SEQIDNO:6 SEQ5 GGGGACCCGGGAGGGGTCGGG3 hTERT3 SEQIDNO:7 SEQ5 GGGGGCTGGGCCGGGGACCCGGG3 shTERT+ 1 SEQIDNO:8 SEQ5 GGAAGGGGTCGGGACGGGG3 shTERT+ 2M SEQIDNO:9 SEQ5 GGAAACCCGGGAGGGGTCGGG3 MshTERT+ 1 SEQIDNO:10 SEQ5 GGGGACCCGGAAGGGGTCGGG3 Mut+ 2M SEQIDNO:11 SEQ5 AAGGGCTGGGCCGGGGACCCGGG3 Mut+ 2E SEQIDNO:12 SEQ5 GGGGGCTGGGCCGGAAACCCGGG3
(27) The oligonucleotides can be modified at their 3 end in order to alter a specific property of the oligonucleotide. For example, the 3-terminus of the oligonucleotide can be modified by the addition of a propyl amine group which has been found to increase the stability of the oligonucleotide to serum nucleases. Additional example of a 3 modification is the addition of a polyethylene glycol substituent via coupling to an appropriate linker to any of the above sequences. Addition of a polyethylene glycol of different molecular weights, especially between 200 and 20,000 molecular weight, results in modifying the pharmacokinetic parameters associated with the oligonucleotides. Other modifications that are well known in the art include 3 and 5 modifications, for example, the binding of cholesterol, and backbone modifications, for example, phosphorothioate substitution and/or 2-O-methyl RNA.
(28) Dosage Forms and Administration
(29) The GPGOs of the present invention can be administered to a patient or subject either alone or as part of a pharmaceutical composition. The GPGOs can be administered to patients either orally, rectally, parenterally (intravenously, intramuscularly, or subcutaneously), intracistemally, intravaginally, intraperitonally, intravesically, locally (powders, ointments, or drops), or as a buccal or nasal spray.
(30) Compositions of the GPGOs of the present invention suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
(31) These compositions may also contain adjuvants such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, for example sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.
(32) Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active ingredient (GPGO) is admixed with at least one inert customary excipient (or carrier) such as sodium citrate or dicalcium phosphate or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (e) solution retarders, as for example paraffin, (f) absorption accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants, as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents.
(33) Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethyleneglycols, and the like.
(34) Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others well known in the art. They may contain opacifying agents, and can also be of such composition that they release the active compound or compounds in a certain part of the intestinal tract in a delayed manner. Examples of embedding compositions which can be used are polymeric substances and waxes. The active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.
(35) Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3-butyleneglycol, dimethylformamide, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethyleneglycols and fatty acid esters of sorbitan or mixtures of these substances, and the like.
(36) Besides such inert diluents, the compositions can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.
(37) Suspensions, in addition to the active compounds, may contain suspending agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances, and the like.
(38) Compositions for rectal or vaginal administrations are preferably suppositories which can be prepared by mixing the compounds of the present invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethyleneglycol or a suppository wax, which are solid at ordinary temperatures but liquid at body temperature and therefore, melt in the rectum or vaginal cavity and release the active component.
(39) Dosage forms for topical administration of a GPGO of the present invention include ointments, powders, sprays, and inhalants. The active component is admixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants as may be required. Ophthalmic formulations, eye ointments, powders, and solutions are also contemplated as being within the scope of this invention.
(40) In addition, the oligonucleotides of the present invention can exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like. In general, the solvated forms are considered equivalent to the unsolvated forms for the purposes of the present invention.
(41) The GPGOs of the present invention can be administered to a patient at dosage levels in the range of about 1.5 mg to about 150 mg per day; it is also possible to administer larger amounts, such as from about 150 mg to 1 g per day. A unit dosage form of GPGOs is an amount which would be administered as a single dose. For a normal human adult having a body weight of about 70 kilograms, a dosage in the range of about 0.2 mg to about 2.0 mg per kilogram of body weight per day is preferable. The specific dosage used, however, can vary. For example, the dosage can depend on a number of factors including the requirements of the patient, the severity of the condition being treated, and the pharmacological activity of the compound being used. The determination of optimum dosages for a particular patient is well known to those skilled in the art. The GPGOs of the present invention can be given in single and/or multiple dosages.
(42) In addition, it is intended that the present invention cover GPGOs made either using standard organic synthetic techniques, including combinatorial chemistry or by biological methods, such as through metabolism.
(43) The GPGOs of the present invention may also be used in combination with other chemotherapeutic agents to provide a synergistic or enhanced efficacy or inhibition of neoplastic cell growth. For example, the GPGOs of the present invention can be administered in combination with chemotherapeutic agents including, for example, cis-platin, mitoxantrone, etoposide, camptothecin, 5-fluorouracil, vinblastine, paclitaxel, docetaxel, mithramycin A, dexamethasone, caffeine, and other chemotherapeutic agents and/or growth inhibitory agents well known to those skilled in the art.
(44) In one embodiment of the invention, a composition for treating a patient is provided, comprising (i) a safe and effective amount of at least one oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 and combinations thereof, and (ii) a carrier, wherein the oligonucleotide forms at least one quadruplex.
(45) In another embodiment, a composition for treating a patient is provided, comprising (i) a safe and effective amount of at least two oligonucleotides, each oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12 and (ii) a carrier, wherein each of said oligonucleotides forms at least one quadruplex.
(46) In another embodiment, a composition for treating a patient is provided, comprising (i) a safe and effective amount of at least three oligonucleotides, each oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12 and (ii) a carrier, wherein each of said oligonucleotides forms at least one quadruplex.
(47) In one embodiment, any of the above compositions comprises one or more sequences having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or essentially 100% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.
(48) In another embodiment, any of the above compositions comprise one or more sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, and combinations thereof.
(49) In another embodiment, any of the above compositions of the present invention further comprises a chemotherapeutic agent. Suitable chemotherapeutic agents include, but are not limited to, adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside (Ara-C), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e.g., paclitaxel (Taxol, Bristol-Myers Squibb Oncology, Princeton, N.J.), and doxetaxel (Taxotere, Rhone-Poulenc Rorer, Antony, France), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, caminomycin, aminopterin, dactinomycin, mitomycins, esperamicins (see U.S. Pat. No. 4,675,187), melphalan and other related nitrogen mustards. Also suitable are hormonal agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapristone.
(50) In another embodiment, any of the above compositions of the present invention further comprises a growth inhibiting agent. Suitable growth inhibitory agents include, but are not limited to, the vincas (vincristine and vinblastine); taxol; topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin; DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and cytosine arabinoside (Ara-C). Also included in the term growth inhibitory agent are chemotherapeutic agents.
(51) In another embodiment, a method of treating cancer is provided, comprising administering to a patient in need thereof a composition comprising (i) a safe and effective amount of at least one oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NOS: 1-12, and combinations thereof, and (ii) a carrier, wherein the oligonucleotide forms at least one quadruplex. In another embodiment, the composition of the method comprises a safe and effective amount of two oligonucleotides, each oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NOS: 1-12, wherein each of said oligonucleotides forms at least one quadruplex. In another embodiment, the composition of the method comprises a safe and effective amount of three oligonucleotides, each oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NOS: 1-12, wherein each of said oligonucleotides forms at least one quadruplex. The composition of the method can be administered to the patient in a variety of modes, including but not limited to, orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, intravesically, locally, or as a buccal or nasal spray. In a specific embodiment, the type of cancer to be treated includes, but is not limited to, leukemia, lymphoma, brain cancer, breast cancer, lung cancer, pancreatic cancer, colon cancer, ovarian cancer, liver cancer, prostate cancer, bone cancer, gastro-intestinal cancer, ocular cancer, head and neck cancer, and melanoma.
(52) In another embodiment, a method of inhibiting cell growth is provided, comprising contacting a cell with a composition comprising (i) an effective amount or a safe and effective amount of at least one oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NOS: 1-12, and combinations thereof, and (ii) a carrier, wherein the oligonucleotide forms at least one quadruplex. In another embodiment, the composition of the method comprises an effective amount or a safe and effective amount of two oligonucleotides, each oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NOS: 1-12, wherein each of said oligonucleotides forms at least one quadruplex. In another embodiment, the composition of the method comprises an effective amount or a safe and effective amount of three oligonucleotides, each oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NOS: 1-12, wherein each of said oligonucleotides forms at least one quadruplex. In one embodiment, the composition of the method may be administered in vivo, to a subject, or in vitro, to cells. In a specific embodiment, the composition is administered to a patient. The composition of the method can be administered to the patient in a variety of modes, including but not limited to, orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, intravesically, locally, or as a buccal or nasal spray.
(53) In a further embodiment, a method of inhibiting telomerase activity of a cell is provided, comprising contacting the cell with a composition comprising (i) an effective amount or a safe and effective amount of at least one oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NOS: 1-12, and combinations thereof, and (ii) a carrier, wherein the oligonucleotide forms at least one quadruplex. In another embodiment, the composition of the method comprises an effective amount or a safe and effective amount of two oligonucleotides, each oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NOS: 1-12, wherein each of said oligonucleotides forms at least one quadruplex. In another embodiment, the composition of the method comprises a safe and effective amount of three oligonucleotides, each oligonucleotide comprising a sequence having at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NOS: 1-12, wherein each of said oligonucleotides forms at least one quadruplex. In one embodiment, the composition of the method may be administered in vivo, to a subject, or in vitro, to cells. In a specific embodiment, the composition is administered to a patient. The composition of the method can be administered to the patient in a variety of modes, including but not limited to, orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, intravesically, locally, or as a buccal or nasal spray.
(54) In another embodiment, a method for treating a patient having a tumor is provided, the method comprising: comprising: (a) performing a biopsy of the patient's tumor; (b) determining a gene expression profile of the tumor; (c) identifying one or more genes that are overexpressed in the tumor, based on the gene expression profile of step (b); (d) selecting one or more guanosine-rich promoter gene oligonucleotide (GPGO) sequences corresponding to the overexpressed genes identified in step (c); (e) administering to the patient a composition comprising a safe and effective amount of the one or more GPGO sequences of step (d), wherein the one or more GPGO sequences have at least 80% nucleic acid sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, and combinations thereof, and wherein each of the one or more GPGO sequences forms at least one quadruplex. In more specific embodiments, the overexpressed gene identified is step (c) is hTERT.
EXAMPLES
(55) The following examples are given by way of illustration and are in no way intended to limit the scope of the present invention.
Example 1
An Improved Model for the hTERT Promoter Quadruplex Materials and Methods
(56) Oligodeoxynucleotides.
(57) Names, sequences and absorption coefficients of the oligonucleotides used in this study are given in Table I. hTERT (obtained from Oligos Etc.) was dissolved in water at a concentration of 650 M. 1XAV was from IDT, Coralville, Iowa The lyophilized, desalted powder was dissolved in 10 mM LiPO.sub.4, pH 7.0 at a concentration of 2 mM. The stock solutions of both oligonucleotides were stored at 4 C. Solutions for fluorescence polarization studies were prepared at 1 M concentration in 10 mM tetrabutyl ammonium phosphate, 1 mM EDTA, 200 mM KCl, pH 7.0 (referred to hereafter as tBAP folding buffer), denatured at 90 C. in a water bath for 10-15 min, followed by annealing by slowly cooling to room temperature in the bath. Folding to the quadruplex state was checked by recording the CD spectrum of the sample over the wavelength range 340 nm to 220 nm and observing a maximum in the CD spectrum at 260 nm and a minimum at 240 nm.
(58) Reagents.
(59) Thiazole orange, whose fluorescence quantum yield increases significantly when bound to DNA.sup.25, was from Sigma Chemical Co. (St. Louis, Mo.). A stock solution of 250 M dye was prepared in folding buffer containing 200 mM KCl and 20% sucrose. The final concentrations of the dye and oligonucleotide in the fluorescence polarization experiments was estimated by spectrophotometry with a Jasco V-550 instrument in conjunction with the appropriate absorption coefficient for the DNA along with a value of .sub.500 nm of 63 mM.sup.1 cm.sup.1 for the dye. To ensure a negligible concentration of free dye, polarization experiments were carried out with excess DNA (DNA:dye3:1).
(60) KCl, tetrabutylammonium dihydrogen phosphate, tetrabutylammonium hydroxide and EDTA (acid form) were from Sigma. Sucrose was from Mallinckrodt Chemicals, Phillipsburg, N.J., and LiH.sub.2PO.sub.4 and LiOH monohydrate were from Aldrich Chemicals, Milwaukee, Wis.
(61) TABLE-US-00002 TABLE1 Oligodeoxynucleotidesusedinthisstudy. .sub.260nm Name Sequence MW (mM.sup.-1cm.sup.-1) hTERT 5-GGGGAGGGGCTGGGA 21632.8 659.3 GGGCCCGGAGGGGGCTGG GCCGGGGACCCGGGAGGG GTCGGGACGGGGCGG GG-3 1XAV 5-TGAGGGTGGGTAGGG 6991.6 228.7 TGGGTAA-3
(62) Circular Dichroism and Thermal Denaturation.
(63) Thermal denaturation of quadruplexes was monitored using a Jasco J-810 spectropolarimeter (Jasco Inc., Easton, Md.) equipped with a programmable Peltier thermostatted cell holder and a magnetic stirrer. CD spectra were collected using instrumental parameters: 280<<350 nm, 1.0 nm step size, 200 nm/min scan rate, 1.0 nm bandwidth, 2 s integration time, with 4 total scans averaged. For melting experiments, samples at 3-4 M in a 1-cm path length cuvette were equilibrated in the cuvette holder at 4 C. prior to starting the melt. Melting experiments were carried out with the thermal parameters: 4 C./min ramp, 0.05 C. equilibration with a 60 s delay prior to acquisition. Spectra were corrected by subtracting a solvent blank. Melts were carried out in duplicate on successive days; data presented here are from the second melt. CD data were normalized to molar circular dichroism () based on DNA strand concentration using equation (1)
=/(32982*c*l(1)
where is the CD ellipticity in millidegrees, c is DNA concentration in mol/L, and l is the path length in cm.
(64) Analytical Ultracentrifugation.
(65) Sedimentation velocity measurements were carried out in a Beckman Coulter ProteomeLab XL-A analytical ultracentrifuge (Beckman Coulter Inc., Brea, Calif.) at 20.0 C. and at 50,000 rpm in standard 2 sector cells. Data (200 scans collected over a 10 hour centrifugation period) were analyzed using the program Sedfit in the continuous c(s) mode or by a model assuming discrete, noninteracting species (www.analyticalultracentrifugation.com). Buffer density was determined on a Mettler/Paar Calculating Density Meter DMA 55A at 20.0 C. and buffer viscosity was measured on an Anton Paar Automated Microviscometer AMVn. For the calculation of frictional ratio, 0.55 mL/g was used for partial specific volume and 0.3 g/g was assumed for the amount of water bound. hTERT sequences were dissolved to give a final concentration of 1 mM in tBAP folding buffer, diluted to give an absorbance at 260 nm of 0.5, heated in a boiling water bath for 10 minutes and allowed to cool to room temperature before centrifugation.
(66) Molecular Dynamics Simulations and HYDROPRO Calculations.
(67) Molecular models of G-quadruplex structures were created using the parallel quadruplex structure 1XAV from the Protein Data Bank with manual modification of the loop regions to for the hTERT sequence. Appropriate coordinating ions were added to the stacked G-tetrads of each model and additional ions were added to neutralize the G-quadruplex structures. The system was solvated in a rectilinear box of TIP3P water molecules with 15 buffer. The system was equilibrated using the following protocol: (i) minimize water and ions (1000 steps-500 steepest descents) holding the DNA fixed (50 kcal/mol/), (ii) 50 ps MD (heating to 300 K) with 20 ns MD as the production trajectory. A further 10 ns of accelerated MD production trajectory was obtained.sup.26. Simulations were performed in the isothermal isobaric ensemble (P=1 atm, T=300K) using sander and GPU version of pmemd (AMBER 13). Periodic boundary conditions and Particle-Mesh-Ewald algorithms were used. A 2.0 fs time step was used with bonds involving hydrogen atoms frozen using SHAKE. Analysis of the trajectory was performed using the cpptraj module of the AmberTools 13 Package. Calculations of hydrodynamic properties were done using the program HYDROPRO 10.sup.27 using the recommended quadruplex parameters.sup.28 on 5000 snapshots of the accelerated MD trajectory.
(68) Fluorescence Experiments.
(69) Fluorescence excitation, emission, and polarization spectra were determined with a Jasco FP-6500 fluorescence spectrophotometer equipped with an ADP-303T Peltier temperature controller and an APH-103 fluorescence polarization unit (Jasco, Inc., Easton, Md.). Instrumental settings were: ex=510 nm, em=530 nm, 5 nm emission and excitation bandwidth, 2 s response time. Excitation and emission spectra were corrected by subtraction of a solvent blank.
(70) Determination of Rotational Relaxation Time.
(71) The rotational relaxation time of a particle is defined as the time required for it to rotate through an angle of 68.4 (cos =1/e). This time depends on the volume V of the molecule as well as the viscosity and temperature T of the medium through the relationship =3V/RT. The rotational relaxation time .sub.0 for a spherical molecule without bound solvent can be calculated from the relationship .sub.0=3M
(72) The rotational relaxation time of a fluorescently labelled molecule can be determined by measuring the degree of fluorescence polarization as a function of viscosity of the solution which can be varied by changing the temperature. Rotational relaxation times for the complexes of hTERT-FL and 1XAV with thiazole orange were determined in tBAP folding buffer with 200 mM KCl and 20% (w/v) sucrose at 2 C. intervals over the temperature range 5 to 39 C. The viscosity of the sucrose solution at the experimental temperatures were obtained by interpolation (where necessary) from standard tables.sup.6.
(73) The data sets were analyzed graphically as described by Montanaro and Sperti.sup.30 using the Perrin equation (Eq. 2) which relates the degree of fluorescence polarization P to the rotational relaxation time of the fluorescent particle and , the lifetime of the excited state:
(74)
P is defined as (I.sub.G.Math.I.sub.)/(I.sub.+G.Math.I.sub.), where I.sub. is the emission intensity with the excitation polarizer at 90 (vertical orientation) and the emission polarizer is at 0 (horizontal orientation), and I.sub. is the intensity with both polarizers at 90. G is a grating correction factor=i.sub./i.sub. with i.sub. indicating the excitation polarizer is at 0 and the emission polarizer is at 90, and i.sub. indicating that both polarizers are in the 0 orientation. P.sub.0 is the intrinsic polarization. The quantity (1/P) is plotted vs. T/ and is estimated from the slope and intercept estimated by linear regression.
(75) Determination of Fluorescence Lifetime.
(76) The fluorescence lifetime for the excited state of thiazole orange bound to hTERT and 1XAV was determined with an ISS K2 Multifrequency Phase Fluorometer (ISS, Champaign, Ill.). The sample was excited at room temperature with a 468-nm LED and polarizers set at magic angle conditions. Emission was measured through a 520-nm band pass filter (Newport Corp.). The instrument was calibrated with fluorescein in 0.1 M NaOH (lifetime=4.0 ns). Phase and amplitude modulation data were analyzed with the ISS program Vinci Beta 1.7 (ISS) to determine lifetimes.
Results and Discussion
a. hTERT Promoter Mutations and Previously Reported Structure
(77) The locations of the reported hTERT promoter mutations are shown in
b. Circular Dichroism Spectra for the hTERT Promoter and hTERT Promoter Sequences with Reported Mutations
(78)
c. Characterization of the hTERT Promoter by Sedimentation Velocity Ultracentrifugation
(79)
(80) Minor amounts (14%) of faster sedimenting species (probably aggregates) are seen, along with minor amounts of slower sedimenting material (probably incompletely folded products). We previously determined that human telomere sequences can form structures with three contiguous quadruplexes with S.sub.20,w values of 3.49 and 3.87 for antiparallel and all-parallel conformations, respectively (Petraccone, L., Trent, J. O. & Chaires, J. B. The tail of the telomere. Journal of the American Chemical Society 130, 16530-16532, doi:10.1021/ja8075567 (2008)). These values suggest that the hTERT sequence forms a three quadruplex structure of some form, consistent with the conclusion based on CD spectra. A three-dimensional molecular model of mixed quadruplex-duplex structure shown is
d. Molecular Modeling
(81) Molecular modeling simulations were used to construct a more realistic detailed model of the structure formed by the hTERT core promoter that is consistent with the biophysical data using computational protocols (Le, H. T., Buscaglia, R., Dean, W. L., Chaires, J. B. & Trent, J. O. Calculation of hydrodynamic properties for G-quadruplex nucleic acid structures from in silico bead models. Topics in current chemistry 330, 179-210, doi:10.1007/128_2012_351 (2013)). The three-stacked parallel quadruplex model (
(82) Sedimentation and circular dichroism data are thus entirely consistent with a compact structure in which three parallel quadruplexes are tightly stacked on one another. The complex quadruplex-duplex structure (Xing, M. et al. BRAF V600E and TERT Promoter Mutations Cooperatively Identify the Most Aggressive Papillary Thyroid Cancer With Highest Recurrence. Journal of clinical oncology: official journal of the American Society of Clinical Oncology 32, 2718-2726, doi:10.1200/JCO.2014.55.5094 (2014)) and the multiple beads-on-a-string quadruplex structure (Nygren, J., Svanvik, N. & Kubista, M. The interactions between the fluorescent dye thiazole orange and DNA. Biopolymers 46, 39-51, doi:10.1002/(SICI)1097-0282(199807)46:1<39::AID-BIP4>3.0.CO;2-Z (1998)) are inconsistent with our biophysical data.
(83) Surprisingly, the mutations shown in
(84) While the mutations can be accommodated by alternate G-quadruplex formation in the longer sequences (which could account for the similar thermal stability), this would require a reduction to a two-tetrad stacked central quadruplex or by mixed guanine-adenine stacking. However, this would require changes in the connecting and internal loop structures of the central quadruplex, thus lowering the S.sub.20,w value due to longer loops and decreased compactness, as is in fact observed in
(85) Detailed structural studies on quadruplex forming sequences in promoter regions have been limited to single quadruplex structures and often these shorter sequences are highly manipulated to reduce polymorphism. This study indicates that the longer promoter region quadruplex-forming sequences may be much more complicated and more biologically contextual. This may well be a general phenomenon as these extended quadruplex-forming sequences are common in the promoters of proto oncogenes that have not been previously examined in this detail.
(86) More than 90% of human tumors overexpress telomerase, as do rapidly dividing cells such as stem cells and germ cells (Shay, J. W. & Bacchetti, S. A survey of telomerase activity in human cancer. Eur J Cancer 33, 787-791, doi:10.1016/S0959-8049(97)00062-2 (1997) and Hiyama, E. & Hiyama, K. Telomere and telomerase in stem cells. Br J Cancer 96, 1020-1024, doi:10.1038/sj.bjc.6603671 (2007)). The mechanism by which hTERT expression is dysregulated has been largely unknown. The data presented here indicate that the common mutations in the hTERT promoter occur in a quadruplex structure in this region. It is possible, by altering recognition elements and stability of this region, that the transcriptionally active duplex DNA structure with the E-twenty six (ETS) binding site would be favored. Importantly, ETS binding likely helps stabilize the double stranded (transcriptionally active) structure. This loss of quadruplex stability could abrogate the gene silencing effects of quadruplex formation, allowing increased hTERT expression. Because of its ubiquitous overexpression and its critical role in almost all tumors, telomerase is an excellent therapeutic target. The concept of reversing promoter silencing via mutations that cause quadruplex destabilization is an exciting new paradigm and provides the first plausible rationalization of mutation mediated gene transcription by quadruplex control.
Example 2
Common hTERT Promoter Mutations Represent a Novel Therapeutic Target Materials and Methods
(87) Oligonucleotides
(88) The hTERT wild type and mutated oligonucleotides were purchased from Oligos etc. (Wilsonville, Oreg.). The lyophilized oligonucleotides were reconstituted in sterile nuclease free H.sub.2O (Millipore, MA) at 500 M and storage at 20 C.
(89) Circular Dichroism (CD) Spectrometry:
(90) The oligonucleotide samples were diluted at 5 M in TM buffer (50 mM TRIS-HCl/2.5 mM MgCl.sub.2, pH7.0), denatured and annealed overnight at room temperature (RT). The concentration was verified by measuring the OD at 260 nm in a Diode Spectrometer before the CD measurement on a Jasco J-710 spectropolarimeter in a 1 cm Quartz cuvette. The spectra were recorded from 220 nm to 340 nm at 20 C.; four spectra were averaged for each reading. The molar extinction coefficients were calculated using the IDT calculator (IDT.com, oligoAnalyser3.1). The CD data were normalized to strand concentration and are expressed in Molar ellipticity [] (degcm.sup.2decimole.sup.1).
(91) Oligonucleotide Structure
(92) Oligonucleotides were 5 end labeled with .sup.32P-ATP (3 Eu) using T4 PNK and 1 kinase buffer for 20 minutes at 37 C. Unincorporated nucleotides were removed using G-25 Sephadex columns. Samples (4,000 cpm) were then mixed with cold oligonucleotide, boiled for ten minutes and allowed to anneal overnight. An equal volume of 2 glycerol dye was added and run on a 15% native acrylamide gel at 250V for 3 h. The bands were visualized by exposing a Kodak phosphor-imager screen and scanned using a Molecular Imager (Pharos FX Plus, Bio-Rad) then to Kodak film for 12 h at 80 C.
(93) Electrophoretic Mobility Shift Assay (EMSA)
(94) The PCR product of a 134 bp hTERT promoter sequence was incubated with 100000 cpm of 5-end .sup.32P-labeled hTERT wild type or mutated oligonucleotide in 20 mM HEPES (pH 7.9), 25 mM KCL, 2 mM MgCl.sub.2, 0.1 mM EDTA, 0.2 mM DTT, 2 mM spermidine and 10% glycerol for 15 min at 37 C. For the competition assay, increasing concentrations of cold hTERT oligonucleotide (1 nM to 1 M) were added to each labeled oligonucleotide and incubated for an additional 15 min. After incubation, an equal volume of 2 glycerol dye was added. Complexes (50000 cpm) were resolved by electrophoresis on a 5% non-denaturing polyacrylamide gel, and visualized as described above.
(95) Cell Culture
(96) Four leukemia cell lines were investigated: U937 (Histiocytic Lymphoma, HL), Molt-4 (acute-T-lymphoblastic leukemia, ALL), HL-60 (Acute Promyelocytic leukemia, APL) and Raji (Burkitt's lymphoma, BL), all obtained from American Type Culture Collection (ATCC, Manassas, Va.). The cell lines were maintained in culture in RPMI-1640/10% FBS/penicillin-streptomycin (all from HyClone, Utah) at 37 C./5% CO.sub.2 in humid atmosphere and were evaluated at exponential growth.
(97) MTT Assay
(98) Cells were seeded at 510.sup.3 cells/well in 96-well flat bottom plates in the presence of different concentrations of oligonucleotides for 24 h up to 5 days as specified in the text. Untreated cells were used as control, and media for blank. Cell proliferation was evaluated by using MTT [3-(4,5-Dimethylthiazol-2-yl) 2,5-diphenyltetrazolium Bromide) Sigma-Aldrich, St Louis, Mo.], as known in the art. Data are shown as percent of the untreated control for an average of at least 3 experiments+/Standard deviation.
(99) Western Blot
(100) U937 were cultured at 110.sup.5 cells/ml in the presence of Pu27, Pu5.sup. or Pu9.sup. (10 M) compared to untreated for 3 days. Total protein lysates was prepared using M-Per lysis buffer (Pierce) containing protease inhibitors (Roche) according to manufacturer instruction and quantified using Coomassie Protein reagent (Thermo). Equal amounts of protein were run in 4-15% gradient gel (Bio-Rad) for 1 h at 70 V, then transferred to PVDF membrane using an iblot (Invitrogen). The membrane was blocked with 5% non-fat dry milk, washed in PBST (PBS/0.05% Tween), hybridized for 1 h at RT with anti-c-MYC antibody (Santa Cruz), followed by washes in PBST, then incubated 1 h at RT with goat anti-mouse antibody. The protein was visualized using femto chemiluminescence reagent (Pierce).
(101) Statistical Analysis
(102) Except for the gene array analysis, all data are expressed as mean+/standard deviation (SD) comparison between untreated and treated was assessed using unpaired two-tailed Student T-test and were considered significant at p-value <0.05.
Results and Discussion
a. hTERT Mutations Destablize Quadruplex and Increase Promoter Activity
(103) The hTERT promoter mutations occur in a 67 bp sequence of the hTERT promoter that has previously been shown to form quadruplex DNA.
b. The WT hTERT Promoter Quadruplex-Forming Oligonucleotide Binds Specifically to its Double Stranded Parent Sequence
(104) We used gel shift analysis to demonstrate the specificity of the interaction between the hTERT promoter sequence and its double stranded target sequence. As shown in
c. Stabilization of the hTERT Quadruplex-Forming Sequence with Sequence-Specific Oligonucleotides Inhibits the Growth of Cells with hTERT Promoter Mutations
(105) Because of our previous experience with the growth inhibition by quadruplex-forming oligonucleotides, we were interested in characterizing the effect of hTERT oligonucleotides on the growth of cells with wild type and mutated hTERT promoter sequences. We reasoned that cells with the mutated promoter sequence might be more sensitive to stabilization of the quadruplex forming sequence since they would be overexpressing telomerase which would provide stimulus for telomere lengthening and nontelomeric telomerase effects. Indeed, this was the case. As shown in
d. hTERT Promoter Quadruplex-Forming Oligonucleotides Inhibit hTERT Promoter Activity
(106) In order to characterize the effect of the hTERT quadruplex-forming oligonucleotides, we tested their effect on hTERT promoter/luciferase expression vectors. As noted above, this approach has been used to document induced overexpression of the luciferase promoter by the mutated sequences. Using reporter vectors in which luciferase is expressed under the control of the wild type hTERT promoter sequence (Veldman T, Horikawa I, Barrett J C, Schlegel R. Transcriptional activation of the telomerase hTERT gene by human papillomavirus type 16 E6 oncoprotein. J Virol 2001; 75:4467-72), we have shown (
(107) All documents cited are incorporated herein by reference; the citation of any document is not to be construed as an admission that it is prior art with respect to the present invention.
(108) While particular embodiments of the present invention have been illustrated and described, it would be obvious to one skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.