Methods of using O-methyltransferase for biosynthetic production of pterostilbene
10370683 ยท 2019-08-06
Assignee
Inventors
- Mohammad Wadud Bhuiya (Saint Louis, MO, US)
- Yechun Wang (Saint Louis, MO, US)
- Xiaodan Yu (Lexington, MA, US)
Cpc classification
A61P31/00
HUMAN NECESSITIES
C12N9/1029
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
International classification
Abstract
A biosynthetic method of making pterostilbene including expressing a 4-coumaratexoenzyme A ligase (4CL) in a cellular system, expressing a stilbene synthase (STS) in the cellular system, expressing a resveratrol O-methyltransferase (ROMT) in the cellular system, feeding p-coumaric acid to the cellular system, growing the cellular system in a medium, and producing pterostilbene.
Claims
1. A biosynthetic method of making pterostilbene comprising: expressing a 4-coumarate:coenzyme A ligase (4CL) in a cellular system; expressing a stilbene synthase (STS) in the cellular system; expressing a resveratrol O-methyltransferase (ROMT) in the cellular system; feeding p-coumaric acid to the cellular system; growing the cellular system in a medium; and producing pterostilbene, wherein the 4-coumarate:coenzyme A ligase is expressed from a gene that has a sequence identity of at least 66% with a 4CL gene comprising the sequence of SEQ ID NO: 14, wherein the stilbene synthase is expressed from a gene that has a sequence identity of at least 66% with a STS gene comprising the sequence of SEQ ID NO: 16, wherein the resveratrol O-methyltransferase is expressed from a gene that has a sequence identity of at least 66% with a ROMT gene comprising the sequence of SEQ ID NO: 12, and wherein the resveratrol O-methyltransferase expressed is modified at one or more residues in SEQ ID NO: 13 selected from the list consisting of residues 167, 174, 258, 261, and a combination thereof, by an alternative amino acid or a modified amino acid, and wherein the modified resveratrol O-methyltransferase exhibits increased activity in converting resveratrol to pterostilbene relative to an unmodified resveratrol O-methyltransferase comprising the sequence of SEQ ID NO: 13.
2. The biosynthetic method of making pterostilbene of claim 1, wherein the 4CL gene is cloned from Arabidopsis thaliana.
3. The biosynthetic method of making pterostilbene of claim 1, wherein the 4-coumarate:coenzyme A ligase is expressed from a gene that has a sequence similarity of at least 90% with a 4CL gene comprising the sequence of SEQ ID NO: 14.
4. The biosynthetic method of making pterostilbene of claim 1, wherein the STS gene is cloned from grape.
5. The biosynthetic method of making pterostilbene of claim 1, wherein the stilbene synthase is expressed from a gene that has a sequence similarity of at least 90% with a STS gene comprising the sequence of SEQ ID NO: 16.
6. The biosynthetic method of making pterostilbene of claim 1, wherein the resveratrol O-methyltransferase is expressed from a gene that has a sequence similarity of at least 90% with a ROMT gene comprising the sequence of SEQ ID NO: 12.
7. The biosynthetic method of making pterostilbene of claim 1, wherein the 4CL gene and the STS gene are a 4CL::STS fusion gene which is transfected.
8. The biosynthetic method of making pterostilbene of claim 1, wherein expressing the 4-coumarate:coenzyme A ligase comprises transfecting the 4CL gene.
9. The biosynthetic method of making pterostilbene of claim 1, wherein expressing the stilbene synthase comprises transfecting the STS gene.
10. The biosynthetic method of making pterostilbene of claim 1, wherein expressing the resveratrol O-methyltransferase comprises transfecting the ROMT gene which is modified.
11. The biosynthetic method of making pterostilbene of claim 1, wherein the cellular system is selected from the group consisting of bacteria, yeast, plant cells, animal cells and a combination thereof.
12. The biosynthetic method of making pterostilbene of claim 1, wherein the cellular system allows for ectopic biosynthetic reaction.
13. The biosynthetic method of making pterostilbene of claim 1, wherein the cellular system comprises an in vitro translation system.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) For a better understanding of the present disclosure, reference may be made to the accompanying drawings in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12) While the disclosure is susceptible to various modifications and alternative forms, specific embodiments thereof are shown by way of example in the drawing and will herein be described in detail. It should be understood, however, that the drawings and detailed description presented herein are not intended to limit the disclosure to the particular embodiment disclosed, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the present disclosure as defined by the appended claims.
DETAILED DESCRIPTIONS OF THE DISCLOSURE
Definition
(13) Cellular System
(14) Cellular system is any cells that provide for the expression of ectopic proteins. It included bacteria, yeast, plant cells and animal cells. It includes both prokaryotic and eukaryotic cells. It also includes the in vitro expression of proteins based on cellular components, such as ribosomes.
(15) Growing the Cellular System
(16) Growing includes providing medium that would allow cells to multiply and divide. It also includes providing resources so that cells or cellular components can translate and make recombinant proteins.
(17) Transfection
(18) Transfection is the process of deliberately introducing nucleic acids into cells. The term is often used for non-viral methods in eukaryotic cells. It may also refer to other methods and cell types, although other terms are preferred: transformation is more often used to describe non-viral DNA transfer in bacteria, non-animal eukaryotic cells, including plant cells. In animal cells, transfection is the preferred term as transformation is also used to refer to progression to a cancerous state (carcinogenesis) in these cells. Transduction is often used to describe virus-mediated DNA transfer. Transformation, transduction, and viral infection are included under the definition of transfection for this application.
(19) Modified Amino Acid
(20) A modified amino acid is one that has been chemically modified and it can be incorporated as part of a polypeptide sequence. The amino acid could be modified in a post-translational manner or prior to incorporation in the polypeptide sequence during translation.
(21) 4CL
(22) The 4-coumarate:coenzyme A ligase is expressed from a 4CL gene cloned from Arabidopsis thaliana (ecotype Columbia-0). In another embodiment, the 4-coumarate:coenzyme A ligase is expressed from a gene that has a sequence identity of at least 66% with a 4CL gene cloned from Arabidopsis thaliana (ecotype Columbia-0). In a further embodiment, the 4-coumarate:coenzyme A ligase is expressed from a gene that has a sequence similarity of at least 90% with a 4CL gene cloned from Arabidopsis thaliana (ecotype Columbia-0).
(23) STS
(24) The stilbene synthase is expressed from a STS gene cloned from grape (Vitis vinifera). In another embodiment, the stilbene synthase is expressed from a gene that has a sequence identity of at least 66% with a STS gene cloned from grape (Vitis vinifera). In a further embodiment, the stilbene synthase is expressed from a gene that has a sequence similarity of at least 90% with a STS gene cloned from grape (Vitis vinifera).
(25) ROMT
(26) The resveratrol O-methyltransferase is expressed from a gene cloned from grape (Vitis vinifera). In another embodiment, the resveratrol O-methyltransferase is expressed from a gene that has a sequence identity of at least 66% with a ROMT gene cloned from grape (Vitis vinifera). In a further embodiment, the resveratrol O-methyltransferase is expressed from a gene that has a sequence similarity of at least 90% with a ROMT gene cloned from grape (Vitis vinifera).
(27) An embodiment of the present disclosure is a biosynthetic method of making pterostilbene including expressing a 4-coumarate:coenzyme A ligase (4CL) in a cellular system, expressing a stilbene synthase (STS) in the cellular system, expressing a resveratrol O-methyltransferase (ROMT) in the cellular system, feeding p-coumaric acid to the cellular system, growing the cellular system in a medium, and producing pterostilbene.
(28) In one embodiment, expressing the 4-coumarate:coenzyme A ligase and expressing the stilbene synthase comprise transfecting a 4CL::STS fusion gene. In another embodiment, expressing the 4-coumarate:coenzyme A ligase comprises transfecting a 4CL gene and expressing the stilbene synthase comprises transfecting a separate STS gene. Expressing the resveratrol O-methyltransferase comprises transfecting a ROMT gene.
(29) The cellular system is selected from the group consisting of at least, bacteria, yeast, and a combination thereof. In another embodiment, the cellular system allows for ectopic biosynthetic reaction.
(30) A further embodiment is a biosynthetic method of making pterostilbene comprising expressing a resveratrol O-methyltransferase (ROMT) in the cellular system, feeding resveratrol to the cellular system, growing the cellular system in a medium, and producing pterostilbene.
(31) A further embodiment is a biosynthetic method of making resveratrol comprising expressing a 4-coumarate:coenzyme A ligase (4CL) in a cellular system, expressing a stilbene synthase (STS) in the cellular system, feeding p-coumaric acid to the cellular system, growing the cellular system in a medium, and producing resveratrol.
(32) A further embodiment is a biosynthetic method of making pterostilbene comprising expressing a 4-coumarate:coenzyme A ligase (4CL) in a first cellular system, expressing a stilbene synthase (STS) in the first cellular system, feeding p-coumaric acid to the first cellular system, growing the first cellular system in a medium, producing resveratrol, expressing a resveratrol O-methyltransferase (ROMT) in a second cellular system, feeding resveratrol to the second cellular system, growing the second cellular system in a medium, and producing pterostilbene.
(33) Materials and Methods
(34) Strains, Plasmids and Culture Condition
(35) HI-Control 10G and DH5a were used for plasmid cloning, and BL21 (DE3) (Invitrogen) was used for recombinant protein expression in E. coli. Wat11 strain was used for protein expression in yeast. p-Coumaric acid, resveratrol and pterostilbene standard were all purchased from Sigma. The pETite N-His SUMO Kan Vector were purchased from Lucigen (Middleton, Wis.). Plasmid pETDuet-1 were purchased from Novagen was used recombinant protein expression purposes.
(36) DNA Manipulation
(37) All DNA manipulations were performed according to standard procedures. Restriction enzymes and T4 DNA Ligase were purchased from New England Biolabs. All PCR amplification and cloning reactions were performed using Phusion High-Fidelity DNA Polymerase New England Biolabs.
(38) RNA Extraction and cDNA Synthesis
(39) ROMT (resveratrol O-methyltransferase), 4CL (4-coumarate:coenzyme A ligase) and STS (stilbene synthase) were cloned from various plant species. Plant total RNA was extracted from grape (Vitis vinifera) for the cloning of ROMT and STS and Arabidopsis thaliana (ecotype Columbia-0) for the cloning of 4CL with Trizol Plus RNA Purification Kit (Invitrogen Inc). The synthesis of cDNA was carried out with Im Prom-II Reverse Transcription System from Promega Inc. following the manufacturer's manual. The genes were amplified from the synthesized cDNA with New England Biolabs Phusion PCR Kit with the primers listed in Table 1.
Example 1
(40) Construction of Bacterial Expression Vector
(41) The PCR product of ROMT was cloned into pETite N-His SUMO Kan Vector (Lucigen Inc) according to the manufacturer's manual. The resultant plasmid with the right insert was confirmed by sequencing, namely Sumo-ROMT, and was transformed into BL21(DE3) for heterogeneous gene expression.
(42) To construct the 4CL::STS fusion gene, At4CL and VvSTS were fused using the PCR amplification strategy. The stop codon of 4CL was removed and a three amino acid linker (Gly-Ser-Gly) was introduced between the open reading frame of 4CL and STS. This construction resulted in a 2.87 kb fused gene construct encoding 4CL, the tripeptide linker, and STS. The fusion gene 4CL::STS cloned into the Gateway entry vector using the pCR8/GW/TOPO TA Cloning kit (Invitrogen), was transformed into One Shot E. coli cells, and then sequenced. 4CL::STS fusion gene was amplified and cloned into the multiple cloning site of pETDuet-1 vector via BamHI/HindIII, name pETDuet-4CLSTS. Primers for all cloning reactions are available in the Table 1.
Example 2
(43) Construction of Yeast Expression Vector
(44) The 4CL::STS gene was introduced into the S. cerevisiae Advanced Gateway destination vector pAG304GPD-ccdB (Addgene, Boston, Mass.), and the ROMT gene was swapped into another Gateway destination vector pAG305GPD-ccdB (Addgene) by LR clonase II enzyme mix kit (Invitrogen). The resultant plasmids were named pAG304GPD-4CLSTS and pAG304GPD-ROMT. The vectors contain integrative recombination side and an expression cassette under the control of a constitutive promoter (GPD). These vectors were transformed into WAT11 for fermentation assays.
(45) Yeast Transformation
(46) The constructs, pAG304GPD-4CLSTS and pAG304GPD-ROMT, along with the pAG304GPD-ccdB and pAG305GPD-ccdB vectors as controls, were transformed into WAT11 cells with the Frozen-EZ Yeast Transformation II kit (Zymo Research, Orange, Calif.). Vectors, pAG304GPD-4CLSTS and pAG304GPD-ROMT, were co-tranformed into yeast WAT11 cells.
(47) Homology Modeling and Docking for Prediction of Substrate Binding Residues of ROMT
(48) According to applicants' knowledge, there is no tertiary structure of ROMT that can be used for analyses of substrate binding sites. To analyze the substrate binding site, applicants built a model for ROMT (
(49) The Bioconversion of P-Coumaric Acid to Resveratrol with the Protein of 4CL::STS Fusion Protein in E. coli and S. cerevisiae
(50) Single colony of the E. coli strain was grown in 3 mL LB medium with 100 g/mL ampicillin overnight at 37 C., and then the seed culture was transferred to 50 mL M9 modified medium with 100 g/mL ampicillin. E.coli BL21(DE3) containing pETDuet-4CLSTS vector was kept shaking at 200 rpm at 37 C. in modified M9 medium until OD600 reach to 0.6, then added 1 mM IPTG, after 2 hour induction with IPTG, p-coumaric acid was dissolved in 100% ethanol was added to the culture to 0.5 g/L. The culture was kept shaking under the same culture condition, and samples were taken at interval for HPLC analysis.
(51) Wat11 cells containing pAG304GPD-4CLSTS plasmid were grown in SD drop out medium at 30 C. until OD600 reach to 0.2, then add p-coumaric acid (0.5 g/L). The culture was kept shaking for 4 days under the same culture condition, and samples were taken at interval for HPLC analysis.
(52) The Bioconversion of Resveratrol to Pterostilbene with the Protein of ROMT in E.coli and S. cerevisiae
(53) E.coli BL21(DE3) containing SUMO-RMOT vector was grown in modified M9 medium at 37 C. until OD600 reach to 0.6, then add 1 mM IPTG, after 2 hour induction with IPTG, resveratrol dissolved in DMSO was added to the culture to 0.228 g/L. M9 medium was modified by addition of yeast extract (1.25 g/L) and glycerol (0.5% v/v) into standard M9 medium. The culture was kept shaking under the same culture condition, and samples were taken at interval for HPLC analysis.
(54) Wat11 cells containing pAG305GPD-RMOT plasmid were grown in standard yeast drop-out medium at 30 C. until OD600 reach to 0.2, then add resveratrol acid (0.228 g/L). The culture was kept shaking under the same culture condition, and samples were taken at interval for HPLC analysis.
(55) The Bioconversion of P-Coumaric Acid to Pterostilbene with the Protein of ROMT and 4CL::STS Fusion Protein in E.coli and S. cerevisiae
(56) E. coli BL21(DE3) containing pETDuet-4CLSTS and SUMO-ROMT vectors was grown in modified M9 medium at 37 C. until OD600 reach to 0.6, then add 1 mM IPTG, after 2 hour induction with IPTG, p-coumaric acid dissolved in 100% ethanol was added to the culture to 0.5 g/L. The culture was kept shaking under the same culture condition, and samples were taken at interval for HPLC analysis.
(57) Wat11 cells containing pAG304GPD-4CLSTS and pAG305GPD-ROMT plasmid were grown in SD drop out medium at 30 C. until OD600 reach to 0.2, then add p-coumaric acid (0.5 g/L). The culture was kept shaking under the same culture condition, and samples were taken at interval for HPLC analysis.
(58) Extraction of Products
(59) Aliquots of cultures (400 ul) were extracted with 800 ul of ethyl acetate. Extracts were evaporated to dryness with an Eppendorf Vacufuge (Eppendorf Scientific Westbury, N.Y.) at room temperature and re-dissolved in 200 ul of 80% (v/v) methanol.
(60) HPLC Analysis.
(61) The HPLC analysis of resveratrol and pterostilbene was carried out with Dionex Ultimate 3000 system. Intermediates were separated by reverse-phase chromatography on a phenomenex Kinetex C18 column (particle size 2.6 m; 1504.6 mm) with 0.1% (vol/vol) formic acid (Solution A) and 100% acetonitrile (Solution B). Samples were diluted into 80% methanol, and the following gradient procedure was used: 10% of solution B for 2 min; a linear gradient from 10% to 70% of solution B for 18 min; from 70% to 30% of solution B for 1 min; from 30% to 10% of solution B for 2 min; 10% of solution B for 5 min at a flow rate of 0.8 ml/min. For quantification, all intermediates were calibrated with external standards. The compounds were identified by their retention times, as well as the corresponding spectra, which were identified with a diode array detector in the system.
(62) Results
(63) The Bioconversion of P-Coumaric Acid to Resveratrol with Fusion Protein of 4CL and STS
(64) Three standards were run by HPLC, which shows that they were separated well (
(65) For in vivo yeast assay, fresh yeast colonies containing pAG304GPD-4CLSTS were grown at 30 C. in 3 ml yeast drop out medium containing 0.5 g/L p-coumaric acid for 4 days. Extracts were analyzed by HPLC. As shown in
(66) The Bioconversion of Resveratrol to Pterostilbene with the Protein of ROMT
(67) As shown in
(68) The Bioconversion of P-Coumaric Acid to Pterostilbene with Co-Expression 4CL::STS and ROMT
(69) p-Coumaric acid was fed into the culture of E.coli and S. cerevisiae with the co-expression of 4CL::STS and ROMT, as shown in
(70) Conventional and Saturation Mutagenesis of ROMT
(71) After careful analysis of the substrate binding site, the amino acid residues 167, 174, 258, and 261 have been selected for saturation mutagenesis to improve the activity of ROMT. Applicants already performed conventional mutagenesis to construct F167A, D174A, W258A, and H261A mutants of ROMT to know their effect on enzyme activity. None of them show activity except D174A, which exhibited very low activity (
(72) TABLE-US-00001 TABLE1 Primersusedinthisstudy Name Sequence(5-3) SumoROMTF CGCGAACAGATTGGAGGTGATTTGGCA AACGGTGTGATATCAGC (SEQIDNO:1) SumoROMTR GTGGCGGCCGCTCTATTATCAAGGATA AACCTCAATGAGGGACC (SEQIDNO:2) ROMTF ATGGATTTGGCAAACGGTGTGATATC (SEQIDNO:3) ROMTR TCAAGGATAAACCTCAATGAGGGACC (SEQIDNO:4) 4CL-F ATGGCGCCACAAGAACAAGCAGTTTC (SEQIDNO:5) 4CLSTS- GAGGGCAAAACTAGCAAATGGATTGGG LinkF ATCTGGCATGGCTTCAGTCGAGGAATT TAGAA (SEQIDNO:6) 4CLSTS- TTCTAAATTCCTCGACTGAAGCCATGC LinkR CAGATCCCAATCCATTTGCTAGTTTTG CCCTC (SEQIDNO:7) STS-R TTAATTTGTAACCATAGGAATGCTATG (SEQIDNO:8) 4CL- CGGGATCCATGGCGCCACAAGAACAAG BamHIF CAGTTTC (SEQIDNO:9) STS- CCCAAGCTTTTAATTTGTAACCATAGG HindIIIR AATGCTATG (SEQIDNO:10) Oligo TTTTTTTTTTTTTTTTTTTTVN dT(22) (SEQIDNO:11)
Identity and Similarity
(73) Identity is the fraction of amino acids that are the same between a pair of sequences after an alignment of the sequences (which can be done using only sequence information or structural information or some other information, but usually it is based on sequence information alone), and similarity is the score assigned based on an alignment using some similarity matrix. The similarity index can be any one of the following BLOSUM62, PAM250, or GONNET, or any matrix used by one skilled in the art for the sequence alignment of proteins.
(74) Identity is the degree of correspondence between two sub-sequences (no gaps between the sequences). An identity of 25% or higher implies similarity of function, while 18-25% implies similarity of structure or function. Keep in mind that two completely unrelated or random sequences (that are greater than 100 residues) can have higher than 20% identity. Similarity is the degree of resemblance between two sequences when they are compared. This is dependent on their identity.
(75) As is evident from the foregoing description, certain aspects of the present disclosure are not limited by the particular details of the examples illustrated herein, and it is therefore contemplated that other modifications and applications, or equivalents thereof, will occur to those skilled in the art. It is accordingly intended that the claims shall cover all such modifications and applications that do not depart from the spirit and scope of the present disclosure.
(76) Moreover, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure belongs. Although any methods and materials similar to or equivalent to or those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are described above.
(77) Other aspects, objects and advantages of the present disclosure can be obtained from a study of the drawings, the disclosure and the appended claims.
REFERENCES
(78) Schmidlin L, Poutaraud A, Claudel P, Mestre P, Prado E, Santos-Rosa M, Wiedemann-Merdinoglu S, Karst F, Merdinoglu D, Hugueney P (2008) A stress-inducible resveratrol O-methyltransferase involved in the biosynthesis of pterostilbene in grapevine. Plant Physiol. 148(3):1630-1639. Ambrish R, Alper K, Yang Z (2010) I-TASSER: a unified platform for automated protein structure and function prediction. Nature Protocols, 5:725-738. Grosdidier A, Zoete V, Michielin O. (2011) SwissDock, a protein-small molecule docking web service based on EADock DSS. Nucleic Acids Res. 39:W270-277.