Methods of nucleic acid amplification and sequencing
10370652 ยท 2019-08-06
Assignee
Inventors
- Celine Adessi (Ambilly, FR)
- Eric Kawashima (Nyon, CH)
- Pascal Mayer (Eloise, FR)
- Jean-Jacques Mermod (Geneva, CH)
- Gerardo Turcatti (Geneva, CH)
Cpc classification
C12N15/1068
CHEMISTRY; METALLURGY
C12Q2565/543
CHEMISTRY; METALLURGY
C12Q2565/543
CHEMISTRY; METALLURGY
C12Q1/6874
CHEMISTRY; METALLURGY
International classification
C12P19/34
CHEMISTRY; METALLURGY
C12Q1/6874
CHEMISTRY; METALLURGY
Abstract
Methods for amplification and sequencing of at least one nucleic acid comprising the following steps: (1) forming at least one nucleic acid template comprising the nucleic acid(s) to be amplified or sequenced, wherein said nucleic acid(s) contains at the 5 end an oligonucleotide sequence Y and at the 3 end an oligonucleotide sequence Z and, in addition, the nucleic acid(s) carry at the 5 end a means for attaching the nucleic acid(s) to a solid support; (2) mixing said nucleic acid template(s) with one or more colony primers X, which can hybridize to the oligonucleotide sequence Z and carries at the 5 end a means for attaching the colony primers to a solid support, in the presence of a solid support so that the 5 ends of both the nucleic acid template and the colony primers bind to the solid support; (3) performing one or more nucleic acid amplification reactions on the bound template(s), so that nucleic acid colonies are generated and optionally, performing at least one step of sequence determination of one or more of the nucleic acid colonies generated. Solid supports, kits and apparatus for use in these methods.
Claims
1. A method comprising the following steps: (1) forming at least one first nucleic acid template comprising at least one nucleic acid to be amplified, wherein said at least one nucleic acid contains (a) an oligonucleotide sequence Y and a means for attaching the at least one first nucleic acid template to a solid support at its 5 end and (b) an oligonucleotide sequence Z at its 3 end; (2) mixing said at least one first nucleic acid template with one or more colony primers X, each of which carries a means for attaching one of the one or more colony primers X to the solid support at its 5 end, in the presence of the solid support such that the 5 ends of both the at least one first nucleic acid template and the one or more colony primers X bind to the solid support and resulting in at least one bound first template and one or more bound colony primers, wherein at least a subset of the one or more colony primers X can hybridize to the oligonucleotide sequence Z; (3) performing one or more nucleic acid amplification reactions on the at least one bound first nucleic acid template, so that a first nucleic acid colony is generated, wherein the first nucleic acid colony comprises multiple copies of the at least one bound first nucleic acid template; and (4) performing at least one step of sequence determination of one or more of the multiple copies of the at least one bound first nucleic acid template while the one or more of the multiple copies of the at least one bound first nucleic acid template is bound to the solid support.
2. The method of claim 1, wherein the oligonucleotide sequence Z is complementary to the oligonucleotide sequence Y and the oligonucleotide sequence of the one or more colony primers X is the same as the oligonucleotide sequence Y.
3. The method of claim 1, wherein the one or more colony primers X comprise two different colony primers X, and wherein the two different colony primers X are mixed with said at least one first nucleic acid template in step (2), and wherein the sequence of one of the two different colony primers X is capable of hybridizing to the oligonucleotide sequence Z, and wherein the sequence of the other of the two different colony primers X is the same as the oligonucleotide sequence Y.
4. The method of claim 1, wherein the step of sequence determination involves incorporation and detection of labelled nucleotides on the one or more of the multiple copies of the at least one bound first nucleic acid template.
5. The method of claim 4, wherein the method further comprises (1) forming additional nucleic acid templates, wherein each of the additional nucleic acid templates contains (a) the oligonucleotide sequence Y and a means for attaching one of the additional nucleic acid templates to the solid support at its 5 end, and (b) the oligonucleotide sequence Z at its 3 end; (2) mixing each of the additional nucleic acid templates with the one or more colony primers X in the presence of the solid support such that the 5 ends of both each of the additional nucleic acid templates and the one or more colony primers X bind to the solid support and resulting in bound additional templates and the one or more bound colony primers, wherein at least a subset of the one or more colony primers X can hybridize to the oligonucleotide sequence Z; (3) performing one or more nucleic acid amplification reactions on the bound additional nucleic acid templates, so that one or more additional nucleic acid colonies are generated in addition to the first nucleic acid colony, each of the one or more additional nucleic acid colonies comprising multiple copies of one of the bound additional nucleic acid templates, each of the additional nucleic acid templates having a different nucleic acid sequence, and wherein the sequences of the bound additional nucleic acid templates and the sequence of the bound first template are determined simultaneously.
6. The method of claim 4, further comprising an additional step of visualising the first colony.
7. The method of claim 6, wherein the step of visualising the first colony involves the use of a labelled or unlabelled nucleic acid probe.
8. The method of claim 1, wherein said 5 ends of both the at least one first nucleic acid template and the one or more colony primers X are covalently bound to the solid support.
9. The method of claim 8, wherein the at least one first nucleic acid template and the one or more colony primers X comprise a chemically modifiable functional group that covalently binds the at least one first nucleic acid template and the one or more colony primers X to the solid support.
10. The method of claim 9, wherein said chemically modifiable functional group is a phosphate group, a carboxylic or aldehyde moiety, a thiol, a hydroxyl, a dimethoxytrityl (DMT), or an amino group.
11. The method of claim 10, wherein said chemically modifiable functional group is an amino group.
12. The method of claim 1, wherein said solid support is selected from the group consisting of latex beads, dextran beads, polystyrene and polypropylene surfaces, polyacrylamide gel, gold surfaces, and silicon wafers.
13. The method of claim 1, wherein the solid support is glass.
14. The method of claim 5, wherein the densities of the first nucleic acid colony and the additional nucleic acid colonies on the solid support are 10,000/mm.sup.2 to 100,000/mm.sup.2.
15. The method of claim 1, wherein the density of the one or more bound colony primers X on the solid support is at least 1 fmol/mm.sup.2.
16. The method of claim 1, wherein the density of the at least one bound first nucleic acid template in the first nucleic acid colony is 10,000/mm.sup.2 to 100,000/mm.sup.2.
Description
(1) The invention will now be described in more detail in the following non-limiting Examples with reference to the following drawings in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
EXAMPLES
Example 1
Preparation of DNA Templates Suitable for the Generation of DNA Colonies
(15) DNA colonies have been generated from DNA templates and colony primers. The term colony primer sequence as used herein refers to a sequence corresponding to the sequence of a colony primer and is elsewhere sometimes referred to as oligonucleotide sequence Y or oligonucleotide sequence Z.
(16) The properties of the colony primers have been chosen based on a selection for oligonucleotide primers that show little non-specific nucleotide incorporation in the presence of heat-stable DNA polymerases. The colony primers, CPa (5-p CACCAACCCAAACCAACCCAAACC) (SEQ ID NO:2) and CP (5-p AGAAGGAGAAGGAAAGGGAAAGGG) SEQ ID NO:1) have been selected due to their low incorporation of radiolabeled .sup.32P-dCTP in the presence of a stable DNA polymerase (AmpliTaq, Perkin Elmer, Foster City, Calif.) in the standard buffer and under thermocycling conditions (94 C. for 30 seconds, 65 C. for 1 minute, 72 C. for 2 minutes, 50 cycles).
(17) A 3.2 Kb DNA fragment was taken as a model system to demonstrate the feasibility of colony generation using colony primers and DNA templates. The chosen template comprises the human gene for the receptor for advanced glycosylation end-products (HUMOXRAGE, GenBank Acc. No. D28769). The RAGE-specific primers are depicted in Table 1. The 3.2 Kb template was generated by PCR amplification from 0.1 g human genomic DNA with 1 M primers TP1 and TP2 with 1 unit of DNA polymerase (AmpliTaq, Perkin Elmer, Foster City, Calif.) in the standard buffer and under thermocycling conditions (94 C. for 30 seconds, 65 C. for 1 minute, 72 C. for 5 minutes, 40 cycles). This 3.2 Kb DNA fragment was used as a template for secondary PCR to generate two shorter templates for colony generation (Templates A and B). The primers used to generate the shorter templates contain both sequences specific to the template and sequences of colony primers CP1 and CP2 to amplify the DNA on the solid surface. In general, the PCR primer used to generate a DNA template is modified at the 5-terminus with either a phosphate or thiol moiety. Thus after the PCR amplification, DNA fragments are generated which contain the colony primer sequences at one or both termini adjoining the RAGE DNA fragment of interest (see
(18) Template A (double stranded template containing the colony primer sequence, CPP at both termini) was generated with 0.1 ng of the 3.2 Kb template with 1 AM primers TPA1 and 1 AM TPA2 with 1 unit of DNA polymerase (AmpliTaq, Perkin Elmer, Foster City, Calif.) in the standard buffer and under thermocycling conditions (94 C. for 30 seconds, 65 C. for 1 minute, 72 C. for 1 minutes, 30 cycles). The products were then purified over Qiagen Qia-quick columns (Qiagen GmbH, Hilden, Germany).
(19) Template B (double stranded template which contains colony primer sequences corresponding to CP(3) was generated with 0.1 ng of the 3.2 Kb template with 1 M primers TPB1 and 1 M TPB2 with 1 unit of DNA polymerase (AmpliTaq, Perkin Elmer, Foster City, Calif.) in the standard buffer and under thermocycling conditions (94 C. for 30 seconds, 65 C. for 1 minute, 72 C. for 1 minutes, 30 cycles). The products were then purified over Qiagen Qia-quick columns (Qiagen GmbH, Hilden, Germany).
(20) Template B (double stranded template containing colony primer sequences corresponding to CP and CP at either end) was generated with 0.1 ng of the 3.2 Kb template with 1 M primers TPB3 and 1 M TPB4 with 1 unit of (AmpliTaq, Perkin Elmer, Foster City, Calif.) in the standard buffer and under thermocycling conditions (94 C. for 30 seconds, 65 C. for 1 minute, 72 C. for 1 minutes, 30 cycles). The products were then purified over Qiagen Qia-quick columns (Qiagen GmbH, Hilden, Germany).
(21) All the specific oligonucleotides employed for the DNA templates preparation and for the DNA colony generation have been reported in the Table 1 together with any chemical modification.
(22) A general scheme showing the chemical attachment of colony primers and templates to the glass surface is reported in
(23) TABLE-US-00001 TABLE1 Listofoligonucleotidesusedfortemplates preparationandcoloniesgeneration: SEQID Coordinates Oligonucleotide Name NO: DNAsequence (orientation) Modification Use TP1 3 GAGGCCAGAACAGT 9810(R) Template TCAAGG 3.2Kb TP2 4 CCTGTGACAAGACG 6550(F) Template ACTGAA 3.2Kb CP1 5 TTTTTTTTTTCACC None 5P Generate AACCCAAACCAACC colonies CAAACC CP2 6 TTTTTTTTTTAGAA None 5P Generate GGAGAAGGAAAGGG colonies AAAGGG CP3 7 TTTTTTTTTTCACC None 5SH Generate AACCCAAACCAACC colonies CAAACC CP4 8 TTTTTTTTTTAGAA None 5SH Generate GGAGAAGGAAAGGG colonies AAAGGG CP5 9 AGAAGGAGAAGGAA None 5P Generate AGGGAAAGGGTTTT colonies TTTTTTTTTTTTNN CP6 10 AGAAGGAGAAGGAA None 5P Generate AGGGAAAGGGGG colonies CP7 5 TTTTTTTTTTCACC None 5(NH.sub.2) Generate AACCCAAACCAACC colonies CAAACC CP8 6 TTTTTTTTTTAGAA None 5(NH.sub.2) Generate GGAGAAGGAAAGGG colonies AAAGGG CP9 6 TTTTTTTTTTAGAA None 5(OH) Control GGAGAAGGAAAGGG oligo AAAGGG CP10 6 TTTTTTTTTTAGAA None 5(DMT) Control GGAGAAGGAAAGGG oligo AAAGGG CP11 6 TTTTTTTTTTAGAA None 5(biotin) Control GGAGAAGGAAAGGG oligo AAAGGG TPA1 12 AGAAGGAGAAGGAA 6550(F) 5P Template AGGGAAAGGGCCTG A TGACAAGACGACTG AA TPA2 13 TTTTTTTTTTAGAA 7403(R) 5P Template GGAGAAGGAAAGGG A AAAGGGGCGGCCGC TGAGGCCAGTGGAA GTCAGA TPB3 14 TTTTTTTTTTCACC 9049(F) None Template AACCCAAACCAACC B CAAACCGAGCTCAG GCTGAGGCAGGAGA ATTG TPB1 15 AGAAGGAGAAGGAA 9265(F) None Template AGGGAAAGGGGAGC B TGAGGAGGAAGAGA GG TPB2 16 AGAAGGAGAAGGAA 8411(R) 5P Template AGGGAAAGGGGCGG B CCGCTCGCCTGGTT CTGGAAGACA TPB4 16 AGAAGGAGAAGGAA 9265(R) 5SH Template AGGGAAAGGGGCGG B CCGCTCGCCTGGTT CTGGAAGACA Coordinate from HUMOXRAGE gene Accession number D28769 (R) means reverse and (F) means forward
Example 1a
Preparation of a Random DNA Template Flanked by a Degenerate Primer
(24) A 3.2 Kb DNA fragment was taken as a model system to demonstrate the feasibility of colony generation from random primer PCR amplification. This strategy can be applied to sequencing of DNA fragments of approximately 100 Kb in length and, by combination of fragments to whole genomes. A fragment of DNA of 3.2 Kb was generated by PCR from human genomic DNA using PCR primers TP1 5-pGAGGCCAGAACAGTTCAAGG (SEQ ID NO:3) and TP1 5-pCCTGTGACAAGACGACTGAA (SEQ ID NO:4), as described in example 1. The 3.2 Kb fragment was cut in smaller fragments by a combination of restriction enzymes (EcoR1 and HhaI yielding 4 fragments of roughly 800 bp). The cut or uncut fragment DNAs were then mixed with the degenerate primer, p252 (5-P TTTTTTTTTTISISISISISIS (SEQ ID NO:17), where I stands for inosine (which pairs with A, T and C) and S stands for G or C) and covalently coupled to the Nucleolink wells (Nunc, Denmark). The tubes were then subjected to random solid phase PCR amplification and visualized by hybridisation with labeled DNA probes, as will be described in Example 2a.
Example 2
Covalent Binding of DNA Templates and Colony Primers on Solid Support (Plastic) and Colony Formation with a Colony Primer
(25) Covalent Binding of Template and Colony Primer to the Solid Support (Plastic)
(26) A colony primer (CP2, 5-TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) (SEQ ID NO: 6), phosphorylated at its 5 terminus (Microsynth GmBH, Switzerland), was attached onto Nucleolink plastic microtitre wells (Nunc, Denmark) in the presence of varying doses of Template A (prepared as described in example 1). 8 wells were set up in duplicate with seven 1/10 dilutions of template with CP2, starting with the highest concentration of 1 nM.
(27) Microtitre wells, to which CP2 colony primer and the template are covalently bound were prepared as follows. In each Nucleolink well, 30 l of a 1 M solution of the colony primer with varying concentrations of template diluted down from 1 nM in 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals) was added. To each well, 10 l of 40 mM 1-ethyl-3-{3-dimethylaminopropyl)-carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole, was added to the solution of colony primer and template. The wells were then sealed and incubated at 50 C. overnight. After the incubation, wells were rinsed twice with 200 l of RS (0.4 N NaOH, 0.25% Tween 20), incubated 15 minutes with 200 l RS, washed twice with 200 l RS and twice with 200 l TNT (100 mM TrisHCl pH 7.5, 150 mM NaCl, 0.1% Tween 20). Tubes were dried at 50 C. and were stored in a sealed plastic bag at 4 C.
(28) Colony Generation
(29) Colony growing was initiated in each well with 20 l of PCR mix; the four dNTPs (0.2 mM), 0.1% BSA (bovine serum albumin), 0.1% Tween 20, 8% DMSO (dimethylsulfoxide, Fluka, Switzerland), 1PCR buffer and 0.025 units/l of AmpliTaq DNA polymerase (Perkin Elmer, Foster City, Calif.). The wells were then placed in the thermocycler and growing was performed by incubating the sealed wells 5 minutes at 94 C. and cycling for 50 repetitions the following conditions: 94 C. for 30 seconds, 65 C. for 2 minutes, 72 C. for 2 minutes. After completion of this program, the wells were kept at 8 C. until further use. Prior to hybridization wells are filled with 50 L TE (10 mM Tris, 1 mM EDTA, pH 7.4) heated at 94 C. for 5 minutes and chilled on ice before probe addition at 45 C.
(30) Colonies Visualization
(31) Probe: The probe was a DNA fragment of 1405 base pairs comprising the sequence of the template at their 3 end (nucleotide positions 8405 to 9259). The DNA probe was synthesized by PCR using two primers: p47 (5-GGCTAGGAGCTGAGGAGGAA), amplifying from base 8405, and TP2, biotinylated at 5 end, amplifying from base 9876 of the antisense strand.
(32) Hybridization and Detection: The probe was diluted to 1 nM in easyhyb (Boehringer-Mannheim, Germany) and 20 L added to each well. The probe and the colonies were denatured at 94 C. for 5 min and then incubated 6 hours at 50 C. Excess probes was washed at 50 C. in 2SSC with 0.1% Tween. The DNA probes were bound to avidin coated green fluorescence fluorospheres of a diameter of 0.04 (Molecular Probes) in TNT for 1 hour at room temperature. Excess beads were washed with TNT. Colonies were visualized by microscopy and image analysis as described in example 2a.
Example 2a
Covalent Binding of DNA Templates and Colony Primers on Solid Support (Plastic) and Colony Formation with a Degenerate Primer
(33) Covalent Binding of Template and Colony Primer to the Solid Support (Plastic)
(34) Microtitre wells with p252 and template DNA fragments were prepared as follows:
(35) In each Nucleolink well, 30 l of a 1 M solution of the colony primer p252 with varying concentrations of template diluted down from 0.5 nM in 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals) was added. To each well, 10 l of 40 mM 1-ethyl-3-(3-dimethylamino-propyl)-carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole, was added to the solution of colony primer and template. The wells were then sealed and incubated at 50 C. overnight. After the incubation, wells were rinsed twice with 200 l of RS (0.4N NaOH, 0.25% Tween 20), incubated 15 minutes with 200 l RS, washed twice with 200 l RS and twice with 200 l TNT (100 mM TrisHCl pH7.5, 150 mM NaCl, 0.1% Tween 20). Tubes were dried at 50 C. and were stored in a sealed plastic bag at 4 C.
(36) Colony Generation
(37) DNA colony generation was performed with a modified protocol to allow random priming in each well with 20 l of PCR mix; the four dNTPs (0.2 mM each), 0.1% BSA, 0.1% Tween 20, 8% DMSO (dimethylsulfoxide, Fluka, Switzerland), 1PCR buffer and 0.025 units/l of AmpliTaq DNA polymerase (Perkin Elmer, Foster City, Calif.). The wells were then placed in the thermocycler and amplification was performed by incubating the sealed wells 5 minutes at 94 C. and cycling for 50 repetitions the following conditions: 94 C. for 30 seconds, 65 C. for 2 minutes, 72 C. for 2 minutes. After completion of this program, the wells were kept at 8 C. until further use. Prior to hybridization wells are filled with 50 L TE (10 mM Tris 1 mM EDTA pH 7.4) heated at 94 C. for 5 minutes and chilled on ice before probe addition at 45 C.
(38) Colonies Visualization
(39) Probes: Two DNA fragments of 546 and 1405 base pairs comprising the sequences of either extremities of the original template were amplified by PCR. The antisense strand of the probe was labeled with biotin, through the use of a 5-biotinylated PCR primer. The base pair coordinates of the probes were 6550 to 7113 and 6734 to 9805.
(40) Hybridization and detection: The probes were diluted to 1 nM in easyhyb (Boehringer-Mannheim, Germany) and 20 L added to each well. The probe and the colonies were denatured at 94 C. for 5 min and then incubated 6 hours at 50 C. Excess probes was washed at 50 C. in 2SSC with 0.1% tween. The DNA probes were bound to avidin coated green fluorescence fluorospheres of a diameter of 40 nanometers (Molecular Probes, Portland Oreg.) in TNT for 1 hour at room temperature. Excess beads were washed off with TNT. Fluorescence was detected using an inverted microscope (using the 20/0.400 LD Achroplan objective, on the Axiovert S100TV, with an arc mercury lamp HBO 100 W/2, Carl Zeiss, Oberkochen, Germany) coupled to a 768(H)512(V) pixel-CCD camera (Princeton Instruments Inc. Trenton, N.J., USA). Exposure were 20 seconds through filter sets XF22 (Ex: 485DF22, Dichroic: 505DRLPO2 Em: 530DF30) and XF47 (Ex: 640DF20, Dichroic: 670DRLPO2 Em: 682DF22) from Omega Optical (Brattleboro Vt.) for FITC and Cy5 respectively. Data were analyzed using Winwiew software (Princeton Instruments Inc., Trenton N.J., USA). The numbers of colonies per field were counted in duplicate wells with image analysis software developed in house.
Example 3
Sequence Discrimination in Different Colonies Originated from Varying Ratios of 2 Different Covalently Bound Templates and a Colony Primer
(41) Covalent Binding of Templates and Colony Primer to the Solid Support (Plastic)
(42) A colony primer (CP2: 5 pTTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) (SEQ ID NO:6), phosphorylated at its 5 terminus (Microsynth GmbH, Switzerland), was grafted onto Nucleolink plastic microtitre wells (Nunc, Denmark) in the presence of varying doses of the two templates A and B (prepared as described in example 1). Series of 8 wells were set up in triplicate with seven 1/10 dilutions of both templates starting with the highest concentration of 1 nM. Template dilutions are set up in opposite directions such that the highest concentration of one template coincides with the lowest of the other.
(43) Microtitre wells, to which CP2 primer and both templates are covalently bound were prepared as follows. In each Nucleolink well, 30 l of a 1 M solution of the CP2 primer with varying concentrations of both templates diluted down from 1 nM in 10 mM 1 methyl-imidazole (pH 7.0) (Sigma Chemicals) were added. To each well, 10 l of 40 mM 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-i imidazole (pH 7.0), was added to the solution of colony primer and templates. The wells were then sealed and incubated at 50 C. for 4 hours. After the incubation, the wells were rinsed three times with 50 l of RS (0.4 N NaOH, 0.25% Tween 20), incubated 15 minutes with 50 l RS, washed three times with 50 l RS and three times with 50 l TNT (100 mM TrisHCl pH 7.5, 150 mM NaCl, 0.1% Tween 20). Tubes were stored in TNT at 4 C.
(44) Colonies Generation
(45) Colony growing was initiated in each well with 20 l of PCR mix; the four dNTPs (0.2 mM), 0.1% BSA, 0.1% Tween 20, 8% DMSO (dimethylsulfoxide, Fluka, Switzerland), 1 PCR buffer and 0.025 units/l of AmpliTaq DNA polymerase (Perkin Elmer, Foster City, Calif.).
(46) The wells were then placed in the thermocycler and growing was performed by incubating the sealed wells 5 minutes at 94 C. and cycling for 50 repetitions the following conditions: 94 C. for 30 seconds, 65 C. for 5 minutes, 72 C. for 5 minutes. After completion of this program, the wells were kept at 8 C. until further use. Prior to hybridization wells are filled with 50 l TE (10 mM Tris, 1 mM EDTA, pH 7.4) heated at 94 C. for 5 minutes and chilled on ice before probe addition at 50 C.
(47) Colonies Visualization
(48) Probe: Two DNA fragments of 546 and 1405 base pairs corresponding to the sequences of the 3.2 Kb DNA fragment at the 5- and 3-termini were amplified by PCR using one biotinylated primer (see example 2). The two probes were denatured by heating at 94 C. for 5 minutes, quick-chilled into 1 M NaCl, 10 mM Tris pH 7.4 and allowed to bind to Strepatividin coated fluorospheres of diameter 0.04 m labeled with different colors for 2 hours at 4 C. The probes bound to bead were diluted 20 fold in easyhyb solution prewarmed to 50 C. 20 l of probes was added to each well containing denatured colonies.
(49) Hybridization and detection: The hybridization was carried out at 50 C. for 5 hours. Excess probes was washed at 50 C. in 2SSC with 0.1% SDS. Colonies were visualized by microscopy with a 20 objective, 20 second exposure and image analysis as described in example 2a.
Example 4
Covalent Binding of DNA Templates and Oligonucleotides on Glass Solid Supports
(50) Aminosilane-derivatized glass slides have been used as solid support to covalently attach thiol-modified oligonucleotides probes using hetero-bifunctional cross-linkers. The reagents selected have thiol-reactive (maleimide) and amino-reactive groups (succinimidyl ester). Oligonucleotide attachment yields and stability of the immobilized molecules will be strongly dependent on the cross-linker stability towards the conditions of the different treatments performed. The reaction schemes of the DNA templates or oligonucleotides attachment on glass are described in
(51) The storage stability of glass slides prepared with the cross-linkers s-MBS and s-SIAB and its thermal stability have been evaluated. An important factor affecting the extent of hybridization of immobilized oligonucleotide probes is the density of attached probes (Beattie et al., 1995; Joss et al., 1997). We have studied this effect by varying the concentration of oligonucleotides during the immobilization and assaying the density of attached oligos by hybridization.
(52) Materials and Methods
(53) Microscope glass slides acid pre-treatmentMicroscope glass slides (Knittel, Merck ABS) were soaked in basic Helmanex solution during 1 hour (HelmanexII.sup.R 0.25%, 1N NaOH). The slides were rinsed with water, immersed overnight in 1N HCl, rinsed again in water and treated 1 hour in sulfuric acid solution (H.sub.2SO.sub.4/H.sub.2O, 1/1, v/v, with a small amount of fresh ammonium persulfate added). The slides were rinsed in water, in ethanol and finally with pure acetone. Glass slides are dried and stored under vacuum for further use.
(54) Silanization of the surfaceThe pre-treated slides were immersed into a 5% solution of ATS (aminopropyltriethoxysilane, Aldrich) in acetone. Silanization was carried out at room temperature for 2 hours. After three washes in acetone (5 min/wash) the slides were rinsed once with ethanol, dried and stored under vacuum.
(55) Cross-linker attachmentCross-linkers, s-MBS and s-SIAB (respectively sulfo m-maleimidobenzoyl-N-hydroxysuccinimide ester, sulfo N-succinimidyl[4-iodoacethyl] aminobenzoate, Pierce, Rockford Ill.), are prepared as 20 mM solutions in PBS (phosphate-buffered saline, 0.1 M NaH.sub.2PO.sub.4, pH 7.2, 0.15 M NaCl). Silanized glass slides, on which 80 L of cross-linker solution was applied, were covered by a cleaned micro cover glass and reacted for 5 hours at 20 C. The glass slides were rinsed in PBS, briefly immersed in water and rinsed in ethanol. Slides were then dried and stored under vacuum in the dark for further use.
(56) Oligonucleotide AttachmentOligonucleotides were synthesized with 5 modifications of a thiol (CP3 and CP4 Eurogentec, Brussels) or a phosphate moiety (CP1 and CP2, Eurogentec, Brussels) using standard phosphoramidite chemistry. 5-thiol oligonucleotide primers (CP3 and CP4) were prepared as 100 M solutions in a saline phosphate buffer (NaPi: 0.1M NaH.sub.2PO.sub.4 pH: 6.6, 0.15M NaCl) and drops of 1 l applied on the functionalized glass slide (functionalized with cross-linker) for 5 hours at room temperature. Glass slides were kept under a saturated wet atmosphere to avoid evaporation. Glass slides were washed on a shaker in NaPi buffer. For thermal stability study glass slides were immersed 2 times in Tris buffer (10 mM, pH 8) for 5 min at 100 C. and directly immersed in 5SSC (0.75 M NaCl, 0.075 M NaCitrate pH 7) at 4 C. for 5 min. Slides were stored in 5SSC at 4 C. for further use. 5-phosphate oligonucleotides primers (CP1 and CP2) were applied (1 l drops) for 5 hours at room temperature to amino-derivatized glass as 1 M solution in 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals) containing 40 mM of 1-ethyl-3-(3-dimethylamino-propyl) carbodiimide (EDC, Pierce, Rockford Ill.). The slides were washed 2 times at 100 C. in Tris buffer (10 mM, pH 8) and directly immersed in 5SSC at 4 C. for 5 min. Slides were stored in 5SSC at 4 C. for further use.
Oligonucleotide and DNA Template Attachment
(57) The 5-thiol oligonucleotide primers (CP3 and CP4), and 5-thiol template B were mixed in a saline phosphate buffer (NaPi: 0.1M NaH.sub.2PO.sub.4 pH: 6.6, 0.15M NaCl). Concentration of DNA template varied from 0.001 to 1 M and from 0.1 to 100 M for primers but were optimized at 1 M and 100 M respectively for template and primers. The procedure described above for CP3 and CP4 attachment on functionalized glass surface was then followed.
(58) The 5-phosphate oligonucleotide primers (CP1 and CP2), and 5-phosphate template B were mixed in a 10 mM 1-methyl-imidazole (pH 7.0)(Sigma Chemicals) solution containing 40 mM of 1-ethyl-3-(3-dimethylamino-propyl) carbodiimide (EDC, Pierce, Rockford Ill.). Concentration of DNA template varied from 0.001 to 10 nM and from 0.1 to 1 M for primers, but were eventually optimized at 10 nM and 1 M respectively for template and primers. The procedure described above for CP1 and CP2 attachment on amino-derivatized glass surface was followed.
(59) Hybridization with fluorescent probesOligonucleotide probes, fluorescently labeled with Cy5 or FITC at their 5end, were synthesized by Eurogentec (Brussels). To prevent non-specific hybridization, glass slides were incubated with a blocking solution (5SSC, Tween 0.1%, BSA 0.1%) for 1 hour and washed on a shaker in 5SSC (2 times, 5 min). Oligonucleotide probes were diluted at 0.5 M in 5SSC, Tween 0.1% and applied on the glass surface for 2 hours at room temperature. Glass slides were rinsed on a shaker at 37 C., once in 5SSC for 5 min, and twice in 2SSC containing 0.1% SDS for 5 minutes.
(60) Hybridization with radiolabeled probesRadiolabeled oligonucleotides complementary to covalently linked oligonucleotides were used as hybridization probes in order to quantify hybridization yields.
(61) Oligonucleotides were enzymatically labeled at their 5 end terminus with [-.sup.32P)dATP (Amersham, UK) using the bacteriophage T4 polynucleotide kinase (New England Biolabs, Beverly, Mass.). Excess (-.sup.32P]dATP was removed with a Chroma Spin column TE-10 (Clontech, Palo Alto Calif.). Radiolabeled oligonucleotides (0.5 M in 5SSC, Tween 0.1%) were then applied onto derivatized slides for 2 hours at room temperature. Glass slides were rinsed on a shaker once in 5SSC for 5 min and twice in 2SSC, SDS 0.1% for 5 minutes at 37 C. After hybridization the specific activity was determined by scintillation counting.
(62) Microscope observationGlass slides were overlaid with 5SSC solution and a micro cover glass. Fluorescence was detected using an inverted microscope model Axiovert S100TV, with an arc mercury lamp HBO 100 W/2 (Carl Zeiss, Oberkochen, Germany) coupled to a CCD camera equipped with a CCD array Kodak with a format 768(H)512(V) pixels; 6.914.6 mm overall, pixel size 99 m2 (Princeton Instruments Inc. Trenton, N.J., USA). Exposition times were between 1 and 50 seconds using the objective LD Achroplan 20/0.400 (Carl Zeiss, Oberkochen, Germany) and filter sets XF22 (Ex: 485DF22, Dichroic: 505DRLP02 Em: 530DF30) and XF47 (Ex: 640DF20, Dichroic: 670DRLP02 Em: 682DF22) from Omega Optical (Brattleboro Vt.) for FITC and Cy5 fluorophores respectively. Data were analyzed using Winwiew software (Princeton Instruments Inc., Trenton N.J., USA).
(63) Results
(64) Evaluation of Storage Stability Attachment and Thermal Stability
(65) We evaluated the storage stability of glass plates prepared with s-MBS and s-SIAB. Since these reagents are sensitive towards hydrolysis, oligonucleotide attachment yields will be dependent on their stability. Amino-derivatized glass plates were functionalized with freshly prepared crosslinking reagents, s-MBS and s-SIAB. The functionalized slides were stored after cross-linking attachment for 10 days in a dessicator under vacuum in the dark at room temperature. After this time, stored slides (t=10 days) and freshly reacted slides with the cross-linker reagents (t=0) were assayed. The results obtained after reaction of a thiol-oligonucleotide and hybridization of a complementary fluorescent probe were compared for both chemistries at t=0 and time=10 days.
(66) Once immobilized, the s-SIAB-functionalized slides are fully stable after 10 days storage as evidenced by the same yields of hybridization obtained at t=0 and t=10 days. In contrast, coupled s-MBS to glass was found to be less stable with a 30% loss in yield of oligonucleotide attachment and hybridization after 10 days storage. In conclusion, s-SIAB functionalized slides are preferred as they can be prepared in advance and stored dry under vacuum in the dark for at least ten days without any reduction in probe attachment yield.
(67) To evaluate the thermal stability of oligonucleotides attached to glass, the slides were subjected to two 5-min treatments at 100 C. in 10 mM Tris-HCl, pH 8. The remaining oligonucleotide still immobilized after washes was assayed by hybridization with a fluorescently labeled complementary oligonucleotide. About 14% of the molecules attached are released for s-SIAB glass slides and 17% for S-MBS glass slides after the first 5 minutes wash, but no further release was detected in the second wash for both chemistries (TABLE 1A). These results are encouraging compared to those obtained by Chrisey et al. 1996, where a release of more than 62% of oligonucleotides attached on fused silica slides via the crosslinker SMPB (Succinimidyl 4-[p-maleimidophenyl] butyrate) was measured after a 10 min treatment in PBS at 80 C.
(68) TABLE-US-00002 TABLE 1A Thermal stability study Hybridisation results (arbitrary units, normalised to 100%) After 5 min wash After 2 5 min Freshly attached at 100 C. wash at 100 C. s-MBS 80 6 69 4 73 4 s-SIAB 100 9 84 8 87 3
(69) Oligonucleotides were attached to glass slides functionalized with either s-MBS or s-SIAB. Attached oligonucleotides were assayed by hybridization with a fluorescently-labeled complementary oligonucleotide. Fluorescence signal is normalized at 100 for the highest signal obtained. Averaged values of triplicate analyses are reported.
(70) Hybridization as a Function of Probe Attachment
(71) We have studied the extent of hybridization of covalently bound oligonucleotide probes as a function of the surface coverage of attached oligonucleotides using the s-MBS, s-SIAB cross-linkers and EDC-mediated reactions. The concentration of oligonucleotides applied for immobilization was 1 M for EDC and has been varied between 1 and 800 M for crosslinkers, the surface density was assayed by hybridization with .sup.32P-labeled probes. The optimal concentration for primer attachment using the heterobifunctional cross-linkers was 500 M which equates with a surface density of hybridized molecules of 60 fmol/mm.sup.2 for s-MBS and 270 fmol/mm.sup.2 for s-SIAB. Similar coverage density as s-MBS was obtained using EDC/Imidazole-mediated attachment of 5-phosphate oligonucleotides to aminosilanised glass. However, only 1 M solutions of oligonucleotide were necessary to attain the same attachment yield, this represents a 500-fold excess of oligonucleotide to be attached for the s-MBS chemistry compared to the EDC/imidazole coupling strategy (Table 1B).
(72) TABLE-US-00003 TABLE 1B Hybridization as a function of probe attachment Oligo hybridized Conc. of oligonucleotide (fmol/mm.sup.2) used for attachment (M) s-MBS s-SIAB EDC 1 NT NT 50 100 10 100 NT 500 60 270 NT
(73) Oligonucleotides were attached to glass slides functionalized with either s-MBS or s-SIAB or via mediated activating reagent EDC. Attached oligonucleotides were assayed by hybridization with a radiolabeled complementary oligonucleotide. The specific activity and therefore the density of hybridized molecules were determined by scintillation liquid. NT: not tested
(74) The 60 fmol/cm.sup.2 surface density corresponds to an average molecular spacing between bound oligonucleotides of 8 nm. According to our results, a coverage density of 30 fmol/mm.sup.2 (spacing of 20 nm) is sufficient to obtain DNA colonies. This yield can be obtained by immobilizing primers at 100 M using the heterobifunctional cross-linker s-SIAB or 1 M probes using the EDC-mediated approach. The hybridization densities we have obtained are in the range of the highest densities obtained on glass slides of other grafting protocols previously reported (Guo et al-1994, Joss et al-1997, Beattie et al1995).
(75) DNA Colony Generation on Glass: Colonies Formation is Dependent on the Length, the Concentration of Template and the Concentration of Primers
(76) Theoretically, DNA colony formation requires an appropriate density of primers attached on the surface corresponding to an appropriate length of the DNA template. For optimal DNA colony generation, it is important to define the range of densities of the bound primers and templates, as well as the stoichiometric ratio between template and primer.
(77) Materials and Methods
(78) Glass Slide Preparation
(79) Glass slides were derivatized and functionalized as described above (Materials and methods). DNA colony primers were CP1 and CP2. The colony templates were prepared as described in example 1 for template B, but using primers TPB3 and TPB2. The modified colony primers and templates were applied on glass surface at varying concentrations of both colony primer and colony template.
(80) Generation of Colonies
(81) Glass slides stored in 5SSC were washed in micro-filtered water to removed salts. Colony growing was initiated on glass surface with a PCR mix; the four dNTP (0.2 mM), 0.1% BSA, 0.1% Tween 20, 1PCR buffer and 0.05 U/l of AmpliTaq DNA polymerase (Perkin Elmer, Foster City, Calif.). The PCR mix is placed in a frame seal chamber (MJ Research, Watertown, Mass.). The slides were placed in the thermocycler (The DNA Engine, MJ Research Watertown, Mass.) and thermocycling was as carried out as follows: step 1 at 94 C. for 1 min, step 2 at 65 C. for 3 minutes, step 3 at 74 C. for 6 min and this program is repeated 50 times. After completion of this program the slides are kept at 6 C. until further use.
(82) Digestion of Double Strand DNA Colonies
(83) The glass surface containing the DNA was cut with a restriction nuclease by overlaying with the restriction enzyme in a digestion 1 buffer. The reaction was run twice for 1 h30 at 37 C. Double strand DNA colonies were denatured by immersing slides 2 times in tris buffer (10 mM, pH 8) at 100 C. for 5 min, followed by a rinse in 5SSC at 4 C. Slides were stored in 5SSC for further use.
(84) Hybridization of One Strand DNA Colonies
(85) To prevent non-specific hybridization, glass slides were incubated with a blocking solution (5SSC, 0.1% Tween, 0.1% BSA) for 1 hour and the slides rinsed in 5SSC (2 times, 5 min). Fluorescently Cy5 5 end labeled oligonucleotide (Eurogentec, Brussels) were diluted at 0.5 M in SSC 5, Tween 0.1% and applied to the glass surface for at least 2 hours. Glass slides are rinsed on a shaker once in SSC 5 for 5 min and twice in SSC 5, SDS 0.1% 5 minutes at 37 C.
(86) The glass slides were visualized as previously described.
(87) We have previously observed that the extent of hybridization is a function of the density of oligonucleotide attachment. A similar study with bound DNA templates has shown that colony formation is also a function of the concentration of template attached on glass slide. Depending on the chemistry used for oligonucleotide and template attachment, the optimal concentration of template is 1 M for the bi-functional crosslinkers, s-MBS (
(88) We have studied colony formation (number) as a function of the concentration of primers, concentration of the DNA template applied on the surface and the length of the DNA template.
(89) We have also evaluated the number of copy of template in each colony. The quantification was based on fluorescence detection with Cy5-, Cy3- or fluorescein-labeled fluorophores supplemented with an anti-bleaching reagent (Prolong, Molecular Probes, Portland Oreg.). The calibration has been done by hybridization experiments on primers attached to the surface as the exact density corresponding has been determined by radioactivity
Example 5
Colony In-situ DNA Sequencing
(90) Glass slides (5 mm diameter Verrerie de Carouge, Switzerland) were first placed into a Helmanex 0.2% (in H.sub.2O), NaOH 1N bath for 1 h at room temperature, rinsed with distilled water, rinsed in pure Hexane, rinsed again two times with distilled water and treated with HCl 1M over night at room temperature. Then, they were rinsed two times in distilled water, and treated with H.sub.2SO.sub.4 (50%)+K.sub.2S.sub.2O.sub.8 for 1 h at room temperature. They were rinsed in distilled water, then two times in Ethanol. Glass slides were derivatized with ATS (as described in example 4).
(91) Colony primers CP1 (5-pTTTTTTTTTTCACCAACCCAAACCAACCCAAACC) (SEQ ID NO:5) and CP2 (5-pTTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) (SEQ ID NO:6) which are 5phosphorylated (Microsynth GmbH, Switzerland) and DNA template B (prepared as described in example 1) were 5 covalently attached onto 5 mm diameter glass slides (Verrerie de Carouge, Switzerland) to a final concentrations of 1 M and 10 nM respectively, as follows: 2 nmoles of each primer were added to 0.2 nmoles of template in 1 ml of solution A (41 l of Methylimidazole (Sigma, #M-8878) in 50 ml H20, pH adjusted to 7 with HCl) and then mixed 1:1 with solution D (0.2 mM EDC in 10 ml of solution A). On both glass slides sides, 3.5 l of the mixture were loaded, and incubated over night at room temperature. The glass slides were then briefly rinsed with 5SSC buffer and placed at 100 C. in 10 mM Tris buffer pH 8.0 for 25.
(92) Non specific sites on glass were blocked with Bovine Serum Albumin (BSA, Boehringer Mannheim GmbH, Germany, #238040) at 1 mg/ml in 5SSC buffer for 1 h at room temperature and then rinsed with distilled water.
(93) Glass slides were then individually placed onto a Microamp reaction tube (Perkin Elmer) containing 170 l of PCR mix, and DNA colonies were then generated using Taq polymerase (AmpliTaq, PE-Applied Biosystems Inc., Foster City Calif.) with 50 cycles (94C/60, 60C/3, 72C/6) in a MTC 200 thermo-cycler (MJ Research, Watertown, Mass.). Each slide was digested twice using 1.3 units of Pvu II (Stratagene) in NEB 2 buffer (New England Biolabs) for 45 minutes at 37 C. After digestion, the tubes were placed at 100 C. in 10mM Tris buffer pH 8.0 for 25, then blocked with filtered (Millex GV4, Millipore) 1 mg/ml BSA in 2SSC buffer for 30 at room temperature and rinsed first in 2SSC 0.1% SDS buffer then in SSSC buffer. Each slide was incubated over night at room temperature with a 5SSC/0.1% Tween 20 buffer containing 1 M of the sequencing primer p181(CGACAGCCGGAAGGAAGAGGGAGC) (SEQ ID NO: 18) overnight at room temperature. Controls without primer were kept in 5SSC 0.1% Tween 20 buffer. Glass slides were washed 2 times in SSSC 0.1% SDS at 37C for 5 and rinsed in SSSC. Primer p181 can hybridize to template B and the sequence following p1B1 is CAGCT . . . . In order to facilitate focusing, green fluorescent beads have been adsorbed to the bottom of the well by incubating each well with 20 l of a 1/2000 dilution of 200 nm yellow/green fluorescent, streptavidin coated FluoSpheres() (Molecular Probes, Eugene, Oreg.) in SX SSC for 20 at room temperature.
(94) After hybridization with the primer, 2 l of a solution containing 0.1% BSA, 6 mM dithiotreitol (Sigma Chemicals), 5 M Cy5-dCTP or 5 M Cy5-dUTP (Amersham, UK) and 1 Sequenase reaction buffer is added to each slide. The addition of the Cy5-nucleotide is initiated with the addition of 1.3 unit of T7 Sequenase DNA polymerase (Amersham, UK) for two minutes at room temperature. The wells are washed 2 times in 5SSC/0.1% SDS bath for 15 and rinsed with 5SSC buffer.
(95) The samples are observed using an inverted microscope (Axiovert S100TV, Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512768 CCD camera and Winview software (Princeton Instruments, Trenton, N.J.). For focusing, a 20 objective and a XF 22 filter set (Omega Optical, Brattleboro, Vt.) were used, and for observing Cy5 incorporation on the samples, a 20 objective and a XF47 filter set (Omega Optical) with a 50 second exposure using a 22 pixel binning. The yellow/green FluoSpheres (approximately 100/field of view) do not give a detectable signal using the XF47 filter set and 50 second exposure (data not shown). The photos are generated by the program, Winview (Princeton Instruments).
(96)
Example 6
5 mRNA Sequence Tag Analysis
(97) The most accurate way to monitor gene expression in cells or tissues is to reduce the number of steps between the collection of the sample and the scoring of the mRNA. New methods for rapidly isolating mRNA are commercially available. The most efficient methods involve the rapid isolation of the sample and immediate disruption of cells into a solution of guanidinium hydrochloride, which completely disrupts proteins and inactivates RNAses. This is followed by the purification of the mRNA from the supernatant of the disrupted cells by oligo-dT affinity chromatography. Finally, 5-capped mRNA can be specifically targeted and transformed into cDNA using a simple strategy (SMART cDNA synthesis, Clontech, Palo Alto).
(98) This method allows the synthesis of cDNA copies of only the translationally active, 5-capped mRNA. By combining the above rapid methods of mRNA isolation and cDNA preparation with the grafted-template method of DNA colony generation described in the present application, we have an approach for the high-throughput identification of a large number of 5 mRNA sequence tags. The advantage of our invention is the possibility to sequence a large number of cDNA by directly grafting the product of the cDNA synthesis reaction, amplifying the cDNA into thousands of copies, followed by the simultaneous in situ sequencing of the cDNAs.
(99) Materials and Methods:
(100) Synthetic oligonucleotides and plasmidsOligonucleotides were synthesized with 5-phosphates by Eurogentec or Microsynth. Plasmids containing partial coding and 3-untranslated sequences of the murine potassium channel gene, mSlo, following the T3 RNA polymerase promoter were generated by standard methods.
(101) mRNA synthesismSlo plasmids were linearized at a single SalI or SacI restriction nuclease site following the poly A+ sequence in the plasmid. After treatment of the cut plasmid with proteinase K, linear plasmid DNA was extracted once with phenol/CH.sub.3Cl/isoamyl alcohol and precipitated with ethanol. The DNA precipitate was re-dissolved in H.sub.2O at a concentration of 10 g/l. Synthetic mRNA capped with the 5-methylguanosine were synthesized by the mMessage mMachine in vitro mRNA synthesis kit as per manufacturer instructions (Ambion, Austin Tex.). Synthetic mRNA was stored at 80 C.
(102) EnzymesRestriction enzymes were obtained from New England Biolabs (Beverly, Mass.).
(103) cDNA synthesisSynthetic mRNA was mixed with mouse liver poly A+ mRNA at different molar ratios (1:1, 1:10, 1:100) and cDNA synthesis on the mixture of synthetic and mouse liver mRNA was performed using the SMART PCR cDNA synthesis kit {Clontech, Palo Alto Calif.) with some minor modifications. In a cDNA reaction, approximately 1 g of the mRNA mixture was mixed with the primer CPS, having at the 5 -end the sequence of CP, (5p-AGAAGGAGAAGGAAAGGGAAAGGGTTTTTTTTTTTTTTTTNN) (SEQ ID NO:9). This primer has been used to make the 1st strand cDNA synthesis. For the 2nd strand synthesis, the SMART technique has been used. The basis of the SMART synthesis is the property of the Moloney murine viral reverse transcriptase to add three to five deoxycytosine residues at the 3-termini of first strand cDNA, when the mRNA contains a 5-methylguanosine-cap (SMART user 35 manual, Clontech, Palo Alto Calif.). A CP6 primer, which contains the sequence of CP plus AAAGGGGG at the 3 end, (5p-AGAAGGAGAAGGAAAGGGAAAGGGGG) (SEQ ID NO: 10) has been used for the 2nd strand cDNA synthesis. Buffer and SUPERSCRIPTII RNase H-reverse transcriptase from Moloney murine leukemia virus (Life Technologies, Ltd.) were used as described in the instructions and the reaction was carried out at 42 C. for 1 hr. The cDNA was assayed by PCR using the primer p251, which contains a fragment of the CP sequence, (5-GAGAAGGAAAGGGAAAGG) (SEQ ID NO: 19) with Taq DNA polymerase (Platinum Taq, Life Technologies, Ltd.).
(104) DNA probes and hybridization.sup.32Biotinylated and .sup.32P-radiolabelled DNA probes specific for the mSlo DNA sequence were synthesized with a 5-biotinylated primer and a normal downstream primer by PCR on the template (mSlo plasmid DNA). The probe incorporated [.sup.32P]-dCTP (Amersham, Amersham UK) at a ratio of 300:1 ([.sup.32P]-dCTP to dCTP) in the PCR reaction, with a final concentration of the four deoxynucleoside triphosphates of 50 M. The resulting biotinylated and radiolabelled DNA probe was desalted over a Chromaspin-1000 column (Clontech, Palo Alto Calif.). The DNA probes were hybridized to the samples in easyhyb buffer (Boehringer-Mannheim, Germany), using the following temperature scheme (in the MTC200 thermocycler): 94 C. for 5 minutes, followed by 68 steps of 0.5 C. decrease in temperature every 30 seconds (in other words, the temperature is decreased down to 60 C. in 34 minutes), using sealed wells. The samples are then washed 3 times with 200 l of TNT at room temperature. The wells are then incubated for 30 minutes with 50 l TNT containing 0.1 mg/ml BSA (New England Biolabs, Beverly, Mass.). Then the wells are incubated 5 minutes with 15 l of solution of red fluorescent, streptavidin-coated, 40 nanometer microspheres (Molecular Probes, Portland, Oreg.). The solution of microspheres is made of 2 l of the stock solution of microspheres, which have been sonicated for 5 minutes in a 50 W ultra-sound water-bath (Elgasonic, Bienne, Switzerland), diluted in 1 ml of TNT solution containing 0.1 mg/ml BSA and filtered with Millex GV4 0.22 m pore size filter (Millipore, Bedford, Mass.).
(105) DNA colony visualizationThe stained samples are observed using an inverted Axiovert 10 microscope using a 20 objective (Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512768 CCD camera (Princeton instruments, Trenton, N.J.), using a PB546/FT580/LP590 filter set, and 10 seconds of light collection. The files are converted to TIFF format and processed in the suitable software (PhotoPaint, Corel Corp. Ltd, Dublin, Ireland). The processing consisted in inversion and linear contrast enhancement, in order to provide a picture suitable for black and white printout on a laser printer.
(106) Results
(107) Synthetic mRNA and cDNA SynthesisFollowing cDNA synthesis, the cDNA was checked in a PCR using the p251 primer (generated at each end of the first strand cDNA) for the correct lengths of products as assayed by agarose gel electrophoresis. The synthetic mSlo mRNA was diluted into the liver mRNA, which was evidenced by the decreasing intensity of the mSlo-specific band and the increase of a non-specific smear of liver cDNA.
(108) Detection and Quantification of DNA ColoniesDNA colonies were assayed using fluorescent imaging CCD microscopy or scintillation counting. The numbers of fluorescently detectable colonies increased as a function of the amount of grafted template, as shown in
(109) With radiolabelled probes it is possible to detect mRNA copies at about 1:100. But with fluorescent microscopic CCD imaging technology, one can detect mRNA to a dilution of 1:10000.
Example 7
Covalent Binding of Primer to the Solid Support (Plastic)
(110) Preparation of DNA coloniesThe 5p-cDNA was mixed with different concentrations of the solid phase colony primer, CP2 (5p-TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) (SEQ ID NO:6) and chemically bound to Nucleolink PCR tubes (NUNC) following manufacturer instructions. DNA colonies were then generated using Taq polymerase (AmpliTaq Gold, PE-Applied Biosystems Inc., Foster City Calif.) with 30 cycles (94C/30, 65C/1, 72C/1.5) in a MTC 200 thermo-cycler (MJ Research, Watertown, Mass.).
(111) Stability of Bound Oligonucleotides Under PCR Colony Generation Conditions
(112) Oligonucleotide primers were attached onto Nucleolink plastic microtitre wells (Nunc, Denmark) in order to determine optimal coupling times and chemistries. Oligonucleotides; CP2 (5-(phosphate)-TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) (SEQ ID NO:6), CP8(5 (aminohexamethylene)-TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) (SEQ ID NO:6), CP9 (5 (hydroxyl)-TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) (SEQ ID NO:6), CP10 (5 -(dimethoxytrityl)TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) (SEQ ID NO:6) and CP11 (5 (biotin)-TTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) (SEQ ID NO:6), (Microsynth GmbH, Switzerland), were attached to Nucleolink microtitre wells as follows (8 wells each); to each well 20 l of a solution containing 0.1 M oligonucleotide, 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals) and 10 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (pH 7.0) (Sigma Chemicals) in 10mM 1-methyl-imidazole. The wells were then sealed and incubated 50 C. for varying amounts of time. The coupling reaction was terminated at specific times by rinsing twice with 200 l of RS (0.4 N NaOH, 0.25% Tween 20) and twice with 200 l TNT (100 mM TrisHCl pH 7.5, 150 mM NaCl, 0.1% Tween 20). Tubes were dried at 50 C. for 30 and were stored in a sealed plastic bag at 4 C.
(113) Stability was tested under colony growing conditions by adding a PCR mix (20 l of four dNTPs (0.2 mM), 0.1% BSA, 0.1% Tween 20, 8% DMSO (dimethylsulfoxide, Fluka, Switzerland), IX PCR buffer). The wells were then placed in the thermocycler and for 33 repetitions under the following conditions: 94 C. for 45 seconds, 60 C. for 4 minutes, 72 C. for 4 minutes. After completion of this program, the wells were rinsed with 5SSC, 0.1% Tween 20 and kept at S C. until further use. Prior to hybridization wells are filled with 50 l 5SSC, 0.1% Tween 20 heated at 94 C. for 5 minutes and stored at RT. Probe: Oligonucleotide probes, R57 (5 (phosphate)GTTTGGGTTGGTTTGGGTTGGTG, control probe) (complement to SEQ ID NO:2) and R5S (5(phosphate)-CCCTTTCCCTTTCCTTCTCCTTCT (complement of DEQ ID NO:1), which is complementary to CP2, CPS, CP9, CP10 and CP11) were enzymatically labeled at their 5 end terminus with -.sup.32P dATP (Amersham, UK) using the bacteriophage T4 polynucleotide kinase (New England Biolabs, Beverly, Mass.). Excess 32P d.ATP was removed with a Chroma Spin column TE-10 (Clontech, Palo Alto Calif.). Radiolabeled oligonucleotides (0.5 Min SSSC, 0.1% Tween 20) were then hybridized to the oligonucleotide derivatized Nucleolink wells at 37 C. for two hours. The wells were washed 4 times with 5SSC, 0.1% Tween 20 at room temperature, followed by a wash with 0.5SSC, 0.1% Tween 20 for 15 at 37 C. Wells were then assayed for bound probe by scintillation counting.
(114) Results
(115) There is a marked difference in the rate and specificity of oligonucleotide coupling depending on the nature of 5-functional group on the oligonucleotide. Oligonucleotides carrying the 5-amino group coupled approximately twice as fast as oligonucleotides functionalized with a 5-phosphate group (see Table 2 and
(116) TABLE-US-00004 TABLE 2 5- 5- 5- 5- 5- phosphate amino hydroxyl DMT biotin Ka 0.0068 0.0135 0.0063 0.0070 0.0068 (min-1) Attached 608 1344 542 602 650 oligo- nucleotide (fmol/well) PCR 56 69 66 66 62 stability (% remaining)