MUTANT STRAINS OF STAPHYLOCOCCUS AUREUS WITH MULTIPLE INACTIVATED TCS SYSTEMS

Abstract

Novel strains of Staphylococcus aureus and uses thereof. The invention provides mutant strains of S. aureus devoid of all non-essential two-component signal systems (TCSs) and even the essential walKR system, the intermediate mutants devoid of a number of TCSs and their uses as research and biotechnological platform. The mutants devoid of all non-essential TCSs are viable, stable under laboratory growing conditions, genetically manageable and capable to express heterologous proteins. Having them allows individual analysis and targeting of each TCS, its individual complementation and obtaining information about the sensing systems that can be useful for biotechnological applications based or directed to S. aureus, such as the identification of novel antimicrobials.

Claims

1. A mutant strain of Staphylococcus aureus (S. aureus), wherein the mutant strain of S. aureus is devoid of all TCS genes except for the gene corresponding to the response regulator (RR) of the walKR system, walR, and, also except for the gene corresponding to the histidine kinase (HK) of the walKR system, walK.

2. Mutant strain of S. aureus according to claim 1, wherein the genes corresponding to the response regulator and the histidine kinase of the walKR system, walR and walK, are operatively linked to an inducible promoter.

3. Mutant strain of S. aureus according to claim 1, wherein walR is ectopically expressed, in a constitutive or in an inducible manner.

4. A mutant strain of S. aureus, wherein any combination of at least two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen or fifteen or sixteen two component signal systems (TCSs) selected from the following group, have been deleted or inactivated: yhcSR; the TCS comprised of the components HK and RR expressed either i) by the genes MW0199-MW0198 of S. aureus strain MW2 (tcs3), or ii) by the genes SAOUHSC_00185-SAOUHSC_00184 of S. aureus strain 8325 (tcs3), or iii)by their corresponding orthologous genes of another S. aureus strain; lytSR, graRS; saeRS; the TCS comprised of the components HK and RR expressed either i) by the genes MW1207-MW1208 of S. aureus strain MW2 (tcs7), or ii) by the genes SAOUHSC_01313-SAOUHSC_01314 of S. aureus strain 8325 (tcs7), or iii) by their corresponding orthologous genes of another S. aureus strain; hssRS; nreBC; braRS; kdpDE; vraSR; phoPR; arlRS; agr; srrAB, and walKR.

5. Mutant strain of S. aureus according to claim 4, which also lacks the kdpED-like TCS of some SCC-mec element.

6. Mutant strain of S. aureus according to claim 1, which is a mutant of a methicillin-resistant S. aureus strain.

7. Mutant strain of S. aureus according to claim 1, which is a mutant of the MW2 strain or a mutant of the 8325 strain.

8. Mutant strain of S. aureus according to claim 1, wherein all the following two-component signal systems are deleted: yhcSR; the TCS comprised of the components HK and RR expressed either i) by the genes MW0199-MW0198 of S. aureus strain MW2 (tcs3), or ii) by the genes SAOUHSC_00185-SAOUHSC_00184 of S. aureus strain 8325 (tcs3), or iii) by their corresponding orthologous genes of another S. aureus strain; lytSR, graRS; saeRS; the TCS comprised of the components HK and RR expressed either i) by the genes MW1207-MW1208 of strain MW2 (tcs7), or ii) by the genes SAOUHSC_01313-SAOUHSC_01314 of S. aureus strain 8325 (tcs7), or iii) by their corresponding orthologous genes of another S. aureus strain; hssRS; nreBC; braRS; kdpDE; vraSR; phoPR; arlRS; agr; and srrAB.

9. Mutant strain according to claim 1, which is devoid of all TCS except for walKR.

10. Mutant strain of S. aureus according to claim 7, which is the mutant of the MW2 strain deposited in the Spanish Type Culture Collection with the accession number CECT 8756, or the mutant of the 8325 strain deposited in the Spanish Type Culture Collection with the accession number CECT 8755.

11. Mutant strain of S. aureus according to claim 1, wherein the chromosome genes corresponding to the walKR TCS are operatively linked to a first inducible promoter and, WalR is expressed ectopically under the control of a constitutive promoter or a second inducible promoter.

12. Mutant strain of S. aureus according to claim 11, which is a mutant of the MW2 strain or a mutant of the 8325 strain and wherein the bacterial chromosome genes encoding proteins belonging to the walKR system are operatively linked to the inducible Pspac promoter, and all the following two-component signal systems are deleted from the chromosome: yhcSR; the TCS comprised of the components HK and RR expressed either i) by the genes MW0199-MW0198 of S. aureus strain MW2 (tcs3), or ii) by the genes SAOUHSC_00185-SAOUHSC_00184 of S. aureus strain 8325 (tcs3), or iii)by their corresponding orthologous genes of another S. aureus strain; lytSR, graRS; saeRS; the TCS comprised of the components HK and RR expressed either i) by the genes MW1207-MW1208 of strain MW2 (tcs7), or ii) by the genes SAOUHSC_01313-SAOUHSC_01314 of S. aureus strain 8325 (tcs7), or iii)by their corresponding orthologous genes of another S. aureus strain; hssRS; nreBC; braRS; kdpDE; vraSR; phoPR; arlRS; agr; and srrAB.

13. Mutant strain of S. aureus according to claim 12, which is the mutant of the MW2 strain deposited in the Spanish Type Culture Collection with the accession number CECT 8915, or the mutant of the 8325 strain deposited in the Spanish Type Culture Collection with the accession number CECT 8916.

14. Mutant strain of S. aureus according to claim 11, wherein a plasmid allowing the ectopic expression of WalR is present, in which plasmid WalR expression is under the control of a second inducible promoter or, preferably, under the control of a constitutive promoter.

15. Mutant strain of S. aureus according to claim 4, which is selected from the group of strains consisting of: a) the following mutants of the strain MW2: MW2 II (MW2 I tcs3): MW2 yhc tcs3 MW2 III (MW2 II MW2 yhc tcs3 lyt MW2 IV (MW2 III gra): MW2 yhc tcs3 lyt gra MW2 V (MW2 IV sae): MW2 yhc tcs3 lyt gra sae MW2 VI (MW2 V tcs7): MW2 yhc tcs3 lyt gra sae tcs7 MW2 VII (MW2 VI hss): MW2 yhc tcs3 lyt gra sae tcs7 hss MW2 VIII: (MW2 VII nre): MW2 yhc tcs3 lyt gra sae tcs7 hsss nre MW2 IX: (MW2 VIII Abra): MW2 yhc tcs3 lyt gra sae tcs7 hss re bra MW2 X (MW2 IX kdp): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra MW2 XI (MW2 X vra): MW2 yhc tcs3 lyt gra sae tcs7 hs re bra kdp MW2 XII (MW2 XI pho): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra vra pho MW2 XIII (MW2 XII MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra vra pho arl MW2 XIV (MW2 XIII agr): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra kdp vra pho arl agr MW2 XV (MW2 XIV srr): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra kdp vra pho arl agr srr or b) the following mutants of the strain 8325 8325 II (8325 I lyt): 8325 yhc lyt 8325 III (8325 II Agra): 8325 yhc lyt gra 8325 IV (8325 III sae): 8325 yhc lyt gra sae 8325 V (8325 IV tcs7): 8325 yhc lyt gra sae tcs7 8325 VI (8325 V tcs3): 8325 yhc lyt gra sae tcs7 tcs3 8325 VII (8325 VI arl): 8325 yhc lyt gra sae tcs7 tcs3 arl 8325 VIII (8325 VII srr): 8325 yhc lyt gra sae tcs7tcs3 arl srr 8325 IX (8325 VIII pho): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho 8325 X (8325 IX hss): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss 8325 XI (8325 X nre): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss nre 8325 XII (8325 XI bra): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss nre bra 8325 XIII (8325 XII vra): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss nre hva vra 8325 XIV (8325 XIII Nap): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss nre bra vra kdp agr. 8325 XV (8325 XIV agr): 8325 yhc lyt gra sae tcs7tcs3 arl srr pho hss nre bra vra kdp agr.

16. A mutant strain of S. aureus according to claim 1, which ectopically expresses one or both of the two components, histidine kinase (HK) and response regulator (RR), of a TCS selected from the group consisting of: yhcSR; the TCS comprised of the components HK and RR expressed either i) by the genes MW0199-MW0198 of S. aureus strain MW2 (tcs3), or ii) by the genes SAOUHSC_00185-SAOUHSC_00184 of S. aureus strain 8325 (tcs3), or iii) by their corresponding orthologous genes of another S. aureus strain; lytSR, graRS; saeRS; the TCS comprised of the components HK and RR expressed either i) by the genes MW1207-MW1208 of strain MW2 (tcs7), or ii) by the genes SAOUHSC_01313-SAOUHSC_01314 of S. aureus strain 8325 (tcs7), or iii) by their corresponding orthologous genes of another S. aureus strain; hssRS; nreBC; braRS; kdpDE; vraSR; phoPR; ar1RS; agr; srrAB, and walKR.

17. A method of using a mutant strain of S. aureus according to claim 1 comprising expressing a heterologous protein, a chimeric protein and/or a fusion protein.

18. A method of using a mutant strain of S. aureus according to claim 1 comprising identifying a candidate to living attenuated strain for vaccination purposes.

19. A method of using a mutant strain of S. aureus according to claim 1 comprising identifying compounds capable of inhibiting one or more TCSs.

20. The method according to claim 19, further comprising identifying candidates to antibiotics.

21. A method of using a mutant strain of S. aureus according to claim 1 comprising identifying promoters whose expression depends on environmental signals.

22. A method of using a mutant strain of S. aureus according to claim 1 for developing biosensor tracks for environmental signals.

23. A method of using a mutant strain of S. aureus according to claim 1 comprising using the mutant strain of S. aureus as platform or research tool.

24. The method according to claim 23, comprising studying S. aureus sensing system, the identification of the biological processes regulated by each individual TCSs, the possibilities of in vivo cross-talk among HKs and RRs each one belonging to different TCSs, the regulation of the expression of each TCSs, the inductor or inhibitor compounds affecting them, the possible influence of acting on different TCS in bacterial viability, the possible genes or systems that could complement the absence of the expression of a specific TCSs, the relation of each two-component with host-pathogen interactions including S. aureus cell adhesion, invasion, tissue colonization, pathogenicity and antibiotic-resistance capabilities and/or the development of S. aureus avirulent strains.

25. A method of using a mutant strain of S. aureus, wherein the mutant strain of S. aureus is a strain of claim 8.

26. The use method according to claim 21, wherein the phenotype of the used mutant strain is compared with the phenotype of a second mutant strain that differs from the first mutant strain in that it ectopically expresses: a. one or both of the two components, histidine kinase and response regulator, of a TCS selected from the group consisting of: yhcSR; the TCS comprised of the components HK and RR expressed either i) by the genes MW0199-MW0198 of S. aureus strain MW2 (tcs3), or ii) by the genes SAOUHSC_00185-SAOUHSC_00184 of S. aureus strain 8325, or iii) by their corresponding orthologous genes of another S. aureus strain; lytSR, graRS; saeRS; the TCS comprised of the components HK and RR expressed either i) by the genes MW1207-MW1208 of strain MW2 (tcs7), or ii) by the genes SAOUHSC_01313-SAOUHSC_01314 of S. aureus strain 8325, or iii)by their corresponding orthologous genes of another S. aureus strain; hssRS; nreBC; braRS; kdpDE; vraSR; phoPR; ar1RS; agr; srrAB; kdpED-like, and walKR; and/or b. any other polypeptide or groups of polypeptides, or any other gene product.

27. The method according to claim 26, wherein at least one of the polypeptides of option b comprises a fragment with the amino acid sequence of a reporter, selection marker or labelling protein.

28. A method for identifying a compound as a blocker or inactivator of the walKR system which comprises the steps of: a) culturing a mutant strain of S. aureus of claim 1 under conditions wherein the WalKR system should be expressed, b) comparing the growth rate of the mutant strain in the presence of the compound with the growth rate in the absence of the compound, c) identifying the compound as a blocker or inactivator of the WalKR system when the growth rate is reduced in the presence of the compound, d) checking whether the compound is a specific blocker of the expression of the walKR system by verifying that the reduction of the growth rate is observed when the strain or strains cultured in the presence of the compound is a S. aureus wild type strain and it is not observed when the strain of strains cultured in the presence of the compound is a S. aureus strains wherein the walKR system is expressed under the control of a promoter that is different from the natural one and that gives rise to the expression of walKR under the culture conditions of step a) and b), e) verifying that the blocking or inactivation cannot be reverted by the expression of another TCSs or by a combination of TCSs by checking that the reduction of the growth rate is not reverted when the strain or strains cultured in the presence of the compound is any one of the mutant strains of claim 1, the parental strain corresponding to the mutant strain used in step a), and/or any other wild type strain, f) additionally, identifying the compound as a candidate to antimicrobial compound when step d) has been carried out and the reduction of the growth rate is not reverted at least in the parental strain or any other wild type strain.

29. A method for identifying physical or chemical signals sense by two-component systems in assays wherein the expression of a reporter gene under the control of a promoter regulated by a two-component system is compared with the phenotype of the same mutant strain except for that it ectopically expresses a TCS selected from the group consisting of: yhcSR; the TCS comprised of the components HK and RR expressed either i) by the genes MW0199-MW0198 of S. aureus strain MW2 (tcs3), or ii) by the genes SAOUHSC_00185-SAOUHSC_00184 of S. aureus strain 8325 (tcs3), or iii)by their corresponding orthologous genes of another S. aureus strain; lytSR, graRS; saeRS; the TCS comprised of the components HK and RR expressed either i) by the genes MW1207-MW1208 of strain MW2 (tcs7), or ii) by the genes SAOUHSC_01313-SAOUHSC_01314 of S. aureus strain 8325 (tcs7), or iii)by their corresponding orthologous genes of another S. aureus strain; hssRS; nreBC; braRS; kdpDE; vraSR; phoPR; arlRS; agr; srrAB; kdpED-like, and walKR.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0040] FIG. 1. Organization of the 16 S. aureus TCSs. Domain organization and topology of the 16 S. aureus histidine kinases and response regulators. Domains are based on NCBI Conserved Domain search and transmembrane helix (TMH) domains are predicted by TMHMM Server v. 2.0. HKs are classified based on their DHp domain and RRs are classified based on their output domain. Black boxes correspond to the domains where the phosphorylable histidines (represented by P letters rounded by circles): the histidine phosphotransfer domains of Histidine Kinases and the receiver domains of the Response Regulators. The vertical band on the right of the histidine kinases names represents the cell membrane, and the dark boxes perperdicular to it correspond to transmembrane helix domains.

[0041] FIG. 2. Schematic circular representation of the S. aureus MW2 XV genome sequence, based on Illumina Next Generation Sequencing. The most internal circle is the positive chain of the circular genome. Peaks protruding from the intermediate circumference represent the GC content. The external circumference, drawn with a wider line, is intended to represent the results of the BlastN analysis of MW2 XV vs MW2 wild type, so that the fifteen white lines interrupting the circumference represent the position of the fifteen TCS deletions, and arrows mark the positions of the SNPs produced spontaneously during the mutagenesis process in MW2 (darker arrows, red in the original) and 8325 strains (lighter arrows, light blue in the original, and marked with asterisks). The two collections of arrowheads surrounded by the most external circumference indicate the sense of transcription of the operons: clockwise in the case of the most external collection and anticlockwise in the case of the most internal collection of arrowheads.

[0042] FIG. 3. Phenotypic analyses of S. aureus MW2 and 8325 wild type strains and their corresponding XV. [0043] Panels A, B, C: Photographs of agar plates with surviving bacteria after overnight incubation at 37 C. (panel A), 28 C. (panel B), 44 C. (panel C). Dilutions of inoculation (from top to bottom): sample of overnight non-diluted culture (top), and dilutions 10.sup.2, 10.sup.4, 10.sup.6 (bottom plates). [0044] Panel D: Metabolic pattern of wild type (WT) and XV mutant according to API Staph galleries. Arrows indicate the position of the metabolic assays where differences between wild type and XV mutants appear. [0045] Panel E: Bar charts representing the desiccation tolerance after 21 days, indicated as the survival percentage after overnight culturing (initial numbers) and air-drying, storing at room temperature, rehydration and determination of remaining viable cells. [0046] Panel F: Photographs of S. aureus strains MW2, MW2 XV, 8325 and 8325 XV, as indicated, growing on Triton X-100 concentration gradient plates. [0047] Panel G: Analysis of Protein A expression by Western blotting.

[0048] FIG. 4. Phenotypic analyses of interaction with cells of the MW2 and MW2 XV strains. [0049] Panels A and B: (A) Adhesion and (B) invasion of S. aureus MW2 wild type and XV mutant to human hepathocytes (Hep3B) and human lung epithelial cells (A549). Bar charts representing the logarithm of the colony forming units (CFU) counted after an adhesion assay to cells seeded in wells (panel A) and 1 hour infection, or after gentamicin assay (panel B). [0050] Panels C and D. Seven mice per group were infected with 10.sup.7 cfu of bacteria by eye vain injection. Kidneys were removed aseptically and homogenized in PBS for enumeration of viable bacteria. Bacterial load, expressed as logarithm of CFUs, is represented in panel D for each mouse. [0051] Panel E. Percentage of mice survival depending of the days after infection with 10.sup.7 cfu of bacteria by eye vain injection. Survival was monitored every day for 7 weeks.

[0052] FIG. 5. Phenotypic analyses of S. aureus MW2 wild type strain and the mutant strains XV and XVI*. [0053] Panels A, B, C: Photographs of agar plates with surviving bacteria after overnight incubation at 37 C. (panel A), 28 C. (panel B), 44 C. (panel C). Dilutions of inoculation (from top to bottom): sample of overnight non diluted culture (top), and dilutions 10.sup.2, 10.sup.4, 10.sup.6 (bottom plates). In Panel A, comparisons of the growth of the XVI strain complemented with an empty plasmid (XVI, third column), complemented with the plasmid pEl walR (strain XVI*: fourth column) . [0054] Panel D: Metabolic pattern of wild type (WT) MW2 strain and XV and XVI* mutants according to API Staph galleries. The arrow indicates the position of the metabolic assay where differences between wild type and mutants appears. [0055] Panel E: Bar cha representing the desiccation tolerance after 21 days, indicated as the survival percentage after overnight culturing (initial numbers) and air-drying, storing at room temperature, rehydration and determination of remaining viable cells. [0056] Panel F: Photographs of S. aureus strains MW2 WT, MW2 XV and MW2 XVI*, as indicated over the photographs, growing on Triton X-100 concentration gradient plates. [0057] Panel G: Analysis of Protein A expression by Western blotting in S. aureus strains MW2 WT, MW2 XV and MW2 XVI* .

[0058] FIG. 6. Phenotypic analyses of S. aureus MW2 sequential TCS mutants (I) (number of mutant indicated over each corresponding column) and single TCS mutants (II) of the MW2 strains. [0059] Panel A. Nitrate reduction capacity under low oxygen concentration: colorimetrical determination of extracellular nitrite concentrations by the Griess Reagent System. The arrows indicate the position of the sequential mutant where the purple/magenta coloration becomes lighter, almost pink (part I) or the single TCS mutant showing a lighter coloration than the others (part II). [0060] Panel B. Bacterial growth at 28 C. on agar plates of decreasing serial dilutions (not diluted, 10.sup.2, 10.sup.4 and 10.sup.6) of the MW2 wild type and mutant strains. [0061] Panel C. Growth phenotype on Triton X-100 concentration gradient plates. [0062] Panel D. Analysis of Protein A expression by Western blotting

[0063] FIG. 7. Complementation of phenotypes in single and XV mutant strains by ectopic expression of a single TCS from expression plasmids. [0064] Panel A. Nitrate reduction capacity under low oxygen concentration: colorimetrical determination of extracellular nitrite concentrations by the Griess Reagent System. It can be seen that expression of nreBC in both the single nreBC mutant (third plate from the left, labelled nreBC pEl nreBC) and the XV mutant (fifth plate from the left, labelled XV pEl nreBC) is sufficient to recover the purple/magenta coloration that is lighter (single mutant with an empty plasmid, nreBC pEl) or absent (XV mutant with an empty plasmid, XV pEl) in the corresponding mutant not expressing nreBC. [0065] Panel B. Bacterial growth at 28 C. on agar plates of decreasing serial dilutions (not diluted, 10.sup.2, 10.sup.4) of the MW2 wild type, transformed with an empty pEl plasmid, mutant strains srrAB and XV transformed either with a pEl empty plasmid (second and fourth column) or with a pEl plasmid expressing the TCS nreBC (third and fifth column). [0066] Panel C. Bacterial growth on Triton X-100 concentration gradient plates. Assayed strains: MW2 wild type transformed with an empty pEl plasmid, mutant strains vraSR and XV transformed either with a pEl empty plasmid (second and fourth column) or with a pEl plasmid expressing the TCS vraSR (third and fifth column). [0067] Panel D. Analysis of Protein A expression by Western blotting. Assayed strains: MW2 wild type transformed with an empty pEl plasmid, mutant strains arlRS and XV transformed either with a pEl empty plasmid (second and fourth column) or with a pEl plasmid expressing the TCS arlRS (third and fifth column).

[0068] FIG. 8. Complementation of the single and XV mutant strains with the RR alone or in combination with the cognate HK. [0069] Panel A. Nitrate reduction capacity under low oxygen concentration: colorimetrical determination of extracellular nitrite concentrations by the Griess Reagent System. Assayed strains: MW2 wild type transformed with an empty pEl plasmid, mutant strains nreBC and XV transformed either with a pEl empty plasmid (second and fifth column) or with a pEl plasmid expressing the RR nreC alone (third and sixth column) or also complemented with its HK nreB (fourth and seventh column). It can be seen that expression of nreC alone in both the single nreBC mutant and the XV mutant gives rise to the same color that the single mutant with the empty vector, the intense purple/magenta coloration being recover in both mutants expressing the RR and the HK of the TCS nreBC. [0070] Panel B. Bacterial growth at 28 C. on agar plates of decreasing serial dilutions (not diluted, 10.sup.2, 10.sup.4) of the MW2 wild type, transformed with an empty pEl plasmid, mutant strains srrAB and XV transformed either with a pEl empty plasmid (second and fifth column), with a pEl plasmid expressing the RR srrA alone (third and sixth column) or also complemented with the HK srrB (fourth and seventh column). [0071] Panel C. Growth phenotype on Triton X-100 concentration gradient plates. Assayed strains: MW2 wild type, transformed with an empty pEl plasmid, mutant strains vraSR and XV transformed either with a pEl empty plasmid (second and fifth column), with a pEl plasmid expressing the RR vraS alone (third and sixth column) or also complemented with the HK vraR (fourth and seventh column). [0072] Panel D. Analysis of Protein A expression by Western blotting. Assayed strains: MW2 wild type, transformed with an empty pEl plasmid, mutant strains arlRS and XV transformed either with a pEl empty plasmid (second and fifth column), with a pEl plasmid expressing the RR arlR alone (third and sixth column) or also complemented with the HK ar/S (fourth and seventh column)

[0073] FIG. 9. System-based analysis of cross-talk in vivo. Analysis of Protein A expression by Western blotting on the following strains: [0074] Panel A: Single arlRS mutant strain complemented with arlR, arlR D52A, arlRS and arlRS H242A [0075] Panel B: XV strain complemented with the set of plasmids containing arl RR combined with the 16 HKs. Note that GraS, apart from ArlS, is able to complement arlR-dependent protein A expression [0076] Panel C: XV strain complemented with arlR or non-phosphorylatable arlR D52A combined with ArlS or GraS. Note that phospho-transfer is necessary for arlR-dependent protein A activation by GraS [0077] Panel D: Single arlRS, double A arlRSgraRS and XV mutant strains complemented with arlR. Note that cross-talk dissappears in the absence of graRS [0078] Panel E: Single arlRS and double arlRSgraRS strains complemented with the arlR or arlR D52A in the presence or absence of 50 g/ml of colistin. Note that colistin activates arlR-dependent protein A.

[0079] FIG. 10. Expression of the Bap-CIfA chimeric protein in MW2 wild type and MW2 XV strains. [0080] Panel A: Schematic representation of the Bap-CIfA chimeric protein present in the plasmid pEl-BapB_SNAPtag, which chimeric protein containing the N-terminal region of S. aureus Bap protein (BapB), the C-terminal region of clumping factor A (CIfA) and a tag named SNAP (SNAPtag) located between them and that allows the fluorescent labelling of the chimeric protein. [0081] Panel B: Schematic representation of the location of the chimeric protein on the bacterial surface and the fluorophore marker (SNAP_Surface488) which interacts with the SNAP peptide. [0082] Panel C: Photographs obtained by fluorescence microscopy of an S. aureus MW2 parenteral strain (first row) or its isogenic mutant MW2 XV (second row) expressing the Bap-CIfA chimeric protein on their surfaces. The expression of the protein is visualized by means of the SNAP_Surface488 fluorophore marker. [0083] Panel D: Detection of the Bap-CIfA chimeric protein in SDS-PAGE gels in S. aureus strains MW2 and XV complemented with an empty pEl plasmid (left lane in each pair of lanes corresponding to each strain) or with the plasmid pEl-BapB_SNAP containing the coding sequence of the Bap-CIfA chimeric protein. [0084] Panel E: Photographs showing the aggregation phenotype associated to the absence (first two tubes starting from the left side) or presence (last two tubes of the series) of the expression of the Bap-CIfA chimeric protein, in the MW2 (first tube in each pair) or the XV (second tube in each pair) strain.

[0085] FIG. 11. Photographs of Petri plates inoculated with an S. aureus MW2 parental strain (first row) or its isogenic mutant MW2 XV (second row), in which strains the walKR operon is under Pspac control. Bacteria were first incubated for 24h in the presence of chloramphenicol (Col) and IPTG as indicated and then they were incubated in new agar plates for 12h in the presence or absence of chloramphenicol and IPTG as indicated.

DETAILED DESCRIPTION OF THE INVENTION

[0086] The present invention relates, among others, to a mutant Staphylococcus aureus strain which is devoid of all TCSs not essential for viability, since all of them have been mutated so that they have been inactivated; the examples of the present application disclose particular embodiments of such mutant strains where the inactivation has been achieved by sequential deletion of the TCSs. The invention also relates to a mutant S. aureus strain completely devoid of TCSs, where the expression of the RR of the TCS walKR is maintained, because the walKR system is essential for growth of S. aureus bacteria. The intermediate mutants generated for obtaining said two previously mentioned mutant strains are also encompassed by the scope of the present invention. The use of the S. aureus mutant strains provided by the present application, particularly as research tools and/or as platforms for biotechnological applications such as the expression of heterologous proteins or the identification of candidates to antimicrobial agents from compounds capable to modulate or inactivate specific TCS, are also part of the present invention.

[0087] The present invention represents an approach completely different from the strategies followed until now for the study of the TCSs and their usefulness for biotechnological applications such as using them as targets for the identification and development of antimicrobial drugs, the expression of heterologous proteins, either constitutively or under the control of a specific environmental signal, and as a bacterial suicide or programme cell death control by the absence of IPTG or another induction system. Instead of aiming to infer the functions that each TCS perform from the phenotypes shown by strains where an individual TCS is mutated, without taking into account possible compensatory effects or interferences with the remaining members of S. aureus sensing system, the present inventors have decided to take advantage of the moderate complexity of the TCS signaling in S. aureus and have conceived and put into practice a reductionist approach: they have generated a strain that is completely devoid of TCS signaling system and used it to investigate the consequences that the removal of the complete TCS sensorial network has for the bacteria, as well as the biotechnological applicability of such mutant and of the intermediate mutants necessary for obtaining it.

[0088] The removal was done in two steps: [0089] First, all non-essential TCS (fifteen in the case of the specific examples shown in the present application) were sequentially deleted from the chromosome for inactivating them. The obtained mutant received the generic denomination XV because the process was carried out using strains lacking the kdpED-like system, so that they contain fifteen non-essential TCSs. The present invention is also compatible with the use as starting strains of S. aureus strains also expressing the kdpED-like system but, in such strains, obtaining a mutant strain lacking all non-essential TCS implies the additional inactivation of the kdpED-like system, thus being sixteen the inactivated TCSs. Therefore, the mutant strains of S. aureus wherein the following TCSs have been deleted or inactivated: yhcSR; the TCS comprised of the components expressed either i) by the genes MW0199-MW0198 of S. aureus strain MW2 (tcs3), or ii) by the genes SAOUHSC_00185-SAOUHSC_00184 of S. aureus strain 8325 (tcs3), or iii) by their corresponding orthologous genes of a another S. aureus strain; lytSR; graRS; saeRS; the TCS comprised of the components expressed either i) by the genes MW1207-MW1208 of strain MW2 (tcs7), or ii) by the genes SAOUHSC_01313-SAOUHSC_01314 of S. aureus strain 8325 (tcs7), or iii) by their corresponding orthologous genes of another S. aureus strain; hssRS; nreBC; braRS; kdpDE; vraSR; phoPR; arlRS; agr and srrAB, and that additionally lack the kdpED-like two component signal system, either because it was not present in the wild-type strain used as starting point for obtaining the mutant strains or also because the kdpED-like was present in the wild-type strains but has been equally deleted or inactivated, are also encompassed within the scope of the present invention. [0090] Then, the expression of the remnant WalKR essential system was placed under the control of an inducible Pspac promoter, so that its expression is inducible by IPTG (1 mM). In the absence of IPTG, the strain lacks the sixteenth two-component systems (mutant strain XVI).

[0091] The strain can grow in the absence of IPTG when WalR is produced ectopically under the control of a constitutive promoter. Thus, the resulting strain lacks all the HKs and it contains a single RR. In the specific cases described in the present application, the resulting mutant can be named XVI*.

[0092] The term devoid of, as it is used in the present application, and applied to a particular TCS, means that the bacteria lack the genes, the component proteins (HK and RR) or the activity of said TCS. That is, a bacterium can be devoid of a particular TCS because the genes corresponding to the system are naturally not present in that strain, because said genes have been deleted, because said genes have been mutated so that they are not expressed (not transcribed or not translated) or even because they give rise to inactive proteins, because the corresponding proteins (HK and RR) are expressed but they are inactivated by means of (an) inhibitor(s) or because the bacterium is grown in conditions where the genes corresponding to said TCS are not expressed because they have been put under the control of (that is, they are operatively linked to) a promoter or any other control element that does not drive the expression of the genes of said TCS under such conditions. As all of such situations results in a loss of the activity of said TCS, in some points of the present application it has been considered that being devoid of a TCS can be used as having such TCS inactivated, so that being devoid of a TCS and having a TCS inactivated have been used as synonyms. Moreover, in the Examples of the present application, the process used for inactivating non-essential TCSs, as can be inferred from the explanation given above, has consisted of deleting them from the bacterial chromosome, so that, for most S. aureus mutated strains of the present invention, such as the strains named I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV and XV, deletion and inactivation can be considered synonyms.

[0093] Example 1 of the present application discloses the generation of two specific XV mutants, each one obtained from a different strain: MW2 and 8325. Therefore, for reasons of clarity in those assays where both mutant strains are used, each XV mutant is specifically denominated MW2 XV or 8325 XV in some locations of the present application, depending on the particular S. aureus strain used as starting point for its generation. As indicated above, the inactivation process used in Example 1 consisted of the sequential deletion of all 15 non essential TCS present in two particular S. aureus strains. As all S. aureus HK and RR pairs are located together, in the same operon, it is possible to define each step of the process as the deletion of a particular TCSs and defining each particular mutant strain obtained in each step with regard to the TCS or combination of TCSs deleted in such strains, as can be seen in the Examples section of the present application. An alternative way of defining the mutant strains obtained in each step is mentioning the specific genes deleted (or, in the general definition of the invention, inactivated), so that the mutant XV, for instance, can be also defined as a mutant strain of S. aureus characterized in that all the folllowing genes of the two-component signal systems are deleted or inactivated: the gene MW0199 of MW2 or the gene SAOUHSC_00020 of strain 8325 or their orthologous gene that encodes the sensor component of the analogous TCS in the corresponding parental strain; the gene MW0198 of MW2 or the gene SAOUHSC_00021 of strain 8325 or their orthologous gene that encodes the response component of the analogous TCS in the used S. aureus parental strain, lytS; lytR; graS; graR; saeS; saeR; the gene MW1207 of MW2 or the gene SAOUHSC_01313 of strain 8325 or their orthologous gene that encodes the sensor component of the analogous TCS in the used S. aureus parental strain; the gene MW1208 of MW2 or the gene SAOUHSC_01314 of strain 8325 or the orthologous gene that encodes the response component of the analogous TCS in the used S. aureus parental strain; arlS; arlR; srrB; srrA; phoR; phoP; yhcS; yhcR; vraS; vraR; agrC; agrA; kdpD; kdpE; hssS; hssR; nreB; nreC; braS; brag. As can be seen in said Examples section, each step of the process gives rise to a particular intermediate mutant, which mutants are generically named I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV and XV (wherein the Roman number indicates the number of the TCSs inactivated, by deletion or by other means, in the mutant with regard to the S. aureus parental strain) in accordance with the number of TCSs deleted in each case. Where clarification is needed, the specific mutants obtained from the strain MW2 or from the strain 8325 are distinguished by including the name of the parental strain before the indication of the number of genes deleted. Table 2 of the present application provides information about the specific genes to be deleted or inactivated in strains MW2 and 8325 in order to inactivate each particular TCS; additional information about the genes corresponding to the TCSs herein denominated tcs3 and tcs7 is also given in Example 1. Regarding possible mutants obtained from other parental strains, it must be pointed out that the genome of S. aureus is well conserved among different strains and isolates, so that the homology among orthologous proteins (proteins with the same function) is high among different strains, existing an homology of 90%-95% or higher among the proteins that are components of TCSs and play the same function in different strain. Therefore, one skilled in the art will find obvious to identify the gene that must be deleted/inactivated in each S. aureus strain in order to obtain S. aureus mutants of the present invention starting with S. aureus parental strains different from those used in the Examples of the present application, even if the genes and/or the corresponding TCSs have a name not mentioned in the present application: it should be a gene whose protein product has the same function as the protein product of one of the above mentioned genes (a histidine kinase or a response element of a specific TCS) and an homology of at least 90% is expected with regard to the corresponding protein expressed by the strain MW2 or 8325 from the corresponding gene mentioned in Table 2 above, which will be the corresponding orthologus gene as the term is used in the present application.

[0094] The information provided in Example 1 shows that the TCS have not been deleted in the same order for the generation of the mutants derived from MW2 or from the 8325 parental strain, because the present invention is compatible with the deletion of the non-essential TCS in any order. Thus, each one of the intermediate mutants II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV, and XV (wherein the Roman number indicates the number of non-essential TCSs inactivated, by deletion or by other means, in the mutant with regard to the S. aureus parental strain), are also comprised within the scope of the present invention and are an aspect of said invention. Embodiments of specific interest are those derived from the strain MW2 or the strain 8325, whose obtaining process is described in Example 1, mentioning the specific combination of TCSs deleted in each mutant. Also embodiments of particular interest are the IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV and XV mutants, particularly those derived from the MW2 or 8325 parental strains disclosed in the present application, among other reasons, because obtaining mutants with such number of deleted TCS requires a considerable amount of time and resources and the generation of such mutants had not been previously considered either for studies related to the functioning or possible interactions of the TCSs themselves or for other biotechnological applications.

[0095] Although the S. aureus mutant strains I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV and XV whose generation is described in the present application have been obtained by a process of sequential deletion of non essential TCSs starting from a parental strain (MW2 or 8325), the present invention is compatible with the use of any other inactivation techniques known for those skilled in the art for obtaining the inactivation for each one of the non essential TCS, such as the interruption of the genes corresponding to the sensor and the cytoplasmic response regulator, mutations in said genes giving rise to inactive proteins, mutations in the corresponding promoter making unable the synthesis of the corresponding mRNAs . . . Also compatible with the present invention, and included within the scope of the same, is the situation where the inactivation of one or a combination of TCSs is conditional, because the operon/s corresponding to one or more TCSs is expressed under the control of a regulatory element, such as a promoter, which is active only under particular conditions, such as it is disclosed in the present application for obtaining the sense devoid S. aureus mutant XVI*, wherein the walKR operon was placed under the control of the inducible Pspac promoter, the expression of walKR being inhibited in such mutant in the absence of alolactose or an analogue of alolactose capable of triggering the transcription of the lac operon, such as IPTG (isopropyl--D-1-thiogalactopyranoside). A multiplicity of promoters with similar characteristics, also compatible with the present invention, are well known, such as the tetracycline (Bateman et al., 2001), cadmiun (Charpentier et al., 2004) and xylose (Kim et al., 1996) inducible promoters. Where the inactivation of several TCSs is made conditional in an individual mutant, all TCSs can be under the control of a control element responding to the same conditions (under the control of the same promoter, for instance) or each TCS can be under the control of a promoter that is active under conditions that are different from those activating other promoters controlling other TCSs, so that the number of TCS activated in a particular assay can be chosen selecting a particular combination of conditions, each one regarding a particular promoter.

[0096] The group of the present inventors carried out the deletion process described below in the section of Examples of the present application using as parental strains (the starting strains), two genetically unrelated strains: MW2 and 8325. MW2 is a community-acquire MRSA strain (deposit number in the American Type Culture Collection ATCC BAA-1707) and 8325 (deposit number in the National Collection of Type Cultures NCTC 8325) is a laboratory strain, that is still sensible to standard antibiotics such as methicillin. The use of genetically unrelated strains allows comparing the phenotypes caused by the sequential mutation of TCS in both XV strains. This strategy is time-consuming but necessary when using reductionist approaches because complementation of the final strain to restore the phenotypes is technically not possible.

[0097] Both parental S. aureus strains, MW2 and 8325, lack the kdpED-like system, so that they are known to contain 16 TCSs and to have 15 non-essential TCSs. Also strains such as S. aureus Newman (PATRIC Genome ID:426430, GenBank Accession AP009351 version AP009351.1 Gl:150373012), S. aureus JH1 (PATRIC Genome ID:359787.11, GenBank Accession CP000736 version CP000736.1 Gl:149944932), S. aureus JH9 (PATRIC Genome ID:359787.11, GenBank Accession CP000703 version CP000703.1 Gl:147739516), S. aureus Mu50 (PATRIC Genome ID:158878.14, GenBank Accession NC_002758 version NC_002758.2 Gl:57634611), S. aureus N315 (PATRIC Genome ID:158879.11, GenBank Accession NC_002745 version NC_002745.2 Gl:29165615) and S. aureus COL (PATRIC Genome ID:93062.19, GenBank Accession NC_002951 version NC 002951.2 Gl:57650036), whose genome are completely sequenced on 21 Aug. 2015 and are known to have 16 TCSs, are suitable parental strain. Also any other S. aureus strain cited in the section of the web site of PATRIC (Pathosystems Resource Integration Center) corresponding to S. aureus genome list (https:/www.patricbrc.org/portal/patric/GenomeList?cType=taxon&cld.1279 &displayMode=Complete&dataSource===PATRIC&pk=) or any other S. aureus strain, can be a suitable parental strain among others. In general, the use of parenteral S. aureus strains with 16 TCSs for the generation of the mutant strains of the present invention I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV, XV and XVI is a suitable option for the purposes of the present invention. As commented above, the use of parenteral S. aureus strains with 17 TCSs is also compatible with the present invention, and the mutant strains generated from such parental strains wherein at least one or two, three, four five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen or sixteen non-essential TCS are deleted or, in general, inactivated, rendering the strain devoid of such non-essential TCS, are also comprised within the scope of the present invention. Therefore, also comprised within the scope of the present invention is any mutant S. aureus strain wherein any combination of at least two, three, four five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen or fifteen two component signal systems selected from the group of yhcSR; the TCS comprised of the components expressed either i) by the genes MW0199-MW0198 of S. aureus strain MW2 (tcs3), or ii) by the genes SAOUHSC_00185-SAOUHSC_00184 of S. aureus strain 8325 (tcs3), or iii) by their corresponding orthologous genes of a another S. aureus strain; lytSR; graRS; saeRS; the TCS io comprised of the components expressed either i) by the genes MW1207-MW1208 of strain MW2 (tcs7), or ii) by the genes SAOUHSC_01313-SAOUHSC_01314 of S. aureus strain 8325 (tcs7), or iii) by their corresponding orthologous genes of another S. aureus strain; hssRS; nreBC; braRS; kdpDE; vraSR; phoPR; arlRS; agr; srrAB, are deleted or inactivated, as well as any of said mutants which lacks the kdpED-like TCS, either because its parental strain naturally lacks it or because the kdpED-like system has been also deleted or inactivated, so that the mutant strain lacks the expression of such system.

[0098] The S. aureus mutants of the present invention having been generated from parental strains naturally having the kdpED-like system are an embodiment of the present invention that can be of particular interest for certain applications, particularly those related to the identification of potential antimicrobial compounds effective against S. aureus, because the kdpED-like system is carried by some methicillin resistant strains.

[0099] The XV mutants whose generation is disclosed in the present application, as previously commented, have been generated using as parental S. aureus strains, MW2 and 8325, which lack the kdpED-like system, so that said XV mutants are devoid of all non-essential TCSs. The analysis of the complete genome sequenced of both XV mutants did not reveal the presence of common polymorphisms compared to their corresponding wild type parental strains, indicating that the deletion process had no selected for compensatory mutations and both mutants were appropriate for any complementation study as those disclosed in the present application.

[0100] Subsequently, the XV mutant was used to generate a derivate also devoid of the WalKR system, using in this case the approach of placing the walKR operon under the control of an inducible promoter, Pspac, so that the walKR TCS is inactivated in such generated XVI mutant when it is grown in media lacking an inductor of the Pspac promoter, such as IPTG. The mutant was complemented with a plasmid encoding the response regulator of the walKR system, the walR gene, under the control of a constitutive promoter, so that the generated XVI* strain constitutively expresses the walR gene, but not the complete walKR system unless it is grown in a medium containing IPTG (1 mM) or other inductor of the Pspac promoter. Therefore, in the absence of an inductor of the expression of the walKR operon, the XVI* mutant is devoid of all TCSs, because the WalKR system, as such TCS, is not active, due to the lack of the sensor component. Surprisingly, in spite of being a sense devoid S. aureus mutant, the XVI* mutant is viable under normal laboratory growing conditions (see the Examples section for the particular conditions) and shows phenotypic characteristics similar to those of the XV mutants: they exhibited growth rates indistinguishable from the wild type under aerobic conditions at 37 C. and 44 C. Loss of sensing capacity causes growth defect at 28 C., decreased capacity for long-term survival during desiccation, higher susceptibility to detergents, deficiency in the capacity to reduce nitrate to nitrite, and renders the bacteria avirulent (see Examples 1 and 2). These results indicate that deprivation of the two-component sensorial system has less consequences for the bacterial biology than expected and demonstrate that, with the exception of walKR (and, particularly, the sensor or response regulator WalR), TCSs are not necessary for the maintenance of house-keeping functions under constant laboratory growing conditions. This can be considered particularly unexpected after having confirmed, as it is described in the first part of Example 1, that most TCSs are constitutively expressed in all the S. aureus strains tested, what indicates that bacteria need to have ready the TCSs to respond to the different stimuli that might encounter in different environmental conditions.

[0101] The mutants XV and XVI provided by the present invention (or, in a more generic denomination, the S. aureus mutant strains devoid of all non-essential TCS systems where, in the particular case of XVI, walKR can be selectively turned off) are stable and manageable. The mutants XV and XVI provide an excellent platform to generate a collection of strains containing single TCS, additional to those remaining in the XV or XVI strains, by reintroducing a cassette with the corresponding coding sequences under the control of appropriate elements (for instance, an inducible or constitutive promoter), the cassette preferably being part of a suitable expression vector such as a plasmid or a recombinant phage. This collection, together with the mutant XVI, is an excellent research tool for increasing the knowledge about S. aureus sensing system in general, enabling novel approaches for the identification of the biological processes regulated by each individual TCS, the possibilities of in vivo cross-talk among HKs and RRs each one belonging to different TCSs, the regulation of the expression of each TCSs, the compounds (inductors or inhibitors) affecting them, the possible influence of acting on different TCS in bacterial viability, the possible genes or systems that could complement the absence of the expression of a specific TCSs, the relation of each two-component system with host-pathogen interactions including S. aureus cell adhesion, invasion, tissue colonization, pathogenicity and antibiotic-resistance capabilities, the development of S. aureus avirulent strains or many other aspect of S. aureus biology. Increasing the knowledge about said matters will allow, directly or indirectly, developing many practical applications of direct industrial interest such as the use of TCS as targets for antibiotics identification and development, or even for identifying promoters whose expression depends on environmental signals or for developing biosensor tracks for environmental signals. Moreover, as they are still genetically manageable, both mutant strains represent excellent platforms for biotechnological applications by themselves, which applications can be independent of the analysis of the TCS network or could be designed to complement such analysis. Examples 3 to 6 of the present application show the applicability of the S. aureus mutant strains of the present application for such uses, since they show how the availability of the mutant strains of the present invention have enabled the clarification of the function of some particular TCS, their regulatory networks and the possibilities of cross talk among some particular TCS, as well as the applicability of the strains for some biotechnological uses.

[0102] For instance, Example 3 shows how the ectopic expression of single TCS in the XV strain allows the identification of the regulatory networks that depend especifically on individual TCS. To date, the regulon affected by a TCS had been inferred from the phenotype and transcription profile displayed by the single mutant and its restoration after complementation. However, such approach could not distinguish between those members of the regulon that are direct targets of the TCS from those targets whose expression depends indirectly on a second TCS. In the present application it is disclosed how the present inventors used the XV mutant complemented with the battery of TCS to analyze whether individual TCS were able to restore the phenotypes characteristic of the XV strain. Interestingly, the results show that single TCSs are sufficient to restore the phenotypes of the XV strain, supporting the notion that TCS regulatory pathways are insulated from one another and little interdependency exists among them. This system-level insulation might explain why phenotypes of XV strains correspond to the sum of phenotypes controlled by each TCS, without noticeable pleiotropic effects on other cellular processes. And it also shows the interest of mutants obtained using as parental strains the XV strains (or, more generally, the S. aureus strains devoid of all non-essential TCS) or the XVI strains (or, in general, the S. aureus strains devoid of all TCS) but containing plasmids or other expression systems additional to the bacterial chromosome which allow the ectopic expression (constitutive or inducible) of one of the TCS that has been deleted or inactivated in the XV strain. Such mutants are also an aspect of the present invention. And also a particularly preferred embodiment of the use as research tool or platform of the strains of the present invention is carrying out (an) assay(s) wherein one observes the phenotypic differences between a particular mutant strain of the present invention and another mutant that differs from the first mentioned mutant in that it ectopically expresses either: a) one or both of the two components, HK and RR, of a TCS selected from the group of yhcSR; the TCS comprised of the components expressed either i) by the genes MW0199-MW0198 of S. aureus strain MW2 (tcs3), or ii) by the genes SAOUHSC_00185-SAOUHSC_00184 of S. aureus strain 8325 (tcs3), or iii) by their corresponding orthologous genes of a another S. aureus strain; lytSR; graRS; saeRS; the TCS comprised of the components expressed either i) by the genes MW1207-MW1208 of strain MW2 (tcs7), or ii) by the genes SAOUHSC_01313-SAOUHSC_01314 of S. aureus strain 8325 (tcs7), or iii) by their corresponding orthologous genes of another S. aureus strain; hssRS; nreBC; braRS; kdpDE; vraSR; phoPR; arlRS; agr; srrAB; kdpED-like and walKR, or b) any other polypeptide (a natural protein, a mutated protein, a chimeric protein, a fusion protein or even a group of proteins, usually resulting from the same polycistronic messenger) or gene product (such as a iRNA). It is particularly preferred that the mutant strains of the present invention used in the assay is a mutant strain devoid of all non-essential TCS (such as one of the XV strains whose generation is described in the Examples section of the present application) or a mutant strain devoid of all TCS (such as one of the XVI strains whose generation is also described in the present application), because it allows to identify clearly any other protein or group of proteins that could complement the function of a particular TCS after its inactivation without the noise of the functioning of other TCS or the whole sensing system. Since there are a number of plasmids that are well known for those skilled in the art as plasmids that can be replicated in S. aureus, such as those used in the present application like pMAD, pSD-3 or pCN47, pCU1, pBT2, and also well known are promoters that can give rise to the expression of coding sequences operatively linked to them when they are part of expression cassetes present in S. aureus cells, either constitutively (all those promoters whose genes are expressed under any circumstaces, such as the promoter of the ribosomal genes, BlaZ, the promoter inducible by cadmium when the inductor is not present) or when an inductor is present (such as Pspac or also the tetracycline (Bateman et al., 2001), cadmiun (Charpentier et al., 2004) and xylose (Kim et al., 1996) inducible promoters), the information provided in the present application is enough for enabling one skilled in the art to put into practice such aspect of the present invention.

[0103] Such assays can be useful for a variety of purposes, particularly when the second mutant strain ectopically expresses one or both of the two components, HK and RR, of a TCS and also any other polypeptide or groups of polypeptides. An interesting embodiment is that one wherein the other polypeptide or a polypeptide of the group of polypeptides is itself or comprises a fragment with the amino acid sequence of a reporter, selection marker or labelling protein, such as a fluorescent protein (like GFP or RFP), a protein that confers resistance to a particular antibiotic, another selection marker or any other protein capable, under particular conditions, of giving rise to a signal easy to detect selected among those well known by those skilled in the art. Particularly interesting might be those assays where the regulatory conditions of a promoter operatively linked to the reporter, marker or labelling protein (or to the fusion or chimeric protein containing it) are not completely known, because the assay can be used for identifying promoters whose expression depends on environmental signals: the appareance of the marker or labelling protein only when a particular environmental signal is present among the culture conditions will indicate that such promoter depends on that environmental signal. Moreover, the mutant strain where the assayed promoter is present can be a useful biosensor track for environmental signals. When the signal is specifically sensed by the TCS also ectopically expressed, a significant degree of specificity is also achieved with such mutant as biosensor track. Therefore, the mutant strains of the present application can be useful not only as research tools, but they can have direct applicability as in the above described situation.

[0104] In the Examples of the present application, the knowledge of the phenotypes activated by each TCS together with the XV strain were used to perform a systematic analysis of cross-talk in vivo in two phases. First, the present inventors analyzed the capacity of a RR to activate the corresponding phenotype in the single mutant compared to the XV strain. This simple strategy allows the rapid identification of those RRs that are activated in the presence of non-cognate HKs. The present inventors focused on those RRs for which a clear phenotype in the XV strain was detected. In agreement with notion that cross-talk between TCS is rare, only ArlR, among the response regulators analyzed, was activated by non-cognate HK. Second, they searched for the HKs capable to activate ArlR by complementing the XV strain with a set of plasmids containing the combination of arlR and the whole family of HKs. The results showed that mainly GraS and to a lower level SrrA were able to activate ArlR. Both systems, ArlS and GraS, have been involved in the regulation of bacterial autolysis, indicating that their regulons overlap. In this respect, and taking the advantage that ArlRS regulates also the production of some secreted proteins (Fournier et al., 2001), they used protein A as a sensitive and easily detectable target to study the cross-talk between both TCSs. Cross-talk between GraS and ArlR occurs in the presence of ArlS, indicating that the phosphatase activity of ArlS cannot prevent the phosphorylation of ArlR by GraS. Furthermore, cross-talk between GraR and ArlR occurs in response to natural stimuli because activation of GraS with colistin increased the production of protein A in the wild type and arlRS mutant strains, whereas the levels remained similar when graRS mutant is grown in the presence of colistin. ArlRS and GraSR are not closely related to one another suggesting that the cross-regulation between GraS and ArlR has been evolutionary selected and represent and integral signalling event that enables S. aureus to adapt more efficiently to environmental perturbations.

[0105] In summary, these studies provide the first example of a free living bacteria in which all non-essential TCSs (XV) and even the whole TCS signalling system (XVI) has been removed. This strategy is especially useful to elucidate the connectivity between environmental signals, the sensor responsible for its perception and the set of regulated genes. Also, it may aid to carry out studies to investigate the molecular mechanisms that govern the specificity between sensors and RRs and to understand the interdependency between different TCS. As the XV mutant (or, more generically, the mutant devoid of all non-essential TCS) is still genetically manageable, it provides an excellent platform for the systematic analysis of the TCS network. Also the strain devoid of all TCS, but expressing WalR (such as the S. aureus XVI* strain disclosed in the present application) can be useful for such object, alone or in assays or practical application wherein it is combined with any other of the S. aureus mutant strains disclosed in the present application. Therefore, it is also an aspect of the present invention the use of any of the S. aureus strains of the present invention as research tools, for metabolic assays in general, particularly those aimed to elucidate the functioning and/or connectivity between environmental signals, particularly those associated to TCSs, and also for the study of S. aureus pathogenicity and infection mechanisms. Both the mutant devoid of all non-essential TCS (such as the XV strain of the Examples of the present application) or the mutant devoid of all TCS, (such as the XVI strain of the Examples of the present application) are particularly preferred for such use.

[0106] From a biotechnological point of view, both the senseless S. aureus mutant or the mutant devoid of all non-essential TCS can be an ideal bacterial chassis for synthetic biology applications. S. aureus XV has a genome that encodes the basic biological functions required for self-maintenance and growth, but is deleted of signal-sensing components that divert resources. Under natural circumstances, signalling functions enable microorganisms to interact with their environment, but they may not be required in the synthetic biology laboratory or in biotechnological settings. S. aureus XV is robust, stable (low spontaneous variability) and easily amenable to genetic manipulations. Thus, S. aureus XV can be engineered to create novel connections between stimuli and gene expression networks to develop different types of useful engineered cells. The assays described in Example 5 shows the applicability of the XV strain of the present invention for expressing heterologous proteins, that can be chimeric proteins if it is wished, and that the XV strain is an appropriate platform for directing them to the desired cell compartment, such as the cell membrane or the cell wall, if appropriate sequences are included in the construction designed for transforming the strain. The methods for obtaining such constructions and the appropriate elements to include in them in order to achieve expression in the desired conditions or to direct the expressed protein to a particular compartment are well known for those skilled in the art. Also well known are the methods for transforming bacteria, particularly Gram positive bacteria such as S. aureus, with any kind of appropriate expression vector (plasmids, phages . . . ) and/or for inserting an expression cassette in the bacterial chromosome, if desired. Therefore, the stability of the mutant strains of the present invention and their amenability to genetic manipulations, together with the corroboration of the assay of Example 5, are enough for supporting their applicability for the expression of any heterologous and/or chimeric protein, for any desired purpose. Such purpose can be, for instance, their inclusion in any study about S. aureus, such as studies about its metabolic pathways, sensing, pathogenicity or any other desired feature, or any other practical purpose not directly related to the study of S. aureus biological processes.

[0107] Moreover, the phenotypic characterization of the XV strains (see Example 1) show that they are capable to adhere to human lung epithelial or hepatocyte cell lines as efficiently as the wild type strain, although they invade both epithelial cell lines less efficiently. The antimicrobial susceptibility of the MW2 XV and 8325 XV strains is different when both strains are compared, but it is also different from that of their parental strains. The assays of Example 1 confirm that the TC sensorial system is important for the pathogenesis of S. aureus infection and that its susceptibility to different antibiotics is modified by TCS inactivation.

[0108] This confirms the applicability of the mutant strains of the present invention for identifying compounds capable to block TCSs, which could be a means for identifying candidates to antibiotic compounds. The method used for it could be based on the assay set forth in Example 6, which also shows that controlling the expression of certain TCS, particularly the expression of WalKR, would allow the creation of a biosafe S. aureus strain able to grow only in the presence of the corresponding inductor, which again means a valuable tool for assays related to S. aureus pathogenicity and means for controlling S. aureus infection.

[0109] The obtained results also aimed at S. aureus mutant strains of the present invention, particularly XV and XVI strains, as candidates to being used as living attenuated mutant strains for vaccination purposes, since they are avirulent but still have a capability of invading and colonizing tissues.

[0110] Following a procedure analogous to that of Example 6, both the XV strain whose generation is disclosed in the assays of the present application (or, more generally, a S. aureus strain devoid of all TCS excepting the essential for viability, WalKR) or a XVI strain wherein the walKR operon is under the control of an inducible promoter (such as the Pspac promoter) but growing under conditions wherein an inductor of the promoter is present, could be a good platform for identifying compounds capable of blocking/inactivating the WalKR system, which could be a way of identifying compounds with antimicrobial potential. In such method for identifying potential antimicrobial compounds, those compounds whose addition to the culture media would give rise to growth inhibition of the mentioned XV strain could be potential antimicrobial drugs. The reversion of the effect by the expression of the WalKR components (ectopically from a plasmid, for instance) would confirm that the effect is due to having inactivated the WalKR system. The sequential transformation of the XV strain with plasmids expressing each one of the other TCS or assays with the strains I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV and the wild type parental strain would confirm the specificity of the effect, the possibility of inactivating simultaneously several systems and the potentiality of the compound as antimicrobial/antibiotic compound, in case the effect could not be reverted in the parental wild type strain or by the reintroduction of any of the systems.

[0111] In conclusion, the present invention provides a set of S. aureus mutant strains that allow: [0112] firstly, a novel approach for the study of S. aureus sensing system, very useful for increasing the knowledge about the functioning, regulation and related phenotypic effects of such system and their components, which has allowed increasing the knowledge about different aspect of such sensing system, as it is demonstrated by the examples of the present application and the findings and teachings provided in them, and which will facilitate or enable the design of assays very difficult or not possible before the disclosure of the present invention which will provide teachings that will further increase the knowledge of S. aureus biology, many of them probably with direct or indirect applicability in the control of S. aureus infection and the development of compounds for controlling such infection and/or for palliating its symptoms; [0113] secondly, direct biotechnological applicability, due to the fact that they are stable under normal growing laboratory conditions and still genetically manageable, being capable of replicating plasmids, expressing heterologous proteins or internalizing external compounds that can be known or putative inductors or inactivators of different cell functions, the latter being directly linked with their possible application for the identification of candidates to antimicrobial compounds, particularly those targeting the TCSs, and the development of more potent or more specific antibiotics from such compounds.

EXAMPLES

[0114] The assays set forth and discussed in the following Examples have been carried out with the following materials and methodologies: [0115] Oligonucleotides, plasmids, bacterial strains and culture conditions

[0116] Bacterial strains, plasmids and oligonucleotides used in the assays of the present application are listed below in Tables 1, 2 and 3, respectively.

TABLE-US-00003 TABLE 3 Bacterial strains used in the present assays S. aureus strains Relevant characteristics MIC.sup.a Reference 15981 Clinical isolate 532 (Valle et al., 2003) RN10359 (8325) RN450 lysogenic for 80 phage 1327 (Ubeda et al., 2007) ISP479r ISP479c with rsbU gene restored 1680 (Toledo-Arana et al., 2005) MW2 WT (NC_003923) 3566 (Baba et al., 2002) MW2 3 MW2 strain with MW0199-MW0198 genes deleted 4032 This study MW2 4 MW2 lytSR 2964 This study MW2 5 MW2 graRS 11 This study MW2 6 MW2 saeRS 2965 This study MW2 7 MW2 MW1207-MW1208 4033 This study MW2 8 MW2 arlRS 4034 This study MW2 9 MW2 srrAB 2966 This study MW2 10 MW2 phoRP 4035 This study MW2 11 MW2 yhcSR 3670 This study MW2 12 MW2 vraRS 4036 This study MW2 13 MW2 agrBDCA 4037 This study MW2 14 MW2 kdpDE 4038 This study MW2 15 MW2 hssRS 2979 This study MW2 16 MW2 nreABC 2967 This study MW2 17 MW2 nsaRS 4039 This study MW2 I MW2 yhc 3670 This study MW2 II MW2 I tcs3 3713 This study MW2 III MW2 II lyt 3717 This study MW2 IV MW2 III gra 66 This study MW2 V MW2 IV sae 371 This study MW2 VI MW2 V tcs7 768 This study MW2 VII MW2 VI hss 1336 This study MW2 VIII MW2 VII nre 1345 This study MW2 IX MW2 VIII bra 1379 This study MW2 X MW2 IX kdp 2955 This study MW2 XI MW2 X vra 2956 This study MW2 XII MW2 XI pho 2957 This study MW2 XIII MW2 XII arl 2958 This study MW2 XIV MW2 XIII agr 2960 This study MW2 XV MW2 XIV srr 2961 This study 8325 WT (NC_007795) 2968 8325 I 8325 yhc 3999 This study 8325 II 8325 I lyt 4000 This study 8325 III 8325 II gra 4001 This study 8325 IV 8325 III sae 4002 This study 8325 V 8325 IV tcs7 4003 This study 8325 VI 8325 V tcs3 4004 This study 8325 VII 8325 VI arl 4005 This study 8325 VIII 8325 VII srr 4006 This study 8325 IX 8325 VIII pho 4007 This study 8325 X 8325 IX hss 4008 This study 8325 XI 8325 X nre 4009 This study 8325 XII 8325 XI bra 4010 This study 8325 XIII 8325 XII vra 4011 This study 8325 XIV 8325 XII I kdp 4012 This study 8325 XV 8325 XIV agr 2969 This study MW2 XVI MW2 XV PspaC-walKR 2975 This study MW2 XVI* MW2 XV Pspac- walKR pEl walR 4674 This study MW2 XV pEl arlR MW2 XV strain harbouring the pEl arlR plasmid 4891 This study MW2 XV pEl arlRS MW2 XV strain harbouring the pEl arlRS plasmid 4538 This study MW2 8 pEl MW2 8 strain harbouring the pEl plasmid 4704 This study MW2 8 pEl arlR MW2 8 strain harbouring the pEl arlR plasmid 4890 This study MW2 8 pEl arlRS MW2 8 strain harbouring the pEl arlRS plasmid 4539 This study MW2 XV pEl MW2 XV strain harbouring the pEl plasmid 4682 This study MW2 XV pEl vraR MW2 XV strain harbouring the pEl vraR plasmid 4708 This study MW2 XV pEl vraSR MW2 XV strain harbouring the pEl vraRS plasmid 4676 This study MW2 12 pEl MW2 12 strain harbouring the pEl plasmid 4684 This study MW2 12 pEl vraR MW2 12 strain harbouring the pEl vraR plasmid 4889 This study MW2 12 pEl vraSR MW2 12 strain harbouring the pEl vraRS plasmid 4675 This study MW2 XV pEl srrA MW2 XV strain harbouring the pEl srrA plasmid 4678 This study MW2 XV pEl srrAB MW2 XV strain harbouring the pEl srrAB plasmid 4680 This study MW2 9 pEl MW2 9 strain harbouring the pEl plasmid 4683 This study MW2 9 pEl srrA MW2 9 strain harbouring the pEl srrA plasmid 4679 This study MW2 9 pEl srrAB MW2 9 strain harbouring the pEl srrAB plasmid 4677 This study MW2 XV pEl nreBC MW2 XV strain harbouring the pEl nreBC plasmid 4536 This study MW2 16 pEl nreBC MW2 16 strain harbouring the pEl nreBC plasmid 4535 This study MW2 XV pEl nreC XV strain harbouring the pEl nreC plasmid 3888 This study MW2 16 pEl 16 strain harbouring the pEl plasmid 3893 This study MW2 16 pEl nreC 16 strain harbouring the pEl nreC plasmid 3889 This study MW2 XV pEl arlR hk3 XV strain harbouring the pEl arlR hk3 plasmid 5041 This study MW2 XV pEl arlR lytS XV strain harbouring the pEl arlR lytS plasmid 5042 This study MW2 XV pEl arlR graS XV strain harbouring the pEl arlR graS plasmid 5043 This study MW2 XV pEl arlR saeS XV strain harbouring the pEl arlR saeS plasmid 5044 This study MW2 XV pEl arlR hk7 XV strain harbouring the pEl arlR hk7 plasmid 5045 This study MW2 XV pEl arlR srrA XV strain harbouring the pEl arlR srrA plasmid 5046 This study MW2 XV pEl arlR phoS XV strain harbouring the pEl arlR phoS plasmid 5047 This study MW2 XV pEl arlR yhcS XV strain harbouring the pEl arlR yhcS plasmid 5048 This study MW2 XV pEl arlR vraS XV strain harbouring the pEl arlR vraS plasmid 5049 This study MW2 XV pEl arlR agrC XV strain harbouring the pEl arlR agrC plasmid 5050 This study MW2 XV pEl arlR kdpD XV strain harbouring the pEl arlR kdpD plasmid 5051 This study MW2 XV pEl arlR hssS XV strain harbouring the pEl arlR hssS plasmid 5052 This study MW2 XV pEl arlR nreC XV strain harbouring the pEl arlR nreC plasmid 5053 This study MW2 XV pEl arlR hk17 XV strain harbouring the pEl arlR hk17 plasmid 5054 This study MW2 8 pEl arlR (D52A) MW2 8 strain harbouring the pEl arlR (D52A) plasmid 5001 This study MW2 8 pEl arlRS (H242A) MW2 8 strain harbouring the pEl arlRS (H242A) plasmid 4924 This study MW2 XV pEl arlR (D52A) XV strain harbouring the pEl arlR (D52A) plasmid 5002 This study MW2 XV pEl arlRS (H242A) XV strain harbouring the pEl arlRS (H242A) plasmid 4925 This study MW2 XV pEl arlR (D52A) graS XV strain harbouring the pEl arlR (D52A) graS plasmid 5043 This study Newman Widely used laboratory strain (Duthie and Lorenz, 1952) .sup.aMicrobial Biofilm Laboratory strain collection number of the inventors. Samples available upon request

TABLE-US-00004 TABLE 4 Plasmids used in the assays Plasmids Relevant characteristic(s) Source of reference pMAD E. coli - S. aureus shuttle vector with the thermosensitive origin or replication (Arnaud et al., 2004) for Gram-positive bacteria. The vector contains the bgaB gene encoding a b- galactosidase under the control of a constitutive promoter as reporter of plasmid presence. Ap.sup.R, Em.sup.R. pMAD TCS3AD pMAD plasmid containing the mutant allele for deletion of the sequence This study pMAD TCS4AD pMAD plasmid containing the mutant allele for deletion of the lytRS genes This study pMAD TCS5AD pMAD plasmidcontaining the mutant allele for deletion of the graRS genes This study pMAD TCS6AD pMAD plasmid containing the mutant allele for deletion of the saeRS genes (Toledo-Arana et al., 2005) pMAD TCS7AD pMAD plasmid containing the mutant allele for deletion of the sequence (Toledo-Arana et al., 2005) pMAD TCS8AD pMAD plasmid containing the mutant allele for deletion of the arlRS genes (Toledo-Arana et al., 2005) pMAD TCS9AD pMAD plasmidcontaining the mutant allele for deletion of the srrAB genes (Toledo-Arana et al., 2005) pMAD TCS10AD pMAD plasmid containing the mutant allele for deletion of the phoRP genes (Toledo-Arana et al., 2005) pMAD TCS11AD pMAD plasmidcontaining the mutant allele for deletion of the yhcRS genes This study pMAD TCS12AD pMAD plasmid containing the mutant allele for deletion of the vraRS genes (Toledo-Arana et al., 2005) pMAD TCS13AD pMAD plasmid containing the mutant allele for deletion of the agrBDCA genes (Valle et al., 2003) pMAD TCS14AD pMAD plasmid containing the mutant allele for deletion of the kdpDE genes This study pMAD TCS15AD pMAD plasmid containing the mutant allele for deletion of the hssRS genes (Toledo-Arana et al., 2005) pMAD TCS16AD pMAD plasmid containing the mutant allele for deletion of the nreBC genes This study pMAD TCS17AD pMAD plasmid containing the mutant allele for deletion of the braRS genes This study pSD3-3 Derivative of pDH88. Pspac-walKR (Dubrac et al., 2007) pCN51 E. coli - S. aureus shuttle vector to express genes under the control of the P.sub.cad (Charpentier et al., 2004) cadmium-inducible promoter. Low copy number (20 to 25 copies/cell). Em.sup.R. Renamed pEl pEl walR pCN51 plasmid expressing walR This study pEl arlRS pCN51 plasmid expressingar/RS This study pEl arlR pCN51 plasmid expressing arlR This study pEl srrAB pCN51 plasmid expressingsrrAB This study pEl srrB pCN51 plasmid expressing srrB This study pEl vraSR pCN51 plasmid expressingvraSR This study pEl vraR pCN51 plasmid expressing vraR This study pEl nreBC pCN51 plasmid expressingnreBC This study pCN40 E. coli - S. aureus shuttle vector to express genes under the control of the P.sub.blaZ (Charpentier et al., 2004) constitutive promoter. Low copy number (20 to 25 copies/cell). Em.sup.R pCN47 E. coli - S. aureus shuttle vector to express genes under its own promoter. Em.sup.R (Charpentier et al., 2004) pEl nreC pEW plasmid constitutively expressing nreC This study pEl arlR hk3 pCN51 plasmid expressing arlR hk3 This study pEl arlR lytS pCN51 plasmid expressing arlR lytS This study pEl arlR graS pCN51 plasmid expressing arlR graS This study pEl arlR saeS pCN51 plasmid expressing arlR saeS This study pEl arlR hk7 pCN51 plasmid expressing arlR hk7 This study pEl arlR srrB pCN51 plasmid expressing arlR srrB This study pEl arlR phoR pCN51 plasmid expressing arlR phoR This study pEl arlR yhcS pCN51 plasmid expressing arlR yhcS This study pEl arlR vraS pCN51 plasmid expressing arlR vraS This study pEl arlR agrC pCN51 plasmid expressing arlR agrC This study pEl arlR kdpD pCN51 plasmid expressing arlR kdpD This study pEl arlR hssS pCN51 plasmid expressing arlR hssS This study pEl arlR braS pCN51 plasmid expressing arlR braS This study pEl arlR (D52A) pCN51 plasmid expressing arlR (D52A) This study pEl arlR (H242A) pCN51 plasmid expressing arlR(H242A) This study pEl arlR (D52A) arlS pCN51 plasmid expressing arlR (D52A) arlS This study pEl arlR(D52A) graS pCN51 plasmid expressing arlR (D52A) graS This study pEl-BapB pCN51 plasmid with Bap-B domain fused to the C-terminal R domain of clumping This study factor A gene (R-clfA) pEl-BapB-SNAP pCN51 plasmid with Bap-B domain fused to a SNAP-tag followed by R-clfAl This study domain, expressed under the cadmium inducible promoter Pcad-cadC

TABLE-US-00005 TABLE5 Oligonucleotidesusedintheassays Oligo SEQ nucleotide Sequence IDNO: tcs3-A GGATCCGTTATCAGAAACAATTGATCA 1 tcs3-B CCATGGTGAATCATCTCCAAAAATTTAT 2 tcs3-C CCATGGATTAGCACATAACTAATGATTA 3 tcs3-D CTCGAGTAAAGGCGATGCAGTTAATA 4 lyt-A GGATCCTGACGTTGAACAAACGAATA 5 lyt-B AAGCTTGATAGCACCTCAGTGAAT 6 lyt-C AAGCTTCAGTAATCCTTTTTTTTATGC 7 lyt-D GAATTCCAACTGTACCGATACCAAT 8 gra-A GGATCCCAAATAGATATTGCTGTATTC 9 gra-B CCATGGCCATATCACCCAATATCATT 10 gra-C CCATGGACATGCGTTTTGTTACTTAG 11 gra-D CTCGAGTTAACGCCACCTAAAACAC 12 sae-A ATTTGAATGGATAGGC 13 sae-B ATTACGTCATAATCCG 14 sae-C AAATCGGATTATGACGTAATAAGTGGGTCATCTATTTTTTCACC 15 sae-D TAACACTACAAATCGC 16 tcs7-A GGATCCAAAGGGGATCTAATTATGATA 17 tcs7-B AAGCTTATTTTATTCCGCCCTTTTAAA 18 tcs7-C AAGCTTATACAAACAAAAAAGTATTGAG 19 tcs7-D GAATTCAAAAATACTTCTCTCTAGCAA 20 arl-A GTTTCCTTTTTGGAGG 21 arl-B TCATGACTGAGACGTC 22 arl-C GCGTCATTTGTACACC 23 arl-D GTGATGAGGTTTAAAC 24 srr-A GGATCCGTGAATTTACTAATTTAATGA 25 srr-B CTCGAGGCCTCTTGGCCATTACTTGCT 26 srr-C CTCGAGATCGAAGAGCATGGTGGTTC 27 srr-D GAATTCATCTTCGCAATGCACATAAA 28 pho-A TGGTAGTAAGATACCC 29 pho-B AAAGTGGTAACAGCGC 30 pho-C ACACGCGCTGTTACCACTTTGGTATGCCTCCCTAAC 31 pho-D CACATGGTACAGCTCC 32 yhc-A TTAAAATGTGTGTAATTGCA 33 yhc-B CAAATCGCTCCAATTCATTT 34 yhc-C AATGAGCTTTTAAATATTTGTC 35 yhc-D GTGTGTTACATCGCTTTTA 36 vra-A GTATTACCAGGTGCAG 37 vra-B TCAATAGTTCGTATTG 38 vra-C AATTCAATACGAACTATTGACGATAAATCACCTCTA 39 vra-D ACGTGGCCTTTTGGCG 40 agr-A AGCACTGAGTCCAAGG 41 agr-B TTTTACACCACTCTCC 42 agr-C GTGAGGAGAGTGGTGTAAAAAAGATAATAAAGTCAGTTAACGGC 43 agr-D CAGTTATTAGCAGGAT 44 kdp-A GGATCCCCAATGATATTAGTTAATCCA 45 kdp-B CCATGGAACCTTCACCTCGATAGC 46 kdp-C CCATGGTTAAATAAAAAAGATCGCTGC 47 kdp-D GAATTCGTTTTCAATAATTGATTCTCTG 48 hss-A CATTAATAGCGACCTC 49 hss-B CTCCCTTATCTTTTTC 50 hss-C AAATGAAAAAGATAAGGGAGTCTCTACCTCCTGAAA 51 hss-D AGGTGTAGTGTGCATC 52 nre-A GGATCCCGCAACATTAGTAACCAATAT 53 nre-B CCATGGGACTTACACCCTAATTCATC 54 nre-C CCATGGAGTTTGAAATTAATATAATTCAGT 55 nre-D CTCGAGTTATAAACAGCAAGACTTAGAA 56 bra-A GGATCCGCTGCAGAATCAGTAATATT 57 bra-B AAGCTTCTATAATCTTCTTCCTTCAAT 58 bra-C AAGCTTAAACTTTCAATATTGTAAGCATA 59 bra-D GAATTCGTGCCATAACAATCTTAACT 60 tcs3-E ATCTACTCAAGTACTGCTTT 61 tcs3-F TGTTTCAAACGTCTTTGTATA 62 lyt-E GAAAAGAAAAATGTAGATTTGA 63 lyt-F AATAACATCATTGGCAAATTG 64 gra-E AAATGACTTGGATTCAGTGT 65 gra-F AAAAAGATAGATGGCATAATG 66 sae-E GTTGGTGATTTTAGACTTTTA 67 sae-F ATAAGATTGTAGAGCACATAA 68 tcs7-E AATTGCCGGAAGATGTTAAA 69 tcs7-F TATCTTTGTAGGCTTTATCG 70 arl-E AGTGATCTGAAACAATTCC 71 arl-F AAGAATAGTAAATAAAACGC 72 srr-E TTTGTACAAAGGTAGACTTG 73 srr-F TGGTTACGGATTACTTTAAAG 74 pho-E AATGAGACCATATGAAAGCC 75 pho-F CAGGTGCAAACATTAATTATG 76 yhc-E CATATAAAGGATCACCAATAA 77 yhc-F CATAGTTATTCATTATACCAC 78 vra-E TGACGAACAAGTGAAATGG 79 vra-F CGTTCTATTATTGGGATGTG 80 agr-E GGGGATGTTATTAATTATGAA 81 agr-F TAGTCATTTATACGAAGGGA 82 kdp-E TACTAATTAAACATGATAATGG 83 kdp-F GAATTCGTTTTCAATAATTGATTCTCTG 84 hss-E CATACATTGTGTCGTTTAAAA 85 hss-F AACCAATGATTAAGCTAATAAA 86 nre-E TTAAGTTCAGCGTCGGATAT 87 nre-F AACTTTACATTATTACGATGAAA 88 bra-E TACTTTCTGCTTGTTACTGT 89 bra-F ACACAAGCGTATATTCAATC 90 ConstitutiveexpressionofTCS SaeR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCATTATCGGCTCCTTTCAAAT 91 KpnI) SaeR-Fw(XhoISalI) GTCGACATTGCTCGAGCGAACAGAGGTGAAAAAATAG 92 NreR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCAATTTCAAACTCTAAAACTCT 93 KpnI) A NreR-Fw(XhoISalI) GTCGACATTGCTCGAGCATACATTGGGGGAATAAAA 94 WalR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCCTCTACTCATGTTGTTGGA 95 KpnI) WalR-Fw(XhoISalI) GTCGACATTGCTCGAGTTAAGAAAAGAGGTTTATGC 96 TCS3R-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCAATCTATTTTGCTTGCTTAC 97 KpnI) TCS3R-Fw(XhoISalI) GTCGACATTGCTCGAGTTCAAGGGGGAATGTAGAT 98 LytR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCACTGTTAAAGTAACCCTATC 99 KpnI) LytR-Fw(XhoISalI) GTCGACATTGCTCGAGGACAAGAGGAGGAATAAATA 100 GraR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCCAAATTATTCATGAGCCATA 101 KpnI) GraR-Fw(XhoISalI) GTCGACATTGCTCGAGAATGATATTGGGTGATATGG 102 TCS7R-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCATTTAGATCCAGCCTTTTTC 103 KpnI) TCS7R-Fw(XhoISalI) GTCGACATTGCTCGAGAACAGGAGGAATAGCATGA 104 ArlR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCTTTGTCATCGTATCACATAC 105 KpnI) ArlR-Fw(XhoISalI) GTCGACATTGCTCGAGGTAATATGAGGTGTACAAAT 106 SrrA(R)-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCACTATTTAGCCGGCTCATC 107 KpnI) SrrA(R)-Fw(XhoISalI) GTCGACATTGCTCGAGTGTGTGGGAGGTATGACC 108 PhoP(R)-Rv GGTACCAATACCCGGGCAATGGATCCTCATCATTGTTCTTTAGGTC 109 (BamHIXmaIKpnI) PhoP(R)-Fw(XhoISalI) GTCGACATTGCTCGAGATAAGTTAGGGAGGCATAC 110 YhcR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCTTCTAAATCAACTTATTTTCC 111 KpnI) YhcR-Fw(XhoISalI) GTCGACATTGCTCGAGATTTAAGGAGATAACCCATG 112 VraR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCGAACTATTGAATTAAATTATGT 113 KpnI) VraR-Fw(XhoISalI) GTCGACATTGCTCGAGAAATAAGGAGGATTCGTATG 114 AgrA(R)-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCTATCTTATTATATTTTTTTAAC 115 KpnI) G AgrA(R)-Fw(XhoISalI) GTCGACATTGCTCGAGCATAAGGATGTGAATGTATG 116 KdpE(R)-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCATTATTTCTCTTTCCACTGC 117 KpnI) KdpE(R)-Fw(XhoISalI) GTCGACATTGCTCGAGAATGAAGGAGACGTATAATG 118 HssR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCTTTAAACATGATTCTCCACC 119 KpnI) HssR-Fw(XhoISalI) GTCGACATTGCTCGAGGATAAGGGAGTTTATAGCTA 120 BraR-Rv(BamHIXmaI GGTACCAATACCCGGGCAATGGATCCCCTATACTTTATATCCGACA 121 KpnI) BraR-Fw(XhoISalI) GTCGACATTGCTCGAGTTGAAGGAAGAAGATTATAG 122 SaeS-Rv(XmaIAscI) GGCGCGCCCGGGATCGGATTATGACGTAATGT 123 SaeS-Fw(BamHI) GGATCCATTTGAAAGGAGCCGATAAT 124 NreS-Rv(XmaIAscI) GGCGCGCCCGGGGTATGTTTCAAATTGGAATGT 125 NreS-Fw(BamHI) GGATCCAGATGAATTAGGGTGTAAGT 126 WalK(S)-Rv(XmaIAscI) GGCGCGCCCGGGCCTTATTATTCATCCCAATC 127 WalK(S)-Fw(BamHI) GGATCCATGAGTAGAGGTCGAAACG 128 TCS3S-Rv(XmaIAscI) GGCGCGCCCGGGTACCTTAAACATCTACATTC 129 TCS3S-Fw(BamHI) GGATCCTTTTTGGAGATGATTCAATG 130 LytS-Rv(XmaIAscI) GGCGCGCCCGGGTATTTATTCCTCCTCTTGTC 131 LytS-Fw(BamHI) GGATCCAATTTACTGAGGTGCTATCG 132 GraS-Rv(XmaI-AscI) GGCGCGCCCGGGCGCATGTTTAAAATGACAAA 133 GraS-Fw(BamHI) GGATCCTAGGAAAAGGATATATGGCT 134 TCS7S-Rv(XmaIAscI) GGCGCGCCCGGGAAAGATGTCATGCTATTCCT 135 TCS7S-Fw(BamHI) GGATCCAAAGGGCGGAATAAAATATG 136 ArlS-Rv(XmaIAscI) GGCGCGCCCGGGGATTAAAATATGATTTTAAACG 137 ArlS-Fw(BamHI) GGATCCTGGCGTTGGGTATGTGATA 138 SrrB(S)-Rv(XmaIAscI) GGCGCGCCCGGGCAATTTTATTCTGGTTTTGG 139 SrrB(S)-Fw(BamHI) GGATCCATTTGAGGTTAAATCTAATG 140 PhoR(S)-Rv(XmaIAscI) GGCGCGCCCGGGTTTTATTCTTTATAATCTTTTAG 141 PhoR(S)-Fw(BamHI) GGATCCATTGGAAAGACCTAAAGAAC 142 YhcS-Rv(XmaIAscI) GGCGCGCCCGGGGCTATTTTATAGGAATTGTG 143 YhcS-Fw(BamHI) GGATCCAAATGAATTGGAGCGATTTG 144 VraS-Rv(XmaIAscI) GGCGCGCCCGGGCTTTAATCGTCATACGAATC 145 VraS-Fw(BamHI) GGATCCGAGACGTAGAGGTGATTTAT 146 AgrC(S)-Rv(XmaIAscI) GGCGCGCCCGGGGGCTAGTTGTTAATAATTTC 147 AgrC(S)-Fw(BamHI) GGATCCTATAAGAGAAAGTGTGATAG 148 KdpD(S)-Rv(XmaIAscI) GGCGCGCCCGGGCATTATACGTCTCCTTCATT 149 KdpD(S)-Fw(BamHI) GGATCCTATCGAGGTGAAGGTTATG 150 HssS-Rv(XmaIAscI) GGCGCGCCCGGGAGATTAAAGTGAATTATTTGG 151 HssS-Fw(BamH1) GGATCCCAAGGCTATAAGGTGGAGA 152 BraS-Rv(XmaIAscI) GGCGCGCCCGGGTTTTTATTCATCTGGAAATTG 153 BraS-Fw(BamHI) GGATCCAGTATAGGGTGAATGCAATG 154

[0117] S. aureus strains were grown in trypticase soy broth supplemented with 0.25% glucose (TSB-gluc) (Pronadisa). Escherichia coli was grown in LB broth (Pronadisa). When required for selective growth, medium was supplemented with appropriated antibiotics at the following concentrations: erythromycin (Em), 1.5 g/ml and 10 g/ml; ampicillin (Amp), 100 g/ml, chloramphenicol (Clo), 10 g/ml and 20 g/ml. [0118] Electrocompetent Staphylococcal Cells

[0119] Staphyloccocal electrocompetent cells were generated as previously described (Schenk and Laddaga, 1992). Briefly, bacteria were grown in 200 ml of B2 broth at 37 C. under shaking conditions (200 rpm) until the culture reached an OD.sub.600nm of 0.5. Culture was incubated for 15 min on ice. Culture was centrifuged and the pellet was washed three times with sterile water and once with 30 ml of ice-cold 10% glycerol. The pellet was resuspended into 15 ml of ice-cold 10% glycerol and incubated for 15 min at 20 C. Culture was centrifuged and bacterial pellet was resuspended into 200 l of ice-cold 10% glycerol. Aliquots of 50 l were performed and stored at 80 C. Plasmids were transformed into staphylococci by electroporation, using a previously described protocol (Cucarella et al., 2001). [0120] Preparation of 80 Transducing Lysates

[0121] For the donor lysate preparation, 50 ml of the S. aureus RN4220 overnight culture (containing pMAD plasmid to be transduced) were diluted in 5 ml of the phage broth (containing CaCl.sub.2). 200 ml of phage dilutions 10.sup.5 10.sup.6 10.sup.7 10.sup.8 (in phage broth containing CaCl.sub.2) were added to 300 ml of the donor cells and the mixture was incubated at room temperature for 30 min. 10 ml of molten phage top agar (containing CaCl.sub.2) at 55 C. were added to the tubes and immediately the liquid was poured over the surface of 2 phage base plates (containing CaCl.sub.2). Plates were incubated overnight at 37 C. Next day the top layer containing the phage plaques was scraped off with a Pasteur pipette into a falcon of 50 ml. Falcons were centrifuged and the supernatant was filtered through 0.45 mm filter and stored at 4 C. [0122] Phage Transduction

[0123] For the phage transduction, the recipient bacteria were grown in 20 ml of TSB overnight. Culture was centrifuged and resuspended in 1 ml of TSB. 500 ml of the culture were mixed with 1 ml of LB (containing CaCl.sub.2) and 500 ml of the phage lysate. There was also a control sample that had no phages. Mixture was incubated at 37 C. for 25 min on a water bath and then at 37 C. for 15 min in a orbital shaker. Reaction was stopped on ice and 1 ml of cold 0.02M Na citrate was added. The tube was centrifuged and the pellet was resuspended in 1 ml of 0.02M Na citrate and incubated on ice for 2 h. The bacterial solution was spread onto five TSA plates (200 ml per plate) containing Erytromicin 1.5 g/ml (Sigma Aldrich) and Na citrate. [0124] Allelic Exchange of Chromosomal Genes

[0125] To generate deletion mutants, the inventors implified by PCR two fragments of 500 bp that flanked the left (primers A and B, see Table 5, SEQ ID NO:1 to SEQ ID NO:60) and right sequences (primers C and D, see Table 5, SEQ ID NO:1 to SEQ ID NO:60) of the region targeted for deletion. The PCR products were purified and cloned separately in the pGEM-T Easy vector (Promega). Fragments were then fused by ligation into the shuttle vector pMAD (Arnaud et al., 2004). The resulting plasmid was transformed into S. aureus 15981 or MW2 strains by electroporation. Homologous recombination experiments were performed as described (Valle et al., 2003). Erythromycin sensitive white colonies, which no longer contained the pMAD plasmid, were tested by PCR using primers E and F (see Table 5, SEQ ID NO:61 to SEQ ID NO:90 [0126] Genome Sequencing of the MW2 and MW2 XV Strains by Illumine

[0127] To exclude the possibility that spontaneous mutations might have emerged during the construction of the XV strains to suppress essential functions of TCS, the XV strains were re-sequenced. Comparison of ancestor and XV mutant identified a total of 9 SNPs for MW2 and 5 SNPs for 8325. The absence of common mutations between both strains confirmed that none of the genetic changes had an influence on the behavior of the XV strain. For Illumina Next Generation Sequencing, genomic DNA was prepared from an overnight culture of MW2, MW2 XV, 8325 and 8325 XV grown in TSB-gluc at 37 C., as described previously (Marmur, 1961) and sequenced on an Illumina Hi-Seq 2000 instrument (Genomics Platform of CIBIR, La Rioja, Spain). Reads (6M-9M 150-bp) were assembled de novo using de Bruijn graph alignment Tools (ABBYS, VELVET, SOAP2) checking different K sizes to ensure the best coverage. SOAP2 was the algorithm that gave the best N50 and therefore the inventors used it on all the samples. The reads were assembled into 466 contigs (>100 bp in size) corresponding to 2864441 bp in length, with a N50 value of 16063 and a GC content of 32.67% for MW2, 236 contigs (>100 bp in size) corresponding to 2856644 bp in length, with a N50 value of 50702 and a GC content of 32.76% for MW2 XV, 283 contigs (>100 bp in size) corresponding to 2839577 bp in length, with a N50 value of 60685 and a GC content of 32.80% for 8325 and 292 contigs (>100 bp in size) corresponding to 2807518 bp in length, with a N50 value of 79329 and a GC content of 32.80% for 8325 XV. Subsequently contigs were ordered with Mauve obtaining a coverage of 99% in MW2 and 98% in 8325 (Rissman et al., 2009). Variant base calling of the mutant XV relative to MW2 and 8325 was performed with SAMTOOLS (H Li et al., 2009). Finally genomic reorganization, insertions and deletions were studied with the Breseq pipeline (Deatherage and Barrick, 2014). [0128] Construction of the Insertional Mutation of walKR Operon

[0129] To generate a strain in which the walKR operon was placed under the control of the inducible Pspac promoter, a 432-bp fragment generated by PCR with primers OSA34 (5-TCTAGATATTAATGATTTAAGAAAAGAGG-3, SEQ ID NO:155) and OSA35bis (5-AGATCTCCAGTGTCTTGTGCTGGTTGTGAG-3, SEQ ID NO:156), carrying the ribosome-binding site and 5 portion of yycF, was digested with Xbal and Bg/ll and cloned into pDH88 to generate pSD3-3 (Dubrac et al., 2007). The circular plasmid was then transformed into S. aureus strain XV, and integration of the plasmid through a single crossover event generated strain S. aureus XVI, in which the yycF operon was placed under Pspac control. Integration of the plasmid through a single crossover event generated strains MW2 Pspac-walKR and XV Pspac-walKR in which the entire walKR operon is under the control of the Pspac iso-propyl-P-D-thiogalactopyranoside (IPTG)-inducible promoter.

[0130] S. aureus strains were grown in Trypticase soy broth (TSB) supplemented with chloramphenicol (10 g/ml). [0131] Transcriptome Analysis [0132] RNA extraction: Bacteria were grown in TSB-gluc at 37 C. under shaking conditions (250 rpm) until the culture reached an OD.sub.650nm of 0,8. Total RNA from bacterial pellets was extracted using TRIzol reagent method as previously described (Toledo-Arana et al., 2009). Briefly, bacterial pellets were resuspended into 400 l of solution A (Glucose 10%, Tris 12.5 mM pH7.6, EDTA 10 mM), and mixed to 60 l of 0.5M EDTA. Resuspended cells were transferred into Lysing Matrix B tubes (MP Biomedicals) containing 500 l of acid phenol, pH 4,5 (Ambion) and mixed. Bacteria were mechanically lysed using the Fastprep apparatus (BIO101) at speed 6.0 during 45 seconds at 4 C. After lysis, tubes were centrifuged 10 min at 14,000 rpm at 4 C. The aqueous phase was transferred to 2-ml tubes containing 1 ml TRIzol, mixed and incubated for 5 min at room temperature. 100 l of chloroform was added, mixed gently and incubated for 3 min at room temperature. Tubes were centrifuged for 10 min at 14,000 rpm at 4 C. The aqueous phase was transferred into a 2-ml tube containing 200 l of chloroform, mixed and incubated for 5 min at room temperature. Tubes were centrifuged for 5 min at 14,000 rpm at 4 C. RNA contained in the aqueous phase was precipitated by addition of 500 l of isopropanol and incubated 15 min at room temperature. Tubes were centrifuged for 15 min at 14,000 rpm at 4 C. RNA pellets were washed with 75% ethanol. Dried RNA pellets were resuspended in DEPC-treated water. RNA concentrations were quantified and RNA qualities were determined using Agilent RNA Nano LabChips (Agilent Technologies). RNAs were stored at 80 C. until needed. [0133] RNA sequencing: Total RNA was extracted after lysing bacteria in the Fastprep homogenizer (Bio101) using TRIzol reagent (Invitrogen). RNA libraries for Illumina sequencing were created using the TruSeq Stranded Total RNA library prep kit (IIlumina). 10 g of total RNA was depleted from 16S and 23S RNAs using the MicroExpress kit according to the instructions of the manufacturer (Ambion). [0134] cDNA libraries for RNA sequencing, read mapping and statistics analysis. Deep sequencing of RNAs from S. aureus 15981 strain was performed as previously described (Lasa et al., 2011). Mapped reads were included in .wig files to be loaded at the S. aureus transcriptome browser (http://staph.unavarra.es/). [0135] Construction of Plasmids Expressing Histidine Kinases (HK) and/or Response Regulators (RR) Under the Control of Different Promoters

[0136] To construct the plasmids expressing RRs the inventors amplified them by PCR using forward (Fw) and reverse (Rv) primers (see Table 5, SEQ ID NO:91 to SEQ ID NO:122) and the MW2 chromosomal DNA as template. Forward primers carried Sall-Xhol tail and reverse primers carried BamHl-Xmal-Kpnl tail. The PCR products were amplified with Phusion High-Fidelity DNA Polymerase (Fermentas-Thermo Scientific), purified and cloned separately in pCR-Blunt II TOPO vector (Invitrogen). Fragments were then ligated using Sall and Kpnl enzymes in the vectors pEW and pEl.

[0137] Similarly, the HKs were amplified by PCR with the forward and reverse primers (see Table 5, SEQ ID NO:123 to SEQ ID NO:154) and the MW2 chromosomal DNA as template. Forward primers carried BamHl tail and reverse primers carried Xmal-Ascl tail. The PCR products were amplified with Phusion High-Fidelity DNA Polymerase (Fermentas-Thermo Scientific), purified and cloned separately in pCR-Blunt II TOPO vector (Invitrogen).

[0138] For the construction of the plasmids expressing a combination of HKs and RRs, TOPO HKn plasmids were digested with BamHl and Xmal enzymes and the BamHl/Xmal module, containing the HK, was transferred to the corresponding plasmids, pEW RRn or pEl RRn. Modules containing RRs and HKs can be moved together from one plasmid to another by digestion with Sall or Xhol and Xmal or Kpn I. [0139] Antibiotic Resistance

[0140] Antibiotic sensitivity tests were performed at the University Clinic of Navarra. Antibiotics routinely used in clinic for treatment of S. aureus infections were tested by VITEK 2 system. [0141] Growth Kinetics Analysis

[0142] In order to compare growth kinetics, overnight cultures of the strains were serially diluted (10.sup.1, 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 and 10.sup.6) in TSB-gluc and 5 l of no diluted, 10.sup.2, 10.sup.4 and 10.sup.6 diluted cultures were spotted onto TSA plates. The plates were then incubated at 28 C., 37 C. and 44 C. overnight and representative pictures were taken with a digital camera. [0143] General Metabolism

[0144] API Staph galleries (Biomerieux) were used to analyze bacterial metabolic patterns, according to the manufacturer's instructions. Homogeneous bacterial suspensions with a turbidity equivalent to 0.5 McFarland were prepared using the API Staph Medium. The microtubes were then filled with the bacterial suspensions and the strip was incubated inside the incubation box at 37 C. for 24 h. The changes in the bacterial metabolic patterns were analyzed comparing the corresponding mutants with the wild type S. aureus strain. [0145] Quantification of nitrite production

[0146] Extracellular concentrations of nitrite were determined colorimetrically by the Griess Reagent System (Promega) according to the manufacturer's instructions. Conditions of decreased oxygen tension were created by growing the bacterial strains in 15-ml Falcon tubes that were completely filled with medium (Schlag et aL, 2008). Potassium nitrate (KNO.sub.3) was added to the medium at 20 mM. A purple/magenta color is being indicative of the presence of nitrites in the media. Absorbance at OD.sub.509nm was measured within 30 minutes in the Original Multiskan EX (Labsystems) microplate reader. [0147] Desiccation Experiments

[0148] The desiccation experiment was adapted from a protocol as described (White and Surette, 2006). Briefly, 100 l from overnight cultures grown in TSB-gluc medium at 37 C. were tested immediately (initial numbers) or air dried and stored in 24-well tissue culture plates at room temperature for 21 days. After rehydration of bacteria in 500 l TSB-gluc, the number of viable cells remaining in each sample was determined by serially diluting cell mixtures and plating in duplicate. The average and SD of three independent assays were recorded. [0149] Triton Resistance Test

[0150] Gradient plates (0 to 0.5%) were used to compare resistance phenotypes for Triton X-100 (USB) (Mccallum et al., 2011). OmniTray single well plates (Nunc) were filled with triton containing agar and a slope was created when the media was still in liquid state. The triton gradient was obtained upon filling the plate with trypticase soy agar. Overnight cultures of the test strains were diluted in TSB-gluc to OD.sub.650nm=0.4 and the cell suspensions were swabbed across agar plates containing triton concentration gradients. Plates were incubated at 37 C. for 24 hours. Triton sensitivity is observed as a growth deficiency, primarily pronounced on the concentrated area of the plate. [0151] Cell Adhesion and Invasion Assay

[0152] Human hepatic Hep3B and epithelial A549 cells were used for this study. Adherence and invasion experiments were performed as described previously (Valle et al., 2003). Briefly, prior to use, wells were seeded with 0.310.sup.6 cells in 6-well tissue culture plates and 0.510.sup.5 cells in 24-well tissue culture plates. Once cells were confluent (1.210.sup.6 or 0.210.sup.5 cells per well) the culture medium was removed and cells were washed with Dulbecco's modified Eagle's medium (DMEM) (Gibco-BRL) plus 10% heat-inactivated fetal bovine serum. For adherence assays, overnight bacterial cultures were mixed vigorously and added to the monolayer cells in a multiplicity of infection of 10 in DMEM. Incubation was carried out 1 hour at 37 C. in 5% CO.sub.2. To remove non-adherent bacteria, cells were washed three times with sterile PBS. Eukaryotic cells were lysed with 0.1% Triton X-100. Before plating extracts were mixed vigorously by vortexing and sonication. The number of adherent bacteria (CFU) was determined by serial dilution, plating and CFU counts. For invasion assays, bacteria were added to the monolayer cells in a multiplicity of infection of 40 in DMEM. Incubation was carried out for 1 hour at 37 C. in 5% CO.sub.2. To kill extracellular bacteria, media was replaced with 2 ml of DMEM containing 50 g/ml of gentamicin (SIGMA) for 2 hour. Cell monolayers were washed three times with sterile PBS and lysed with 0.1% Triton X-100. Before plating extracts were mixed vigorously by vortexing and sonication. The number of intracellular bacteria was determined by serial dilution and plating. Experiments were performed in triplicate and repeated four times for each cell line. [0153] Mouse Infection Model

[0154] MW2 wild-type, XV, XIV (with agr) and XIV (with srrAB) S. aureus strains were cultured overnight in TSB plates and a single colony was resuspended into 5 ml of PBS to an optical density at 650nm of 0.2 (110.sup.8 cfu/ml). For the infection model, CD1 mice (Charles River) were inoculated by eye vain injection with 100 l (110.sup.7 cells) of these cultures of staphylococcal strains. Seven mice were used for each strain group. After one week mice were euthanized. Kidneys were removed, homogenized in PBS (9 ml per gram), and plated on tryptic soy agar for determination of the number of colony-forming units (CFU). [0155] Western Blot Analysis. Quantification of Protein A expression

[0156] Overnight cultures of the strains were diluted in TSB-gluc to an OD.sub.650nm=0.1 and 50 l of the diluted cultures were mixed with 1950 l of chemically defined medium HHWm (Hussain-Hastings-White modified medium) (Toledo-Arana et al., 2005) to inoculate sterile 24-well polystyrene microtitre plates (Costar). Plates were incubated at 37 C. for 24 hours, trying to mimic biofilm forming conditions. Eight ml of bacterial cultures were centrifuged and pellets were resuspended in 60 l PBS. Then, 2 l of Lysostaphin 1 mg/ml (Sigma) and 3 l of DNase I 1 mg/ml (Sigma) were added. After 2 h of incubation at 37 C. cell lysates were centrifuged and supernatants were collected. Protein concentration was determined with the Bio-Rad protein assay (Bio-Rad). Samples were adjusted to 3-5 g of total protein and one volume of Laemmli buffer was added. Total protein extracts were denatured by boiling at 100 C. for 5 min. Proteins were separated on 10% SDS-polyacrylamide gels and stained with 0.25% Coomassie brilliant blue R250 (Sigma) as loading controls. For Western blotting, proteins were transferred onto Hybond-ECL nitrocellulose membranes (Amersham Biosciences) by semi-dry electroblotting. Membranes were blocked overnight with 5% skimmed milk in phosphate-buffered saline (PBS) with 0.1% Tween 20, and incubated with goat anti-mouse secondary antibodies labelled with phosphatase alkaline (Sigma) diluted 1:2500 for 2 h at room temperature. Protein A was detected with the SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). [0157] Construction of the Bap-Snap-ClfA Quimeric Protein and Expression in S. aureus XVI

[0158] The signal peptide (SP) and the Bap-B domain of the bap gene were amplified from S. aureus V858, using the pairs of primers Bapori-1mB (5-GGATCCTTTATTTTGAGGTGAGTAAATATGGG-3, SEQ ID NO:157) containing a recognition sequence for BamHl/Bap-65c (5-GGCTCTTTAATTGAATTAGATGAAGCACTATTTTGTACTTCCGC-3, SEQ ID NO:158), and Bap-66m (5-GCGGAAGTACAAAATAGTGCTTCATCTAATTCAATTAAAGAGCC-3, SEQ ID NO:159)/Bap-63cK (5-GGTACCGGTGCCTTCTGGTGAATTTGG-3, SEQ ID NO:160) containing a recognition sequence for Kpnl. A second overlapping PCR was performed with primers Bapori-1mB (SEQ ID NO:157) and Bap-63cK (SEQ ID NO:160) to obtain a single fragment. To allow anchoring of amplified B-Bap domain to the bacterial cell wall, the R region of clumping factor A gene containing an LPXTG motif was amplified from S. aureus Newman strain using primer K-ClfA (5-GGTACCGAAATTGAACCAATTCCAGAGGAT-3, SEQ ID NO:161) with a recognition sequence for Kpnl, and primer ClfA-7cE (5-GAATTCTTACACCCTATTTTTTCGCC-3, SEQ ID NO:162) with a recognition sequence for EcoRl. The BamHI/Kpnl-restricted SP-B-Bap and Kpnl/EcoRl-restricted R-clfA were ligated into the shuttle vector pCN51 that contains the Pcad-cadC promoter (Charpentier et al., 2004), giving the pCN51-BapB plasmid. The SNAP-Tag was amplified from pSNAP-tag(T2)-2 plasmid (New England Biolabs) using the pair of primers Snap-Fw (5-GGTACCATGGACAAAGATTGCGAAATG-3, SEQ ID NO:163)/Snap-Rv (5-GGTACCTCCCAGACCCGGTTTACCCAG-3, SEQ ID NO:164). The Kpnl-restricted SNAP-tag was ligated into Kpnl-restricted pCN51-BapB plasmid. The final pCN51-BapB-SNAP plasmid contains Bap-B domain fused to a SNAP-tag followed by the C-terminal R domain of clumping factor A gene, expressed under the activity of a cadmium inducible promoter. [0159] BapB-SNAP-ClfA Protein Preparation and Western Blotting

[0160] Surface protein preparations were obtained from S. aureus cells under isosmotic conditions. Briefly, overnight cultures of the strains tested were diluted 1:100 in TSB-gluc, and 20 ml of this cell suspension were grown in 125 ml flasks until OD.sub.600nm reached 0.8. Ten ml of bacterial cultures were centrifuged and pellets were resuspended in 100 l of isosmotic digestion buffer (PBS containing 26% [wt/vol] raffinose). After addition of Lysostaphin 1 mg/ml (Sigma) and 3 l of DNase 1 1 mg/ml (Sigma), the preparations were incubated with shaking at 37 C. for 2 h. Protoplasts were sedimented by centrifugaction at 8,000 for 30 min with slow deceleration and supernatants were collected. Protein concentration was determined with the Bio-Rad protein assay (Bio-Rad). Samples were adjusted to 5-10 g/l of total protein and one volume of Laemmli buffer was added. Denaturation, separation in SDS-polyacrylamide gels, staining with Coomasie brilliant blue, protein transfer and membrane blocking were carried out as commented above in the section Western Blot analysis. For detecting the BapB-SNAP-ClfA protein, membranes were incubated with an anti-Bap rabbit poly-clonal antibody described previously (Cucarella et al., 2001) diluted 1:2,500 with TBS and immunoabsorbed with 5% skimmed milk. Alkaline phosphatase-conjugated goat anti-rabbit IgG (Sigma) diluted 1:10.000 in TBS-5% skimmed milk was used. The BapB-SNAP-ClfA protein was detected with the Amersham ECL Prime kit following the manufacturer's recommendations. [0161] BapB-SNAP-ClfA Imaging

[0162] For imaging, 10 l of bacteria cell suspension grown in flasks until OD.sub.600nm reached 0.8 were plated on coverslips. After fixation with 4% paraformamide, SNAP-surface Alexa-488 (1 mM) (New England Biolabs) was added and the cells were incubated for 10-20 min. The cells were washed three times to remove unreacted substrate. After this labeling, the cells were observed by fluorescent microscopy (Zeiss). [0163] Inhibition of S. aureus XV Growth by Repressing the Expression of WalKR TCSs

[0164] An overnight culture of the mutant was inoculated with or without IPTG at an optical density at 600 nm (0D600) equal to 0.005 and incubated at 37 C. After six generations without IPTG, growth was arrested, indicating that the system is essential at physiological temperatures. The number of CFU was monitored in the same assay by plating the cultures on TSB medium with or without IPTG. Although no cell lysis was observed in the absence of IPTG, the number of bacteria able to form colonies was drastically decreased, leading to 95% cell death 3 h after cessation of WalKR expression. These results indicate that WalKR expression is necessary for S. aureus under replicating growth conditions. [0165] Statistical Analysis.

[0166] The statistical analysis was performed with the GraphPad Prism program. Data corresponding to adhesion, invasion and kidney colonization assay were compared using the Mann-Whitney U tests. However, data corresponding to dessication resistance were compared usin Unpaired Student's t-test. Finally data corresponding to the survival assay were compared using Log-rank (Mantel-Cox) test. All the tests were two-tailed and the significance level was 5%.

Example 1

Construction and Characterization of the S. aureus XV Mutants

[0167] 1.1. Deletion of the Fifteen Non-Essential TCS in a Single Cell

[0168] The present inventors constructed S. aureus strains deficient in the fifteen non-essential TCS to uncover the range of phenotypes affected by TCS signaling in S. aureus biology. The deletions were done in two strain backgrounds, the S. aureus MW2 (Complete genome accessible with NCBI Access Number NC_003923, version NC_003923.1 Gl:21281729) and NCTC 8325 (Complete genome accessible with NCBI Access Number NC_7795, version NC_007795.1 GI:88193823) strains, both of them lacking the kdpED-like system present in some MRSA strains, applying subsequently the process explained in the previous section Allelic exchange of chromosomal genes. The sequence of generation of intermediate mutants, as can be deduced from Table 3, was:

[0169] MWA XV [0170] MW2 I: MW2 yhc [0171] MW2 II (MW2 I tcs3): MW2 yhc tcs3 [0172] MW2 III (MW2 II lyt): MW2 yhc tcs3 lyt [0173] MW2 IV (MW2 III gra): MW2 yhc tcs3 lyt gra [0174] MW2 V (MW2 IV sae): MW2 yhc tcs3 lyt gra sae [0175] MW2 VI (MW2 Vtcs7): MW2 yhc tcs3 lyt gra sae tcs7 [0176] MW2 VII (MW2 VI hss): MW2 yhc tcs3 lyt gra sae tcs7 hss [0177] MW2 VIII: (MW2 VII nre): MW2 yhc tcs3 lyt gra sae tcs7 hss nre [0178] MW2 IX: (MW2 VIII bra): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra [0179] MW2 XX (MW2 IX kdp): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra kdp [0180] MW2 XI (MW2 XX vra): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra kdp vra [0181] MW2 XII (MW2 XI pho): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra kdp vra pho [0182] MW2 XIII (MW2 XII arl): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra kdp vra pho arl [0183] MW2 XIV (MW2 XIII Aagr): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra kdp vra pho arl agr [0184] MW2 XV (MW2 XIV srr): MW2 yhc tcs3 lyt gra sae tcs7 hss nre bra kdp vra pho arl agr srr

[0185] 8325 XV [0186] 8325 I: 8325 yhc [0187] 8325 II (8325 I lyt): 8325 yhc lyt [0188] 8325 III (8325 II gra): 8325 yhc lyt gra [0189] 8325 IV (8325 III sae): 8325 yhc lyt gra sae [0190] 8325 V (8325 IV tcs7): 8325 yhc lyt gra sae tcs7 [0191] 8325 VI (8325 V tcs3): 8325 yhc lyt gra sae tcs7 tcs3 [0192] 8325 VII (8325 VI arl): 8325 yhc lyt gra sae tcs7 tcs3 arl [0193] 8325 VIII (8325 VII srr): 8325 yhc lyt gra sae tcs7 tcs3 66 arl srr [0194] 8325 IX (8325 VIII pho): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho [0195] 8325 X (8325 IX hss): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss [0196] 8325 XI (8325 X nre): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss nre [0197] 8325 XII (8325 XI bra): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss nre bra [0198] 8325 XIII (8325 XII vra): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss nre bra vra [0199] 8325 XIV (8325 XIII kdp): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss nre bra vra kdp [0200] 8325 XV (8325 XIV agr): 8325 yhc lyt gra sae tcs7 tcs3 arl srr pho hss nre bra vra kdp agr

[0201] As has been commented previously, the TCSs herein denominated tcs3 and tcs7 are those whose components are the HK and RR identified in the above mentioned S. aureus MW2 NC_003923) and 8325 (NC_007795) annotated genomes as: [0202] Tcs3 HK:

[0203] NC 003923.1 GI:21281729 (MW2) [0204] Gene: complement (233788 . . 235344);/locus_tag=MW_RS01035;/old_locus_tag=MW0199 [0205] CDS:complement(233788 . . 235344);/locus_tag=MW_RS01035;/old_locus_tag=MW0199;/inference=EXISTENCE: similar to AA; sequence:RefSeq:WP_000127992.1;/note=Derived by automated computational analysis using gene prediction method: Protein Homology.; codon_start=1;/transl_table=11;/product=histidine kinase;/protein_id=WP_000127997.1;/db_xref=GI:446050142

[0206] NC 007795.1 GI:21281729 (8325)

[0207] Gene: complement (202799 . . 204355);/locus_tag=SAOUHSC_00185;/db_xref=GenelD:3919499 [0208] CDS: complement(202799 . . 204355);/locus_tag=SAOUHSC_00185;/note=conserved hypothetical protein;/codon_start=1;/transl_table=11;/product=hypothetical protein;/protein_id=YP_498782.1;/db_xref=G1:88193995;/db_xref=GenelD:3919499

[0209] Tcs3 RR:

[0210] NC 003923.1 GI:21281729 (MW2) [0211] Gene: complement (233037 . . 233795);/locus_tag=MW_RS01030;/old_locus_tag=MW0198 [0212] CDS complement (233037 . . 233795);/locus_tag=MW_RS01030;/old_locus_tag=MW0198;/inference=EXISTENCE: similar to AA; sequence:RefSeq:WP_000477527.1;/note=Derived by automated computational analysis using; gene prediction method: Protein Homology.;/codon_start=1;/transl_table=11;/product=AraC family transcriptional regulator;/protein_id=WP_000477521.1;/db_xref=G1:446399666

[0213] NC 007795.1 GI:21281729 (8325); [0214] Gene: complement(202048 . . 202806);/locus_tag=SAOUHSC_00184;/db_xref=GenelD:3919498; [0215] CDS: complement (202048 . . 202806);/locus_tag=SAOUHSC_00184;/note=Response regulator receiver domain protein;/codon_start=1;/transl_table=11;/product=response regulator receiver domain-containing; protein;/protein_id=YP_498781.1;/db_xref=GI:88193994;/db_xref=GenelD:3919498;

[0216] Tcs7 HK:

[0217] NC 003923.1 GI:21281729 (MW2) [0218] Gene: 1321404 . . 1322495;/locus_tag=MW_RS06485;/old_locus_tag=MW1208 [0219] CDS: 1321404 . . 1322495;/locus_tag=MW_RS06485;/old_locus_tag=MW1208 ;/inference=EXISTENCE: similar to AA; sequence:RefSeq:WP_001556634.1;/note=Derived by automated computational analysis using;gene prediction method: Protein Homology.;/codon_start=1;/transl_table=11;/product=histidine kinase;/protein_id=WP_000670300.1;/db_xref=GI:446592954

[0220] NC 007795.1 GI:21281729 (8325) [0221] Gene: 1257226 . . 1258317;/locus_tag=SAOUHSC_01313;/db_xref=GenelD:3920139 [0222] CDS 1257226 . . 1258317;/locus_tag=SAOUHSC_01313;/note=Histidine kinase-, DNA gyrase B-, and HSP90-like; ATPase domain protein;/codon_start=1;/transl_table=11;/product=histidine kinase;/protein_id=YP_499843.1;/db.sub.xref=GI:88195043;/db_xref=GenelD:3920139

[0223] Tcs7 RR:

[0224] NC 003923.1 GI:21281729 (MW2) [0225] Gene: 1320669 . . 1321400;/locus_tag=MW_RS06480;/old_locus_tag=MW1207 [0226] CDS 1320669 . . 1321400;/locus_tag=MW_RS06480;/old_locus_tag=MW1207;/inference=EXISTENCE: similar to AA; sequence:RefSeq:WP_000603962.1;/note=Derived by automated computational analysis using; gene prediction method: Protein Homology.;/codon_start=1;/transl_table=11;/product=multidrug ABC transporter permease;/protein_id=WP_000603969.1;/db_xref=GI:446526623;

[0227] NC 007795.1 GI:21281729 (8325) [0228] Gene: 1258314 . . 1258916;/locus_tag=SAOUHSC_01314;/db_xref=GenelD:3920140 [0229] CDS: 1258314 . . 1258916;/locus_tag=SAOUHSC_01314;/note=conserved hypothetical protein;/codon_start=1;/transl_table=11;/product=hypothetical protein;/protein_id=YP_499844.1;/db_xref=GI:88195044;/db_xref=GenelD:3920140

[0230] Due to the particular combination of oligonucleotide primers used in this particular case for obtaining the above mentioned mutant strains (see Table 4), in some particular operons, not only the genes corresponding to the HK and RR component have been deleted, but also certain genes also present in the operon. This is the case of the genes: graX in the case of the operon corresponding to the TCS graRS, saeP and saeQ in the case of the operon corresponding to the TCS saeRS, agrB and agrD in the case of the operon agr, and nreA in the case of the operon of the TCS nreBC. For such reason, in the sequence of mutant generation until obtaining MW2 XV and 8325 XV strains, the names of the operons are indicated without indicating thereafter the initials of the HK and RR components.

[0231] The genomes of the resulting strains, S. aureus MW2 XV and S. aureus 8325 XV, were sequenced as described in the corresponding above section, to exclude the possibility that spontaneous mutations might have emerged during the successive deletion process. The absence of common mutations between both strains confirmed that the absence of the fifteen TCS does not select for a particular genetic change that influenced the behavior of the XV strains (Table 6 and 7).

TABLE-US-00006 TABLE 6 Spontaneous changes produced during the mutagenesis on the MW2 genome Position Mutation Annotation Gene Description 239,826 G.fwdarw.A A220T (GCA.fwdarw.ACA) pflA .fwdarw. formate acetyltransferase activating enzyme 379,604 G.fwdarw.T G249V (GGA.fwdarw.GTA) MW0330 .fwdarw. hypothetical protein 746,147 G.fwdarw.T E123* (GAA.fwdarw.TAA) nagA .fwdarw. N-acetylglucosamine-6- phosphate deacetylase 1,021,368 G.fwdarw.T D263Y (GAT.fwdarw.TAT) menB .fwdarw. naphthoate synthase 1,105,909 43545 bp Phage insertion rpmF.fwdarw.IisdB 50S ribosomal protein L3/hypothetical protein 1,267,878 G.fwdarw.T R475L (CGT.fwdarw.CTT) pnpA .fwdarw. polynucleotide phosphorylase/polyadenylase 1,283,489 G.fwdarw.C G502A (GGT.fwdarw.GCT) MW1169 .fwdarw. phosphodiesterase 1,691,188 G.fwdarw.T L10I (CTA.fwdarw.ATA) MW1565 hypothetical protein 2,639,004 GT.fwdarw.TG Y441S (TAC.fwdarw.TCA) rocA 1-pyrroline-5-carboxylate dehydrogenase 2,639,012 T.fwdarw.A T439S (ACA.fwdarw.TCA) rocA 1-pyrroline-5-carboxylate dehydrogenase * Position in the genome of the MW2 strain (NC_003923.1)

TABLE-US-00007 TABLE 7 Spontaneous changes produced during the mutagenesis on the 8325 genome Position* Mutation Annotation Gene Description 781,629 C.fwdarw.T Y258Y (TAC.fwdarw.TAT) eno .fwdarw. phosphopyruvate hydratase 787,913 C.fwdarw.T intergenic (+907/+415) smpB.fwdarw.ISA00806 SsrA-binding protein/ hypothetical protein 1,101,720 A.fwdarw.G intergenic (+149/237) SA01150.fwdarw.I.fwdarw.SA01152 cell division protein FtsZ/hypothetical protein 1,560,503 C.fwdarw.T A190T (GCT.fwdarw.ACT) SA01646 glucokinase 1,703,050 T.fwdarw.C intergenic (589/23) SA01802I.fwdarw.SA01803 hypothetical protein/ hypothetical protein *Position in the genome of the 8325 strain (NC_007795.1)

[0232] 1.2. Phenotypic Characterization of S. aureus XV Strains

[0233] It was then determined how the removal of the complete sensorial system affects the bacterial physiology, performing several comparative tests as described above.

[0234] Firstly, a comparative growth kinetics analysis was performed as described above in the corresponding methodological section. As can be seen in FIG. 3, S. aureus XV strains exhibited growth rates indistinguishable from the wild type under aerobic conditions at 37 C. and 44 C., while it showed a growth defect at 28 C.

[0235] With regard to dessication tolerance, S. aureus XV showed a decreased capacity for long-term survival during desiccation in the absence of nutrients (see FIG. 3E).

[0236] In standard biochemical and fermentation tests carried out with API Staph galleries and quantification of nitrite production, both XV mutant strains only exhibited a deficiency in the capacity to reduce nitrate to nitrite compared to wild type strain (see FIG. 3D).

[0237] The assays of susceptibility of XV mutants to cell lysis induced by a non-ionic detergent, Triton X-100, which reflects deficiencies in the regulation of autolytic activity (de Jonge et aL, 1991), revealed that XV mutants exhibited a much higher autolysis rate compared to the wild-type strain in Triton X-100 gradient plates (see FIG. 3F).

[0238] Next, because S. aureus protein A is a representative cell wall-associated exoprotein and a major determinant of virulence in S. aureus, the present inventors also compared the protein levels of protein A between the XV mutant and the wild type. The results confirmed that the expression of protein A in the XV mutant was lower than that in the wild type (see FIG. 3G).

[0239] Finally, antimicrobial susceptibility test against the panel of antibiotics routinely used in clinics for treatment of S. aureus infections revealed that MW2 XV mutant is more susceptible to oxacillin, levofloxacin, linezolid, nitrofurantoin and cefoxitin while the sensitivity for the rest of antibiotics tested remained similar. The 8325 XV mutant show higher susceptibility to bencilpenicillin, ampicillin, vancomycin and fosfomycin while the sensitivity for the rest of antibiotics tested remained similar. The results are summarized in Table 8 below.

TABLE-US-00008 TABLE 8 Antimicrobial susceptibility test against the panel of antibiotics routinely used in clinics for treatment of S. aureus infection ANTIBIOTICS MW2 MW2 XV 8325 8325 XV -lactam + + Cefoxitin detection + + Bencilpenicillin R R R (0.25) S (0.12) Ampicillin R R R S Cloxacillin R R S S Oxacillin R (4).sup.a R (2).sup.a S S Cefalotin R R S S Cefuroxime R R S S Gentamicin S S S S Tobramycin S S S S Ciprofloxacin S S S S Levofloxacin S (0.25).sup.a S (0.12).sup.a S S Inducible resistance to Clindamycin Azithromycin S S S S Clarithromycin S S S S Erithromycin S S S S Clindamycin S S S S Quinuspristin/Dalfopristin S S S S Linezolid S (2).sup.a S (1).sup.a S S Teicoplanin S S S S Vancomycin S S S (1).sup.a S (0.5).sup.a Tigecycline S S S S Fosfomycin S S S (16).sup.a S (8).sup.a Nitrofurantoin S (32).sup.a S (16).sup.a S S Fusidic acid S S S S Mupirocin S S S S Rifampicin S S S S Trimethoprim/Sulfamethoxazole S S S S Cefoxitin R S S S Chloramphenicol S S S S MRSA + + .sup.aMIC, Minimal inhibitory concentration; R: resistant; S: susceptible

[0240] 1.3. S. aureus XV Mutant is Attenuated in Vivo

[0241] An essential step in the establishment of S. aureus infection is the adhesion of bacteria to surface components of epithelial cells. Therefore, the present inventors analyzed the consequences of the absence of the TCS signaling on the adherence capacity of S. aureus to two different cell lines, a human lung epithelial (A549) and a human hepatocyte (Hep-3B) cell lines. Remarkably, as can be seen in FIG. 4A, XV mutant strains adhere to both cell lines as efficiently as the wild type strain (P>0.05). In contrast, XV mutant strain invaded both epithelial cell lines less efficiently than the wild type strain (FIG. 4B).

[0242] Because S. aureus is a leading cause of bacteraemia and sepsis, it was then investigated the contribution of TCS to invasive staphylococcal disease using a mouse renal abscess model. The results revealed that wild type S. aureus MW2 formed abscesses in kidneys with a mean bacterial load of 7.5910.sup.7 CFU per gram of tissue. In contrast, XV mutant was unable to form abscesses and displayed a >1000-fold (log 4.24) reduction in bacterial load as compared with the wild type counterpart (P<0.01; FIG. 4C and 4D).

[0243] The mice survival upon intravenous injection of 10.sup.7 CFU of wild type or XV strains was also analysed. All mice infected with the mutant strain survive after 50 days, while 50% of the animals inoculated with MW2 wild type strain died by day 21 post-infection (see FIG. 4E).

[0244] Taken together, these data indicated that TCS network is important for the pathogenesis of S. aureus infections, whether measured as the ability of S. aureus to form abscesses and persist in host tissues or lethal bacteremia.

Example 2

Sense Devoid S. aureus Mutant

[0245] It is well documented that WalKR is essential for S. aureus growth. To generate a mutant unable to sense environmental signals, the present inventors generated a derivative of S. aureus XV strain (named S. aureus XVI) in which the walKR operon was placed under the control of an inducible promoter, Pspac iso-propyl--D-thiogalactopyranoside (IPTG)-inducible promoter (Dubrac and Msadek, 2004).

[0246] In the absence of IPTG (that is, in the situation where the strain lacks the expression of the walKR operon from the chromosome), the S. aureus XVI strain only grows when it is complemented with a plasmid encoding the walR gene under the control of a constitutive promoter (pEl walR), giving rise to the XVI* strain.

[0247] In the absence of IPTG, XVI* strain exhibited growth rates indistinguishable from the XV strain a 37 C. y 28 C. (see FIGS. 5 A, B, C), showed similar capacity for long-term survival during desiccation in the absence of nutrients (FIG. 5E), susceptibility to triton X-100 (FIG. 5F), deficiency in the capacity to reduce nitrate to nitrite (FIG. 5D) and reduction in protein A expression than the XV strain (FIG. 5G).

[0248] Taken together, these results indicate that the constitutive expression of WalR in the absence of WalK sensor was sufficient to suppress lethality and that a S. aureus strain devoid of the TCSs is viable under laboratory conditions.

Example 3

Single TCS-Dependent Phenotypes

[0249] 3.1. Preparation and Phenotypic Characterization of Single TCS Mutants

[0250] All previous phenotypes related with TCS have been deduced from the comparison between the wild type and the corresponding isogenic mutant. This strategy allows the identification of phenotypes for which the presence of the corresponding TCS is necessary. However, identification of a TCS necessary for a phenotype does not necessarily imply that the TCS is sufficient to account for this particular phenotype in the absence of other TCS.

[0251] To identify the correlation between the phenotypes displayed by the XV strain with individual TCS, the present inventors prepared a collection of mutants of the MW2 strain, each one lacking one TCS, named MW2 4 to MW2 17 (see Table 3). The TCS deleted in each strain can be found in Table 3. Mutant MW2 l (MW2 yhc), whose construction was the first step for obtaining MW2 XV as described in Example 1 of the present application, was also a part of such collection of single mutants.

[0252] In order to identify those phenotypes that depend exclusively on a single TCS, the present inventors compared the phenotypes previously characterized in the XV strain with the collection of single mutants, the collection of sequential mutants and the collection of XV derivatives each complemented with a single TCS. The inventors hypothesized that if a single TCS controls a phenotype, then, the phenotype should be characteristic of the single mutant in this TCS, the sequential mutant after deletion of uniquely this TCS and the phenotype should be restored with the ectopic expression of this TCS in the XV strain.

[0253] The results revealed that growth defect under replicating conditions depends on the WalKR system, the defect on the growth at 28 C. depends on the SrrAB, the capacity to reduce nitrite to nitrate depends on NreBC, the expression of protein A depends on ArlRS, and susceptibility to triton X-100 depends on VraRS.

[0254] 3.2. Mutants with Ectopic Expression of a TCS Previously Deleted in the XV Strain

[0255] In order to confirm the adscription of a particular loss of function to a particular TCS in accordance with the results of the previous section, complementation of the XV mutant with the expression of such TCS was sought.

[0256] For the complementation purposes, the present inventors engineered a procedure in which each HK and RR is produced as an individual module that can be very easily combined with other modules into the same plasmid, as it is explained in the methodological section of Construction of plasmids expressing HKs and/or RRs under the control of different promoters. This strategy gave the inventors the possibility to express each RR either alone, together with the cognate HK pair or in combination with the non-cognate HKs. Depending on the selecting plasmid the expression of HK-RR pairs could be under the control of the cadmium-inducible promoter (P.sub.cad) (pEl and pCI plasmids) or the constitutive promoter P.sub.blz (pEW and pCW plasmids).

[0257] In all of the instances assayed in section 3.1., ectopic expression of a functional copy of the corresponding TCS was sufficient to fully rescue each phenotype in the XV strain (FIG. 7), as well as in the corresponding single mutant. Taken together, these results indicate that phenotypes of XV strain depend on individual TCS, and ectopic restoration of the corresponding TCS is sufficient to restore phenotypes associated to the XV strain.

Example 4

System-Based Analysis of Cross Talk in Vivo

[0258] 4.1. Testing of General Cross-Talk

[0259] Next, the inventors exploited the XV strain as well as the collections of single mutants to carry on a systematic analysis of the connectivity between HKs and RRs in vivo. Their reasoning was that if ectopic expression of a native RR is capable to activate the phenotype in the corresponding single mutant but it is unable to activate a specific phenotype in the XV strain, it implies the existence of cross talk from one or various non-cognate sensor kinases present in the single mutant but absent in the XV strain.

[0260] Based on the previously observed correlation between phenotypes and single TCS, MW2 mutants in srrAB, nreBC, arlRS, vraRS and the XV mutant were complemented with the corresponding SrrB, NreC, ArlR and VraR response regulators. The results are shown in FIG. 8.

[0261] Interestingly, ectopic expression of the native arlR gene was able to restore protein A expression in the single S. aureus arlRS mutant whereas complementation of XV mutant with the same plasmid did not. Contrary to this, complementation with SrrB, NreC and VraR response regulators could not activate their corresponding phenotype in the single mutant, indicating that cross-talked between these RR and non-cognate HK does not occur between non-cognate HK and these RR at least under laboratory growth conditions.

[0262] 4.2. Cross-Phosphorylation

[0263] The observation that ArlR restored protein A production in the absence of ArlS led the inventors to hypothesize that cross-talk from another HK to ArlR occurs in vivo. They first confirmed that phosphorylation of ArlR by ArlS was necessary to induce protein A expression (FIG. 9A). For that, the aspartic residue at position 52 in ArlR was replaced with a nonphosphorylatable alanine residue. Complementation of arlRS mutant with ArlRD52A allele could not activate protein A expression, suggesting that phospho-transfer to ArlR was necessary to induce protein A expression.

[0264] The phosphatase activity of the cognate HK is one of the mechanisms to prevent the non-specific phosphorylation of the cognate RR and it also provides a mechanism to reset the signal transduction to the baseline state. Therefore, cross-talk from non-cognate HK in the absence of the phosphatase catalytic activity of the cognate histidine kinase has been previously reported (Stock et al., 2000; Amemura et al., 1990). To test whether cross-talk of ArlR by a non-cognate HK could occur in the presence of the phosphatase activity of ArlS, ArlR was expressed together with the ArlSH242A allele, which contains an histidine-to-alanine substitution at position 242, and therefore it retains the phosphatase activity but it cannot phosphorylate ArlR. The resulting strain showed a level of expression of protein A similar to that of the strain complemented with ArlR alone, indicating that the phosphatase activity of ArlS cannot supress cross-talk from other histidine kinases to ArlR (FIG. 9A).

[0265] The present inventors next developed a system-level approach to identify cross-phosphorylation between HKs and ArlR in vivo. A set of fifteen plasmids each containing the arlR gene in combination with one HK was used to complement XV strain. This strategy allows to test the ability of non-cognate HKs to activate ArlR-dependent protein A in the absence of other sources of phosphotransfer to ArlR (FIG. 9B). In addition to ArlS itself, GraS is able to restore protein A expression in XV strain. This restoration was dependent on the phosphorylation of ArlR because substitution of ArlR wild type by the non-phosphorylatable ArlRD52A allele suppresses the cross-talk. It is also notable that cross-talk with ArlR occurs in the single arlRS mutant, implying that the GraS cross-phosphorylates ArlR even in the presence of its cognate GraR RR. Together, these results indicate that cross-talk between otherwise distinct TCSs (ArlR and GraS) through phosphotransfer occurs in vivo, though it seems to be limited to few specific TCS.

[0266] Since GraS is activated in the presence of colistin in the media, the present inventors hypothesized that cross-talk from GraS to ArlR might be induced in the presence of colistin (FIG. 9E). As expected, when GraS was stimulated with 50 g of colistin, activation of the expression of protein A was observed in the wild type and single arlRS mutant but not in arlRS graSR double mutant. Furthermore, activation of protein A expression was absent when the ArlR phosphate accepting aspartate was mutated.

[0267] Together these data indicate that natural activation of GraS with cationic peptides can cross-phosphorylate ArlR to activate protein A expression in vivo.

Example 5

Use of the XV Strain for Expressing Heterologous Proteins

[0268] Once verified that the S. aureus XV strains are robust and stable and easily ameneable to genetic manipulations, their applicability for synthetic biology applications and, particularly, for the expression of heterologous proteins was also confirmed.

[0269] To that aim, a vector for the expression of a quimeric protein Bap-Snap-CIfA was constructed from plasmid pCN51 as explained above. The final pEl-BapB-SNAP plasmid contains the Bap-B domain (N-terminal region of the Bap protein of S. aureus) fused to a SNAP-tag followed by the C-terminal R domain of the clumping factor A gene, expressed under the activity of a cadmium inducible promoter (see FIG. 10A).

[0270] Clumpling factor A is a surface-protein, which mediates binding of S. aureus to human fibrinogen. BapB, as previously explained, is a cell wall surface protein that seems to be involved in biofilm formation. The SNAP peptide tag allows the fluorescent labelling of the quimeric protein by means of a fluorophore which recognizes and associates with the SNAP peptide.

[0271] Both the MW2 wild type and MW2 XV strain were transformed with the pEl-BapB-SNAP plasmid and the resulting mutant was cultured under conditions where the protein could be expressed. The assays of protein preparation and Western blotting showed that the quimeric protein was expressed in both strains (see FIG. 10D).

[0272] The expression of the protein on the bacterial surface (see schematic representation on FIG. 10B) was verified by labelling with SNAP-surface Alexa-488 and fluorescent microscopy, being possible to detect fluorescent signal around the bacteria in both strains containing the plasmid, in the one derived from MW2 WT and in the MW2 XV strain transformed with the plasmid (see FIG. 100).

[0273] Finally, the aggregation experiments showed that the expression of the Bap-Snap-ClfA protein completely changes the aggregation phenotype of both the MW2 WT and the XV strains when such protein is expressed in the strains (see FIG. 10E), demonstrating the funcionality of the expressed protein.

[0274] The assays show that the XV strain is not only capable of producing heterologous proteins but also of including them in the membrane, when the heterologous protein contains appropriate sequence fragments for it. The expressed proteins are expected to be functional according to the assays.

Example 6

Use of the Mutant Strains for Identifying Candidates to S. aureus Antimicrobial Drugs through the Identification of Compounds Capable of Blocking Individual TCSs

[0275] In order to verify that inhibition assays with the addition or remotion of certain compounds can be used to identify compounds capable to act on individual TCSs and to block S. aureus growth, thus being candidate compounds for being used as antimicrobial drugs, comparative assays of the growth of the parental MW2 and its isogenic mutant XV were carried, after having placed, in both strains, the expression of the walKR operon was placed under the control of an inducible promoter, Pspac iso-propyl--D-thiogalactopyranoside (IPTG)-inducible promoter, thus generating the strains MW2 Pspac::walKR and XV Pspac::walKR (see Example 2).

[0276] An overnight culture of each mutant (MW2 Pspac::walKR and XV Pspac::walKR) was inoculated with or without IPTG at an optical density at 600 nm equal to 0.005 and incubated at 37 C. After six generations without IPTG, growth was arrested, indicating that the system is essential at physiological temperatures. The number of CFU was monitored in the same assay by plating the cultures on TSB medium with or without IPTG (see FIG. 11). Although no cell lysis was observed in the absence of IPTG, the number of bacteria able to form colonies was drastically reduced leading to 95% cell death 3 hours after cessation of growth, suggesting that in this conditions the absence of walKR expression is lethal for S. aureus. It can be seen that many bacteria lose viability after having been incubated in the absence of IPTG and they are not able to grow again even after a subsequent incubation in the presence of IPTG.

[0277] The conditions of growth without IPTG can be assimilated to those conditions where a strain is growing in presence of an inhibitor, which condition of inhibitor could be assayed following a procedure similar to the one used in the present assay. The use of the XV mutant would like to identify inhibitors capable to block the walKR system, which is indispensable for S. aureus life, among those compounds capable to block the growth of a XV strain with an intact walKR system. The use of other individual mutants or the reintroduction of each individual TCS in the XV mutants would allow the identification of compounds capable to block other individual TCS among those compounds provoking the cessation of growth when they are present, which growth can be observed when the compound is absent of the culture media of the same mutant strain.

[0278] This assay also demonstrate that using inducible regulatory elements (such as riboswitches, thermosensors, or transcriptional regulators) to control the expression of WalKR would allow the creation of a biosafe S. aureus strain able to grow only in the presence of the corresponding inductor.

Deposit of Microorganisms

[0279] The mutant strains MW2 XV, 8325 XV, MW2 XVI and 8325 XVI whose generation is disclosed in the present application were deposited in the Coleccion Espanola de Cultivos Tipos (Spanish Type Culture Collection), Parc Cientific Universitat de Valencia, Catedratico Agustin Escardino, 9, 46980 Paterna, Valencia, Spain, under the Budapest Treaty. The deposit date and assigned number are as follows:

TABLE-US-00009 Abbreviated Deposit Mutant strain name number Date of deposit S. aureus MW2 XV MW2 XV CECT 8756 30.sup.th Oct. 2014 S. aureus NCTC 8325 XV 8325 XV CECT 8755 30.sup.th Oct. 2014 S. aureus MW2 DeltaXVI MW2 XVI CECT 8915 3.sup.rd Jul. 2015 S. aureus NCTC 8325 8325 XVI CECT 8916 3.sup.rd Jul. 2015 DeltaXVI

[0280] The four strains were deposited indicating as contact person one of the inventors, Dr. Lasa, as employee of one of the applicants, acting for and on behalf of the two applicants, Universidad Pblica de Navarra and Consejo Superior de Investigaciones Cientificas.

REFERENCES

[0281] Alm, E., Huang, K., and Arkin, A. (2006) The evolution of two-component systems in bacteria reveals different strategies for niche adaptation. PLoS Comput Biol 2: e143-e143. [0282] Arnaud, M., Chastanet, A., and Dbarbouille, M. (2004) New Vector for Efficient Allelic Replacement in Naturally Nontransformable, Low-GC-Content, Gram-Positive Bacteria. Appl Environ Microbiol 70: 6887-6891. [0283] Baba, T., Takeuchi, F., Kuroda, M., Yuzawa, H., Aoki, K. I., Oguchi, A., et al. (2002) Genome and virulence determinants of high virulence community-acquired MRSA. The Lancet 359: 1819-1827. [0284] Bateman, B., Donegan, N., Jarry, T., Palma, M., and Cheung, A. (2001) Evaluation of a tetracycline-inducible promoter in Staphylococcus aureus in vitro and in vivo and its application in demonstrating the role of sigB in microcolony formation. Infect Immun 69: 7851-7857. [0285] Boyle-Vavra, S., Yin, S., Jo, D. S., Montgomery, C. P., and Daum, R. S. (2013) VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 57: 83-95. [0286] Brunskill, E. W., and Bayles, K. W. (1996) Identification and molecular characterization of a putative regulatory locus that affects autolysis in Staphylococcus aureus. J Bacteriol 178: 611-618. [0287] Capra, E. J., Perchuk, B. S., Skerker, J. M., and Laub, M. T. (2012) Adaptive Mutations that Prevent Crosstalk Enable the Expansion of Paralogous Signaling Protein Families. Cell 150: 222-232. [0288] Charpentier, E., Anton, A. I., Barry, P., Alfonso, B., Fang, Y., and Novick, R. P. (2004) Novel Cassette-Based Shuttle Vector System for Gram-Positive Bacteria. Appl Environ Microbiol 70: 6076-6085. [0289] Corrigan, R. M., Campeotto, I., Jeganathan, T., Roelofs, K. G., Lee, V. T., and Grndling, A. (2013) Systematic identification of conserved bacterial c-di-AMP receptor proteins. Proc Natl Acad Sci U S A 110: 9084-9089. [0290] Cucarella, C., Solano, C., Valle, J., Amorena, B., Lasa, I., and Penads, J. R. (2001) Bap, a Staphylococcus aureus surface protein involved in biofilm formation. J Bacteriol 183: 2888-2896. [0291] David, M. Z., and Daum, R. S. (2010) Community-associated methicillin-resistant Staphylococcus aureus : Epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev 23: 616-687. [0292] de Jonge, B. L., de Lencastre, H., and Tomasz, A. (1991) Suppression of autolysis and cell wall turnover in heterogeneous Tn551 mutants of a methicillin-resistant Staphylococcus aureus strain. J Bacteriol 173: 1105-1110. [0293] Deatherage, D. E., and Barrick, J. E. (2014) Identification of mutations in laboratory-evolved microbes from next-generation sequencing data using breseq. Methods Mol Biol 1151: 165-188. [0294] Delaune, A., Dubrac, S., Blanchet, C., Poupel, O., Mader, U., Hiron, A., et al. (2012) The WalKR system controls major staphylococcal virulence genes and is involved in triggering the host inflammatory response. Infect Immun 80: 3438-3453. [0295] Dubrac, S., and Msadek, T. (2004) Identification of genes controlled by the essential YycG/YycF two-component system of Staphylococcus aureus. J Bacteriol 186: 1175-1181. [0296] Dubrac, S., Boneca, I. G., Poupel, O., and Msadek, T. (2007) New insights into the WalK/WalR (YycG/YycF) essential signal transduction pathway reveal a major role in controlling cell wall metabolism and biofilm formation in Staphylococcus aureus. J Bacteriol 189: 8257-8269. [0297] Dunman, P. M., Murphy, E., Haney, S., Palacios, D., Tucker-Kellogg, G., Wu, S., et al. (2001) Transcription profiling-based identification of Staphylococcus aureus genes regulated by the agr and/or sarA loci. J Bacteriol 183: 7341-7353. [0298] Duthie, E. S., and Lorenz, L. L. (1952) Staphylococcal coagulase; mode of action and antigenicity. J Gen Microbiol 6: 95-107. [0299] Fournier, B., and Hooper, D. C. (2000) A new two-component regulatory system involved in adhesion, autolysis, and extracellular proteolytic activity of Staphylococcus aureus. J Bacteriol 182: 3955-3964. [0300] Fournier, B., Klier, A., and Rapoport, G. (2001) The two-component system ArlS-ArlR is a regulator of virulence gene expression in Staphylococcus aureus. Mol Microbiol 41: 247-261. [0301] Fridman, M., Williams, G. D., Muzamal, U., Hunter, H., Siu, K. W. M., and Golemi-Kotra, D. (2013) Two unique phosphorylation-driven signaling pathways crosstalk in Staphylococcus aureus to modulate the cell-wall charge: Stk1/Stp1 meets GraSR. Biochemistry 52: 7975-7986. [0302] Galperin, M. Y. (2010) Diversity of structure and function of response regulator output domains. Curr Opin in Microbiol 13: 150-159. [0303] Giraudo, A. T., Raspanti, C. G., Calzolari, A., and Nagel, R. (1994) Characterization of a Tn551-mutant of Staphylococcus aureus defective in the production of several exoproteins. Can J Microbiol 40: 677-681. [0304] Guckes, K. R., Kostakioti, M., Breland, E. J., Gu, A. P., Shaffer, C. L., Martinez, C. R., et al. (2013) Strong cross-system interactions drive the activation of the QseB response regulator in the absence of its cognate sensor. Proc Natl Acad Sci U S A 110: 16592-16597. [0305] Hanssen, A.-M., and Ericson Sollid, J. U. (2006) SCC mecin staphylococci: genes on the move. FEMS Immunol Med Microbiol 46: 8-20. [0306] Holland, L. M., O'Donnell, S. T., Ryjenkov, D. A., Gomelsky, L., Slater, S. R., Fey, P. D., et al. (2008) A Staphylococcal GGDEF Domain Protein Regulates Biofilm Formation Independently of Cyclic Dimeric GMP. J Bacteriol 190: 5178-5189. [0307] Kim, L., Mogk, A., and Schumann, W. (1996) A xylose-inducible bacillus subtilis integration vector and its application. Gene 181: 71-76. [0308] Kinkel, T. L., Roux, C. M., Dunman, P. M., and Fang, F. C. (2013) The Staphylococcus aureus SrrAB Two-Component System Promotes Resistance to Nitrosative Stress and Hypoxia. mBio 4: e00696-13-e00696-13. [0309] Kofoid, E. C., and Parkinson, J. S. (1988) Transmitter and Receiver Modules in Bacterial Signaling Proteins. Proc Natl Acad Sci USA 85: 4981-4985. [0310] Kolar, S. L., Nagarajan, V., Oszmiana, A., Rivera, F. E., Miller, H. K., Davenport, J. E., et al. (2011) NsaRS is a cell-envelope-stress-sensing two-component system of Staphylococcus aureus. Ann Rev Microbiol 157: 2206-2219. [0311] Kuroda, M., Kuroda, H., Oshima, T., Takeuchi, F., Mori, H., and Hiramatsu, K. (2003) Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus. Mol Microbiol 49: 807-821. [0312] Lasa, I., Toledo-Arana, A., Dobin, A., Villanueva, M., de Los Mozos, I. R., Vergara-Irigaray, M., et al. (2011) Genome-wide antisense transcription drives mRNA processing in bacteria. Proc Natl Acad Sci USA 108: 20172-20177. [0313] Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., et al. (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25: 2078-2079. [0314] Li, M., Lai, Y., Villaruz, A.E., Cha, D. J., Sturdevant, D. E., and Otto, M. (2007) Gram-positive three-component antimicrobial peptide-sensing system. Proc Natl Acad Sci U S A 104: 9469-9474. [0315] Lowy, F. (1998) Staphylococcus aureus infections. N Engl J Med 339: 520-532. [0316] Maestro, B., Novakov, L., Hesek, D., Lee, M., Leyva, E., Mobashery, S., et al. (2011) Recognition of peptidoglycan and |.sup.2-lactam antibiotics by the extracellular domain of the Ser/Thr protein kinase StkP from Streptococcus pneumoniae. FEBS Letters 585: 357-363. [0317] Marmur, J. (1961) A procedure for isolation of deoxyribonucleic acid from microorganisms. J Mol Biol 3: 208-218. [0318] Martin, P. K., Li, T., Sun, D. X., Biek, D. P., and Schmid, M. B. (1999) Role in cell permeability of an essential two-component system in Staphylococcus aureus. J Bacteriol 181: 3666-3673. [0319] Mccallum, N., Meier, P. S., Heusser, R., and Berger-Bachi, B. (2011) Mutational analyses of open reading frames within the vraSR operon and their roles in the cell wall stress response of Staphylococcus aureus. Antimicrob Agents Chemother 55: 1391-1402. [0320] Podgornaia, A. I., and Laub, M. T. (2013) Determinants of specificity in two-component signal transduction. Curr Opin in Microbiol 16: 156-162. [0321] Pragman, A., Yarwood, J., Tripp, T., and Schlievert, P. (2004) Characterization of virulence factor regulation by SrrAB, a two-component system in Staphylococcus aureus. J Bacteriol 186: 2430-2438. [0322] Queck, S. Y., Jameson-Lee, M., Villaruz, A. E., Bach, T. H. L., Khan, B. A., Sturdevant, D. E., et al. (2008) RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus. Mol Cell 32: 150-158. [0323] Rice, K. C., Mann, E. E., Endres, J. L., Weiss, E. C., Cassat, J. E., Smeltzer, M. S., and Bayles, K. W. (2007) The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus. Proc Natl Acad Sci U S A 104: 8113-8118. [0324] Rissman, A. I., Mau, B., Biehl, B. S., Darling, A. E., Glasner, J. D., and Perna, N. T. (2009) Reordering contigs of draft genomes using the Mauve Aligner. Bioinformatics 25: 2071-2073. [0325] Ruiz de Los Mozos, I., de Los Mozos, I. R., Vergara-Irigaray, M., Segura, V., Villanueva, M., Bitarte, N., et al. (2013) Base pairing interaction between 5- and 3-UTRs controls icaR mRNA translation in Staphylococcus aureus. PLoS Genetics 9: e1004001-el 004001. [0326] Schenk, S., and Laddaga, R. (1992) Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol Lett 73: 133-8. [0327] Schlag, S., Fuchs, S., Nerz, C., Gaupp, R., Engelmann, S., Liebeke, M., et al. (2008) Characterization of the oxygen-responsive NreABC regulon of Staphylococcus aureus. J Bacteriol 190: 7847-7858. [0328] Sharma-Kuinkel, B. K., Mann, E. E., Ahn, J. S., Kuechenmeister, L. J., Dunman, P. M., and Bayles, K. W. (2009) The Staphylococcus aureus LytSR Two-Component Regulatory System Affects Biofilm Formation. J Bacteriol 191: 4767-4775. [0329] Siryaporn, A., and Goulian, M. (2008) Cross-talk suppression between the CpxA-CpxR and EnvZ-OmpR two-component systems in E. coli. Mol Microbiol70: 494-506. [0330] Skerker, J. M., Prasol, M. S., Perchuk, B. S., Biondi, E. G., and Laub, M. T. (2005) Two-Component Signal Transduction Pathways Regulating Growth and Cell Cycle Progression in a Bacterium: A System-Level Analysis. PLoS Biol3: e334. [0331] Stock, A. M., Robinson, V. L., and Goudreau, P. N. (2000) Two-component signal transduction. Annu Rev Biochem 69: 183-215. [0332] Sun, F., Ji, Q., Jones, M. B., Deng, X., Liang, H., Frank, B., et al. (2012) AirSR, a [2Fe-2S] cluster-containing two-component system, mediates global oxygen sensing and redox signaling in staphylococcus aureus. J Am Chem Soc 134: 305-314. [0333] Sun, H., Yang, Y., Xue, T., and Sun, B. (2013) Modulation of cell wall synthesis and susceptibility to vancomycin by the two-component system AirSR in Staphylococcus aureus NCTC8325. BMC Microbiol 13: 286. [0334] Toledo-Arana, A., Dussurget, O., Nikitas, G., Sesto, N., Guet-Revillet, H., Balestrino, D., et al. (2009) The Listeria transcriptional landscape from saprophytism to virulence. Nature 459: 950-956. [0335] Toledo-Arana, A., Merino, N., Vergara-Irigaray, M., Dbarbouill, M., Penads, J. R., and Lasa, I. (2005) Staphylococcus aureus develops an alternative, ica-independent biofilm in the absence of the arlRS two-component system. J Bacteriol 187: 5318-5329. [0336] Torres, V., Stauff, D., Pishchany, G., Bezbradica, J., Gordy, L., lturregui, J., et al. (2007) A Staphylococcus aureus Regulatory System that Responds to Host Heme and Modulates Virulence. Cell Host & Microbe 1: 109-119. [0337] Ubeda, C., Maiques, E., Tormo, M. A., Campoy, S., Lasa, I., Barbe, J., et aL (2007) SaPI operon I is required for SaPI packaging and is controlled by LexA. Mol Microbiol 65: 41-50. [0338] Ulrich, M., Bastian, M., Cramton, S. E., Ziegler, K., Pragman, A. A., Bragonzi, A., et al. (2007) The staphylococcal respiratory response regulator SrrAB induces ica gene transcription and polysaccharide intercellular adhesin expression, protecting Staphylococcus aureus from neutrophil killing under anaerobic growth conditions. Mol Microbiol 65: 1276-1287. [0339] Valle, J., Toledo-Arana, A., Berasain, C., Ghigo, J.-M., Amorena, B., Penads, J. R., and Lasa, I. (2003) SarA and not sigmaB is essential for biofilm development by Staphylococcus aureus. Mol Microbiol 48: 1075-1087. [0340] Weidenmaier, C., Goerke, C., and Wolz, C. (2012) Staphylococcus aureus determinants for nasal colonization. Trends in Microbiology 20: 243-250. [0341] White, A. P., and Surette, M. G. (2006) Comparative Genetics of the rdar Morphotype in Salmonella. J Bacteriol 188: 8395-8406. [0342] Xue, T., You, Y., Hong, D., Sun, H., and Sun, B. (2011) The Staphylococcus aureus KdpDE two-component system couples extracellular K +sensing and agr signaling to infection programming. Infect Immun 79: 2154-2167. [0343] Yarwood, J., McCormick, J., and Schlievert, P. (2001) Identification of a novel two-component regulatory system that acts in global regulation of virulence factors of Staphylococcus aureus. J Bacteriol 183: 1113-1123. [0344] Zhao, L., Xue, T., Shang, F., Sun, H., and Sun, B. (2010) Staphylococcus aureus Al-2 quorum sensing associates with the KdpDE two-component system to regulate capsular polysaccharide synthesis and virulence. Infect Immun 78: 3506-3515.