PARASITIC PHYTOPHTHORA-DERIVED OMEGA-3 FATTY ACID DESATURASE FOR SYNTHESIZING POLYUNSATURATED FATTY ACIDS, CARRIER CONTAINING FATTY ACID DESATURASE, RECOMBINANT MICROORGANISMS, AND APPLICATION THEREOF

20190233908 ยท 2019-08-01

    Inventors

    Cpc classification

    International classification

    Abstract

    It relates to w-3 fatty acid desaturase for the synthesis of pufas from phytophthora parasitica, a plasmid containing the same, a recombinant microorganism containing the plasmid and its application. The invention also provides the use of the above ?-3 fatty acid desaturase in the biosynthesis of PUFAs, especially to catalyze C20:4.sup.?5,8,11,14 to C20:5.sup.?5,8,11,14,17 at normal temperature, with catalytic efficiency 65%. The recombinant strain reached 31.5% of the total fatty acid, and the conversion rate to AA was up to 77.6%,

    Claims

    1-20. (canceled)

    21. A recombinant Mortierella alpine MA-oPpFADS17-4 strain, overexpressing ?-3 fatty acid desaturase from Phytophthora parasitica, was preserved in China General Microbiological Culture Collection Center (CGMCC) since Jan. 18, 2016, with the accession number CGMCC No. 11820, the address of CGMCC being No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, the Institute of Microbiology, Chinese Academy of Science.

    22. The recombinant Mortierella alpine according to claim 21, characterized in that the said ?-3 fatty acid desaturase oPpFADS17m gene is optimized according to the codon usage bias of Mortierella alpine, derived from ?-3 fatty acid desaturase gene from Phytophthora parasitica, and has nucleic sequence shown as SEQ ID NO.5.

    23. The recombinant Mortierella alpine according to claim 21, characterized in that the strain is constructed by using the recombinant plasmid pBIG2-ura5s-oPpFADS17 containing ?-3 fatty acid desaturase oPpFADS17m gene to convert A. tumefaciens and then to the M. alpina uracil auxotrophic strain with A. tumefaciens containing transformation plasmids pBIG2-ura5s-oPpFADS17.

    24. The recombinant M. alpine according to claim 23, characterized in that M. alpina uracil auxotrophic strain is a strain that can inactivate the ura5 encoding orotate phosphoribosyltransferase (OPRTase) in M. alpina ATCC32222.

    25. A method for constructing the recombinant M. alpine according to claim 21, comprising the following steps: a) according to the natural origin of ?-3 fatty acid desaturase in Phytophthora parasitica and condon usage bias of M. alpina, artificially synthesizing the optimized ?-3 fatty acid desaturase gene oPpFADS17m, shown as SEQ ID NO.5; b) constructing the recombinant plasmid pBIG2-ura5s-oPpFADS17; c) transforming the obtained recombinant plasmid pBIG2-ura5s-oPpFADS17 into A. tumefaciens; d) transforming M. alpina uracil auxotrophic strain with A. tumefaciens containing the recombinant plasmid pBIG2-ura5s-oPpFADS17; e) screening and identifying the transformed strains and obtaining a special EPA producing recombinant M. alpina MA-oPpFADS17-4 with overexpression of ?-3 fatty acid desaturase oPpFADS17m.

    26. The method according to claim 25, characterized in that in the said step c), A. tumefaciens is A. tumefaciens C58C1.

    27. The method according to claim 25, characterized in that, in the said step d), M. alpina uracil auxotrophic strain is M. alpina MAU1, which was preserved in China General Microbiological Culture Collection Center (CGMCC) since Nov. 1, 2013, with the accession number CGMCC No. 8414.

    28. The method for constructing the recombinant M. alpine strain according to claim 24, characterized in that in the said step e), the method for screening and identifying the transformed strains comprises the following steps: 1) scouring the surface of GY medium with 3 mL saline, and collecting liquid in a sterile 1.5 mL centrifuge tube and then filtering with 25 ?m filter membrane; 2) counting the spore concentration with a haemacytometer and adjusting the concentration to 10.sup.8/100 ?L, 10.sup.6/100 ?L and 10.sup.4/100 ?L each, and each with 200 ?L coating on the GY-CS tablet containing 100 ?g/mL of cefotaxime and 100 ?g/mL cefotaxime, then culturing at 25? C. for 2-3 days in the dark; 3) picking the fungal mycelium by sterile forceps and placing them on a SC-CS plate containing 100 ?g/mL of the mycin and 100 ?g/mL cefotaxime, and then culturing at 25? C. for 2-3 days in the dark; 4) observing the growth of M. alpina on the plate, and picking the mycelium on the SC-CS plate onto the GY slope; 5) culturing the M. alpine strain spores in the above step 4) on the GY medium for 3 times; 6) identifying the strains with hereditary stability as recombinant M. alpina with overexpression of ?-3 fatty acid desaturase oPpFADS17m, and keeping it on the GY slope; 7) extracting the genomic DNA of the recombinant M. alpine, and designing a pair of primers with specific promoters and terminators for PCR verification; TABLE-US-00013 P1(sense): CACACACAAACCTCTCTCCCACT P2(antisense): CAAATGAACGTATCTTATCGAGATCC; 8) keeping the recombinant M. alpina on the GY slope.

    29. The use of the recombinant M. alpine strain MA-oPpFADS17-4 according to claim 21 or those obtained according to the method according to claim 25 in the production of fatty acid.

    30. The use of the recombinant M. alpine strain MA-oPpFADS17-4 according to claim 29, the fatty acid is EPA.

    Description

    DESCRIPTION OF THE ATTACHED DRAWINGS

    [0050] FIG. 1 is the target gene fragment of PCR amplification, in which M is Marker, Lane 1 is oPaFADS17 gene fragment (1080 bp), Lane 2 is oPpFADS17y gene fragment (1086 bp), and Lane 3 is oAiFADS17y gene fragment (1095 bp);

    [0051] FIG. 2 is the schematic diagram of recombinant Saccharomy cescerevisiae, in which M is Marker, Lane 1 is a carrier containing empty plasmid, Lane 2-4 is the 1, 2, 3 transformants of INVSc 1-oPaFADS17; Lane 5-7 is the 1, 2, 3 transformants of INVSc 1-oPpFADS17; Lane 8-10 is the 1, 2, 3 transformants of INVSc 1-oAiFADS17.

    [0052] FIG. 3 is the transcriptional level of the Saccharomyces cerevisiae transformants, in which Lane 1 is a carrier containing empty plasmid, Lane 2-4 is the 1, 2, 3 transformants of INVSc 1-oPpFADS17; Lane 5-7 is the 1, 2, 3 transformants of INVSc 1-oAiFADS17; Lane 8-10 is the 1, 2, 3 transformants of INVSc 1-oPaFADS17.

    [0053] FIG. 4 is the result of gas phase detection of transformants of Saccharomyces cerevisiae in which A is INVSc 1-oPpFADS17, B is INVSc 1-oAiFADS17, and C is INVSc 1-oPaFADS17.

    [0054] FIG. 5 is the schematic diagram of construction of the plasmid pBIG2-ura5 s-oPpFADS17.

    [0055] FIG. 6 is the schematic diagram of agarose gel electrophoresis of identification of the recombinant M. Alpina that overexpress oPpFADS17m gene, in which M is marker; 1 is negative control; 2-6 is No. 1-5 transformant FIG. 7 is the expression level of ?-3 fatty acid desaturase gene of wild type M. alpina and 5 recombinant M. alpine, in which, M. alpina is wild type M. alpina (control); 1-5 are representative of recombinant M. alpine MA-oPpFADS17-1, MA-oPpFADS17-2, MA-oPpFADS17-3, MA-oPpFADS17-4, and MA-oPpFADS17-5.

    EMBODIMENTS

    [0056] The following Embodiments further illustrate the present invention. The experimental methods without indicating specific conditions in the followings examples will be performed generally in accordance with the manual of molecular cloning experiments.

    [0057] The present invention relates to the following medium:

    [0058] Broth medium: 20 g/L glucose, 5 g/L yeast extract, 1 g/L potassium dihydrogen phosphate, 0.25 g/L magnesium sulfate heptahydrate, 10 g/L potassium nitrate, pH 6.

    [0059] MM solid medium: 1.74 g/L potassium hydrogen phosphate, 1.37 g/L potassium dihydrogen phosphate, 0.146 g/L sodium chloride, 0.49 g/L magnesium sulfate heptahydrate, 0.078 g/L calcium chloride, 0.0025 g/L ferrous sulfate, 0.53 g/L ammonium sulfate, 1.8 g/L glucose, 0.5% glycerol, 20 g/L agar, pH 6.8.

    [0060] The IM medium was a MM medium containing additional 200 ?M acetyl syringone (AS).

    [0061] SC solid medium: 20 g/L glucose, 5 g/L yeast nitrogen source (without amino acid and ammonium sulfate), 1.7 g/L ammonium sulfate, 60 mg/L isoleucine, 60 mg/L leucine, 60 mg/L phenylalanine, 50 mg/L threonine, 40 mg/L lysine, 30 mg/L tyrosine, 20 mg/L adenine, 20 mg/L arginine, 20 mg/L histidine, 10 mg/L methionine, 20 g/L agar, pH 6.8

    [0062] The SC-CS medium is a SC solid medium with 100 ?g/mL Spectinomycin and 100 ?g/mL Cefotaxime Sodium.

    [0063] SC selective medium: 6.7 g/L yeast nitrogen source (without amino acid, while with ammonium sulfate), 20 g/L glucose, 0.1 g/L (respectively, adenine, arginine, cysteine, leucine, lysine, threonine and tryptophan), and 0.05 g/L (respectively, aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine and valine), 20 g/L agar powder.

    [0064] GY solid medium: 20 g/L glucose, 10 g/L yeast extract, 2 g/L potassium nitrate, 1 g/L phosphate dihydrogen sodium, 3 g/L magnesium sulfate heptahydrate, 20 g/L agar, pH 6.8.

    [0065] The GY-CS medium was a GY solid medium containing additional 100 ?g/mL Spectinomycin and 100 ?g/mL Cefotaxime Sodium.

    [0066] SOC resuscitation medium: 20 g/L peptone, 5 g/L yeast powder, 0.5 g/L NaCl, 2.5 mM KCl, 10 mM MgCl.sub.2, 20 mM glucose.

    [0067] LB solid medium: 10 g/L peptone, 5 g/L yeast powder, 10 g/L NaCl, 20 g/L agar.

    [0068] YPD medium: 10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose. 20 g/L agar is added when a solid medium is involved.

    [0069] 1 Recombinant S. cerevisiae Expressing the ?-3 Fatty Acid Desaturase from Phytophthora parasitica

    Example 1: Determination of ?-3 Fatty Acid Desaturase with a Preference for 20C at Normal Temperature

    [0070] Five kinds of known ?-3 fatty acid desaturase sequences (gene OPIN 17, SDD 17, PsD 17, PrD 17 and PaD 17) with a preference for 20C at normal temperature were compared in NCBI library. According to the analysis of sequence similarity and homology, two gene sequences of ?-3 fatty acid desaturase, which were similar to the known sequences, were screened out. They were derived from Phytophthora parasitica and Aphanomyces invadans respectively. The gene numbers are XM_008906963 and XM_008870610, respectively. According to the interpretation of the NCBI library, these two sequences belong to fatty acid desaturase, but there is no more detailed comments on their specific function.

    [0071] Clustal W2 was used to compare the amino acid sequence with 5 kinds of known ?-3 fatty acid desaturase sequences. It is found that the natural genes from Phytophthora parasitica and the gene from Aphanomyces invadans have 3 His-box regions. The similar His-box region protein sequence is shown in the table 1. The results of TMHMM analysis showed that the two sequences had transmembrane domains similar to known sequences.

    TABLE-US-00002 TABLE 1 amino acid sequences of 3 His-box regions of ?-3 fatty acid desaturase with a preference for 20 C. at normal temperature. species Gene Name Gene number His-box I His-box II His-box III Phytophthora infestans OPIN 17 CAJ30870 HDAGH HRHHH HQIHH Saprolegnia diclina sdd 17 AY373823 HDCGH HRHHH HQVHH Phytophthora sojae PsD 17 FW362214.1 HDAGH HRHHH HQIHH Phytophthora ramorum PrD 17 FW362213.1 HDAGH HRHHH HQIHH Pythium aphanidermatum PaD 17 FW362186.1 HDCGH HRHHH HQIHH Phytophthora parasitica Hypothetical XM_008906963 HDAGH HEHHH HQIHH protein AphaNomyces invadans Hypothetical XM_008870610 HDCGH HRHHH HQVHH protein

    Example 2: Construction of Recombinant Expression Vector

    [0072] 1. Obtaining the Target Gene

    [0073] Because the codon usage bias of sequence derived from Phytophthora parasitica, AphaNomyces invadans and Pythium aphanidermatum are different from that of Saccharomyces cerevisiae, according to the codon usage bias of eukaryotes, codon optimization was performed by Genscript OptimumGene? system. The optimized gene oPpFADS17y (oPpFADS17 in CN 2015109025795), oAiFADS17y (oAiFADS17 in CN 2015109025795) and oPaFADS17 (as a positive control) as SEQ ID NO. 3, SEQ ID 9, and 11 are respectively artificially synthesized, and then connected to carrier pUC57-simple (PUC57-simple in CN 2015109025795) to obtain pUC57-oPpFADS17, pUC57-oAiFADS17 and pUC57-oPaFADS17 respectively, which are preserved in E. coli Top 10.

    [0074] Primers were designed, and each pair of primers were added with enzyme sites EcoR I and Xho I (underline). The plasmid pUC57-oPpFADS17, pUC57-oAiFADS17 and pUC57-oPaFADS17 were used as templates, and the corresponding primers and KOD high fidelity polymerase were used to amplify the target gene by PCR. PCR program: 94? C. 30 s, 55? C. 30 s, 68? C. 1.5 min, 30 cycles, 68? C. 10 min. The PCR product was purified and the purified product was verified by agarose gel electrophoresis. The result is in FIG. 1.

    [0075] The sequences of primers used to amplify the target gene are as follows:

    TABLE-US-00003 oPpFADS17yF ctaattgaattcATGGCAACCAAGCAAGC oPpFADS17yR cgattctcgagTTAAGTTGACTTGGTTTTAACAGCG oAiFADS17yF acaatggaattcATGCCATCCCCTAAAGCCAC oAiFADS17yR cctgatctcgagTTATAAGGTCTTTTTAACTGAGTTTGCTCT oPaFADS17F catgtagaattcATGGCTTCGTCCACCGTTG oPaFADS17R ttacgactcgagTTAGTTAGCCTTGGTCTTGGCAG

    [0076] 2. Enzyme Digestion Reaction:

    [0077] At the temperature of 37? C., the target fragment and vector pYES2/NT C (PYES2/NT C in CN 2015109025795) are digested with the restrictive endonuclease EcoR I and Xho I. Enzyme digestion system: 2 ?L EcoR I, 2 ?L Xho I, 30 ?L target gene/vector, 10 ?L cutsmart Buffer, 56 ?L deionized water, incubating at 37? C. for 12 h. The digestion products thus obtained were recovered with Thermo Scientific GeneJET gel extraction kit before preserved at ?20? C.

    [0078] In which, endonuclease buffer solution 10?cutsmart Buffer: 500 mM potassium acetate, 200 mM Tris-acetate buffer, 100 mM magnesium acetate, 1000 g/mL bovine serum albumin, pH 7.9.

    [0079] 3. Ligation Reaction:

    [0080] The purified target fragment oPpFADS17y, oAiFADS17y and oPaFADS17 and vector pYES2/NT C were ligated with T4 ligase respectively, and then incubated at 4? C. for 12 h. The ligation system is: 1 ?L vector pYES2/NT C (50 ng/L), 75-150 ng fragment, 1 ?L buffer, 1 ?L T4 ligase, with addition of water to 10 ?L.

    [0081] In which, 10?ligase buffer: 660 mM Tris-hydrochloric acid buffer (pH 7.6), 66 mM magnesium chloride, 100 mM DTT, 1 mM adenosine triphosphate.

    [0082] 4. Transformation of Escherichia coli TOP 10 Competent Cell

    [0083] The method for transforming is as follows:

    [0084] (1) In the aseptic state, 100 ?L of the competent cells were taken, and 1-2 ?L ligation product was added and the mixture was blown and mixed well.

    [0085] (2) The competent cells in the above steps were moved into the electric rotating cup to avoid bubbles.

    [0086] (3) The rotating cup was put into Bio-Rad electric rotary instrument and adjusted into a propriate preset program position. The electrical transformation was carried out according to the operation instructions of the instrument at the voltage condition of 1.8 kV.

    [0087] (4) The transformed competent cells were transferred into a centrifugation tube containing 1 mL SOC medium and incubated for 1 h at 37? C. and 150 rpm.

    [0088] (5) A LB solid medium plate containing 100 ?g/mL ampicomycin was coated with 200 ?L of the obtained product, and reversed and incubated at 37? C. overnight.

    [0089] The positive transformants were picked up, the plasmids were extracted and sequenced, and the sequencing results were completely matched with the gene sequences, indicating that the ligation was successful and the expression vectors were obtained, named pYES2/NT C-oPpFADS17, pYES2/NT C-oAiFADS17, pYES2/NT C-oPpFADS17 respectively.

    [0090] A Saccharomyces cerevisiae INVSc 1 (purchased from Invitrogen, USA) was cloned in 10 mL YPD medium and cultivated at 30? C. overnight. OD.sub.600 was measured and transferred to a 50 mL medium to make the OD value being 0.4, then for another 2-4 h. It was centrifuged at 2500 RPM for 3 min, and 40 mL 1?TE suspension. Then at 2500 RPM centrifugation for 3 min, 2 mL 1?LiAc/0.5?TE suspension, incubated for 10 min at room temperature.

    [0091] For each transformant of example 2, the 100l of yeast suspension in the last step was added to the transformants, and 1 ?g recombinant plasmid vector DNA and 100 ?g salmon sperm carrier DNA were added. In order to get the best conversion efficiency, the carrier DNA was denatured repeatedly before each transformation, with boiling water bath for 2 min and ice bath for 2 min, repeated four times.

    [0092] In which, 1?TE: 10 mM Tris-hydrochloric acid buffer (PH=8.0), 1 mM EDTA (PH=8.0); 1?LiAc:10 mM lithium acetate.

    Example 4: PCR Verification of Saccharomyces cerevisiae Transformant

    [0093] The corresponding primers were used for PCR identification. The primers are as follows:

    TABLE-US-00004 T7 TAATACGACTCACTATAGGG T7terminator TCGGTTAGAGCGGATGTG

    [0094] PCR reaction system are as follows: 7 ?L dd H.sub.2O, 10 ?L 10?Taq MIX, 1 ?L universal primer T7, 1 ?L universal primer T7 terminator, 1 ?L templates (plasmids). The conditions of the PCR reaction are: 94? C. 5 min, 94? C. 30 s, 58? C. 30 s, 72? C. 1.5 min, 30 cycles, 72? C. 7 min.

    [0095] As shown in FIG. 2, 3 transformants were obtained from each gene. The recombinant transformants were named INVSc 1-oPpFADS17-1, -2, -3, and INVSc 1-oAiFADS17-1, -2, -3, and INVSc 1-oPaFADS17-1, -2, -3 respectively, and stored in 30 wt % glycerol tube. PYES2/NT C empty vector without gene fragment was used as negative control group.

    Example 5: Inducible Culture of Saccharomyces cerevisiae Transformant

    [0096] The single colony on the transformant plate of Saccharomyces cerevisiae was seeded on the seed medium SC-U, incubated at 28? C. for 48 h, and the OD.sub.600 value was measured. Then it was transferred to the induction medium, and the OD value reached 0.4, while the exogenous polyunsaturated fatty acids substrate with different carbon chain lengths were added. It was incubated at 28? C. for 48 h and the bacteria were then collected.

    [0097] In which, seed medium SC-U is: 6.7 g/L yeast nitrogen source (without amino acid but with ammonium sulfate), 20 g/L glucose, 0.1 g/L (adenine, arginine, cysteine, leucine, lysine, threonine, tryptophan and uracil, respectively), and 0.05 g/L (aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine and valine, respectively) Induction medium is the seed culture medium in which the carbon source is replaced to 10 g/L raffinose and 20 g/L inducer galactose are added.

    Example 6: Determination of Transcriptional Level of Saccharomyces cerevisiae Transformant

    [0098] The total RNA of Saccharomyces cerevisiae transformants was extracted, comprising:

    [0099] (1) Appropriate amount of bacteria frozen in liquid nitrogen was removed, and liquid nitrogen was added to the precooled aseptic and enzyme-free mortar and ground well

    [0100] (2) 1 mL TRIzol (purchased from Invitrogen, USA) were added and continued to grind to powder and then put at the room temperature to dissolve.

    [0101] (3) An enzyme free gun head was used to extract 1 mL of the above liquid in an enzyme free centrifuge tube and mixed with 200 ?L of trichloromethane.

    [0102] (4) Centrifuged at 12000 rpm and 4? C. for 15 min, and the supernatant was sucked in a new enzyme free centrifuge tube.

    [0103] (5) Mixed with 200 ?L trichloromethane, and centrifuged at 12000 rpm and 4? C. for 15 min, and the supernatant was sucked in a new enzyme free centrifuge tube.

    [0104] (6) Equal volume of isopropanol was added and rest for 15 min, then centrifuged at 12000 RPM and 4? C. for 15 min. The supernatant was removed and then dried at room temperature.

    [0105] (7) 1 mL 70 vol % ethanol was added, then centrifuged at 12000 RPM and 4? C. for 15 min. An enzyme free gun head was used to suck out ethanol and put it dry at room temperature.

    [0106] (8) 50 ?L enzyme free water was added to dissolve RNA and stored at ?80? C.

    [0107] (9) Determination of concentration: 1 ?L RNA was taken and measured its concentration with NaNodrop 2000.

    [0108] (10) Detecting of the integrity of RNA by denaturing gel electrophoresis: The integrity of RNA was observed by electrophoresis of 1 ?g RNA in 1.2 wt % denaturing gel.

    [0109] According to the gene sequence oPpFADS17y, oAiFADS17y and oPaFADS17 and internal standard 18S rDNA sequence of Saccharomyces cerevisiae, qRT-PCR primers were designed:

    TABLE-US-00005 q-oPpFADS17yF GGCAACCAAGCAAGCCTATGTA q-oPpFADS17yR GCTAAGGCAACTGCAATTACCAAAC q-oAiFADS17yF TACTACTTCGCTCCATTGTTCGTTT q-oAiFADS17yR CAACCGTAGGATCTATCAACTGAAG q-oPaFADS17F CTTCGTCCACCGTTGCTG q-oPaFADS17R AGCCAGCGATTCCGAGA 18S-F AATCATCAAAGAGTCCGAAGACATTG 18S-R CCTTTACTACATGGTATAACTGTGG

    [0110] The total RNA of 0.5-1 ?g was taken as the template, and the cDNA of the recombinant strain was obtained according to the operation of PrimeScript RT reagent kit (purchased from Japan TaKaRa company). ABI-Prism 7900 sequence detection system (Applied Biosystems, CA) was used to perform RT-qPCR reaction in accordance with the instructions of SYBR Green PCR Master Mix (Applied Biosystems, CA).

    [0111] The reaction system is: 10 ?l SYBR Green PCR Master Mix, 0.5 ?l of each gene upstream and downstream primers, 8 ?l enzyme free water, 1 ?l template. The PCR cycle is set as 2 min at 50? C., 10 min at 95? C., 15s at 95? C., 30 s at 60? C., and 40 cycles. The 18S rRNA of Saccharomyces cerevisiae is used as the internal reference gene.

    [0112] According to the 2.sup.???Ct method, the relative transcription level of the gene was calculated. All the samples were tested for three duplicates, in which: ??Ct=?Ct (sample)??Ct (control).

    [0113] The result is shown in FIG. 3. It was found that, comparing each gene transformant to the control group, the value of AACt was about 10 in all gene transformants, which illustrated that the expression of the gene growing out of nothing, which showed that the gene was transcribed successfully in the host strain.

    Example 7: Determination of Protein Expression in Saccharomyces cerevisiae

    [0114] Under the same conditions, after inducing different transformants of different genes, the total protein was extracted from the broken mycelium with 0.5 mm acid-washed glass beads.

    [0115] After the protein concentration was determined by BSA, SDS-PAGE electrophoresis was performed with sample volume of 100 ?g total protein, until Marker was separated completely.

    [0116] The protein in the gel was transferred to the PVDF membrane on the Bio-Rad electrophoresis apparatus. The transmembrane condition was 20 mA and overnight.

    [0117] After the transmembrane was completed, the PVDF membrane was soaked in TBST buffer and incubated on the table concentrator for 10 min at room temperature. Repeat three times.

    [0118] The PVDF membrane was soaked in TBST buffer containing 5 wt % skim milk and incubated on the table concentrator for 90 min at room temperature.

    [0119] The PVDF membrane was soaked in TBST buffer and incubated on the table concentrator for 10 min at room temperature. Repeat three times.

    [0120] In the ratio of 1:5000, anti-His primary antibody was dissolved in the TBST buffer containing 5 wt % skim milk, and then incubated on the table concentrator for 1 h.

    [0121] The PVDF membrane was soaked in TBST buffer and incubated on the table concentrator for 10 min at room temperature. Repeat three times.

    [0122] In the ratio of 1:10000, the goat anti-mouse secondary antibodies was dissolved in the TBST buffer containing 5 wt % skim milk, and then incubated on the table concentrator for 1 h.

    [0123] The PVDF membrane was soaked in TBST buffer and incubated on the table concentrator for 10 min at room temperature. Repeat three times.

    [0124] The PVDF film was developed by ECL, and exposed and photographed in the Western imager.

    [0125] The results showed that different transformants of different genes were all expressed, and the protein expression level of different transformants was almost the same.

    [0126] In which, TBST buffer (IL) consisted of 8.8 g HCl; 20 mL IM pH 8.0 Tris-HCl buffer; 0.5 mL Twain 20.

    Example 8: Extraction of Fatty Acid from Saccharomyces cerevisiae

    [0127] The following steps are included:

    [0128] The induced bacteria were collected and then vacuum freeze-dried.

    [0129] After fully ground and crushed, 10 mg of the above bacteria was weighed, 1 mL 10 wt % hydrochloric acid in methanol solution (i.e. methanol containing 10 wt % HCl) and internal standard (C15:0 and C21:0, each of 100 ?l) were added, then mixed well with vibration for 3 h at 60? C. in water bath and vibrated every 0.5 h.

    [0130] 1 mL hexane and 1 mL saturated sodium chloride were added to mix evenly, and centrifuged at 4000 rpm for 5 min. The supernatant was taken into a clean bottle.

    [0131] 1 mL hexane was added to the original bottle and centrifuged at 4000 rpm for 5 min. The supernatant was taken into the above-mentioned new bottle.

    [0132] The liquid in the new bottle is blown dry with N2. Then 1 mL hexane was added, the lid was tightened, and shaken and dissolved, thus obtained fatty acid methyl ester solution.

    [0133] The obtained fatty acid methyl esters were analyzed by GC-MS (Shimadzu Co., Japan) and Rtx-Wax (30 m?0.25 mm, 0.25 m) as the chromatographic column. The mass spectrometry detection was under the temperature of the vaporization chamber and detector at 240? C. and 250? C. respectively. 1 ?L samples were injected by distributary injection, the split ratio was 10:1, and the carrier gas was helium.

    [0134] Temperature programmed: the initial temperature was 40? C. for 5 min, 20? C./min to 150? C., then 5? C./min to 190? C. for 5 min, and at last 5? C./min to 220? C., and for 17 min. Qualitative and quantitative analysis of fatty acids in samples was carried out by comparison of their retention time, peak area ratio and mass spectrometric analysis to those of fatty acid methyl ester standard (C15:0).

    Example 9: Identification of the Activity of ?-3 Fatty Acid Desaturase with a Preference for 20C at Normal Temperature

    [0135] In the induction medium, three ARA at concentration gradient of 0.05 mM, 0.1 mM and 0.2 mM were added as substrates to collect the bacteria and extract fatty acids. The results of GC-MS fatty acid determination were shown in FIG. 4.

    [0136] Compared with the Ctrl group, INVSc 1-oPpFADS17, INVSc 1-oAiFADS17 and INVSc 1-oPaFADS17 had a new peak in 37.5 min. By comparison with fatty acid methyl ester standard products and mass spectrometric analysis, this peak was found to be EPA. The results of the specific analysis are shown in Table 2.

    TABLE-US-00006 TABLE 2 Catalytic efficiency of different ?-3 fatty acid desaturase recombinant Saccharomyces cerevisiae 0.05 mM ARA 0.1 mM ARA 0.2 mM ARA Recombinant EPA EPA EPA EPA EPA EPA transformant output conversion output conversion output conversion (INVSc 1-) (mg/g) (100%) (mg/g) (100%) (mg/g) (100%) oPpFADS17-1 9.0 ? 0.3 71.3 ? 3.5 6.6 ? 0.9 44.5 ? 3.7 5.6 ? 0.2 34.5 ? 1.2 oPpFADS17-2 9.0 ? 0.1 63.3 ? 2.3 8.7 ? 1.0 48.7 ? 3.7 4.5 ? 0.5 28.0 ? 2.4 oPpFADS17-3 9.4 ? 0.5 64.8 ? 3.3 7.8 ? 3.4 49.0 ? 2.3 3.3 ? 0.5 43.8 ? 2.5 oAiFADS17-1 5.7 ? 0.4 41.4 ? 2.4 3.8 ? 0.7 26.1 ? 1.0 3.7 ? 0.7 27.0 ? 1.0 oAiFADS17-2 6.7 ? 0.3 36.5 ? 3.0 6.2 ? 0.4 34.8 ? 0.8 3.3 ? 0.2 23.5 ? 2.3 oAiFADS173 7.6 ? 0.6 46.3 ? 3.5 5.1 ? 0.7 33.5 ? 3.0 4.0 ? 0.2 23.9 ? 0.9 oPaFADS17-1 8.5 ? 0.3 69.7 ? 1.7 6.3 ? 0.8 48.4 ? 2.9 3.1 ? 0.2 39.5 ? 2.8 oPaFADS17-2 6.6 ? 0.4 67.9 ? 2.8 7.1 ? 0.7 46.8 ? 1.8 5.6 ? 0.6 23.1 ? 1.9 oPaFADS17-3 6.2 ? 0.5 66.3 ? 3.3 6.7 ? 0.6 44.4 ? 2.7 4.1 ? 0.4 28.7 ? 0.8 Ctrl 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 recombinants on ARA

    [0137] The three transformants of INVSc 1-oPpFADS17 have the highest catalytic efficiency for ARA, of which INVSc 1-oPpFADS17-3 reached 64.8%, 49% and 43.8% respectively under three concentration gradients, which had almost no difference from the catalytic efficiency of the positive control INVSc 1-oPaFADS17 at three concentrations i.e. 69.7%, 48.4% and 39.5%, while the absolute yield is better than each of the transformants of the positive control.

    [0138] In particular, in comparison with the recombinant lipoprotein yeast recorded in the existing technology Identification and characterization of new ?-17 fatty acid desaturases, in the realization of about the same catalytic conversion rate, the INVSc 1-oPpFADS17 transformant of the present invention had a significant reduction in the concentration of substrate ARA in the required inducible medium, in particular, the highest conversion rate under 0.05 mM, and a further increase in the output of EPA, and good EPA conversion capability. In addition, the expression vector used in the present invention only contains A9 fatty acid dehydrogenase, that is, only two kinds of monounsaturated fatty acids linoleic acid and palmitoleic acid in Saccharomyces cerevisiae. Compared with the existing recombinant lipolytic yeast, the recombinant Saccharomyces cerevisiae of the present invention will not interfere with the polyunsaturated fatty acid synthesis pathway to be used, and the recombinant vector of the present invention has His tags, which is more conducive to the purification and identification of subsequent proteins.

    [0139] In addition, the above data showed that the 0-3 fatty acid desaturase gene (oAiFADS17y) sequence from Aphanomyces invadans was highly similar and closely relative to the 0-3 fatty acid desaturase gene (oPpFADS17y) sequence from P. parasitica, but the recombinant Saccharomyces cerevisiae obtained by the same technique had not the same effect. The catalytic efficiency of the transformant INVSc 1-oAiFADS17 from Aphanomyces invadans was relatively low, 46.3%, 33.5% and 23.9% respectively. In order to further verify whether these genes preferred to catalyze the 20C substrate, three recombinant transformants INVSc 1-oPpFADS17-3, INVSc 1-oAiFADS17-3 and INVSc 1-oPaFADS17-1 were selected, and 0.2 mM of LA, GLA, DGLA, ARA were added in the induced medium respectively, and 0.1 mM LA and 0.1 mM ARA were added at the same time, as shown in Table 3.

    TABLE-US-00007 TABLE 3 Catalytic efficiency of different ?-3 desaturation Saccharomyces cerevisiae recombinant transformant on different substrates at 28? C. 0.2 mM LA 0.2 mM GLA 0.2 mM DGLA 0.2 mM ARA recombinant ALA SDA SDA ETA ETA EPA EPA transformant output ALA t output conversion output conversion output conversion (INVSc 1-) (mg/g) (100%) (mg/g) (100%) (mg/g) (100%) (mg/g) (100%) oPpFADS17-3 1.2 ? 0.1 7.1 ? 0.7 1.0 ? 0.1 4.7 ? 0.7 4.2 ? 0.2 25.6 ? 0.3 6.1 ? 0.6 45.3 ? 1.3 oAiFADS17-3 0.5 ? 0.1 2.9 ? 0.4 0.3 ? 0.1 1.6 ? 0.3 3.0 ? 0.2 18.3 ? 0.4 3.8 ? 0.1 27.1 ? 1.1 oPaFADS171 0.6 ? 0.1 3.4 ? 0.3 0.5 ? 0.1 3.0 ? 0.5 1.9 ? 0.3 13.4 ? 1.7 5.2 ? 0.5 49.5 ? 1.1 Ctrl 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 recombinant 0.1 mM LA + 0.1 mM ARA transformant ALA output ALA conversion EPA output EPA conversion (INVSc 1-) (mg/g) (100%) (mg/g) (100%) oPpFADS17-3 0.6 ? 0.1 6.6 ? 0.6 3.8 ? 0.1 51.5 ? 0.8 oAiFADS17-3 0.5 ? 0.1 4.1 ? 1.2 3.4 ? 0.3 37.3 ? 0.7 oPaFADS171 0.4 ? 0.1 3.6 ? 1.0 3.3 ? 0.1 47.0 ? 0.9 Ctrl 0 ? 0 0 ? 0 0 ? 0 0 ? 0

    [0140] The analysis showed that the conversion of the recombinant transformant INVSc 1-oPpFADS17-3 and INVSc 1-oAiFADS17-3 and INVSc 1-oPaFADS17-1 to the 20C substrate is significantly higher than the 18C substrate, and of which the conversion efficiency for ARA was particularly obvious. The conversion rate of INVSc 1-oPpFADS17-3 to ARA was the highest, and was the same as that of positive control INVSc 1-oPaFADS17-1, and the yield was higher than that of positive control. In addition, the conversion rate of INVSc 1-oPpFADS17-3 to ?-6 PUFAs outside ARA was about two times that of the positive control, indicating that the efficiency of ?-3 PUFAs synthesis of the recombinant bacteria of the present invention was significantly higher than that of positive control.

    [0141] In order to prove that the catalytic activity of ?-3 fatty acid desaturase at normal temperature and lower temperature is higher, 0.2 mM LA, GLA, DGLA, ARA were added respectively and 0.1 mM LA and 0.1 mM ARA were added at the same time to the inducible medium, at 12? C. The result is as shown in table 4.

    TABLE-US-00008 TABLE 4 Catalytic efficiency of different ?-3 desaturation Saccharomyces cerevisiae recombinant transformant on different substrates at 12? C. 0.2 mM LA 0.2 mM GLA 0.2 mM DGLA 0.2 mM ARA recombinant ALA ALA SDA SDA ETA ETA EPA EPA transformant output conversion output conversion output conversion output conversion (INVSc 1-) (mg/g) (100%) (mg/g) (100%) (mg/g) (100%) (mg/g) (100%) oPpFADS17-3 1.3 ? 0.1 4.7 ? 0.2 0.7 ? 0.1 3.1 ? 0.7 3.2 ? 0.3 17.7 ? 1.1 3.9 ? 0.3 30.9 ? 2.8 oAiFADS17-3 0.5 ? 0.1 1.9 ? 0.2 0.2 ? 0.1 1.2 ? 0.4 1.4 ? 0.2 8.4 ? 0.4 1.6 ? 0.2 15.0 ? 0.9 oPaFADS171 0.8 ? 0.1 3.5 ? 0.5 0.4 ? 0.1 2.1 ? 0.3 2.0 ? 0.1 12.4 ? 1.4 3.4 ? 0.1 26.0 ? 1.4 Ctrl 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 0 ? 0 recombinant 0.1 mM LA + 0.1 mM ARA transformant ALA output ALA conversion EPA output EPA conversion (INVSc 1-) (mg/g) (100%) (mg/g) (100%) oPpFADS17-3 0.8 ? 0.1 5.9 ? 0.7 3.9 ? 0.1 33.2 ? 1.6 oAiFADS17-3 0.5 ? 0.1 4.1 ? 1.2 3.4 ? 0.3 37.3 ? 0.7 oPaFADS171 0.2 ? 0.1 2.1 ? 0.4 2.3 ? 0.3 25.9 ? 0.9 Ctrl 0 ? 0 0 ? 0 0 ? 0 0 ? 0

    [0142] The results of fatty acid determination in Table 4 showed that the conversion rates of different recombinant bacteria were lower at lower temperature. However, in the present invention, the recombinant Saccharomyces cerevisiae that can express ?-3 fatty acid desaturase from Phytophthora parasitica had significantly higher EPA conversion and EPA output than those of the recombinant Saccharomyces cerevisiae that can express ?-3 fatty acid desaturase from Aphanomyces invadans at a lower temperature. They were also better than those of the recombinant Saccharomyces cerevisiae that can express ?-3 fatty acid desaturase from Pythium aphanidermatum.

    [0143] 2. Recombinant M. alpina Expressing ?-3 Fatty Acid Desaturase from Phytophthora parasitica

    Example 10: Constructing Expression Vector pBIG2-ura5s-oPpFADS17

    [0144] The ?-3 fatty acid desaturase from Phytophthora parasitism was optimized according to the characteristics of M. alpina, and the optimized gene sequence oPpFADS17m (as shown by SEQ ID No.5) was ligated with pUC57 carrier to obtain pUC57-oPpFADS17 (PUC57-oPpFADS17 in CN 201610184669.X).

    [0145] At 37? C., the plasmids pUC57-oPpFADS17 and vector pBIG2-ura5s-ITs fragments were overnight enzyme digested by the restriction endonuclease Hind III. The Hind III enzyme digestion system (100 ?L) was: 2 ?L Hind III-HF, 30 ?L plasmid or vector, 10 ?L Cutsmart Buffer, 58 ?L deionized water, incubated at 37? C. for 12 h.

    [0146] In which, vector pBIG2-ura5s-lts was directly obtained according to Chinese Patent Application No. CN201310524221.4.

    [0147] The expression unit HPH was obtained from pD4 plasmid by PCR. The expression unit HPH was enzyme digested with restriction endonuclease EcoR I and Xba I and inserted into the MCS of pET28a(+) which was enzyme digested by EcoR I and Xba I, to obtain the plasmidpET28a-HPHs. The ura5 (orotate phosphoribosyl transferase, OPRTase) gene was obtained from M. alpina by PCR. The ura5 gene was enzyme digested by restriction endonuclease BspH I and BamH I, then the digested ura5 gene was inserted into the plasmid pET28a-HPHs which was enzyme digested by Nco I and BamH I, to replace the gene hpt and construct the plasmid pET28a-ura5s. The expression unit ura5s was obtained by digestion of plasmid pET28a-ura5s with the restriction enzyme EcoR I and Xba I. The expression unit ura5s was used to replace the expression unit HPH in plasmid pBIG2RHPH2, and plasmid transformation plasmid pBIG2-ura5s was further constructed. Furthermore, based on plasmid pBIG2-ura5s and plasmid pET28a-HPHs, a general carrier for genetic manipulation of M. alpina was constructed. A non-coding intron DNA fragment IT was obtained from the genome of M. alpina by PCR. The restriction endonuclease NcoI and BamHI were used to digest the IT gene fragment and plasmid pET28a-HPHs respectively, and hpt gene of the plasmid pET28a-HPHs was replaced by the IT fragment through the legation reaction to obtain the plasmid pET28a-ITs. ITs expression unit was obtained by double digesting the plasmid pET28a-ITs with restriction endonuclease Spe I and Xba I. The ITs expression unit was inserted into the plasmid pBIG2-ura5s which was digested with Xba I, a general carrier pBIG2-ura5s-ITs for genetic manipulation of M. alpina was constructed.

    [0148] The digestion products were recovered and further digested with restriction endonuclease Xho I, and then the aimed gene (?-3 fatty acid desaturase gene fragment oPpFADS17m from Phytophthora parasitica, optimized for M. alpina, oPpFADS17 in CN 201610184669X) and vector pBIG2-ura5s-ITs fragments were recovered by cutting gel. The enzyme digestion system (100 ?L) was: 2 ?L Xho I, 30 ?L plasmid or vector pBIG2-ura5s-ITs fragment, 10 ?L cutsmart Buffer, 58 ?L deionized water, digested at 37? C. water bath for 12 h.

    [0149] In which, the enzyme buffer Cutsmart buffer: 50 mM acetic acid, 20 mM Tris-acetic acid, 10 M magnesium acetate, 100 ?g/mL bovine serum albumin, pH 7.9.

    [0150] Then, the T4 ligase was used to ligate the ?-3 fatty acid desaturase gene fragment oPpFADS17m with the vector pBIG2-ura5s-ITs, at 4? C. for 12 h, to obtain the recombinant expression vector pBIG2-ura5s-oPpFADS17. The ligation system (10 ?L) is: 2 ?L target gene fragments after digestion, 3 ?L carrier fragments after digestion, 1 ?L ligase buffer, 1 ?L T4 ligase, 3 ?L sterile water, ligating at 4? C. for 12 h.

    [0151] The method for transforming E. coli TOP10 competent cells with the ligation products is as follows:

    [0152] (1) In the aseptic state, 100 ?L of the competent cells were taken, and 1-2 ?L ligation product were added and the mixture was blown and mixed well.

    [0153] (2) The mixed competent cells were moved into the pre-cooled electric rotating cup to avoid bubbles.

    [0154] (3) The electric rotating cup was put into Bio-Rad electric rotary instrument and adjusted into a propriate preset program position. The electrical transformation was carried out at the voltage condition of 1.8 kV.

    [0155] (4) 1 mL SOC resuscitation medium was added into the transformed competent cells, mixed, and then transferred into a 1.5 mL centrifugation tube and incubated at 37? C. and 150 rpm for 1 h.

    [0156] (5) A LB solid medium plate containing 100 ?g/mL ampicomycin was coated with 200 ?L of the obtained product, and reversed and incubated at 37? C. overnight.

    [0157] The positive transformants were picked up, the plasmids were extracted, the results of sequencing proved that the ligation was successful and binary expression vector pBIG2-ura5s-oPpFADS17 was obtained.

    [0158] The binary expression vector pBIG2-ura5s-oPpFADS17 was used to transform 15 Agrobacterium tumefaciens by means of transformation of E. coli TOP10. Agrobacterium tumefaciens C58C1 containing plasmid pBIG2-ura5s-oPpFADS17 was obtained.

    Example 11: ATMT of M. alpina

    [0159] The transformation was optimized according to the method referred to the open accessed articles, the detailed steps are as follows:

    [0160] (1) A. tumefaciens C58C1 harboring pBIG2-ura5s-oPpFADS17 preserved at the temperature of ?80? C. was put on the YEP solid plate (containing 100 lag/mL rifampicin and 100 ?g/mL kanamycin), reversed incubating at the temperature of 28? C. for 48 h in the dark.

    [0161] (2) A single clone was transferred to a 20 mL liquid YEP medium (containing 100 ?g/mL rifampicin and 100 ?g/mL kanamycin) and cultured at 28? C. and 200 rpm for 24-48 h in the dark.

    [0162] (3) Bacteria was collected by centrifuging at 4000?g for 5 min. the suspension was removed, pellet was suspended by 5 mL IM medium, followed by a centrifugation at 4000?g for 5 min. After removing the suspension, 2 mL of IM medium were added to suspend the bacterium.

    [0163] (4) The concentration of the bacterium suspension to OD.sub.600=0.3, followed by a dark cultivation at 28? C. and shaking at 200 rpm to OD.sub.600=1.0;

    [0164] (5) 500 ?L sterilized physiological saline was used to wash M. alpina uracil auxotrophic strain CCFM501 (i.e. uracil auxotrophic strain MAU1 disclosed in CN 201310347934.8) with GY-U slant culture for more than one month. Spores were collected and counted with a haemacytometer to adjust the concentration of spores to 10.sup.7/100 ?L.

    [0165] (6) 100 ?L Agrobacterium tumefaciens was mixed with 100 ?L spores and evenly coated on the IM solid medium with cellophane. Incubated at 23? C. for 36-48 h in the dark.

    [0166] (7) The cellophane was transferred to the SC plate (SC-CS) containing 100 ?g/mL of the spectinomycin and 100 ?g/mL cefotaxime antibiotics. The culture was carried out at 18? C. for 12 h and then transferred to 25? C.

    [0167] (8) The growth of the colony on the SC-CS plate was continuously observed. If the colonies were grown out, the outer edge was excavated in time with the sharp tweezers and inoculated on the SC-CS plate, and continued to be placed in the 25? C. incubator.

    [0168] (9) After the transformants on the SC-CS plate grew, the mycelia were transferred to the SC-CS plate, and screened repeatedly for 3 times to eliminate the negative transformants.

    [0169] (10) The bacterial colony which grew after three time's screening was inoculated to the GY plate, cultured at 28? C. to produce a large number of spores and stored at 4? C.

    Example 12: Screening and Identifying of M. alpina for Overexpressing oPpFADS17m

    [0170] (1) 3 mL physiological saline was used to wash GY's surface. Liquid was collected in a sterile 1.5 mL centrifuge tube and then filter with 25 ?m membrane.

    [0171] (2) The spore concentration was counted with a haemacytometer and three kinds of spores concentration gradient were adjusted to 10.sup.8/100 ?L, 10.sup.6/100 ?L and 10.sup.4/100 ?L each, and each with 200 ?L coated on the GY-CS tablet containing 100 ?g/mL of cefotaxime and 100 ?g/mL cefotaxime, then cultured at 25? C. for 2-3 days in the dark;

    [0172] (3) The growing fungal mycelium was picked by sterile forceps and placed on a SC-CS plate, and then incubated at 25? C. for 2-3 days;

    [0173] (4) The growth of M. alpina on the plate was observed. The mycelium grown on the SC-CS plate were picked and inoculated onto the GY slope;

    [0174] (5) The M. alpine strain spores in the above step 4) were cultured on the GY medium for 3 times;

    [0175] (6) The strains with hereditary stability were identified as recombinant M. alpina for heterologous expressing oPpFADS17m and kept on the GY slope;

    [0176] (7) The right genomic DNA of the recombinant M. alpine were extracted and identified, and PCR verification was performed with a pair of primers specifically binding to promoters and terminators:

    TABLE-US-00009 P1(sense): CACACACAAACCTCTCTCCCACT P2(antisense): CAAATGAACGTATCTTATCGAGATCC;

    [0177] The results of agarose gel electrophoresis analysis of recombinant strains were shown in FIG. 6. M was marker; swim Lane 1 was negative control; swimming lane 2-6 were 1-5 MA-oPpFADS17 recombinant strain. The results showed that five positive transformants could amplify two product bands of 818 bp and 1086 bp, respectively. The electrophoresis results showed that all the 1-5 transformants were positive transformants, in which binary expression vectors successfully integrated into the genome of M. alpina.

    [0178] (8) The obtained recombinant strains were kept on GY slope respectively.

    Example 13: Extraction of Total RNA from Positive Transformants MA-oPpFADS17

    [0179] (1) Appropriate amount of bacteria frozen in liquid nitrogen was removed, and liquid nitrogen was added to the precooled aseptic and enzyme-free mortar and ground well

    [0180] (2) 1 mL TRIzol (purchased from Invitrogen, Carlsbad, Calif., USA) were added and continued to grind to powder and then put at the room temperature to dissolve.

    [0181] (3) An enzyme free gun head was used to extract 1 mL of the above liquid in an enzyme free centrifuge tube and mixed with 200 ?L of trichloromethane.

    [0182] (4) Centrifuged at 13200?g and at 4? C. for 15 min, and the supernatant was sucked in a new enzyme free centrifuge tube.

    [0183] (5) Mixed with 200 ?L trichloromethane, and centrifuged at 13200?g and 4? C. for 15 min, and the supernatant was sucked in a new enzyme free centrifuge tube.

    [0184] (6) Equal volume of isopropanol was added and rest for 15 min, then centrifuged at 13200?g and 4? C. for 15 min. The supernatant was removed and then dried at room temperature.

    [0185] (7) 1 mL 70 vol % ethanol was added, then centrifuged at 13200?g and 4? C. for 15 min. An enzyme free gun head was used to suck out ethanol and put to dry at room temperature.

    [0186] (8) 50 L enzyme free water was added to dissolve RNA and stored at ?80? C.

    [0187] (9) Determination of concentration: 1 ?L RNA was taken out and measured its concentration with NaNodrop 2000.

    [0188] (10) Detecting of the integrity of RNA by denaturing gel electrophoresis: The integrity of RNA was observed by electrophoresis of 1 ?g RNA in 1.2 wt % denaturing gel.

    [0189] (11) 1 ?g total RNA was taken as the template, and the cDNA of the recombinant strain was obtained according to the operation of PrimeScript RT reagent kit (TaKaRa, Otsu, Shiga, Japan).

    Example 14: RT-qPCR Detection of Transcriptional Level of Positive Transformant MA-oPpFADS17

    [0190] Primers were designed according oPpFADS17 sequence and internal standard 18SrRNA sequence:

    TABLE-US-00010 q-oPpFADS17mF: TCTTCCCCACCCTCACCG (q-oPpFADS17FinCN201610184669.X) q-oPpFADS17mR: CAAGCCACGAGCGTAGTTCA (q-oPpFADS17RinCN201610184669.X) 18SRTF: CGTACTACCGATTGAATGGCTTAG 18SRTR: CCTACGGAAACCTTGTTACGACT

    [0191] 0.5-1 ?g cDNA was taken as template, and RT-qPCR reaction was performed according to the instructions of iTaq Universal SYBR Green Supermix by using Bio-Rad CFX Connect? system. The reaction system is: 8 ?L enzyme-free water, 10 ?L iTaq Universal SYBR Green Supermix, 0.5 ?L q-oPpFADS17m F, 0.5 ?L q-oPpFADS17-m R, 1 ?L template, with a total volume of 20 ?L. The PCR cycle is set at 50? C. for 2 min, 95? C. for 10 min, 95? C. for 15 s, 60? C. for 30 s, 30 cycles. 18S rRNA of M. Alpina was taken as internal reference gene, each transformants was taken three parallel lines.

    [0192] Results as shown in FIG. 7, ?-3 fatty acid desaturase gene (oPpFADS17m) in the wild type of M. alpina as a control was not transcribed, and the transcription level of ?-3 fatty acid desaturase gene (oPpFADS17m) of 5 genetically engineered stains were significantly increased. This suggests that the Agrobacterium tumefaciens mediated method can be used to transcribe and express exogenous ?-3 fatty acid desaturase gene, which is optimized for M. alpina, oPpFADS17m from Phytophthora parasitica), in M. alpina.

    Example 15: Extraction of Fatty Acid from Positive Transformant

    [0193] (1) The M. alpina prototrophic strain and M. alpina strains for overexpressing oPpFADS17m which were screened in Example 3 were inoculated in Broth medium, incubated at the temperature of 28? C. at 200 rpm for 7 d.

    [0194] (2) The bacteria were collected, vacuum freeze-dried to constant weight, weighed and calculated biomass.

    [0195] (3) The bacteria were grinded into powder, and 50 mg was weighed, and 2 mL 4 M hydrochloric acid was added.

    [0196] (4) Water bath at 80? C. for 1 h, then at ?80? C. for 15 min. Repeat once. Then water bath at 80? C. for 1 h.

    [0197] (5) Cooled down to room temperature, then 1 mL methanol were added and mixed well.

    [0198] (6) 1 mL chloroform were added and shaken for 10 min, followed by centrifuge at 3000?g for 3 min. Chloroform were collected.

    [0199] (7) Repeat step (6) twice.

    [0200] (8) Chloroform (3 mL) were combined. 1 mL saturated NaCl solution were added and mixed well, and then centrifuged at 3000?g for 3 min. Chloroform layer were collected into a new tube. 1 mL chloroform were added in the residual liquid, followed by centrifugation at 3000?g for 3 min. All the chloroform (4 mL) were combined.

    [0201] (9) After dried by nitrogen blow, 1 mL ether were added and transferred to a clean and weighed tube, followed by drying by nitrogen blow.

    Example 16: Detection of Fatty Acid from Positive Transformant

    [0202] The method for detecting the composition and content of fatty acid is as follows:

    [0203] (1) 100 ?L 2.02 mg/mL internal standard C15:0 and 1 mL 10 wt % methanolic hydrochloride were added into the above crude fat. At 60? C. water bath for 3 h, the mixture were vibrated for 1 min every 30 min.

    [0204] (2) After cooling to room temperature, 1 mL n-hexane and 1 mL saturated sodium chloride solution were added, vibrated and mixed, centrifuged at 3000?g for 3 min. The hexane layer was sucked out and 1 mL hexane were added and vibrated and mixed, centrifuged at 3000?g for 3 min. N-hexane were sucked out and merged.

    [0205] (3) After nitrogen drying at 37? C., 1 mL of n-hexane was added and mixed, then transferred into the gas bottle to obtain fatty acid methyl ester solution.

    [0206] (4) Fatty acid methyl esters were analyzed by GC-2010 (Shimadzu Co., Japan) and DB-Waxetr (30 m?0.32 mm, 0.22 ?m) as the chromatographic column. The detection was performed by hydrogen flame ionization detector, under the temperature of the vaporization chamber and detector at 240? C. and 260? C. respectively. 1 ?L samples were injected by distributary injection, the split ratio was 10:1, and the carrier gas was helium. Temperature programmed: the initial temperature was 120? C. for 3 min, 5C/min to 190? C., then 4? C./min to 2200? C. for 20 min, and at last 5? C./min to 220? C., and for 17 min. Qualitative and quantitative analysis of fatty acids' composition in samples was carried out by comparison with quality of commercial fatty acid methyl ester standard product (37 kinds of fatty acid methyl esters mixed standard, Supelco, USA) and the added internal standard C15:0.

    [0207] Table 5 is the comparison of fatty acid yield between the wild (protrophic type) M. alpina and five M. alpina strains expressing oPpFADS17m gene from Phytophthora parasitica. The table 6 is the comparison of fatty acid composition between the wild M. alpina and the five M. alpina strains expressing oPpFADS17m gene from Phytophthora parasitica.

    [0208] The results of table 5 and table 6 showed that there was no significant difference in biomass between five genetic engineering strains and wild-type strains, but the composition of fatty acid changed significantly. Among the five recombinant strains, the yield of AA (C20:4) was reduced in varying degrees than in the wild type, and a large number of EPA (C20:5) were produced, and the reduction of output of AA and increase in production of EPA had obvious regularity, while the yield of the other fatty acids (C16:0, C18:0, C18:1, C18:2, C18:3) had no significant changes, which indicated that all five strains of recombinant strains can catalyze AA to EPA in varying degrees. In which, MA-oPpFADS17-4 showed excellent EPA production, the output of EPA reached 1197.3 mg/L, accounting for 31.5% of total fatty acid (TFA), and its AA yield was only 326.8 mg/L, indicating that most AA could be converted to EPA, and the conversion rate of AA was 77.6% (conversion rate=EPA/(AA+EPA)*100%). In addition, the absolute value of TFA also increased to a certain extent.

    [0209] In addition, the other four recombinant strains (MA-oPpFADS17-1, 2, 3 and 5) also showed different levels of increase in EPA production, which was significantly different from the wild-type strains. This indicates that the ?-3 fatty acid desaturase gene oPpFADS17m from Phytophthora parasitica can be successfully expressed in M. alpina, and the recombinant bacteria obtained according to the construction method of the present invention can convert AA into EPA and have considerable conversion rate. Among them, MA-oPpFADS17-4 has the most obvious effect, compared with other MA-oPpFADS17 transformants, has an unexpected improvement, which is also significantly higher than the other existing techniques.

    TABLE-US-00011 TABLE 5 Comparison of fatty acid production between wild type strain and five genetic engineering strains of M. alpina Strains Biomass (g/L) AA(mg/L) EPA(mg/L) TFA(g/L) M. alpina 11.1 ? 0.2 1264.8 ? 33.6 0.0 ? 0.0 3.1 ? 0.1 MA-oPpFADS17-1 11.2 ? 0.3 1174.8 ? 19.7 105.6 ? 13.7 3.3 ? 0.1 MA-oPpFADS17-2 10.9 ? 0.1 1094.4 ? 26.1 195.2 ? 14.5 3.2 ? 0.1 MA-oPpFADS17-3 11.1 ? 0.3 682.0 ? 17.3 558.2 ? 31.7 3.1 ? 0.1 MA-oPpFADS17-4 11.6 ? 0.1 326.8 ? 11.4 1197.3 ? 21.8 3.8 ? 0.1 MA-oPpFADS17-5 11.1 ? 0.1 682.5 ? 17.7 819.4 ? 13.4 3.5 ? 0.1

    TABLE-US-00012 TABLE 6 Comparison of fatty acid composition between wild type strain and five genetic engineering strains of M. alpina Content of various fatty acids (% TFA) C18:3 C20:4 Strains C16:0 C18:0 C18:1 C18:2 (n-6) (n-6) C20:5 M. alpina 11.3 ? 0.4 10.4 ? 0.3 17.2 ? 1.4 8.8 ? 0.1 5.2 ? 0.1 40.8 ? 3.1 0 ? 0 MA-oPpFADS17-1 12.6 ? 0.4 11.4 ? 0.4 16.7 ? 0.5 9.1 ? 0.1 5.4 ? 0.1 35.6 ? 2.3 3.2 ? 0.1 MA-oPpFADS17-2 11.6 ? 0.7 11.4 ? 0.3 15.9 ? 0.4 9.2 ? 0.1 5.6 ? 0.1 34.2 ? 1.2 6.1 ? 0.1 MA-oPpFADS17-3 12.9 ? 0.8 11.7 ? 0.6 16.2 ? 0.1 9.6 ? 0.3 5.1 ? 0.1 22.0 ? 1.1 18.0 ? 1.0 MA-oPpFADS17-4 13.3 ? 0.4 10.4 ? 0.4 18.0 ? 0.9 10.5 ? 0.2 5.3 ? 0.1 8.6 ? 0.4 31.5 ? 2.7 MA-oPpFADS17-5 11.5 ? 0.5 10.9 ? 0.4 16.3 ? 0.9 9.5 ? 0.1 5.2 ? 0.1 19.5 ? 2.0 23.4 ? 1.0

    [0210] The results show that the recombinant M. alpina overexpressing ?-3 fatty acid desaturase gene (oPpFADS17m) from Phytophthora parasitica, obtained according to the method of the present invention, have genetic stability for multiple passage. Furthermore, compared with the wild-type, there is no significant difference in the fatty acid analysis results for the products obtained by the normal temperature culture. The yield of EPA was improved, of which the EPA production of the strain MA-oPpFADS17-4 has reached 31.5% of the total fatty acid, compared with the wild type, the yield of EPA was significantly higher than that of the other recombinant strains obtained by the same method. It was also significantly higher than the production of EPA by normal temperature culture of other known recombinant M. alpina overexpressing ?-3 fatty acid desaturase gene. The genetic engineering strains constructed by this method and their construction methods laid a theoretical and applied foundation for subsequent industrialization.

    [0211] To sum up, ?-3 fatty acid desaturase obtained according to the present invention can catalyze both 18C and 20C polyunsaturated fatty acids, but prefer converting 20C ARA to EPA, and the conversion efficiency at normal temperature is obviously higher. Furthermore, the efficiency of the synthesis of 0-3 PUFAs is further superior to the existing technology. Using this gene to construct genetic engineering strains laid a foundation for subsequent industrial production of EPA and DHA.

    [0212] It should be appreciated that the foregoing is only preferable embodiments of the invention and is not for use in limiting the invention. Any modification, equivalent substitution, and improvement without departing from the spirit and principle of this invention should be covered in the protection scope of the invention.