FEED COMPOSITION COMPRISING AN ACID PROTEASE

20190230958 · 2019-08-01

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a feed composition comprising an acid protease.

    Claims

    1. A feed composition comprising a protease from Peptidase family S53.

    2. The composition according to claim 1, wherein said protease is at least one selected from the group consisting of Kumamolisin-AS (also called Kumamolisin 1), Kumamolisin-AC and/or Grifolisin.

    3. The composition according to any one of the aforementioned claims, wherein said composition further comprises a phytase.

    4. The composition according to any one of the aforementioned claims, which has a pH of 5.

    5. The composition according to any one of the aforementioned claims, which is for at least one selected from the group consisting of monogastric species like poultry, pig, fish, companion animals and aquaculture.

    6. The composition according to any one of the aforementioned claims, wherein the protease is produced by homologous or heterologous protein expression.

    7. The composition according to any one of the aforementioned claims, which composition further comprises at least one agent or buffer that is present in a concentration suitable to maintain the pH of said composition at a value of 5.

    8. The composition according to any one of the aforementioned claims, wherein the pH of 5 is caused by the protein expression as such, or by the cultivation conditions or fermentation conditions.

    9. The composition or use according to any one of the aforementioned claims, wherein the protease remains inactive at a pH of 5.

    10. The composition according to any one of the aforementioned claims, which composition comprises at least one further enzyme.

    11. The composition according to any one of the aforementioned claims, wherein the composition or one or more enzymes therein has increased stability and/or storage life.

    12. The composition or use according to any one of the aforementioned claims, wherein the protease comprises one or more amino acid exchanges, insertions or deletions compared to the respective wildtype.

    13. The composition or use according to claim 12, wherein the respective one or more exchanges, insertions or deletions serve to provide, to the acid protease, at least one of the features selected from the group consisting of increased activity increased thermostability optimized substrate specificity increased resistance against extreme pH values increased resistance or optimized performance in the presence of other feed ingredients increased resistance towards animals endogenous enzymes optimized producibility optimized activation speed increased thermal stability effects of propeptide, and/or optimized propeptide core enzyme interaction.

    14. A method of activating a composition according to any one of the aforementioned claims, which method comprises decreasing the pH of said composition to a value of 5 or smaller.

    15. The method according to claim 14, wherein the decrease of the pH is at least partly accomplished by adding a suitable agent or buffer to the composition, adding the composition to another composition that has a more acidic pH, and/or allowing the composition to decrease its pH by means of natural processes.

    16. The method according to claim 14 or 15, wherein the decrease of the pH is at least partly accomplished in situ in the digestive tract of an animal.

    17. A feed additive, a feed ingredient, a feed supplement, or a feedstuff which comprises a composition according to any of to any one of claims 1-13.

    18. The feed additive, ingredient, supplement, or feedstuff according to claim 17, which further comprises at least one agent selected from the group consisting of a fat-soluble vitamin, a water-soluble vitamin, a trace mineral, and/or an emulsifying agent.

    19. A feedstuff comprising the feed additive, ingredient, or supplement according to any one of claims 17-18, or the composition according to any one of claims 1-13, which has a crude protein content of between 10 and 500 g/kg (1-50% w/w).

    20. The feedstuff according to claim 19, which feedstuff comprises the protease in an amount from >0.0005% to <0.5% w/w.

    21. A method of decreasing a population of bacteria in the upper gastrointestinal tract of a subject, the method comprising administering to the subject a composition according to any one of claims 1-13, wherein the population of bacteria is reduced in the upper gastrointestinal tract of the subject.

    22. The method according to claim 21, wherein the bacteria comprise Clostridium perfringens.

    23. A method for improving feed efficiency, the method comprising modifying a standard diet to contain less protein, and supplementing the modified diet with the feed additive, ingredient, supplement or feedstuff according to any one of claims 17-20, or the composition according to any one of claims 1-13.

    24. The method according to claim 23, wherein the modified diet contains between 5% or 20% less protein than the standard diet.

    25. A method of producing an acid protease by homologous or heterologous protein expression in a protein expression system, in which method cultivation conditions are applied that lead to a pH of 5.5 or higher, for at least a given period of time, and at least locally.

    26. The method according to claim 25, in which method the pH of the medium surrounding the protein expression system is established by addition of an agent or buffer that is present in a concentration suitable to maintain the pH of said composition at a value of 5, and/or caused by the protein expression as such, or by the cultivation conditions or fermentation conditions.

    27. The method according to claim 25 or 26, in which method the protein expression system is at least one selected from the group consisting of a yeast-based protein expression system a filamentous fungus-based protein expression system a bacterial protein expression system

    28. A method of screening for, or producing a, protease with a particular stability against a given condition, or with a particular enzyme activity, which method comprises b) phenotypically characterizing individual members of a protease library for a given parameter, wherein at least part of the characterization is carried out under conditions which keep the protease in its deactivated state c) selecting one or more members of said library according to the outcome of the selection in step b), and, optionally d) isolating said one or more selected members.

    29. The method according to claim 28, wherein the phenotypical characterization in step b) comprises the substeps of b1) pretreatment at a given temperature, and b2) subsequent measurement of protease activity.

    30. The method according to claim 28 or 29, which method further comprises an initial step of a1) providing a library of proteases, and/or a2) producing a library of mutated proteases by mutagenesis of one or more genes or cDNA encoding for a given scaffold protease which step precedes step b).

    31. The method according to any one of claims 28-30, which method further comprises a subsequent step of e) producing said one or more members selected in step c), and optionally isolated in step d), by means of a suitable protein expression method.

    32. The method according to any one of claims 28-31, wherein, in step b1), the protease is kept in its deactivated state by at least one step selected from establishing or keeping a medium pH of 5, adding a peptide which mimics the propeptide and binds to the active site of the active protease adding a small molecule inhibitor which reversibly binds to the active site adding an aptamer or antibody binding to or blocking access to the active site with sufficiently high thermal stability providing a propeptide that consists, or comprises D-amino acids which can not be cleaved, or hydrolysed, from the protease under respectively applied conditions.

    33. The method according to any one of claims 28-32, wherein the pretreatment at a given temperature is carried out in a medium that is characterized by at least one of the group consisting of: b1) pH of 5 b2) added peptide which mimics the propeptide and binds to the active site of the active protease b3) added small molecule inhibitor which reversibly binds to the active site b4) added aptamer or antibody binding to or blocking access to the active site with sufficiently high thermal stability, and/or b5) added propeptide that consists, or comprises D-amino acids which cannot be cleaved, or hydrolysed, from the protease under respectively applied conditions.

    Description

    SHORT DESCRIPTION OF THE FIGURES

    [0173] FIG. 1: Results of the Kumamolisin AS maturation experiments. FIG. 1A: pH 5.5, FIG. 1B: pH 6.0; FIG. 1C: pH 7.0

    [0174] K1+ Fully activated protease with processed propeptide

    [0175] K1 Zymogen with nicked propeptide

    [0176] 0 d to 21 d Samples stored for the indicated time at pH as outlined above. All samples were the unnicked zymogen at day 0 as checked by the thermal stability profile as outlined in example 5. Arrows indicate apparent mobility of enzyme species Z (zymogen form with propeptide unprocessed), N (the inactive enzyme with nicked propeptide) and A (the fully activated enzyme without propeptide)

    [0177] After incubation above pH 7.0 the enzyme was not activated over an extended period of time. Only a fraction was initially nicked but there is no change over time and no activation at any time.

    [0178] After incubation between pH 7.0 and pH 6.0 the enzyme is not activated but nicking of the enzymes proceeded over time until all enzyme was nicked. No activation is observed at any time.

    [0179] After incubation below pH 6.0 the enzyme was nicked and activated over time with all enzyme being activated after 15 days and all enzyme being nicked within the first 24 hours.

    [0180] FIG. 2: Zymogen of aspergilloglutamic protease, and active processed form, according to pH conditions. The zymogen has 35 kDa, and the active processed form has 30 kDa.

    [0181] FIG. 3: Effect of pH and storage time on the thermal stability mediated by the propeptide. The effect of pH and storage time on the thermal stability was tested at different storage pH and ambient temperature as also outlined in example 4. FIG. 3 shows the respective thermostability curves after preincubation at the given pH values.

    [0182] FIG. 4: Activation kinetics of Kumamolisin AS stored at different pH. Enzymes that were activated (stored at a pH of 5.5, time points t15, t17 and t21 at pH 5.5) showed a quick onset of activity, while enzymes stored under conditions where no activation, or nicking only, occurs (pH above 6.0, see also example 3 and 4) show a lag phase for activation of 3 minutes. No significant differences in activation lag time were observed for nicked or unprocessed zymogen.

    [0183] FIG. 5: pH activity profile of activated and not activated Kumamolisin AS. The activated protease (e.g., in an acidic medium) showed a broader pH profile, being also active at pH values where only nicking but no activation occurs.

    [0184] FIG. 6: Thermal stability of Kumamolisin AS for the zymogen (closed circles) or the activated enzyme (open circles). The thermal inactivation curve of the zymogen shows the standard sigmoidal inactivation curve, with a sharp decline in activity (curve can be fitted to a four parameter logistic) whereas the activated enzyme shows an early decline of activity as a mixed effect of self hydrolysis and thermal inactivation. Selecting protease variants for increased thermal stability with active or activated enzyme resulted in a high frequency of false positives due to this mixed effect. From 61 variants tested only 4 showed a slightly increased thermal stability, 5 showed wild type stability and 52 had reduced thermal stabilities.

    [0185] FIGS. 7-11: Results of experiment 10. FIG. 7 shows the body weight gain, FIG. 8 shows the feed conversion ratio, FIG. 9 shows the apparent digestibility of crude protein, FIG. 10 shows the apparent digestibility of fat, and FIG. 11 shows the apparent digestibility of phosphorous.

    [0186] FIG. 12 A-F: Results of experiment 11. A: Body weight gain. B: Feed conversion ratio. C: Apparent ileal digestibility of fat. D: Apparent ileal digestibility of crude protein. E: Apparent ileal digestibility of calcium. F: Apparent ileal digestibility of phosphorous.

    [0187] FIG. 13 A-F: Results of experiment 12. A: Body weight gain. B: Feed conversion ratio. C: Apparent ileal digestibility of crude protein. D: Apparent ileal digestibility of phosphorous. E: Apparent ileal digestibility of calcium. F: Apparent ileal digestibility of crude fat.

    [0188] FIG. 14: Relative trypsin activities (%) on AAPF at pH 7 in the presence/absence of BBI/KTI and +/ hydrolysis of BBI/KTI with grifosilin. Black columns represent data with BBI/KTI hydrolysis with grifosilin, while white columns represents those without grifosilin treatment. All data are means from duplicates.

    EXAMPLE 1

    Production of Enzymes

    1.1. Expression Systems

    [0189] The proteins were produced by means of heterologously expression in different host systems, depending on the source organism. Expression systems were:

    [0190] Kumamolisin AS, as a reference for bacterial acid proteases of the protease family S53, was expressed in a Bacillus subtilis strain, a derivative of strain Bacillus subtilis 168. The codon usage optimized gene of Kumamolisin AS was expressed as a zymogen sequence (SEQ ID NO 1) from a plasmid and secreted into the culture medium.

    [0191] Aspergilloglutamic peptidase, as a reference for acid proteases of the protease family G1 was expressed in Hansenula polymorphs, an auxotroph derivative of strain CBS4732. The codon usage optimized gene (SEQ ID NO 4) as expressed and secreted into the culture medium as the zymogen from a strain harboring a stable genomic integration of the gene.

    1.2. Fermentation and preparation

    [0192] Kumamolisin AS (K1): Bacillus subtilis, transformed with a plasmid harboring the codon optimized gene under the control of a constitutive promotor were cultivated in 1 L Erlenmeyer flasks containing 200 mL TB medium (12 g L.sup.1 trypton, 24 g L.sup.1 yeast extract, 1% (w/v) glucose, 80 mM potassium phosphate, pH 7.2) supplemented with 20 g mL.sup.1 neomycin. Cultivation was inoculated to an OD of 0.05 from a pre culture incubated on a rotary shaking table (150 rpm) at 37 C. in 2 Luria Bertani medium (20 g L.sup.1 pepton, 10 g L.sup.1 yeast extract, 5 g L.sup.1 NaCl, pH 7.5) supplemented with 20 g mL.sup.1 neomycin. The medium was buffered with 200 mM Tris/HCl at pH 7.5.

    [0193] The expression culture was cultivated for 40 h at 37 C. on a rotary shaking table at 150 rpm.

    [0194] Aspergilloglutamic protease (A2): Hansenula polymorphs strains with stable genomic integrations of the codon optimized gene under the control of an inducible promotor were fermented in YNB synthetic medium with 2% (w/v) glucose and 1% (w/v) at a pH of 6.0.

    [0195] Fermenter were inoculated to an OD of 1 from a pre culture run 20 h at 30 C. on a rotary shaker at 130 rpm in 1% (w/v) yeast extract, 2% (w/v) peptone 2% (w/v) glucose. The fermentation continued for 65 h at a cultivation temperature of 30 C. After onset of diauxy from glucose to glycerin, the cultivation was fed with 75% Glycerin (w/v) 1.5-6 g L.sup.1h.sup.1, coupled to oxygen saturation as a set point. Further set points, air flow rate 2.5 L min.sup.1, stirrer speed 500-1500 rpm coupled to oxygen saturation. Correction solutions used for the control of pH and foam were, 33% phosphoric acid (H.sub.3PO.sub.4), 12.5% ammonia hydroxide (NH.sub.4OH) and anti foam J6173.

    1.3. Crude Preparations

    [0196] Cells were separated from crude culture broth of fermentations by centrifugation (17.000 rpm, 20 min, 4 C.). Supernatants were decanted from the precipitate and filtered through 0.45 gm PES membrane in order to remove residual host cells.

    [0197] The cell free crude fermentation supernatant was further concentrated 20 times on a crossflow membrane unit (Vivaflow 200, Hydrosart membrane, 10.000 Da cutoff). Initial concentrates were checked for pH which in all cases maintained the pH of the fermentation and were than further diafiltrated on the same crossflow system into different buffers, depending on the test condition. Buffers used for diafiltration were: [0198] pH 5.5 100 mM Na-Acetate buffer pH 5.5, 0.5 mM CaCl.sub.2 [0199] pH 6.0 100 mM Na-Acetat buffer pH 6.0 +0.5 mM CaCl.sub.2 [0200] pH 7.0 100 mM HEPES buffer pH 7.0 +0.5 mM CaCl.sub.2

    EXAMPLE 2

    Protease Assays and Stability Tests

    1.1. Protease Assays

    [0201] a) AAPF assay 96 well format [0202] Assay buffer: 200 mM sodium acetate or citrate, 1 mM CaCl.sub.2, 0.01% Triton X-100 at pH 4 or pH 3 depending on the experiment [0203] Substrate stock solution: 100 mM in water free DMSO [0204] Substrate working solution: Substrate Stock solution diluted 1:50 in assay buffer, either pH 4 (acetate) or pH 3 (citrate) [0205] Execution: Load 50 L of the diluted sample into the wells of a Nunc 96 clear flat bottom plate. Dilution is made in water containing 0.01% Triton-X100 corresponding to the volumetric activity of the sample. [0206] Start reaction by adding 50 L of substrate working solution. [0207] Measure kinetics at 37 C. by monitoring the increase in adsorption at 410 nm as a measure for enzymatic activity.
    b) IT.sub.50: IT.sub.50 defines the temperature where 50% of the activity is inactivated under the conditions described above. Although not equivalent to, it is a measure for the thermal stability in the application, e.g. pelleting conditions or conditions in a detergent application, either dish washing or the cleaning of a fabric or hard surface and other technical applications. [0208] Assay buffers: 50 mM sodium phosphate, 0.25 mM CaCl.sub.2 pH 6.0 800 mM glycine pH 2.8 [0209] Thermal inactivation execution: Samples were diluted corresponding to the volumetric activity in potassium phosphate buffer. The pH of the final solution was checked to be above pH 5.5. The samples were transferred in replicates, 20 L per well, into a 384 well PCR plate according the direction of the temperature gradient of the PCR machine. The plates were sealed with an adhesive or hot melting cover foil and incubated on a thermal gradient cycler with a temperature gradient of +/ 12 C. around the expected IT50 value for 10 minutes. The samples were cooled to 8 C. before measuring the residual activity of the samples with AAPF-pNA as followed. Samples, 15 L each from the temperature incubation plate were transferred into a Nunc 384 clear flat bottom plate and 9 L of glycine buffer were added to activate the protease during a incubation of 1 hour at 37 C. After the activation of the protease the assay was started by adding 24 L of an AAPF-pNA solution (2 mM AAPF-pNA in water with 0.01% Triton-X100) and activity was measured by following the kinetics at 37 C. The normalized experimental data for residual activity at the inactivation temperatures were fitted to a four parameter logistics function to evaluate the IT50.

    EXAMPLE 3

    Kumamolisin AS Maturation of the Propeptide Tested by Apparent Gel Mobility Under Native Conditions

    [0210] Samples of the protease incubated at different pH were tested for the processing of the propeptide. pH was adjusted as follows:

    TABLE-US-00005 pH 5.5 100 mM Na-Acetate buffer pH 5.5 + 0.1 mM CaCl.sub.2 pH 6.0 100 mM Na-Acetate buffer pH 6.0 + 0.1 mM CaCl.sub.2 pH 7.0 100 mM HEPES buffer pH 7.0 + 0.1 mM CaCl.sub.2

    [0211] Separation was performed on an native Gel (Mini-Protean TGX Stain free gel, any kD, Biorad 456-8126, with sample buffer 62.5 mM Tris pH 6.8, 12.5% glycerol, Bromphenol-Blue, running buffer 25 mM Tris pH 8.5, 192 mM glycin). Gels were either stained (with coomassie or using the stainfree protocol of Biorad), or further analysed by a zymogram procedure. For zymograms the separated protease species were fully activated after separation in the gel, by rinsing the gel in water followed by an incubation in 100 mM sodium citrate pH 3.0 for 1 h. Active bands were detected by lying an x-ray film (AGFA or Fuji, light exposed and developed, the gelatin side facing the gel) on top of the gel and incubating the gel for 30 minutes at 37 C. in a humidified box. After incubation the x-ray film was rinsed with water to remove hydrolysed protein. Active bands are visual as translucent areas on a black film.

    [0212] Three enzyme species can be distinguished based on the mobility, the zymogen (Z), the enzyme with nicked propeptide (N) and the processed, fully activated enzyme (A) (see FIG. 1).

    EXAMPLE 4

    pH Dependent Maturation of the Aspergilloglutamic Protease

    [0213] The pH that is required to activate the protease is backbone-dependent with Kumamolisin AS showing the highest pH. The pH for the activation of aspergilloglutamic protease is below 5.0 as deduced from the processing of the propeptide, judged by the shift in molecular weight of the zymogen (28.8 kDa theoretical) to the active processed form 23.1 kDa theoretical). Results from SDS-PAGE analysis are shown in FIG. 2.

    EXAMPLE 5

    Effect of pH and Storage Time on the Thermal Stability Mediated by the Propeptide

    [0214] The effect of pH and storage time on the thermal stability was tested at different storage pH and ambient temperature as also outlined in example 3. The thermal stability was tested at the indicated incubation times by analyzing the IT.sub.50 value as described in example 2b.

    [0215] Kumamolisin AS showed an apparent IT.sub.50 of 83.5 C. when not activated during preincubation (because of storage at a pH of 7), whereas the nicked and fully processed enzymes (i.e., which were activated during preincubation because of storage at a pH of 6 or lower) showed an IT.sub.50 of 67.3 C.

    [0216] The determination of IT.sub.50 shows the ratio between inactive and active enzyme candidates. Enzyme candidates with higher stability are inactivated at higher temperatures (right shift), while enzyme candidates with lower stability are already inactivated at lower temperatures (left shift). Under activating conditions nicking occurs, or complete processing of the propeptide, respectively. This leads to the loss of the stabilizing effect of the propeptide. Hence, the processed enzyme candidate has a lower thermal stability (left shift).

    [0217] Nicking or activation hence produces a mixture of species, resulting in a biphasic thermal inactivation curve, with the inflection point giving the fraction of the stable not processed species. The transition from the nicked to the fully activated form results in a change of the slope of inactivation, as a mixed effect of thermal instability and auto proteolysis. Results from this experiment are following the quantitative analysis performed via apparent mobility in the native gel chromatography of example 3.

    [0218] See FIG. 3 for the respective thermostability curves after preincubation at the given pH values 5.5; 6.0 and 7.0. t0-t21 indicate the storage time/preincubation time in days. It is very obvious that at pH 5.5, only the sample that was not preincubated (storage time t0) had an IT.sub.50 of higher than 80 C., while the samples preincubated for 1 day or more suffered an immediate loss in IT50 to lower temperatures.

    [0219] Without being bound to theory, it appears that the point that the preincubation under activating conditions leads to a left shift in IT.sub.50 is caused by hydrolysis of the propeptide, leading to a loss of the stabilising effect of the propeptide. Further, once the enzyme is fully activated, it becomes also self digesting.

    EXAMPLE 6

    Activation Kinetics of Kumamolisin AS Stored at Different pH

    [0220] The effect of storage time and pH on the activation state and activation kinetics was investigated at different storage pH and ambient temperature as also outlined in example 4. Activation kinetic was tested at the indicated time point by transferring the stored protease into an activity assay, as described in example 3, at a pH found in the stomach of monogastric animals.

    [0221] Fully activated samples hydrolyze proteins or protease substrate at maximum conversion speed without any lag time (time points t15, t17 and t21 at pH 5.5), whereas enzymes stored under conditions where no activation, or nicking only, occurs (pH above 6.0, see also example 3 and 4) show a lag phase for activation of 3 minutes. No significant differences in activation lag time were observed for nicked or unprocessed zymogen. Fast activation is beneficial as the time at acidic pH, where the protease of the invention can be active is limited. See FIG. 4 for results.

    EXAMPLE 7

    pH Activity Profile of Activated and not Activated Kumamolisin AS

    [0222] A preparation of Kumamolisin AS produced under conditions where no activation occurs (i.e., at a pH >6), was assayed for the activity at different pH using the assay described under example 3 but using the broad pH band assay buffer as described by Britton and Robinson (1931) without veronal.

    [0223] Activity was analysed at steady state conditions and activity normalized to the maximum activity observed. The activated protease showed a broader pH profile, being also active at pH values where only nicking but no activation occurs. See FIG. 5 for results.

    EXAMPLE 8

    Storage Stability of Feed Enzymes in the Presence of Proteases

    [0224] Besides having a positive effect on the thermal stability (see example 5), the propeptides of the zymogens also have an effect on the enzymatic activity of the protease, with the zymogen being inactive. This protects the protease from self-hydrolysis (see example 9) but also protects other enzymes in the medium (e.g., the feedstuff) from proteolytic degradation. Different enzymes used as feed additive were hence tested for degradation by the acid proteases Kumamolisin AS (K1) at pH where the acid proteases are not activated (pH 6) and at the pH where the protease is activated.

    [0225] A commercial cellulase and a commercial phytase at 50 mg/L were incubated at different pH in the presence of the proteases dosed with equal activity, or the cellulose/phytase alone at the indicated pH values as control. The residual activity of the enzymes was tested at indicated time points using the following assays: Mix 20 L of substrate solution (1 mM MU, methylumbelliferyl substrates, for cellulase and phytase in water) with 20 L of the incubated enzyme mixtures, diluted corresponding to the expected activity, in a black 384 well plate. Incubate at 37 C. for 30 minutes. Add 40 L of a 500 mM sodium carbonate (pH 10.3) solution. Read the fluorescence 364 ex 448 nm and calculate the residual activity with respect to t0. Results are shown in table 1:

    TABLE-US-00006 TABLE 1 Storage of commercial cellulose enzyme at different pH in the presence or absence of proteases, activated or as zymogen. commercial cellulase enzyme assayed at indicated time point with MUC days stored K1 pH4 K1 pH 6 0 100% 100% 2 100% 100% 7 89% 93% 14 100% 100% 21 91% 100% 27 100% 100% commercial cellulase enzyme w/o protease days stored Ctrl pH 3 Ctrl pH 4 Ctrl pH 6 Ctrl pH 8 0 100% 100% 100% 100% 2 92% 100% 98% 100% 7 100% 92% 97% 87% 14 95% 100% 100% 100% 21 100% 96% 100% 100% 27 100% 100% 100% 100%

    TABLE-US-00007 TABLE 2 Storage of commercial phytase enzyme at different pH in the presence or absence of proteases, activated or as zymogen commercial phytase enzyme assayed at indicated time point with MUC days stored K1 pH4 K1 pH 6 0 91% 96% 2 78% 92% 7 67% 100% 14 35% 89% 21 27% 100% 27 21% 100% commercial phytase enzyme w/o protease days stored Ctrl pH 3 Ctrl pH 4 Ctrl pH 6 Ctrl pH 8 0 81% 78% 86% 89% 2 89% 89% 92% 100% 7 90% 98% 93% 100% 14 100% 100% 87% 100% 21 100% 100% 100% 100% 27 100% 89% 100% 100%

    [0226] The data show clearly that coincubation with the acid protease at neutral or basic pH (which leaves the protease as the inactive zymogen) protects the other enzymes in the mixture (cellulase, phytase) from being digested, while coincubation with the acid protease at an acidic pH (which activates the protease by hydrolyzing the propetide) degrades the other enzymes in the mixture.

    EXAMPLE 9

    Selection of Optimized Variants with Higher Thermal Stability

    [0227] Thermal stability of enzymes is a relevant parameter for technical enzymes in food, feed, detergent, cleaning and other applications. The thermal stability of enzymes can be optimized by means of directed evolution an expression describing a combination of generating a genetic diversity and functional selection of optimized, i.e. increased thermally stable variant enzymes. Functional screening of a genetic diversity under predictive conditions is essential. For proteases like those described herein screening for thermally more stable variants by methods as described in example 2b can be affected by the self hydrolysis of the protease.

    [0228] Testing the thermal stability of Kumamolisin AS for the zymogen (FIG. 6, closed circles) or the activated enzyme (FIG. 6, open circles) characterize this difference. The thermal inactivation curve of the zymogen shows the standard sigmoidal inactivation curve, with a sharp decline in activity (curve can be fitted to a four parameter logistic) whereas the activated enzyme shows an early decline of activity as a mixed effect of self hydrolysis and thermal inactivation.

    EXAMPLE 10

    In Vivo Digestibility Test of Acid Protease

    [0229] To test the efficacy of acid proteases in feed applications Kumamolisin AS (K1), as example for a peptidase of the sedolisin group was tested in an in vivo trial.

    [0230] Enzyme produced as described in example 1 was freeze dried as active enzyme and incorporated in a standard corn soy diet at a dosage depending on the activity of the samples of 35 mg/kg for K1.

    [0231] After a 21 day pre-treatment period where the diet was fed without enzyme, male broiler chickens (Cobb 500) were assigned to three treatments (24 animals per treatment, 8 repetitions with three birds per cage, base area 34 cm55 cm), and fed for further 7 days a basal diet without (control group) or with enzyme supplementation at the dose levels stated. Feed was offered in automatic feeders ad libitum. Fresh water in drinking quality was continuously supplied by nipple drinkers.

    [0232] The efficacy was demonstrated by productive performance (body weight, body weight gain, feed intake, feed conversion ratio) from 22 to 28 d of age, and apparent ileal digestibility measurements (ash, crude protein, crude fat, calcium, phosphorus) at the end of the 7 d feeding period (28 d of age).

    [0233] For calculation of the individual body weight gain the following formula was used:


    Average weight gain per bird for each period FS (corrected by weight gain of died or culled chickens)


    F-Average weight of the live birds in the cage at the weighing day


    S-Average weight of the live birds in the cage at the previous weighing

    [0234] The feed intake (corrected for dispersed feed) was calculated by the following formula

    [00001] Feed .Math. .Math. intake .Math. .Math. per .Math. .Math. period = total .Math. .Math. feed .Math. .Math. consumed .Math. .Math. per .Math. .Math. cage ( number .Math. .Math. of .Math. .Math. surviving .Math. .Math. birds days .Math. .Math. of .Math. .Math. the .Math. .Math. period ) + days .Math. .Math. of .Math. .Math. died .Math. .Math. birds .Math. .Math. alive

    [0235] The feed conversion ratio was estimated by using the following formula:

    [00002] Feed .Math. .Math. conversion .Math. .Math. per .Math. .Math. period = total .Math. .Math. feed .Math. .Math. consumed .Math. .Math. per .Math. .Math. cage total .Math. .Math. weight .Math. .Math. gain .Math. .Math. for .Math. .Math. the .Math. .Math. period ( with .Math. .Math. died .Math. .Math. or .Math. .Math. culled .Math. .Math. chicken )

    [0236] Apparent ileal digestibility was determined in all birds per treatment group at the end of the 7 d treatment period. The ileal contents of 3 birds of one cage were pooled. Before analysing the pooled samples were kept at 20 C. before being freeze-dried for chemical analyses. Titanium(IV) oxide (TiO2) was supplemented as an inert marker at the dose level of 3 g/kg diet from 22 to 28 days of age. For calculation of the apparent ileal digestibility the following formula was used:

    [00003] Ileal .Math. .Math. digeatability .Math. .Math. ( % ) = 100 - [ % .Math. .Math. marker .Math. .Math. in .Math. .Math. feed % .Math. .Math. marker .Math. .Math. in .Math. .Math. ileum % .Math. .Math. nutrient .Math. .Math. in .Math. .Math. ileum % .Math. .Math. nutrients .Math. .Math. in .Math. .Math. feed 100 ]

    [0237] Results are shown in FIGS. 7-11, and in tables 7 and 8.

    [0238] FIG. 7 shows the body weight gain, FIG. 8 shows the feed conversion ratio, FIG. 9 shows the apparent digestibility of crude protein, FIG. 10 shows the apparent digestibility of fat, and FIG. 11 shows the apparent digestibility of phosphorous.

    [0239] It is indeed surprising that the digestibility of fat and phosphorous is increased by administration of the acid protease. This effect could not be expected, because proteases do not digest fat or phosphorous-comprising molecules. Without being bound to theory, the inventors speculate that the acid proteases might cleave up particular complexes comprising proteins, which then release fats or phosphorous.

    [0240] These experiments show that the acid proteases according to the inventionin particular those from the sedolisin groupare indeed useful as feed additives, to increase digestability of food and body weight gain.

    EXAMPLE 11

    In Vivo Performance Test

    [0241] To test the efficacy of acid protease Kumamolisin AS (K1) as an example for an acid protease of the group of sedolisins (S53), an in vivo trial against a Ronozyme ProAct (RPA) was carried out. As discussed, the latter enzyme is a protease with a neutral pH activity profile, and was included to demonstrate the performance advantage of said acid proteases of the group of sedolisins (S53), over neutral active proteolytic enzymes.

    [0242] Enzyme produced as described in example 1 was freeze dried as active enzyme and incorporated in a standard corn soy diet at a dosage depending on the activity of the samples of 354 mg/kg for K1. The dosing being the activity dose equivalent to the dose recommendation of the RPA enzyme product of 200 mg/kg. The protease Ronozyme ProAct was dosed according to the dose recommendation with 200 mg/kg and Phytase was dosed with 500 FTU/kg, also according to the standard dosing recommendation.

    [0243] The experiment was performed with one-day-old male broiler chickens (Cobb 500) that were allocated to four experimental groups with eight repetitions of 3 birds each. The chickens were distributed as homogenous as possible to identical stainless steel cages with three birds per cage (8 repetitions per any treatment).

    [0244] The 35 d experimental period was divided into two feeding phases; a starter period from first day to day fourteen of age and a subsequent grower period from day fifteen to day thirty-five of age, respectively. The basal starter and grower diets were calculated to meet the nutrient requirements for broiler chickens recommended by the GfE with exception of slightly reduced protein, amino acids, and phosphorus contents. One group received the basal diets without test products (control). Further groups were offered diets containing the enzyme prototype K1 the commercial enzyme product Ronozyme ProAct (RPA) throughout the 35 d feeding period. A further group received the phytase enzyme product Quantum Blue 5G.

    [0245] Broiler chickens had ad libitum access to feed (mash form) throughout the 35 d feeding period; water supplied by drinking bells was also available ad libitum. The trial was run without any adverse technical events (e.g. power failure, feed/water failures). The overall mortality rate amounted to 2.5%.

    [0246] The efficacy was demonstrated by productive performance (body weight, body weight gain, feed intake, feed conversion ratio) over the full feeding period, and apparent ileal digestibility measurements (ash, crude protein, crude fat, calcium, phosphorus) at the end (35 days of age).

    [0247] For calculation of the individual body weight gain the following formula was used:

    [0248] Average weight gain per bird for each period F-S (corrected by weight gain of died or culled chickens) [0249] F-Average weight of the live birds in the cage at the weighing day [0250] S-Average weight of the live birds in the cage at the previous weighing

    [0251] The feed intake (corrected for dispersed feed) was calculated by the following formula

    [00004] Feed .Math. .Math. intake .Math. .Math. per .Math. .Math. period = total .Math. .Math. feed .Math. .Math. consumed .Math. .Math. per .Math. .Math. cage ( number .Math. .Math. of .Math. .Math. surviving .Math. .Math. birds days .Math. .Math. of .Math. .Math. the .Math. .Math. period ) + days .Math. .Math. of .Math. .Math. died .Math. .Math. birds .Math. .Math. alive

    [0252] The feed conversion ratio was estimated by using the following formula:

    [00005] Feed .Math. .Math. conversion .Math. .Math. per .Math. .Math. period = total .Math. .Math. feed .Math. .Math. consumed .Math. .Math. per .Math. .Math. cage total .Math. .Math. weight .Math. .Math. gain .Math. .Math. for .Math. .Math. the .Math. .Math. period ( with .Math. .Math. died .Math. .Math. or .Math. .Math. culled .Math. .Math. chicken

    [0253] Apparent ileal digestibility of crude protein, crude fat, crude ash, calcium and phosphorus was determined in all birds of each treatment group at day 35 on trial (5 days of age). The ileal contents of 3 birds of one cage were pooled. Before analysing the pooled samples were kept at 20 C. before being freeze-dried for chemical analyses.

    [0254] Titanium(IV) oxide (TiO2) was supplemented as an inert marker at the dose level of 3 g/kg diet. For calculation of the apparent ileal digestibility the following formula was used:

    [00006] Ileal .Math. .Math. digeatability .Math. .Math. ( % ) = 100 - [ % .Math. .Math. marker .Math. .Math. in .Math. .Math. feed % .Math. .Math. marker .Math. .Math. in .Math. .Math. ileum % .Math. .Math. nutrient .Math. .Math. in .Math. .Math. ileum % .Math. .Math. nutrients .Math. .Math. in .Math. .Math. feed 100 ]

    TABLE-US-00008 TABLE 3 Performance from day 1 to day 35 control (T1) RPA (T2) K1 (T3) Quantum Blue (T5) Broiler chickens no 23 24 24 23 Body weight start g 41.6 0.9 41.6 1.1 41.6 1.4 41.5 1.2 Body weight end g 2067.3 25.9.sup.a 2119.8 34.5.sup.b 2177.8 34.9.sup.c 2080.2 26.0.sup.ab Body weight gain g 2025.6 26.0.sup.a 2078.1 34.9.sup.b 2136.1 35.0.sup.c 2038.7 25.7.sup.ab Feed intake g 2951.2 68.1 2955.8 46.2 2971.2 85.3.sup. 2938.7 62.2 Feed conversion 1) 1.457 0.036.sup.b 1.422 0.013.sup.ab 1.391 0.047.sup.a 1.442 0.033.sup.b Points FCR increase 3.5 6.6 1.5 Different superscripts within lines indicate levels of significance at P < 0.05

    [0255] When feeding broiler chickens with inclusion of the acid protease K1 benefits on overall body weight gain were significantly higher than those reported for Ronozyme ProAct, or the phytase enzyme product Quantum Blue 5G (table 3). The corresponding overall feed conversion ratio was significantly reduced by 6.6 points compared to the control and 5.1 points to broiler chickens fed Quantum Blue 5G. Reduction of the food conversion ratio was also 3.1 points higher than reported for Ronozyme ProAct.

    [0256] The positive response on performance of the enzymes was based on improvements in the apparent ileal digestibility measured at day 35 of age (measurements performed as described in example 10). As already reported in the feeding trial shown in example 10, the apparent ileal digestibility of crude protein was increased but also significant effects on the digestibility of calcium, phosphate and fat were observed (table 4). The averaged apparent ileal digestibility increase of the acid proteases K1 was 7.9%., being significant higher than the observed increase for the neutral active protease Ronozyme ProAct with 4.3%.

    [0257] The significant and unexpected high effects on the apparent digestibility of phosphate (K1, 8.8% increase to control) and calcium (K1, 12.2% and increase to control) can be attributed to the known interaction between phytate and protein. The publication of Selle et al. (2000) consolidates the information about phytate-protein complexes and discusses the effect of phytase and the phytase-associated positive effects on protein digestibility. Under acid conditions of the stomach, below the isoelectric point of proteins, binary protein-phytate complexes are formed, whereas ternary complexes of phytate, metal ions and proteins are formed at neutral pH (Cosgrove 1966, Anderson 1985). Binary protein-phytate complexes have been demonstrated in vitro at acid pH for several proteins e.g. glycinin (Okubo et al. 1976) the major protein in soybeans also being a protein source in the feeding trials described above and in example 10 and 12. The maximum of protein complexation to binary complexes have been described at pH 2-3 for globulin, with a dependence on the phytate to protein ratio. Rajendran & Prakash (1993) described progressive protein-protein aggregation after an initial binding of protein to phytate associated with conformational changes of the protein. Such aggregates might be recalcitrant to protein hydrolysis as several in vitro studies describe a reduction of peptic hydrolysis in the presence of phytate in acid conditions (Camus & Laporte, 1976). This initial description was extended by several studies consistently showing a reduction of peptic activity for plant storage and animal proteins (Kanaya et al. 1976, Inagawa et al. 1987, Knuckles et al. 1989, Vaintraub & Bulmaga 1991).

    [0258] The working hypothesis was derived from these observations that the formation of binary protein-phytate complexes are a major aspect of the wellknown anti-nutritive effect of phytate. The anti-nutritive effect of phytate today is only addressed by means of supplemented microbial phytase activity beside the effect of the liberation of dietary phosphate from phytate. The protein effect of phytase is most probably associated with the protein-phytate complexes, by hydrolysis of phytate to lower inositol phosphates with a rendered ability to form such complexes. It might also be that a new propagated reading of dose recommendation, the superdosing of phytase exerts its effect by fast hydrolyzing phytate and interfering with the built up of such complexes. No examples of using a protease from peptidase family S53 to address these protein-phytate complexes are described so far though it is obvious that also phytase will hydrolyse soluble phytate better (Lonnerdal et al. 1989) than phytate in protein decorated complexes (Konishi et al. 1999, Bohn et al. 2007).

    [0259] Releasing protein and phytate from such binary complexes, in which phytate and protein are both more recalcitrant to hydrolysis, by the action of an acid protease, does have the potential to have synergistic effects with phytase. This effect is a result of the simultaneous activity of both enzymes and haven't been tested for neutral active proteases before or been observed in the in vivo trials shown in examples 10, 11 and 12. Testing the hydrolysis of binary complexes in vitro is hard to test as complex preparation render the complex nature and predictivity is concomitantly limited (Selle et al. 2000). In vivo feeding trials might be the best way to test such effects. It can be expected that an acid protease able to hydrolyze protein in binary complexes or before such complexes have been formed will have beneficial effects on the digestibility of crude protein and at least additional effects with phytase on the digestibility of phosphorous, with more than additive, i.e. synergistic effects being a good prove for the discussed mode of action and the inventive step in selecting an acid protease which is active on binary protein-phytate complexes. Otherwise picking an acid enzyme is not obvious, as acid proteases do have less time to hydrolyze protein due to a 4 time longer retention time in the neutral parts of the gastrointestinal tract, the mostly lower thermal stability, fewer examples for the economical producibility and examples for genetic engineering of such enzymes for better performance.

    TABLE-US-00009 TABLE 4 Apparent ileal digestibility at day 35 control (T1) RPA (T2) K1 (T3) Quantum Blue (T5) Crude Protein digestibility % 80.93 1.36.sup.a 81.95 0.99.sup.ab 82.53 1.01.sup.abc 82.67 0.86.sup.bcd Crude Fat digestibility % 88.52 1.22.sup.a 90.06 0.75.sup.abc 91.47 0.39.sup.bcd 89.74 0.42.sup.ab Ash digestibility % 38.87 3.20.sup.a 42.67 1.53.sup.ab 43.91 2.26.sup.bc 43.80 1.14.sup.bc Calcium digestibility % 48.93 2.88.sup.a 50.94 2.86.sup.ab 54.92 2.32.sup.bc 55.11 3.80.sup.bc Phosphorous digestibility % 45.34 2.79.sup.a 47.34 2.10.sup.ab 49.32 1.78.sup.b 53.54 2.04.sup.c Averaged apparent ileal 4.3 7.9 9.4 digestibility increase % over control

    [0260] For better evaluation of the results exploratory graphics as box-and-whisker plots were shown in FIG. 12 A-F, to show distribution of the presented datasets, for body weight gain, feed conversion and apparent ileal digestibility of crude protein, phosphorous, calcium and crude fat. Treatment groups were 1 control; 2 Ronozyme ProAct, 3 Kumamolisin AS (K1), 5 Quantum Blue 5Geach dosed as outlined above.

    EXAMPLE 12

    In Vivo Digestibility and Performance Test

    [0261] To test for any synergistic effects with phytases, Kumamolisin AS (K1), as an example for an acid protease of the group of sedolisins (S53) or G1, was tested in combination with the phytase Quantum Blue (AB Vista) in an in vivo trial against the combination of Ronozyme ProAct (RPA) with the same phytase. As discussed, the latter enzyme is a protease with a neutral pH activity profile, and was included to demonstrate the performance advantage of said acid proteases of the group of sedolisins (S53) or G1, over neutral active proteolytic enzymes, when combined with a phytase.

    [0262] The trial was run in parallel to and under the same conditions as outlined for the trial in example 11, with the exception that proteases were only fed from day twenty-nine to day thirty-five. Control, basal diet without enzyme (treatment 1) and the phytase reference, basal diet with phytase Quantum blue 5G (treatment 5) were the same as in example 11. Further groups offered diets with Quantum blue 5G for the full feeding period of 35 days with additional protease for the last seven days (day 29 to day 35), Ronozyme ProAct (treatment 6) and Kumamolisin AS (treatment 7). Further groups were protease control groups to test for the effect of protease Ronozyme ProAct (treatment 8) or and Kumamolisin AS (treatment 9) when only feed for the last seven days of the 35 day feeding period and in the absence of phytase.

    [0263] The dosing was equal to and described in example 11. In brief, enzyme produced as described in example 1 was freeze dried as active enzyme and incorporated in the starter and grower diets outlined in example 11 at a dosage depending on the activity of the samples of 354 mg/kg for K1, being the activity dose equivalent to the dose recommendation of the RPA enzyme product. The protease Ronozyme ProAct was dosed according to the dose recommendation with 200 mg/kg and phytase was dosed with 500 FTU/kg, also according to the standard dosing recommendation.

    [0264] The efficacy was demonstrated by productive performance (body weight, body weight gain, feed intake, feed conversion ratio) over the full feeding period, and apparent ileal digestibility measurements (ash, crude protein, crude fat, calcium, phosphorus) at the end (35 days of age). All calculations also for apparent ileal digestibility were as in example 10 and 11.

    [0265] Before comparative analytics of the feeding trial results it was evaluated whether treatments feeding enzymes only for the last 7 days are relevant with regard to the overall feeding period of 35 days. By the fact that corresponding benefits (weight gain; feed conversion ratio) were found for Ronozyme ProAct, and K1 fed throughout the 35 day feeding period or from day 29 to day 35 of age without enzyme addition before (compare treatment groups 2, 8 and 3, 9 in table 5) results of the enzyme combinations measured from day 29 to day 35 are sufficiently relevant. The fact that results on apparent ileal digestibility of Ronozyme ProAct and K1 were nearly independent from feeding duration (compare lines line for treatment groups T2 and T3 from table 3 in example 11, with lines from treatment group T8 and T7 in table 6 of example 12 respectively) benefits of enzyme combinations measured from day 29 to day 35 of age seemed to be relevant with regard to the overall feeding period.

    TABLE-US-00010 TABLE 5 Performance from day 29 to day 35 Quantum Control RPA K1 Blue (T1) (T2) (T3) (T5) Body weight start g 1424.6 15.0 1454.9 21.3 1490.4 20.8 1434.1 16.4 Body weight end g 2067.3 25.9 2119.8 34.5 2177.8 34.9 2080.2 26.0 Body weight gain g 642.6 35.6 664.9 51.3 687.3 42.9 646.1 25.5 Feed intake g 1002.9 41.2 1008.1 47.2 1008.9 37.0 992.8 45.2 Feed conversion 1) 1.563 0.073 1.521 0.089 1.472 0.102 1.537 0.062 Points FCR increase 4.2 9.1 2.6 Quantum Blue + Quantum Blue + K1 RPA K1 RPA (T6) (T7) (T8) (T9) Body weight start g 1435.7 13.8 1428.2 19.3 1422.4 18.4 1429.4 18.6 Body weight end g 2150.8 19.8 2173.0 20.5 2096.1 28.0 2112.9 22.3 Body weight gain g 715.1 26.0 744.8 26.7 676.7 25.6 683.5 20.4 Feed intake g 1017.5 37.7 1025.3 39.3 1003.3 55.6 1014.6 42.1 Feed conversion 1) 1.424 0.044 1.377 0.03 1.490 0.091 1.485 0.073 Points FCR increase 13.9 18.6 7.3 7.8

    TABLE-US-00011 TABLE 6 Apparent ileal digestibility at day 35 Quantum Quantum Quantum Blue + Control RPA K1 Blue Blue + K1 RPA K1 (T1) (T2) (T3) (T5) RPA (T6) (T7) (T8) (T9) Crude Protein % 80.93 1.36 81.95 0.99 82.53 1.01 82.67 0.86 83.83 1.39 84.29 0.81 82.52 1.05 83.19 0.79 Crude Fat % 88.52 1.22 90.06 0.75 91.47 0.39 89.74 0.42 92.19 1.05 92.03 0.89 90.78 0.598 91.65 0.60 Ash % 38.87 3.20 42.67 1.53 43.91 2.26 43.80 1.14 44.02 2.85 47.09 4.44 42.12 2.86 43.00 1.90 Calcium % 48.93 2.88 50.94 2.86 54.92 2.32 55.11 3.80 55.37 1.52 57.68 2.75 54.53 2.02 55.33 2.05 Phosphorous % 45.34 2.79 47.34 2.10 49.32 1.78 53.54 2.04 55.85 2.42 58.51 2.12 48.48 2.89 49.23 3.10 Averaged apparent ileal 4.3 7.9 9.4 11.3 15.3 6.2 7.7 digestibility increase % over control Increase of phosphorus 2.0 4.4 8.2 10.5 13.2 3.1 3.9 digestibility % over control Increase of phosphorus 2.3 5.0 digestibility % over Quantum blue Treatment T1-T5 groups are reproductions from example 11

    [0266] The overall body weight gain for K1 was significantly higher than those recorded for chickens fed any other enzyme over the full feeding period. The corresponding overall feed conversion ratio was significantly reduced compared to the other enzymes. The highest benefits on body weight gain and feed conversion ratio were found for combinations with the phytase Quantum Blue 5G with effects of K1, the acid protease in combination with phytase being superior to the neutral protease Ronozyme ProAct.

    [0267] The positive response on performance of these enzymes and these enzyme combinations was based on improvements in the apparent ileal digestibility. K1 and Ronozyme ProAct feed for the last 7 days increased the averaged apparent digestibility by 7.7% and 6.2% respectively.

    [0268] The averaged apparent ileal digestibility benefits were highest for combinations of the phytase Quantum Blue 5G and Ronozyme ProAct or K1 of 11.3% or 15.3% respectively, with K1 the acid protease combination being superior to the neutral protease Ronozyme ProAct combination with phytase.

    [0269] The effect of combining the acid protease K1 with a phytase was better than observed for the combination of phytase with the neutral active enzyme product Ronozyme ProAct, especially with respect to calcium and phosphorus. Also referencing the discussed potential benefits of an acid protease over a neutral protease in combination with phytase, the increase of phosphate digestibility in combination with phytase is more than additive for the acid active protease K1, pointing to synergistic effects with phytases, whereas the neutral active protease shows less than additive effects (compare table 6, line Increase of phosphorus digestibility % over Quantum blue for T6 and T7 to line Increase of phosphorus digestibility % over control for T8 and T9 respectively) .

    [0270] For better evaluation of the results exploratory graphics as box-and-whisker plots were shown in FIG. 13 A-F, to show distribution of the presented datasets, for body weight gain, feed conversion and apparent ileal digestibility of crude protein, phosphorous, calcium and crude fat. Treatment groups were 1 control; 2 Ronozyme ProAct, 3 Kumamolisin AS (K1), 5 Quantum Blue 5G, 6 Quantum Blue 5 G+Ronozyme ProAct (day 29-35), 7 Quantum Blue 5 G+K1 (day 29-35), 8 Ronozyme ProAct (day 29-35), 9 K1 (day 29-35)each dosed as outlined above.

    [0271] These experiments show impressively that there is a true synergism between an acid protease from the S53 family and a phytase. As discussed, acid proteases from the S53 family and the G1 family form a group of what were formerly termed pepstatin-insensitive carboxyl proteinases. Hence, both families share a particular structural and/or functional relationship. For this reason, said synergism also applies to a combination of an acid protease from the G1 family and a phytase, when compared to a combination of a neutral/alkali protease with a phytase.

    TABLE-US-00012 TABLE 7 Performance for treatment period from day 22 to day 28 control RPA K1 Broiler no 24 24 24 chickens Body g 824.3 24.7 824.0 20.9 824.3 23.7 weight start Body g 1330.0 25.2 1341.4 22.7 1352.1 22.9 weight end Body g 505.8 19.2 517.4 11.3 527.9 21.5 weight gain Feed intake g 726.9 30.3 727.8 17.3 730.5 24.2 Feed (kg feed 1.438 0.044 1.407 0.032 1.385 0.032 conversion per kg body weight gain) Points FCR 3.1 5.3 increase Different superscripts within lines indicate levels of significance at P < 0.05

    TABLE-US-00013 TABLE 8 Apparent ileal digestibility at end of treatment period day 28 control RPA K1 Crude Protein digestibility % 76.00 1.56.sup.a 78.60 0.92.sup.b 80.18 1.03.sup.c Crude Fat digestibility % 91.43 2.21.sup.a 93.99 1.17.sup.b 94.67 0.79.sup.b Ash digestibility % 36.09 4.89.sup.a 38.50 1.85.sup.a 45.11 3.76.sup.b Calcium digestibility % 35.30 4.46 38.55 4.94 38.31 63.68 Phosphorous digestibility % 45.14 2.91.sup.a 48.39 2.31.sup.ab 51.70 3.31.sup.b Averaged apparent ileal digestibility 5.86% 11.42% increase % over control

    EXAMPLE 13

    Expression of Grifolisin

    [0272] Grifosilin is another peptidase from the S53 family originating from the fungus Grifola frondosa. Grifolisin was expressed in Saccharomyces cerevisiae strain BY4741, transformed with a plasmid harboring the codon optimized gene (SEQ ID NO 3) under the control of a constitutive promotor as a zymogen. The enzyme was secreted via a S. cerevisiae specific leader into the culture medium and further processed to retain active enzyme.

    [0273] The expression took place in SC-Ura media supplemented with 2% glucose adjusted to pH 5.6. A pre-culture of 10 mL SC-Ura 2% glucose media was inoculated with 50 l glycerol stock containing the transformed cells and grown at 30 C. 150 rpm for 24 h. For the main culture 1 L SC-Ura 2 v % glucose medium were supplemented with the pre-culture adjusting to an OD600 of 0.05, and the cells were then further grown at 30 C. 150 rpm for 72 h.

    EXAMPLE 14

    Hydrolysis of Soybean Derived Kunitz-Type and Bowman-Birk Trypsin Inhibitors (BBI/KTI)

    [0274] In soy beans and other legume seeds, two types of trypsin inhibitors are found in soy beans: the Kunitz trypsin inhibitor (KTI) and the Bowman-Birk inhibitor (BBI). KTI is a large (20,100 daltons), strong inhibitor of trypsin, while BBI is much smaller (8,000 daltons) and inhibits both trypsin and chymotrypsin, which occur naturally in the gut of humans and livestock.

    [0275] Both inhibitors have significant anti-nutritive effects in the body, affecting digestion by hindering protein hydrolysis and activation of other enzymes in the gut. Whole soybeans contain 15-40 mg of trypsin inhibitor per gram, hence, between 1.5% w/w and 4.0% w/w, and do hence a form a significant fraction of the bean's protein content.

    [0276] The presence of these inhibitors is thought to protect soy seeds against consumption by animal predators.

    [0277] Interestingly, the two inhibitors are remarkably stable, and furthermore largely resistant against digestion by proteases. In feed applications, an enzymatic degradation of these two inhibitors has a twofold effect, namely (i) makes said protein fraction accessible for uptake by the animal, and (ii) blocks inhibition of the animals own gut proteases, trypsin and chymotrypsin.

    [0278] Both effects increase the food conversion rate, and enhance the protein uptake from the feedstuff.

    [0279] However, many proteases, like trypsin and chmotrypsin, do not degrade neither Kunitz trypsin inhibitor (KTI) not Bowman-Birk inhibitor (BBI). In the following experiment, it has been demonstrated that another member of the peptidase family S53, Grifolisin, can effectively degrade KTI and BBI, hence leading to a recovery of normal trypsin activity.

    Experimental Protocol

    [0280] a) Hydrolysis of KTI and BBI with grifosilin 96-well format

    [0281] Incubate KTI (17.5 g/ml) and/or BBI (4.3 g/mL) with 14 g/ml purified grifosilin for 60 min at 37 C.

    [0282] Assay buffer: 100 mM Na-Citrate, 1 mM CaCl.sub.2, pH 3 [0283] b) Residual activity of trypsin after BBI and KTI hydrolysis by grifosilin using AAPF assay 96-well format

    [0284] Dilute reaction mix from a) 1:5 in 24 L 100 mM Na-Citrate, 1 mM CaCl.sub.2, pH 3

    [0285] Dilute 1:1 Trypsin solution in 1 M Na-phosphate pH 8 (this adjusts reaction mix pH to 7) and incubate for 10 min at 37 C.

    [0286] Start reaction by adding substrate working solution for protease assay (see example 2, except that assay buffer has pH 7 for neutral protease activity)

    [0287] Measure kinetics at 37 C. by monitoring the increase in adsorption at 410 nm as a measure for enzymatic activity. We will compare the residual activity of trypsin in the presence and absence of BBI, KTI, and BBI/KTI.

    [0288] Concentrations in the protease assay:

    TABLE-US-00014 KTI 1.5 g/mL BBI 0.37 g/mL BBI/KTI 0.6 + 0.3 g/mL Trypsin 0.1 g/mL +/Grifosilin 1.2 g/mL AAPF 1 mM

    [0289] FIG. 14 clearly shows that inhibitor-mediated trypsin inhibition is strongly decreased in the presence of grifosilin, for BBI, KTI, and BBI/KTI. In numbers, 20-40% of the initial trypsin activity could be restored. Without grifosilin, no trypsin activity in presence of any type of inhibitor is visible, while in the presence of grifosilin, said activity was restored. This data suggest that grifosilin is active on both KTI and BBI, and has hence a true effect in feed applications, where it can help to increase the food conversion rate and the protein uptake efficiency.

    [0290] Normal BBI/KTI hydrolysis assays usually show the inhibitor degradation via SDS-PAGE but never address the functional consequences of KTI/BBI hydrolysis on trypsin itself, which is the most important aspect. This functional assay here directly measures the trypsin activity after treating BBI and KTI with an acid feed protease from the S53 family, and thus, it is much closer to real-life applications.

    REFERENCES

    [0291] Wlodawer A1, Li M, Gustchina A, Oyama H, Dunn B M, Oda K., Acta Biochim Pol. 2003; 50(1):81-102

    [0292] Terashita, T., Oda, K., Kono, M. & Murao, S., Agric Biol Chem (1981) 45, 1937-1943

    [0293] Oda, K., Takahashi, S., Ito, M. & Dunn, B. M., Adv Exp Med Biol (1998) 436, 349-353

    [0294] Britton, H. T. K. and R. A. Robinson. J. Chem. Soc., 1931, 1456-1462.

    [0295] P. H. Selle, V. Ravindran, R. A, Caldwell and W. L. Bryden. Phytate and Phytase: consequences for protein utilisation. Nutrition Research Reviews (2000), 13, p. 255-278

    [0296] D. J. Cosgrove (1966). The chemistry and biochemistry of inositol polyphosphates. Reviews of pure and applied chemistry, 16, p. 209-224

    [0297] P. A. Anderson (1985) Interactions between proteins and constituents that affect protein quality. In Digestibility and Amino Acid Availability in Cereals and Oilseeds, pp. 31-45 [J. W. Finley and D. T. Hopkins, editors]. St. Paul, Minn.: American Association of Cereal Chemistry, Inc.

    [0298] K. Okubo, D. V. Meyers and G. A. Iacobucci (1976) Binding of phytic acid to glycinin. Cereal Chemistry 53, pp 513-524

    [0299] Rajendran and V. Prakash (1993) Kinetics and thermodynamics of the mechanism of interaction of sodium phytate with alpha-globulin. Biochemistry 32, pp. 3474-3478

    [0300] M. C. Camus and J. C. Laporte (1976) Inhibitionde la protolyse pesique par le bl. Rle de l'acide phytique des issues. (Inhibition of pepsin proteolysis by wheat. Role of phytic acid in the outcome). Annales de Biologie Animale Biochimie Biophysique 16, pp. 719-729

    [0301] K. Kanaya, K. Yasumoto and H. Mitsuda (1976) Pepsin inhibition by phytate contained in rice bran. Eiyo To Shokuyo 29, pp. 341-346

    [0302] J. Inagawa, I. Kiyosawa and T. Nagasawa (1987) Effects of phytic acid on the digestion of casein and soybean protein with trypsin, pancreatin and pepsin. Nippon Eiyo Shokuryo Gakkaishi 40, pp. 367-373

    [0303] B. E. Knuckles, D. D. Kuzmicky, M. R. Gumbmann and A. A. Betschart (1989) Effect of myo-inositol phosphate esters on in vitro an in vivo digestion of protein. J. of Feed Science 54, pp. 1348-1350

    [0304] I. A. Vaintraub and V. P. Bulmaga (1991) Effect of phytate on the in vitro activity of digestive proteinases. J. of Agricultural and Food Chemistry 39, pp. 859-861

    [0305] B. Lonnerdal, A. S. Sandberg, B. Sandstrom and C. Kunz (1989) Inhibitory effects of phytic acid and other inositol phosphates on zinc and calcium absorption in suckling rats. J. of Nutrition 119, pp. 211-214

    [0306] Bohn, L., Josefsen, L., Meyer, A. S., Rasmussen, S. K., 2007 Quantitative analysis of phytate globoids isolated from wheat bran and characterization of their sequential dephosphorylation by wheat phytase. J. Agri. Food Chem. 55, pp. 7547-7552

    [0307] C. Konishi, T. Matsui, H. Park, H. Yano and F. Yano (1999) Heat treatment of soybean and rapeseed meals suppress rumen degradation of phytate phosphorus in sheep. Animal Feed Science and Technology 80, pp. 115-122

    Sequences

    [0308]

    TABLE-US-00015 SEQIDNo1KumamolisinAScodonoptimizedfor Bacillussubtilis tcagatatggaaaaaccgtggaaagaaggcgaagaagctagagcagttct gcaaggccatgcaagagcacaagcaccgcaagcagttgataaaggaccgg ttgcaggcgacgaaagaatggcagttacagttgttctgcgcagacaaaga gcaggcgaactggcagcacatgttgaaagacaagcagcaattgcaccgca tgcaagagaacatctgaaaagagaagcatttgcagcatcacatggcgcat cactggatgattttgcagaactgagaagatttgcagatgcgcatggcctg gcactggatagagcaaatgttgcagcaggcacagcagttctgtcaggacc ggttgatgcaattaatagagcatttggcgttgaactgcgccattttgatc atccggatggctcatatagatcatatctgggcgaagttacagttccggca tcaattgcaccgatgattgaagcagttctgggcctggatacaagaccggt tgcaagaccgcattttagaatgcaaagacgcgcagaaggcggatttgaag caagatcacaagcagcagcaccgacagcatatacaccgctggatgttgca caagcatatcaatttccggaaggcctggatggacaaggccaatgcattgc aattattgaacttggcggaggctatgatgaagcatcactggcacaatatt ttgcatcactgggcgttccggcaccgcaagttgtttcagtttcagttgat ggcgcatcaaatcaaccgacaggcgatccgtcaggaccggatggcgaagt tgaactggatattgaagttgcaggcgcactggcacctggcgcaaaatttg cagtttattttgcaccgaatacggatgcaggctttctggatgcaattaca acagcaattcatgatccgacactgaaaccgtcagttgtttcaattagctg gggaggaccggaagattcatggacatcagcagcgattgcagcaatgaata gagcgtttcttgatgcagcagcactgggcgttacagttctggcagcagca ggcgattcaggcagcacagatggcgaacaagatggcctgtatcatgttga ttttccggcagcatcaccgtatgttctggcatgcggaggcacaagacttg ttgcatcaggcggaagaattgcacaagaaacagtttggaatgatggacct gatggcggagcaacaggcggaggcgtttcaagaatttttccgcttccggc atggcaagaacatgcaaatgttccgccttcagcaaatcctggcgcatcat caggcagaggcgttccggatctggcaggcaatgcagatccggcaacaggc tatgaagttgttattgatggcgaagcgacagttattggcggaacatcagc agttgcaccgctgtttgcagcactggttgcaagaattaatcaaaaactgg gcaaagcagtcggctatctgaatccgacactgtatcaacttccggcagat gtctttcatgatattacagaaggcaacaacgatattgcgaatcgcgcaca aatttatcaagcaggaccgggatgggatccgtgcacaggcctgggctcac cgattggcgttagactgctgcaagcactgctgccgtcagcatcacaaccg caaccgtaa SEQIDNO2:Aspergillopepsin2codonoptimized forSaccharomycescerevisiae gctccattgactgaaaaaagaagagctagaaaagaagctagagctgctgg taagagacattctaatccaccatatattccaggttccgacaaagaaatct tgaagttgaacggtactaccaacgaagaatactcttctaattgggctggt gctgttttgattggtgatggttatacaaaggttaccggtgaattcactgt tccatctgtttctgctggttcttcaggttcttctggttatggtggtggtt acggttattggaaaaacaagagacaatccgaagaatattgtgcttctgct tgggttggtattgatggtgatacttgtgaaactgctatcttgcaaactgg tgttgatttctgttacgaagatggtcaaacttcttacgatgcttggtatg aatggtatccagattacgcttacgatttctccgatattaccatctctgaa ggtgattccatcaaggttactgttgaagctacctctaaatcatctggttc tgccactgttgaaaacttgactactggtcaatctgttacccatactttct ctggtaatgttgaaggtgacttgtgtgaaactaatgccgaatggatcgtt gaagatttcgaatctggtgattctttggttgcttttgctgatttcggttc tgttactttcactaacgctgaagctacttctggtggttctactgttggtc catctgatgctactgttatggatattgaacaagacggttccgttttgacc gaaacttctgtttcaggtgattctgttaccgttacttacgtttga SEQIDNO3:Grifolisincodonoptimizedfor Saccharomycescerevisiae actccaagagttccattgtccgaacaatctcatccttccaatatgatcac ctcttctttcttggttgtctccttgtttactttggctttgtctaagccaa tgtccagatctatgaaggttcacgaaactagagaaggtattccagatggt tttgctttggctggttctccttcttctgatacttctttgaacttgagaat tgccttggtccaaaatgatccagctggtttggaaactgcattatacgatg ttaataccccatcctctgctaactacggtaaccatttgtctaaagccgaa gttgaaaagttcgttgctccagaaccagaatctgttgatgctgttaatgc ttggttggaagaaaatggtttgactgctactactatttctcctgctggtg attggttggcttttgaagttccagtttctaaggccaacgaattattcgat gctgatttctctgtttacacccatactgatactggtttagaagccattag aaccttgtcctattctattccagctgaattgcaaggtcacttggatttgg ttcatccaactattactttcccaaacccatactcaagattgccagttgtt gcttcttctattaagactgctgctccaacttctgataacttgacttcttt ggctgttccatcttcttgtgcttctacaattactccagcttgtttacaag ccttgtacggtattccaactacaccagctactcaatcttctaacaaattg gctgtttccggttacattgaacaattcgctaatcaagccgacttgaaaac tttcttgactaagttcagaaccgacatctcttcttctactactttcacta ctcaaaccttggatggtggtgaaaatccacaaaatggtaatgaagctggt gttgaagctgatttggatgttcaatatactgttggtttggctactgatgt tccaaccgttttcatttctgttggtgataactttcaagacggtgctttgg aaggtttcttggacattatcaatttcttgttggacgaatctaccccacct caagttttgactacttcttatggtcaaaacgaaaacaccatctccagaaa cttggctaacaatttgtgtaacgcttacgctcaattgggtgctagaggta cttctattttgtttgcttcaggtgacggtggtgtttctggttcacaatct gattcttgttctaagttcgttccaactttcccatctggttgtccttttat gacttcagttggtgctactacaggtattaacccagaaactgctgctgatt tttcttctggtggtttctctaattacttcggtactccatcttatcaagcc tctgctcattctgcttacttgcaagccttgggttctactaatgctggtaa gtttaatacctctggtagaggttttccagacgtttctactcaaggtgaaa acttccaaatcgttgttgatggtcaaaccggtacagttgatggtacatca tgtgcttctccaacctttgcttctgttgtttctttgttgaacgatagatt gattgctgccggtaaatctccattgggttttttgaatccattcttgtact ctactggtgcttctgcctttaactctattacatctggttctaacccaggt tgtaacactaatggtttcccagctaaaactggttggtcaccagttactgg tttgggtactccaaattttgctaagttgttaaccgccgttggttta SEQIDNO4:Aspergillopepsin2codonoptimized forHansenulapolymorpha gctccattgactgaaaaaagaagagctagaaaagaagctagagctgctgg taagagacattctaatccaccatatattccaggttccgacaaagaaatct tgaagttgaacggtactaccaacgaagaatactcttctaattgggctggt gctgttttgattggtgatggttatacaaaggttaccggtgaattcactgt tccatctgtttctgctggttcttcaggttcttctggttatggtggtggtt acggttattggaaaaacaagagacaatccgaagaatattgtgcttctgct tgggttggtattgatggtgatacttgtgaaactgctatcttgcaaactgg tgttgatttctgttacgaagatggtcaaacttcttacgatgcttggtatg aatggtatccagattacgcttacgatttctccgatattaccatctctgaa ggtgattccatcaaggttactgttgaagctacctctaaatcatctggttc tgccactgttgaaaacttgactactggtcaatctgttacccatactttct ctggtaatgttgaaggtgacttgtgtgaaactaatgccgaatggatcgtt gaagatttcgaatctggtgattctttggttgcttttgctgatttcggttc tgttactttcactaacgctgaagctacttctggtggttctactgttggtc catctgatgctactgttatggatattgaacaagacggttccgttttgacc gaaacttctgtttcaggtgattctgttaccgttacttacgtttga