COMPOSITIONS AND METHODS FOR ENHANCING GROWTH, SPREAD, AND ONCOLYTIC AND IMMUNOTHERAPEUTIC EFFICACY OF ONCOLYTIC RNA VIRUSES
20190231832 ยท 2019-08-01
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2760/20232
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N2760/20221
CHEMISTRY; METALLURGY
A61K35/768
HUMAN NECESSITIES
C12N2760/20243
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61K35/768
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
Abstract
Provided herein are methods for enhancing infection, growth, spread, or titer of an oncolytic RNA virus in a cancer or tumor cell; enhancing the oncolytic activity, cytokine-induced cell death activity, and/or cytotoxic activity of an oncolytic RNA virus in a cancer or tumor cell; upregulating cytokine response to, and/or enhancing the immunotherapeutic activity of an oncolytic RNA virus in a cancer or tumor cell; and/or treating a tumor or cancer in a subject in need thereof. Such methods employ a vanadium-containing compound, administered to the cancer or tumor cells before, after, or concurrently with infection of the cancer or tumor cells with the oncolytic RNA virus. Related compositions, uses, and kits therefor are also provided. Methods for producing RNA viruses, RNA virus-based cancer vaccines, and RNA virus-based cancer gene therapy vectors are also provided.
Claims
1. A method for enhancing infection, growth, spread, or titer of an oncolytic RNA virus in a cancer or tumor cell, said method comprising: administering a vanadium-containing compound to the cancer or tumor cell before, after, or concurrently with infection of the cancer or tumor cell with the oncolytic RNA virus.
2. The method according to claim 1, wherein the administration of the vanadium-containing compound enhances an oncolytic activity, a cytokine-induced cell death activity, and/or a cytotoxic activity of the oncolytic RNA virus.
3. The method according to claim 1, wherein the administration of the vanadium-containing compound potentiates an immune response to, upregulates a cytokine response to, and/or enhances an immunotherapeutic activity of the oncolytic RNA virus.
4. The method according to claim 1, wherein the administration of the vanadium-containing compound to the cancer or tumor cell is for treating a tumor or cancer in a subject in need thereof.
5. The method according to claim 1, wherein the vanadium-containing compound comprises Orthovanadate, Metavanadate, Vanadium (V) oxytriethoxyde (VOx), Vanadium (IV) oxide sulphate (VS) and bismaltolato oxovanadium (IV) (BMOV), Vanadium tetra-fluoride and Vanadium tri-bromide, or a pharmaceutically acceptable salt, solvate, hydrate, reduced, or oxidized form thereof.
6. The method according to claim 1, wherein the oncolytic RNA virus comprises a reovirus, newcastle disease virus, polio virus, mumps virus, measles virus, influenza virus, Maraba virus (such as MG-1), Rabies virus, Rotavirus, Hepatitis A virus, Rubella virus, Dengue virus, Chikungunya virus, Respiratory Syncitial Virus, LCMV, lentivirus, replicating retrovirus, or rhabdovirus, or a variant or derivative thereof.
7. The method according to claim 6, wherein the RNA virus comprises a rhabdovirus which is vesicular stomatitis virus or a derivative or variant thereof.
8. The method according to claim 1, wherein the RNA virus comprises a virus selected under specific growth conditions, subjected to one or more selection pressures, genetically modified using a recombinant technique, or any combination thereof.
9. The method according to claim 1, wherein the cell or subject is mammalian.
10. The method according to claim 9, wherein the cell or subject is human.
11. The method according to claim 1, wherein the cancer or tumor comprises lymphoblastic leukemia, myeloid leukemia, adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, atypical teratoid/rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, osteosarcoma, malignant fibrous histiocytoma, brain stem glioma, brain tumor, cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, craniopharyngioma, ependymoblastoma, medulloblastoma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma, visual pathway and hypothalamic glioma, spinal cord tumors, breast cancer, bronchial tumors, Burkitt lymphoma, carcinoid tumor, central nervous system lymphoma, cervical cancer, chordoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-Cell lymphoma, embryonal tumors, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), gastrointestinal stromal cell tumor, germ cell tumors, extracranial, extragonadal, ovarian, gestational trophoblastic tumor, glioma, hairy cell leukemia, head and neck cancer, hepatocellular (Liver) cancer, histiocytosis, Langerhans cell cancer, Hodgkin lymphoma, hypopharyngeal cancer, islet cell tumors, Kaposi sarcoma, kidney cancer, laryngeal cancer, lymphocytic leukemia, hairy cell leukemia, lip and oral cavity cancer, liver cancer, non-small cell lung cancer, small cell lung cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, malignant fibrous histiocytoma of bone and osteosarcoma, medulloblastoma, medulloepithelioma, melanoma, intraocular melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma/plasma cell neoplasm, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oral cancer, oropharyngeal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal parenchymal tumors, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, renal pelvis and ureter cancer, transitional cell cancer, respiratory tract carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, uterine sarcoma, skin cancer, Merkel cell skin carcinoma, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, stomach (Gastric) cancer, supratentorial primitive neuroectodermal tumors, T-Cell lymphoma, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, trophoblastic tumor, urethral cancer, uterine cancer, endometrial cancer, uterine sarcoma, vaginal cancer, vulvar cancer, or Wilms tumor.
12. A composition comprising an oncolytic RNA virus and a vanadium-containing compound.
13. A kit comprising an oncolytic RNA virus and a vanadium-containing compound.
14. A method for producing an RNA virus comprising: culturing a cancer or tumor cell infected with the RNA virus in an appropriate medium in the presence of a vanadium-containing compound; and producing the RNA virus from the cancer or tumor cell via viral replication.
15-17. (canceled)
18. The method according to claim 1, wherein the RNA virus is VSV?51.
19. The method according to claim 1, wherein the vanadium-containing compound is a vanadate.
20. The method according to claim 1, wherein the vanadium-containing compound is a pharmaceutically acceptable salt of orthovanadate.
21. The composition according to claim 12, wherein the RNA virus is VSV?51.
22. The composition according to claim 12, wherein the vanadium-containing compound is a vanadate.
23. The kit according to claim 13, wherein the RNA virus is VSV?51.
24. The kit according to claim 13, wherein the vanadium-containing compound is a vanadate.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0094] These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
DETAILED DESCRIPTION
[0107] The following description is of one or more preferred embodiments. Several inventions may be described herein with compositions, and kits provided with identical, similar or distinct uses or methods of use.
[0108] In an embodiment, there is provided herein a method of enhancing or increasing the infection, spread, titer, or the oncolytic or immunotherapeutic activity of an RNA virus in a cell, for example, but not limited to, a cancer, tumor, or immortalized cell, the method comprising administering a vanadium-containing compound to said cell prior to, after, or concurrently with infection of the cell with the virus.
[0109] In another embodiment, there is provided herein a method of enhancing or increasing the infection, spread, titer, or the oncolytic or immunotherapeutic activity of an oncolytic RNA virus in cancer or tumor cells, the method comprising administering a vanadium-containing compound to said cells prior to, after, or concurrently with infection of the cells with the virus.
[0110] In a further embodiment, which is not meant to be limiting, the oncolytic RNA virus oncolytic or immunotherapeutic activity is potentiated in cancer or tumor cells as compared to the oncolytic or immunotherapeutic activity of the virus alone or the immunotherapeutic activity of the vanadium-containing compound alone.
[0111] In yet another embodiment of any of the compositions, method or methods described above, the vanadium-containing compound enhances RNA virus infection, growth or spread in infection-resistant cancer cells.
[0112] In yet another embodiment of any of compositions, method or methods described above, the vanadium-containing compound enhances RNA virus infection, growth or spread in cancer cells and tumors in vivo without inducing virus spread to major organs.
[0113] In a further embodiment of any of compositions, method or methods described above, the vanadium-containing compound enhances the virally induced cancer cell death in vivo and in vitro.
[0114] In still a further embodiment, which is not meant to be limiting, there is provided compositions comprising one or more of the vanadium-containing compounds, and one or more of a) an RNA virus, a genetically modified RNA virus, an attenuated RNA virus, an oncolytic RNA virus, an RNA virus-based cancer vaccine or cancer gene therapy vector, b) one or more cancer cells, c) a carrier, diluent or excipient, d) a pharmaceutically acceptable carrier, diluent or excipient, e) non-cancer cells; f) cell culture media; g) one or more cancer therapeutics; or any combination of a)-g). The present invention also contemplates embodiments wherein any one or a combination of a-g) are specifically excluded from the composition or kit. Any component or group of components may be excluded if desired.
[0115] In yet another embodiment, there is provided herein a kit comprising one or more of the vanadium-containing compounds, and one or more of a) an RNA virus, a genetically modified RNA virus, an attenuated RNA virus, an oncolytic RNA virus, an RNA virus-based cancer vaccine or cancer gene therapy vector, b) one or more cancer cells, c) a pharmaceutically acceptable carrier, diluent or excipient, d) non-cancer cells; e) cell culture media; f) one or more cancer therapeutics, g) a cell culture plate or multi-well dish; h) an apparatus to deliver the compound to a cell, medium or to a subject; i) instructions for using the compound or any component in the kit, j) a carrier diluent or excipient, or any combination of a)-j). The present invention also contemplates kits wherein any one or a combination thereof of a)-j) are specifically excluded.
[0116] It will be understood by the person of skill in the art having regard to the teachings herein that enhancing or increasing viral activity, production, oncolytic activity, or cytotoxicity may include enhancing or increasing at least one of viral infection and/or rate thereof, viral production and/or rate thereof, viral titer and/or rate at which full titer may be reached, viral spread and/or rate thereof, cell lysis and/or rate thereof, viral cytotoxicity and/or rate thereof, or any combination thereof, as compared to when the one or more compounds are not used.
[0117] It will be understood by the person of skill in the art having regard to the teachings herein that enhancing or increasing the immunotherapeutic activity of an oncolytic RNA virus may include enhancing or increasing the systemic antitumor immune response through the up-regulation of many cytokines, including higher expression of cytokines induced by the virus or the vanadium-containing compound alone or up-regulation of cytokines not up-regulated by either the virus or the vanadium-containing compound alone.
[0118] In certain embodiments, and without wishing to be bound by theory, a vanadium-containing compound as described herein may be used to at least partially subvert the antiviral type I IFN response toward a death-inducing and proinflammatory type II IFN response, which may improve oncolytic virus spread, increase bystander killing of cancer cells, and/or enhance anti-tumor immune stimulation.
[0119] By the term vanadium-containing compound, it is meant compounds which include a vanadium transition metal core. The vanadium core can be in any oxidation state. Such compounds include but are not limited to: Orthovanadate, Metavanadate, Vanadium (V) oxytriethoxyde (VOx), Vanadium (IV) oxide sulphate (VS) and bismaltolato oxovanadium (IV) (BMOV), Vanadium tetra-fluoride and Vanadium tri-bromide. In certain embodiments, Vanadium-containing compounds may include vanadium-based phosphatase inhibitors, for example.
[0120] In certain embodiments, vanadium salts and compounds are known to undergo different hydrolytic conversions in solution. Orthovanadate, metavanadate and vanadium(V) oxytriethoxide all result in a solution of H.sub.2VO.sub.4.sup.? at physiological pH, while the solutions prepared from vanadyl sulfate and vanadium(IV) fluoride result in a solution of aqueous V(IV) and V(V), and those prepared from bis(maltolato)oxovanadium(IV) will contain both V(IV) and V(V) maltolato complexes. In the studies described in further detail herein, such compounds may, in certain embodiments, show a robust capacity to enhance OV activity, for example.
[0121] By the term oncolytic virus it is meant a virus that preferentially infects and lyses cancer or tumor cells as compared to non-cancer or normal cells. Examples of oncolytic viruses known in the art include, without limitation, reovirus, newcastle disease virus, adenovirus, herpes virus, polio virus, mumps virus, measles virus, influenza virus, vaccinia virus, rhabdoviruses such as vesicular stomatitis virus and derivatives/variants thereof. In a preferred embodiment, the virus in the presence of a the vanadium-containing compound as described herein preferentially infects and lyses cancer cells or tumor cells as compared to the virus alone and as compared to normal cells alone or in the presence of the vanadium-containing compound.
[0122] By the term RNA virus it is meant a virus that has RNA (ribonucleic acid) as its genetic material. The nucleic acid can be either single-stranded RNA or double-stranded RNA, and the RNA can be either negative-sense or positive-sense. Examples of RNA viruses include reovirus, newcastle disease virus, polio virus, mumps virus, measles virus, influenza virus, rhabdoviruses such as vesicular stomatitis virus.
[0123] Cytotoxic/oncolytic activity of the virus may be present, observed or demonstrated in vitro, in vivo, or both. Preferably, the virus exhibits cytotoxic/oncolytic activity in vivo.
[0124] By a derivative or variant of a virus, it is meant a virus obtained by selecting the virus under different growth conditions, one that has been subjected to a range of selection pressures, that has been genetically modified using recombinant techniques known within the art, or one that has been engineered to be replication defective and/or express transgenes, or any combination thereof. Examples of such viruses are known in the art, for example from US patent applications 20040115170, 20040170607, 20020037543, WO 00/62735; U.S. Pat. Nos. 7,052,832, 7,063,835, 7,122,182 (which are hereby incorporated by reference) and others. Preferably the virus is a Vesicular stomatitis virus (VSV), or a related rhabdovirus variant/derivative thereof, for example, selected under specific growth conditions, one that has been subjected to a range of selection pressures, one that has been genetically modified using recombinant techniques known within the art, or a combination thereof. In a preferred embodiment, the virus is VSV?51 (Stojdl et al., VSV strains with defects in their ability to shutdown innate immunity are potent systemic anti-cancer agents, Cancer Cell. 2003 October; 4(4):263-75, herein incorporated by reference).
[0125] The one or more types of cancer or tumor cells may be cancer or tumor cells in vitro or in vivo from any cell, cell line, tissue or organism, for example, but not limited to human, rat, mouse, cat, dog, pig, primate, horse and the like. In a preferred embodiment, the one or more cancer or tumor cells comprise human cancer or tumor cells, for example, but not limited to lymphoblastic leukemia, myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, atypical teratoid/rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, osteosarcoma, malignant fibrous histiocytoma, brain stem glioma, brain tumor, cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, craniopharyngioma, ependymoblastoma, medulloblastoma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma, visual pathway and hypothalamic glioma, spinal cord tumors, breast cancer, bronchial tumors, Burkitt lymphoma, carcinoid tumor, central nervous system lymphoma, cervical cancer, chordoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-Cell lymphoma, embryonal tumors, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), gastrointestinal stromal cell tumor, germ cell tumors, extracranial, extragonadal, ovarian, gestational trophoblastic tumor, glioma, hairy cell leukemia, head and neck cancer, hepatocellular (Liver) cancer, histiocytosis, Langerhans cell cancer, Hodgkin lymphoma, hypopharyngeal cancer, islet cell tumors, Kaposi sarcoma, kidney cancer, laryngeal cancer, lymphocytic leukemia, hairy cell leukemia, lip and oral cavity cancer, liver cancer, non-small cell lung cancer, small cell lung cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, malignant fibrous histiocytoma of bone and osteosarcoma, medulloblastoma, medulloepithelioma, melanoma, intraocular melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma/plasma cell neoplasm, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oral cancer, oropharyngeal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal parenchymal tumors, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, renal pelvis and ureter cancer, transitional cell cancer, respiratory tract carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, uterine sarcoma, skin cancer, Merkel cell skin carcinoma, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, stomach (Gastric) cancer, supratentorial primitive neuroectodermal tumors, T-Cell lymphoma, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, trophoblastic tumor, urethral cancer, uterine cancer, endometrial cancer, uterine sarcoma, vaginal cancer, vulvar cancer, or Wilms tumor. However, the compounds and compositions described herein possible may be used to treat other cancers or tumor in vivo or in vitro.
[0126] In another embodiment, there is provided herein a composition comprising a) one or more vanadate-containing compounds as described herein and b) one or more additional components, for example, but not limited to 1) a carrier, diluent or excipient, 2) a pharmaceutically acceptable carrier, diluent or excipient, 3) a RNA virus, for example, but not limited to an attenuated virus, a genetically modified virus or an oncolytic virus, 4) cancer or tumor cells, 5) non-cancerous or normal cells, 6) cell culture media, 7) one or more cancer therapeutics, for example, but not limited to chemotherapeutics. As an example, but not to be considered limiting in any manner, cyclophosphamide (CPA) is a common chemotherapy drug used primarily for the treatment of lymphoma, chronic lymphocytic leukemia and breast, ovarian and bladder cancers. CPA is converted into its active metabolites, 4-hydroxycyclophosphamide and aldophosphamide by liver oxidases. Use of CPA as an immune suppressant to enhance viral oncolysis has improved virotherapy efficacy in combination with oncolytic variants of HSV, adenoviruses, measles virus, reovirus, and vaccinia virus.
[0127] A further cancer therapeutic known in the art is cisplatin. Cisplatin binds and cross-links cellular DNA leading to apoptosis when DNA is not repaired. Cisplatin has been investigated in combination with oncolytic adenoviruses, herpes viruses, parvovirus, vaccinia virus, and vesicular stomatitis virus. Enhanced therapeutic activity in vitro and in vivo has been observed when combining cisplatin with oncolytic variants of adenovirus, herpesvirus, parvovirus and vaccinia virus whereas slight inhibition was observed for oncolytic variant of vesicular stomatitis virus.
[0128] Mitomycin C (MMC) is a DNA cross-linking antibiotic with antineoplastic properties. MMC exhibited synergistic cytotoxicty with oncolytic HSV. In vivo, combination of oncolytic herpes virus and MMC significantly improved therapeutic effects in models of gastric carcinomatosis and non-small cell lung cancer.
[0129] Doxorubicin is an anthracycline antibiotic that intercalates into DNA and prevents the action of topoisomerase II. Doxorubicin was synergistically cytotoxic when combined with oncolytic adenovirus (ONYX-015) and the combination reduced tumor growth relative to the monotherapies. ONYX-015 was successfully combined with MAP (mitomycin C, doxorubicin and cisplatin) chemotherapy in a phase I-II clinical trial for treatment of advanced sarcomas.
[0130] Gancyclovir (GCV) is a widely used antiviral agent, originally developed for the treatment of cytomegalovirus infections. GCV is a guanasine analogue prodrug that upon phosphorylation by herpes virus thymidine kinase (TK) competes with cellular dGTP for incorporation into DNA resulting in elongation termination. Oncolytic viruses encoding the HSV TK gene lead to an accumulation of toxic GCV metabolites in tumor cells which interfere with cellular DNA synthesis leading to apoptosis. Targeted oncolytic HSV viruses in combination with GCV significantly improved survival in models of human ovarian cancer and rat gliosarcoma. Adenoviruses, engineered to express the HSV TK gene, also show enhanced anti-tumor activity when combined with GCV.
[0131] CD/5-FC enzyme/pro-drug therapy has also proven successful in combination with oncolytic virotherapy. 5-FU is a pyrimidine analogue that inhibits the synthesis of thymidine. The anti-tumor activity of two different oncolytic vaccinia viruses expressing CD was significantly enhanced when combined with 5-FC therapy in immune-competent ovarian cancer and immune suppressed colon cancer models.
[0132] Taxanes are a class of chemotherapy drugs, including paclitaxel and docetaxel, which cause stabilization of cellular microtubules thereby preventing function of the cellular cytoskeleton, a requirement for mitosis. Combination of docetaxel or paclitaxel with an urothelium- or prostate-targeted oncolytic adenovirus significantly reduced in vivo tumor volume and resulted in synergistic in vitro cytotoxicity.
[0133] Rapamycin (sirolimus) is an immunosuppressant commonly used in transplant patients however it has also been shown to significantly enhance the oncolytic effects of the oncolytic variants of poxviruses myxoma and vaccinia virus.
[0134] The prototypical proteosome inhibitor MG-132 enhanced cellular CAR expression in Lovo colon carcinoma cells, which was accompanied with enhanced oncolytic adenovirus target gene expression and oncolysis.
[0135] The efficacy of oncolytic VSV against chronic lymphocytic leukemia cells was increased by combination therapy with the BCL-2 inhibitor EM20-25.
[0136] One group showed that a single dose of angiostatic cRGD peptide treatment before oncolytic virus treatment enhanced the antitumor efficacy of oncolytic HSV.
[0137] Other groups have shown that immune checkpoint inhibitors targeting CTLA4 or PD1 in combination with oncolytic Newcastle disease virus[42], oncolytic measles virus[43], and oncolytic VSV[44] as well as oncolytic HSV-1 [45] enhance their anticancer activity.
[0138] For in vivo therapeutic applications, preferably there is provided a pharmaceutical composition comprising one or more vanadate-containing compounds and a pharmaceutically acceptable carrier, diluent or excipient, optionally containing other solutes such as dissolved salts and the like. In a preferred embodiment, the solution comprises enough saline, glucose or the like to make the solution isotonic. Pharmaceutical compositions and methods of preparing pharmaceutical compositions are known in the art and are described, for example, in Remington: The Science and Practice of Pharmacy (formerly Remingtons Pharmaceutical Sciences); Gennaro, A., Lippincott, Williams & Wilkins, Philidelphia, Pa. (2000), herein incorporated by reference.
[0139] Administration of such compositions may be via a number of routes depending upon whether local and/or systemic treatment is desired and upon the area to be treated. In a first embodiment, which is not meant to be limiting, the compound is administered locally to the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary (e.g. by inhalation or insufflation of powders or aerosols, including by nebulizer), intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, or intracranial, e.g. intrathecal or intraventricular, administration. Also contemplated is intra-tumor injection, perfusion or delivery into the general vicinity of the tumor or injection into the vasculature supplying a tumor. Alternatively, the vanadate-containing compounds may be formulated in a tablet or capsule for oral administration. Alternate dosage forms, including slow-release, sustained-release, extended release, as would be known in the art are also contemplated.
[0140] For administration by inhalation or insufflation, the compounds can be formulated into an aqueous or partially aqueous solution, which can then be utilized in the form of an aerosol. For topical use, the modulators can be formulated as dusting powders, creams or lotions in pharmaceutically acceptable vehicles, which are applied to affected portions of the skin.
[0141] Without wishing to be liming, the dosage requirements for the vanadate-containing compounds of the present invention may vary with the particular compositions employed, the route of administration and the particular subject being treated. Dosage requirements can be determined by standard clinical techniques known to a worker skilled in the art. Typically, treatment will generally be initiated with small dosages less than the optimum dose of the compound or compound/virus. Thereafter, the dosage is increased until the optimum or satisfactory effect under the circumstances is reached. In general, the vanadate-containing compound or pharmaceutical compositions comprising the vanadate-containing compound are administered at a concentration that will generally afford effective results without causing significant harmful or deleterious side effects. Administration can be either as a single unit dose or, if desired, the dosage can be divided into convenient subunits that are administered at suitable times throughout the day.
[0142] The vanadate-containing compound may be employed in sequential administration, for example, before, after or both before and after administration of a RNA virus, for example, but not limited to an attenuated virus, a genetically modified virus, a cancer vaccine, a cancer gene therapy vector or an oncolytic virus. Alternatively, the vanadate-containing compound may be administered concurrently or in combination with a RNA virus as described above, preferably in combination with an oncolytic virus. In addition, the vanadate-containing compound may be used with an oncolytic virus as described above and in combination with one or more cancer therapeutics or cancer therapies as is known to a person of skill in the art, for example but not limited to interferon therapy, interleukin therapy, colony stimulating factor therapy, immunotherapy, immune checkpoint inhibitor therapy, chemotherapeutic drugs, for example, but not limited to 5-fluorodeoxyuridine amsacrine, bleomycin, busulfan, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, clofarabine, crisantaspase, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, etoposide, fludarabine, fluorouracil, gemcitabine, gliadel, hydroxycarbamide, idarubicin, ifosfamide, irinotecan, leucovorin, lomustine, melphalan, mercaptopurine, mesna, methotrexate, mitomycin, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, pentostatin, procarbazine, raltitrexed, satraplatin, streptozocin, tegafur-uracil, temozolomide, teniposide, thiotepa, tioguanine, topotecan, treosulfan, vinblastine, vincristine, vindesine, vinorelbine or a combination thereof. Further, anti-cancer biologics may also be employed, for example, but without limitation, monoclonal antibodies and the like.
[0143] In another embodiment, there are provided herein methods and uses of the compositions as described herein for increasing or enhancing the spread of an RNA virus, for example, a genetically modified virus, an attenuated virus, a cancer vaccine, a cancer gene therapy vector, or an oncolytic virus in one or more cells, for example, but not limited to one or more types of cancer or tumor cells, increasing or enhancing the cytotoxicity/oncolytic activity of an oncolytic virus against one or more cancer or tumor cells, increasing or enhancing the production, yield or reproductive capacity of a RNA virus, for example, a genetically modified virus, an attenuated virus, cancer vaccine, cancer gene therapy vector, an oncolytic virus, or, any combination of the above. In an embodiment, which is not meant to be limiting in any manner, the compositions reduces the viability of a cancer or tumor cell by either killing the cancer or tumor cell or limiting its growth for a period of time.
[0144] In another embodiment, the cells may be cancer cells in vivo, or in vitro. In a further embodiment, the in vivo cancer cells may be from a mammalian subject. In still a further embodiment, the mammalian subject may be a human subject.
[0145] In another embodiment, there is provided herein a composition comprising a cell culture medium and a vanadium-containing compound. In certain embodiments, the composition may be used for culturing a cell infected with an RNA virus.
[0146] In an embodiment, there is provided herein a method of enhancing or increasing the infection, spread, titer, or the oncolytic or immunotherapeutic activity of an RNA virus in a cell, for example, but not limited to, a cancer, tumor, immortalized cell, or other suitable cell, the method comprising administering a vanadium-containing compound to said cell prior to, after, or concurrently with infection of the cell with the virus. In a further embodiment which is not meant to be limiting in any manner, the compounds and compositions described herein and throughout may be used in an industrial or pharmaceutical manufacturing setting for producing RNA viruses, genetically modified RNA viruses, oncolytic RNA viruses, RNA virus-based vaccines, and/or RNA virus-based vectors and the like in cells which may include, among others, MRC-5, WI-38 and Vero cells. Viruses that might be desirable to produce in this manner include, but are not limited to Reovirus, measles, rhabdovirus (rabies, vsv, mgl), sindbis virus, influenza virus, Poliovirus, Rhinovirus, Hepatitis A, Hepatitis C virus, Hepatitis D virus, Sindbis Virus, Semilki Forest virus, Ebola virus, Marburg Virus, Rift Valley fever virus, Lassa Virus, Dengue virus, Yellow Fever Virus, Rotavirus, Zika Virus, Japanese Encephalitis Virus, West Nile virus, Sponweni Virus, Newcastle Disease Virus, Corona Virus, SARS, Rubella virus, Ross River Virus, Chikungunya virus. Measles Virus, Mumps Virus, Human respiratory syncytial virus and others, including Group VI RNA viruses which include, but are not limited to lentiviruses and retroviruses.
[0147] In certain embodiments, the cell may comprise a cell of an egg. By way of example, in certain embodiments the cell may comprise a cell of an egg, and the egg may be used in vaccine production.
[0148] The present invention will be further illustrated in the following examples.
EXAMPLES
Example 1: Vanadate Enhances the Spread of Oncolytic RNA Viruses
[0149] We tested the impact of sodium orthovanadate (
Example 2: Vanadium-Based Compounds have Unique Viral Enhancing Properties
[0150] Orthovanadate has been shown to inhibit tyrosine phosphatases, an activity which is linked to its close structural and steric resemblance to phosphate[46]. We therefore tested whether phosphate could reproduce similar effects but found that in contrast with vanadate, various phosphate salts had no impact on viral growth (
Example 3: Vanadate Enhances Virus and Cytokine-Induced Death
[0151] While our data suggested that Vanadium-based compounds enhanced VSV?51 spread in cancer cells, we wondered whether this could also impact its oncolytic activity.
Example 4: Vanadate Enhances the Oncolytic Activity of VSV?51 In Vivo
[0152] Given the observation that vanadate enhanced both spread and oncolytic activity of VSV?51 in vitro, we wondered if the combination of VSV?51 and vanadate could have anti-cancer effects in animal models of cancer. Given reports in the literature suggesting vanadate has immunomodulatory properties, we performed experiments in a panel of immunocompetent syngeneic mouse models.
Example 5: Vanadate Potentiates an Immunogenic Response Following Infection
[0153] To gain insight on how combination treatment with vanadate and VSV?51 could lead to robust anti-tumor immunity, we used gene expression microarrays took at the impact of VSV?51 and Vanadium-based compounds (orthovanadate and metavanadate), alone or in combination, on gene expression profiles 24 h post infection of 786-0 cells. In line with our demonstration that vanadate stimulates an anti-tumor immune response, gene set-enrichment analyses using GOrilla revealed that vanadate alone induced inflammatory responses, and immune system processes; which were further potentiated in combination with VSV?51. Uniquely, the infection of vanadate treated cells led to the increased expression of a number of proinflammatory cytokines (CCL8, CCL3, IL6, TNF, IFN?, CCL5) and many genes typically induced by type II IFN (IFN?), including chemokines such as CXCL9, CXCL10, and CXCL11 (
[0154] Importantly, IFN? and IFN? bind to distinct receptors and lead to differential activation of STAT1 and STAT2 (Signal Transducer and Activator of Transcription) transcription factors. Phosphorylation of STATs leads to their dimerization and nuclear translocation to activate transcription of IFN-stimulated genes (ISGs). Some of these genes are regulated by both type I and type II IFNs, whereas others are selectively regulated by one or the other. Type I IFNs induce the phosphorylation of both STAT1 and STAT2, leading to the formation of the ISGF3 complex composed of a STAT1-STAT2 heterodimer and IRF9 that binds specific promoter regions known as IFN-stimulated response elements (ISREs); while type II IFN primarily induce the phosphorylation of STAT1, leading to the formation of STAT1-STAT1 homodimers that bind IFN?-activated-sequence (GAS) elements (Mechanisms of type-1 and type-ii-interferon-mediated signaling, Plantanias, LC, Nat Rev Immunol, 2005). Consistent with a shift from a type I towards a type II IFN response, vanadate treatment inhibited the IFN?-induced phosphorylation of STAT2 and reduced its nuclear accumulation but did not similarly affect STAT1 as observed by Western blot (
[0155] Clustering analyses (
Materials and Methods
Drugs, Chemicals and Cytokines.
[0156] Drugs, chemicals and cytokines and their respective supplier and solvent used in this study are listed below.
TABLE-US-00001 Name Formula Abbreviation Solvent Supplier Sodium orthovanadate Na.sub.3VO.sub.4 vanadate Water Sigma- Aldrich (St. Louis, Missouri) Ammonium NH.sub.4VO.sub.3 metavanadate Water Sigma- metavanadate Aldrich (St. Louis, Missouri) Vanadium(IV) oxide VOSO.sub.4xH.sub.2O VS Water Sigma- sulfate hydrate Aldrich (St. Louis, Missouri) Vanadium(V) OV(OC.sub.2H.sub.5).sub.3 VOx DMSO Sigma- oxytriethoxide Aldrich (St. Louis, Missouri) Bis(maltolato) C.sub.12H.sub.10O.sub.7V BMOV DMSO Sigma- oxovanadium(IV) Aldrich (St. Louis, Missouri) Vanadium(III) bromide VBr.sub.3 VBr.sub.3 Water Sigma- Aldrich (St. Louis, Missouri) Vanadium(IV) fluoride VF.sub.4 VF.sub.4 Water Santa Cruz (Dallas, Texas) potassium KMnO.sub.4 KMnO.sub.4 Water Sigma- permanganate Aldrich (St. Louis, Missouri) Chromium(VI) oxide CrO.sub.3 CrO.sub.3 Water Sigma- Aldrich (St. Louis, Missouri) L-Ascorbic acid C.sub.6H.sub.8O.sub.6 L-AA Water Sigma- Aldrich (St. Louis, Missouri) Tiron (OH).sub.2C.sub.6H.sub.2(SO.sub.3NO.sub.2H.sub.2O Tiron Water Sigma- Aldrich (St. Louis, Missouri) Potassium Phosphate K.sub.2HPO.sub.4 K.sub.2HPO.sub.4 Water Sodium phosphate NaH.sub.2PO.sub.4 H.sub.2O NaH.sub.2PO.sub.4 Water monobasic monohydrate H.sub.2O Sodium phosphate NaHPO.sub.4 NaHPO.sub.4 Water dibasic anhydrous Sodium phosphate NaH.sub.2PO.sub.4 NaH.sub.2PO.sub.4 Water monobasic anhydrous Tetrasodium Na.sub.4P.sub.2O7 Na.sub.4P.sub.2O.sub.7 Water pyrophosphate D-Luciferin, potassium C.sub.11H.sub.7KN.sub.2O.sub.3S.sub.2 Luciferin PBS Biotium salt (Hayward, California) Human IFN 2a alpha hIFNa PBS Sigma- Aldrich (St. Louis, Missouri) Human hIFNb PBS PBL (Piscataway, NJ)
[0157] Cell Lines.
[0158] CT26 wt (colon), CT26-LacZ (colon), DBT (astrocyte) and Pan02 (pancreatic) mouse cancer cells; 786-0 (renal), SKOV3 (ovarian) human cancer cells; Vero monkey kidney cells; and GM-38 normal human fibroblasts were obtained from the American Type Culture Collection (Manassas, Va.). Cells were cultured in HyQ high-glucose Dulbecco's modified Eagle's medium (Hyclone, Waltham, Mass.) supplemented with 10% fetal calf serum (CanSera, Etobicoke, Ontario, Canada). All cell lines were incubated at 37? C. in a 5% CO.sub.2 humidified incubator.
[0159] Viruses and Quantification.
[0160] The Indiana serotype of VSV (VSVD51 or wild type) was used throughout this study and was propagated in Vero cells. VSVD51-expressing GFP or firefly luciferase are recombinant derivatives of VSVD51 described previously[37]. All viruses were propagated on Vero cells and purified on 5-50% Optiprep (Sigma, St Louis, Mo.) gradient and all virus titres were quantified by the standard plaque assay on Vero cells as previously described[38].
[0161] Cell Viability Assay.
[0162] The metabolic activity of the cells was assessed using alamarBlue (Bio-Rad, Mississauga, ON) according to the manufacturer's protocol. Treated and/or infected cells in a 96-well plate (Corning, Manassas, Va.) were treated, at indicated time, with 10 uL of alamar blue in each well and incubated for 2 to 4 hours. Fluorescence was measure at 590 nm upon excitation at 530 nm using a Fluoroskan Ascent FL (Thermo Labsystems, Beverly, Mass.).
[0163] Microarray and Analysis.
[0164] 786-0 cells were plated at a density of 1?10.sup.6 in 6-well dishes and allowed to adhere overnight. The next day, cells were pretreated for 4 hours with orthovanadate (150 uM), metavanadadate (150 uM) or the vehicle. Following pre-treatment, the cells were infected with VSV?51 at an MOI of 0.01 or left uninfected. Twenty-four hours post infection, RNA was collected using an RNA-easy kit (Qiagen, Valencia, Calif., USA). Biological triplicates were subsequently pooled and RNA quality was measured using Agilent 2100 Bioanalyzer (Agilent Technologies) before hybridization. Hybridized to Affymetrix Human PrimeView Array was performed by The Centre for Applied Genomics, The Hospital for Sick Children, Toronto, Canada. Microarray data was processed using Transcriptome Analysis Console (TAC) 3.0 under default parameters of Gene Level Differential Expression Analysis. Fold change in gene expression was calculated for each gene in relation to uninfected, untreated control. Heatmaps of normalized expression values were generated using R package pheatmap. Volcano plots of gene expression values were generated using R. Gene ontology enrichments anlysis was evaluated using GOrilla[39] following correction for multiple hypothesis testing (Benjamini-Hochberg).
[0165] Mouse Tumor Models.
[0166] CT26 wt, CT26-LacZ, DBT, Pan02 Models.
[0167] Six-week-old female Balb/c mice (or C57BL/6 mice for the Pan02 model) obtained from Charles River Laboratories (Wilmington, Mass.) were given subcutaneous tumours by injecting 3?10.sup.5 syngeneic CT26 wt, CT26-LacZ, or DBT (or 1?10.sup.5 for the Pan02 model) cells suspended in 100 ?l PBS. 11 days (CT26 wt, CT26-LacZ) or 13 days (DBT) or 45 days (Pan02) post implantation, tumours were treated intratumourally once with a chemical compound (dissolved in 25 ?l PBS) or the vehicle as indicated. Four hours later, tumors were injected intratumorally with 1?10.sup.8 p.f.u. (in 25 ?l PBS) of the indicated virus. Tumour sizes were measured every other day using an electronic caliper. Tumour volume was calculated as=(length.sup.2?width)/2. For survival studies, mice were culled when tumours had reached 1,500 mm.sup.3. For in vivo imaging, an IVIS (Perkin Elmer, Waltham, Mass.) was used as described previously[40][41]. Quantification of the bioluminescent signal intensities in each mice was measured using Living Image? v2.50.1 software.
[0168] Dose Escalation Studies.
[0169] Six-week-old Balb/c mice were intraperitoneally administered various doses of chemical compounds dissolved in PBS (approximately 50 ?L) as indicated. Mortality and body weight loss were monitored for 10-14 days. Mice were euthanized upon experimental endpoint (when drug treatment resulted in greater than 20% body weight loss).
[0170] All experiments were performed in accordance with the University of Ottawa Animal Care and Veterinary Services guidelines for animal care under the protocol OHRI-2265 and OHRI-2264.
[0171] Ex Vivo Tumor Model.
[0172] Balb/c mice were implanted with subcutaneous CT26 wt or DBT cells. Mice were sacrificed after tumors had reached at least 10 mm?10 mm in size. Tumor, lung, spleen and brain tissue were extracted from the mice, cut into 2 mm thick slices and cored into 2 mm?2 mm pieces using a punch biopsy. Each tissue core was incubated in 1 mL of Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum, 30 mM HEPES and were incubated at 37? C. in a 5% CO.sub.2 humidified incubator. Cores were treated for 4 hours with indicated concentration of chemical compound. Subsequently the cores were then infected VSV?51-GFP. GFP pictures were taken for each core 24 hours post infection.
[0173] Immunoblotting.
[0174] Cells were pelleted and lysed on ice for 30 minutes using in 50 mM HEPES, pH 7.4, 150 mM NaCl, 10 mM EDTA, 10 mM Na.sub.4P.sub.2O.sub.7, 100 mM NaF, 2 mM Na.sub.3VO.sub.4, protease inhibitor cocktail (Roche) and 1% Triton X-100. Following protein determination by Bradford assay (Bio-Rad Protein Assay Solution, Mississauga, ON), 20 pg of clarified cell extract were electrophoresed on 4-15% Mini-PROTEAN? TGX? Precast Gels (Bio-Rad) using the Mini-PROTEAN? Tetra Cell Systems (Bio-rad) and transferred on nitrocellulose membranes (Hybond-C, Bio-Rad). Blots were blocked with 5% BSA and probed with polyclonal rabbit antibodies specific for Phospho-Stat1 (Tyr701, #9171, Cell Signalling Technology, Danvers, Mass., used at 1:1,000 for 1 hour) and Stat1 (#9172, Cell Signalling Technology, Danvers, Mass., used at 1:1,000), with monoclonal rabbit or mouse antibodies specific for ?-Actin (#4970, Cell Signalling Technology, Danvers, Mass., used at 1:1,000) or ?-Tubulin (sc-8035, Santa Cruz Biotechnology, Dallas, Tex., used at 1:500). Blots were then probed with a goat anti-rabbit or mouse peroxidase-conjugated antibodies (Jackson Immunoresearch Labs, West Grove, Pa.). Bands were visualized using the Supersignal West Pico Chemiluminescent substrate (Thermo Scientific Pierce, Rockford Ill.).
[0175] Quantitative Real-Time PCR.
[0176] 786-0 or Ct26 wt cells were pretreated for 4 h with chemical compound or the vehicle, and were infected with VSV?51 at MOI 0.01 or left uninfected. 24 hours post infection, cells were collected and RNA extraction was performed using the Qiagen RNeasy kit (Qiagen). RNA quantity and purity was assessed using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Waltham, Mass.) RNA was converted to cDNA with RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific). Real-time PCR reactions were performed according to the manufacturer's protocol with the QuantiTect SYBR Green PCR kit (Qiagen) on a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, Calif.). Gene expression relative to GAPDH or b-actin. Fold induction was calculated relative to the untreated/uninfected samples for each gene. List of qPCR primers used in this study are listed below.
TABLE-US-00002 Model Gene ForwardPrimer(5.fwdarw.3) ReversePrimer(5.fwdarw.3) VSV M (SEQIDNO:1) (SEQIDNO:2) ATACTCAGATGTGGCAGCCG GATCTGCCAATACCGCTGGA Human CXCL9 (SEQIDNO:3) (SEQIDNO:4) AGTGCAAGGAACCCCAGTAG AGGGCTTGGGGCAAATTGTT CCL8 (SEQIDNO:5) (SEQIDNO:6) TGCTGAAGCTCACACCCTTG GGAAACTGAATCTGGCTGAGCA CCL3 (SEQIDNO:7) (SEQIDNO:8) TTCCGTCACCTGCTCAGAAT CAGCAGCAAGTGATGCAGAGA IL6 (SEQIDNO:9) (SEQIDNO:10) ACCCCCAATAAATATAGGACTGGA GAAGGCGCTTGTGGAGAAGG CXCL8 (SEQIDNO:11) (SEQIDNO:12) ACCGGAAGGAACCATCTCAC GGCAAAACTGCACCTTCACAC TNF (SEQIDNO:13) (SEQIDNO:14) GCTGCACTTTGGAGTGATCG GAGGGTTTGCTACAACATGGG CXCL10 (SEQIDNO:15) (SEQIDNO:16) CTGAGCCTACAGCAGAGGAAC AGGTACTCCTTGAATGCCACTT CXCL11 (SEQIDNO:17) (SEQIDNO:18) CAGCATTTCTACTCCTTCCAAGA TGGGGAAGCCTTGAACAACT CCL5 (SEQIDNO:19) (SEQIDNO:20) GCAGTCGTCCACAGGTCAAG TCTTCTCTGGGTTGGCACAC IFNb (SEQIDNO:21) (SEQIDNO:22) CATTACCTGAAGGCCAAGGA CAGCATCTGCTGGTTGAAGA IFIT3 (SEQIDNO:23) (SEQIDNO:24) GCACAGACCTAACAGCACCC TTGGTGACCTCACTCATGATGGC GAPDH (SEQIDNO:25) (SEQIDNO:26) ACAGTCAGCCGCATCTTCTT GTTAAAAGCAGCCCTGGTGA Mouse CXCL9 (SEQIDNO:27) (SEQIDNO:28) CAGTGTGGAGTTCGAGGAACC TTTGTTGCAATTGGGGCTTGG CCL3 (SEQIDNO:29) (SEQIDNO:30) CCATATGGAGCTGACACCCC TCAGGAAAATGACACCTGGCT IL6 (SEQIDNO:31) (SEQIDNO:32) TCCTCTCTGCAAGAGACTTCC GGTCTGTTGGGAGTGGTATCC CXCL11 (SEQIDNO:33) (SEQIDNO:34) CAGCTGCTCAAGGCTTCCTTA CAACTTTGTCGCAGCCGTTA CCL5 (SEQIDNO:35) (SEQIDNO:36) CTGCTGCTTTGCCTACCTCT CGAGTGACAAACACGACTGC IFNb (SEQIDNO:37) (SEQIDNO:38) CAGTGTGGAGTTCGAGGAACC TTTGTTGCAATTGGGGCTTGG b-Actin (SEQIDNO:39) (SEQIDNO:40) AGGTCTCAAACATGATCTG AGGTATCCTGACCCTGAAG
[0177] Elisa.
[0178] 786-0 cells plated in 12-well dishes, were pretreated with drug or the vehicle for 4 h, and subsequently infected with VSV?51-GFP at indicated MOI or left uninfected. Cell supernatants were collected at different times post infection as indicated. IFN alpha and IFN beta quantification was performed using the Verikine Human IFN alpha or IFN beta ELISA kit (PBL Assay Science) by following the manufacturers' instructions. Absorbance values at 450 nM were measured on a Multiskan Ascent Microplate Reader (MXT Lab Systems, Vienna, Va.).
[0179] Supernatant Transfer and Filter Experiment.
[0180] 786-0 cells plated in 12-well dishes, were pretreated with drug or the vehicle for 4 h, and subsequently infected with VSV?M51-AG-GFP at an MOI of 10. This virus can infect cells but cannot exit the cell because of the lack of the viral G protein, thus preventing release of viral particles in the supernatant. 24 post infection supernatants were filtered through a 3-kDa filter (Millipore, Billerica, Mass.) before being transferred to fresh 786-0 and process for further analysis.
[0181] Tumoral T-Cell Quantification.
[0182] Mice were sacrificed and the tumors were collected at the indicated time points. The tumours were dissosiated using the mouse tumor MACS Dissociation Kit (Miltenyi Biotec, Germany). Lysis of red blood cells was performed using ACK lysis buffer. For surface staining, cells were incubated with combinations of anti-CD45-BV786 and anti-CD3-AF300 (BD Biosciences, San Jose, Calif.) for 30 minutes. Cells were then washed twice and resuspended in FACS buffer for analysis using a BD LSRFortessa flow cytometer (BD Biosciences, San Jose, Calif.).
[0183] Cytokine Array.
[0184] Supernatants from treated 786-0 cells were assayed screened with the RayBio? Cytokine Antibody ArraysHuman Cytokine Antibody Array System 3 (RayBiotech, Norcross, Ga.). The assay was performed according to the manufacturer's instructions. Data were analyzed using ImageJ and Analysis Tool for AAH-CYT-3 (RayBiotech).
[0185] Statistics.
[0186] Statistical significance was calculated using Student's T-test with Welch's correction, one-way or two way ANOVA test as indicated in the figure legends. The Gehan-Breslow-Wilcoxon was used to determine significant differences in plots for survival studies. For all studies, significance was considered to mean a P value below or equal to 0.05. Error bars represent standard error of the mean. Statistical analyses were performed using GraphPad Prism 6.0 and Excel.
REFERENCES
[0187] 1. Ilkow, C. S., et al., From scourge to cure: tumour-selective viral pathogenesis as a new strategy against cancer. PLoS Pathog, 2014. 10(1): p. e1003836. [0188] 2. Arulanandam, R., et al., Microtubule disruption synergizes with oncolytic virotherapy by inhibiting interferon translation and potentiating bystander killing. Nat Commun, 2015. 6: p. 6410. [0189] 3. Forbes, N. E., R. Krishnan, and J. S. Diallo, Pharmacological modulation of anti-tumor immunity induced by oncolytic viruses. Front Oncol, 2014. 4: p. 191. [0190] 4. Liu, T. C. and D. Kim, Gene therapy progress and prospects cancer: oncolytic viruses. Gene Ther, 2008. 15(12): p. 877-84. [0191] 5. Zamarin, D., et al., Localized oncolytic virotherapy overcomes systemic tumor resistance to immune checkpoint blockade immunotherapy. Sci Transl Med, 2014. 6(226): p. 226ra32. [0192] 6. Russell, S. J., K. W. Peng, and J. C. Bell, Oncolytic virotherapy. Nat Biotechnol, 2012. 30(7): p. 658-70. [0193] 7. Coffin, R. S., From virotherapy to oncolytic immunotherapy: where are we now? Curr Opin Virol, 2015. 13: p. 93-100. [0194] 8. Lichty, B. D., et al., Going viral with cancer immunotherapy. Nat Rev Cancer, 2014. 14(8): p. 559-67. [0195] 9. Zhang, J., et al., Maraba MG1 virus enhances natural killer cell function via conventional dendritic cells to reduce postoperative metastatic disease. Mol Ther, 2014. 22(7): p. 1320-32. [0196] 10. Workenhe, S. T. and K. L. Mossman, Oncolytic virotherapy and immunogenic cancer cell death: sharpening the sword for improved cancer treatment strategies. Mol Ther, 2014. 22(2): p. 251-6. [0197] 11. Andtbacka, R. H., et al., Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. J Clin Oncol, 2015. 33(25): p. 2780-8. [0198] 12. Lawler, S. E. and E. A. Chiocca, Oncolytic Virus-Mediated Immunotherapy: A Combinatorial Approach for Cancer Treatment. J Clin Oncol, 2015. 33(25): p. 2812-4. [0199] 13. Hu, J. C., et al., A phase I study of OncoVEXGM-CSF, a second-generation oncolytic herpes simplex virus expressing granulocyte macrophage colony-stimulating factor. Clin Cancer Res, 2006. 12(22): p. 6737-47. [0200] 14. Swarup, G., S. Cohen, and D. L. Garbers, Inhibition of membrane phosphotyrosyl-protein phosphatase activity by vanadate. Biochem Biophys Res Commun, 1982. 107(3): p. 1104-9. [0201] 15. Huyer, G., et al., Mechanism of inhibition of protein-tyrosine phosphatases by vanadate and pervanadate. J Biol Chem, 1997. 272(2): p. 843-51. [0202] 16. Chasteen, N. D., Vanadium in biological systems: physiology and biochemistry. 1990, Dordrecht, The Netherlands; Boston: Kluwer Academic Publishers. viii, 225 p. [0203] 17. Tracey, A. S., G. R. Willsky, and E. Takeuchi, Vanadium: chemistry, biochemistry, pharmacology, and practical applications. 2007, Boca Raton, Fla.: CRC Press. 250 p. [0204] 18. Bowman, B. J. and C. W. Slayman, The effects of vanadate on the plasma membrane ATPase of Neurospora crassa. J Biol Chem, 1979. 254(8): p. 2928-34. [0205] 19. Morita, A., et al., Sodium orthovanadate suppresses DNA damage-induced caspase activation and apoptosis by inactivating p53. Cell Death Differ, 2006. 13(3): p. 499-511. [0206] 20. Morita, A., et al., Sodium orthovanadate inhibits p53-mediated apoptosis. Cancer Res, 2010. 70(1): p. 257-65. [0207] 21. Mustelin, T., T. Vang, and N. Bottini, Protein tyrosine phosphatases and the immune response. Nat Rev Immunol, 2005. 5(1): p. 43-57. [0208] 22. Secrist, J. P., et al., Stimulatory effects of the protein tyrosine phosphatase inhibitor, pervanadate, on T-cell activation events. J Biol Chem, 1993. 268(8): p. 5886-93. [0209] 23. Watson, F. and S. W. Edwards, Stimulation of primed neutrophils by soluble immune complexes: priming leads to enhanced intracellular Ca2+ elevations, activation of phospholipase D, and activation of the NADPH oxidase. Biochem Biophys Res Commun, 1998. 247(3): p. 819-26. [0210] 24. Di Gioacchino, M., et al., In vitro effects of vanadate on human immune functions. Ann Clin Lab Sci, 2002. 32(2): p. 148-54. [0211] 25. Ehring, G. R., et al., Vanadate induces calcium signaling, Ca2+ release-activated Ca2+ channel activation, and gene expression in T lymphocytes and RBL-2H3 mast cells via thiol oxidation. J Immunol, 2000. 164(2): p. 679-87. [0212] 26. O'Shea, J. J., et al., Activation of human peripheral blood T lymphocytes by pharmacological induction of protein-tyrosine phosphorylation. Proc Natl Acad Sci USA, 1992. 89(21): p. 10306-10. [0213] 27. Heyliger, C. E., A. G. Tahiliani, and J. H. McNeill, Effect of vanadate on elevated blood glucose and depressed cardiac performance of diabetic rats. Science, 1985. 227(4693): p. 1474-7. [0214] 28. Thompson, K. H., et al., Vanadium treatment of type 2 diabetes: a view to the future. J Inorg Biochem, 2009. 103(4): p. 554-8. [0215] 29. Srivastava, A. K. and M. Z. Mehdi, Insulino-mimetic and anti-diabetic effects of vanadium compounds. Diabet Med, 2005. 22(1): p. 2-13. [0216] 30. Evangelou, A. M., Vanadium in cancer treatment. Crit Rev Oncol Hematol, 2002. 42(3): p. 249-65. [0217] 31. Bishayee, A., et al., Vanadium in the detection, prevention and treatment of cancer: the in vivo evidence. Cancer Lett, 2010. 294(1): p. 1-12. [0218] 32. Rehder, D., The potentiality of vanadium in medicinal applications. Future Med Chem, 2012. 4(14): p. 1823-37. [0219] 33. Leon, I. E., et al., Vanadium and cancer treatment: antitumoral mechanisms of three oxidovanadium(IV) complexes on a human osteosarcoma cell line. J Inorg Biochem, 2014. 134: p. 106-17. [0220] 34. Gordon, Y. J., et al., Vanadate promotes reactivation and iontophoresis-induced ocular shedding of latent HSV-1 Win different host animals. Curr Eye Res, 1990. 9(10): p. 1015-21. [0221] 35. Yamamoto, F., et al., Enhancement of Newcastle disease virus-induced fusion of mouse L cells by sodium vanadate. Microbiol Immunol, 1984. 28(1): p. 75-83. [0222] 36. Wang, E. and P. W. Choppin, Effect of vanadate on intracellular distribution and function of 10-nm filaments. Proc Natl Acad Sci USA, 1981. 78(4): p. 2363-7. [0223] 37. Stojdl, D. F., et al., VSV strains with defects in their ability to shutdown innate immunity are potent systemic anti-cancer agents. Cancer Cell, 2003. 4(4): p. 263-75. [0224] 38. Diallo, J. S., et al., Propagation, purification, and in vivo testing of oncolytic vesicular stomatitis virus strains. Methods Mol Biol, 2012. 797: p. 127-40. [0225] 39. Eden, E., et al., GOrilla: a tool for discovery and visualization of enriched GO terms in ranked gene lists. BMC Bioinformatics, 2009. 10: p. 48. [0226] 40. Le Boeuf, F., et al., Synergistic interaction between oncolytic viruses augments tumor killing. Mol Ther, 2010. 18(5): p. 888-95. [0227] 41. Doman, M. H., et al. First-in-class small molecule potentiators of cancer virotherapy Sci Rep. 2016. 26(6):26786. [0228] 42. Zamarin, D. et al., Localized oncolytic virotherapy overcomes systemic tumor resistance to immune checkpoint blockade immunotherapy. Sci Transl Med. 2014 6(226):226. [0229] 43. Engeland, C. E., et al., CTLA-4 and PD-L1 checkpoint blockade enhances oncolytic measles virus therapy. Mol Ther. 2014 22(11):1949-59. [0230] 44. Cockle, J. V. et al., Combination viroimmunotherapy with checkpoint inhibition to treat glioma, based on location-specific tumor profiling. Neuro Oncol. 2016 April; 18(4):518-27.45. Puzanov, I., et al., Talimogene Laherparepvec in Combination With Ipilimumab in Previously Untreated, Unresectable Stage IIIB-IV Melanoma. J Clin Oncol. 2016 Aug. 1; 34(22):2619-26. [0231] 46. Huyer, G., et al., Mechanism of inhibition of protein-tyrosine phosphatases by vanadate and pervanadate. J Biol Chem. 1997 Jan. 10; 272(2):843-51. [0232] 47. G?nther, T. M. et al., Sodium orthovanadate associated with pharmacological doses of ascorbate causes an increased generation of ROS in tumor cells that inhibits proliferation and triggers apoptosis. Biochem Biophys Res Commun. 2013 Jan. 18; 430(3):883-8. [0233] 48. Zafarullah, M., et al., Molecular mechanisms of N-acetylcysteine actions. Cell Mol Life Sci. 2003 January; 60(1):6-20. [0234] 49. Hebenstreit D et al., JAK/STAT-dependent gene regulation by cytokines. Drug News Perspect. 2005 May; 18(4):243-9. [0235] 50. Ruotsalainen J J et al., Clonal variation in interferon response determines the outcome of oncolytic virotherapy in mouse CT26 colon carcinoma model. Gene Ther. 2015 January; 22(1):65-75.
All references cited herein and elsewhere in the instant specification are herein incorporated by reference in their entirety.