APOPTOSIS REGULATORY GENE DETECTED IN IRRADIATED-THYMIC LYMPHOMA CELL AND METHOD FOR DETECTING SAME

Abstract

An apoptosis regulatory gene is detected in an irradiated-thymic lymphoma cell by a method for detecting such an apoptosis regulatory gene in a low-dose-rate and low-level-irradiated thymic lymphoma cell of a mouse. This has an effect of revealing the function of an apoptosis regulatory gene by means of irradiation and providing a gene profile, by detecting an apoptosis regulatory gene detected in an irradiated-thymic lymphoma cell. The detected apoptosis regulatory gene is used to construct a gene profile that can assess the dose-response relationship of industrial and healthcare workers living in a low level-radiation environment. The detected apoptosis regulatory gene can be used as an index for evaluating the extent of cancer progression and the degree of treatment in patients with thymic lymphoma. The method for detecting such an apoptosis regulatory gene is used to prepare for the prepare a composition for diagnosing thymic lymphoma and a diagnostic kit.

Claims

1. A method of detecting an apoptosis regulatory gene in thymic lymphoma cells, comprising: applying low-dose-rate low-level radiation to thymic lymphoma cells; and detecting an apoptosis regulatory gene having altered gene expression in individual irradiated mouse thymic lymphoma cells.

2. The method of claim 1, wherein the thymic lymphoma cells are a mouse (Mus musculus) thymic lymphoma EL4 cell line.

3. The method of claim 1, wherein the low-dose-rate low-level radiation is applied such that a final cumulative dose is 61.92 mGy at a dose rate of 2.58 mGy/hr, 139.2 mGy at a dose rate of 5.8 mGy/hr, and 557.28 mGy at a dose rate of 23.22 mGy/hr.

4. The method of claim 1, wherein the detecting the apoptosis regulatory gene includes performing polymerase chain reaction and Western blotting.

5. The method of claim 1, wherein in the detecting the apoptosis regulatory gene, the detected gene includes Bik (Genebank accession No: NM_007546), Bmf (Genebank accession No: NM_138313), Ddit3 (Genebank accession No: NM_007837), Nod1 (Genebank accession No: NM _172729), and Tnfrsf19 (Genebank accession No: NM_013869).

6. A composition for diagnosing thymic lymphoma, comprising a base sequence of at least one apoptosis regulatory gene selected from the group consisting of apoptosis regulatory genes of thymic lymphoma, including Bik (Genebank accession No: NM _007546), Bmf (Genebank accession No: NM_138313), Ddit3 (Genebank accession No: NM_007837), Nod1 (Genebank accession No: NM_172729) and Tnfrsf19 (Genebank accession No: NM_013869) or a base sequence complementary thereto.

7. A diagnostic kit for diagnosing thymic lymphoma, comprising the composition of claim 6.

Description

DESCRIPTION OF DRAWINGS

[0017] FIGS. 1 A to 1D show changes in RNA-level expression of apoptosis regulatory genes depending on the dose rate and the cumulative dose;

[0018] FIG. 2 shows changes in apoptosis regulatory protein expression depending on the dose rate and the cumulative dose; and

[0019] FIG. 3 shows molecular changes due to low-dose-rate low-level irradiation in mouse thymic lymphoma cells and the resulting cancer suppression mechanism.

BEST MODE

[0020] Hereinafter, a detailed description will be given of the present invention.

[0021] An embodiment of the present invention pertains to a method of detecting an apoptosis regulatory gene in thymic lymphoma cells, comprising applying low-dose-rate low-level radiation, high-dose-rate low-level radiation and high-dose-rate high-level radiation to thymic lymphoma cells and detecting an apoptosis regulatory gene having altered gene expression in individual irradiated mouse thymic lymphoma cells.

[0022] The thymic lymphoma cells are preferably derived from mouse (Mus musculus) thymic lymphoma.

[0023] As the mouse thymic lymphoma cells, the EL4 cell line is a T-cell line established in lymphoma of C57BL/6, which is a pure mouse to which a chemical carcinogen is administered, and expresses Thy-1, 2 and H2b on the cell surface, and is reactive to phytohemagglutinin (PHA). This cell line produces interleukin-2 (IL-2) and is used for cell-mediated immunity experiments.

[0024] The low-dose-rate low-level radiation is preferably applied such that a final cumulative dose is 61.92 mGy at a dose rate of 2.58 mGy/hr, 139.2 mGy at a dose rate of 5.8 mGy/hr, and 557.28 mGy at a dose rate of 23.22 mGy/hr.

[0025] The detecting the apoptosis regulatory gene may be performed through polymerase chain reaction and Western blotting.

[0026] In the detecting the apoptosis regulatory gene, the detected gene may include Bik ((Genebank accession No: NM_007546), Bmf (Genebank accession No: NM_138313), Ddit3 (Genebank accession No: NM_007837), Nod1 (Genebank accession No: NM_172729), and Tnfrsf19 (Genebank accession No: NM_013869).

[0027] Another embodiment of the present invention pertains to a composition for the diagnosis of thymic lymphoma, comprising the base sequence of at least one apoptosis regulatory gene selected from the group consisting of apoptosis regulatory genes of thymic lymphoma, including Bik ((Genebank accession No: NM_007546), Bmf (Genebank accession No: NM_138313), Ddit3 (Genebank accession No: NM_007837), Nod1 (Genebank accession No: NM_172729) and Tnfrsf19 (Genebank accession No: NM_013869) or the base sequence complementary thereto.

[0028] A better understanding of the present invention will be given through the following examples, which are merely set forth to illustrate the present invention but are not to be construed as limiting the scope of the present invention, as will be apparent to those skilled in the art.

EXAMPLE 1

Mouse Thymic Lymphoma Cell Culture and Irradiation

[0029] Mouse thymic lymphoma cells (EL4) (TIB-39, ATCC) were cultured using a cell incubator at 37 C. under 5% CO.sub.2 using an RPMI 1640 medium containing 10% fetal bovine serum and 1% penicillin/streptomycin. The cultured cells were prepared at a concentration of 10.sup.5 cells/ml.

[0030] For the low-dose-rate low-level-irradiated cell group, low-dose-rate low-level radiation (2.58 mGy/hr, 5.8 mGy/hr, 23.22 mGy/hr) was applied for 24 hr to the cells prepared as above such that the cumulative dose of the cells was 61.92 mGy, 139.2 mGy and 557.28 mGy.

[0031] For the high-dose-rate low-level-irradiated cell group, in comparison with the low-dose-rate low-level-irradiated cell group, high-dose-rate low-level radiation (0.8 Gy/min) was applied to the cells prepared as described above such that the final cumulative dose was 61.92 mGy, 139.2 mGy and 557.28 mGy.

[0032] For the high-dose-rate high-level-irradiated cell group, high-dose-rate high-level radiation (0.8 Gy/min) was applied such that the final cumulative dose was 2 Gy.

EXAMPLE 2

Screening of Apoptosis Regulatory Gene of Irradiated Mouse Thymic Lymphoma Cells and Measurement of RNA-level Expression Thereof

2-1 Screening of Apoptosis Regulatory Gene of Irradiated Mouse Thymic Lymphoma Cells

[0033] In order to screen the apoptosis regulatory gene of irradiated cells, a microarray was performed.

[0034] Total RNA of the low-dose-rate low-level-irradiated cell group of Example 1 was extracted and labeled with Cyanine3. A microarray chip in which all the genes of total DNA were arranged was prepared, and the Cyanine3-labeled total RNA was allowed to react therein. The signal in response to the above reaction was analyzed and the extent of expression of each RNA was verified.

[0035] Furthermore, the high-dose-rate low-level-irradiated cell group and the high-dose-rate high-level-irradiated cell group were subjected to microarray in the same manner as above.

[0036] Based on the results of microarray, genes, the expression of which was increased two times or more in the low-dose-rate low-level-irradiated cell group compared to the non-irradiated cell group, were selected. The selected genes were Adm, Btg2, II12a, Mapt, Mnda, Bmf, Nod1, Bik, Ddit3, Prkcz, and Tnfrsf19.

[0037] 2-2 Measurement of RNA-Level Expression of Apoptosis Regulatory Gene of Irradiated Mouse Thymic Lymphoma Cells

[0038] In order to verify RNA-level expression of 11 genes selected through microarray, polymerase chain reaction (PCR) was performed.

[0039] Using a high-capacity cDNA reverse transcription kit (Applied Biosystems, USA), RNA of the apoptosis regulatory gene was subjected to reverse transcription. Then, PCR of RNA subjected to reverse transcription was carried out using primers shown in Table 1 below. The PCR results were normalized using the housekeeping gene GAPDH.

[0040] Furthermore, in the high-dose-rate low-level-irradiated cell group and the high-dose-rate high-level-irradiated cell group, the amount of apoptosis regulatory gene expression was measured in the same manner as above.

TABLE-US-00001 TABLE1 BasesequenceofprimerusedinPCRformeasurementofexpression ofapoptosisregulatorygene Gene GeneNo. Forward(5.fwdarw.3) Backward(5.fwdarw.3) Adm NM_009627 TCGCTGATGAGACGACAGTT GTTGTGTTCTGCTCGTCCAG Bik NM_007546 ATGGCCAGAGACGTCATCAA CCTTCATGCTGGGAGTCTCA Bmf NM_138313 CTCTCTGCTGACCTGTTTGC AATGGGTGAGAGGGAAGAGC Btg2 NM_007570 ATGAGCCACGGGAAGAGAAC GCCCTACTGAAAACCTTGAGTC Ddit3 NM_007837 TCGCTCTCCAGATTCCAGTC GCTCTTCCTCCTCTTCCTCC Il12a NM_001159424 TGATGATGACCCTGTGCCTT TTGATGGCCTGGAACTCTGT Mapt NM_001285455 TAGCAACGTCCAGTCCAAGT TCCTGGCTTGTGATGGATGT Mnda NM_001033450 GACAACCAAGAGCAATACACCA ATCAGTTTGCCCAATCCAGAAT Nod1 NM_172729 GAAGGCACCCCATTGGGTT AATCTCTGCATCTTCGGCTGA Prkcz NM_008860 GCGTGGATGCCATGACAAC AATGATGAGCACTTCGTCCCT Tnfrsf19 NM_013869 GCATGCTGTCAGTATCACCG CAGCACAAGGACGGAATCAG

[0041] The results of measurement of RNA-level expression of apoptosis regulatory genes upon irradiation are shown in FIGS. 1A to 1D.

[0042] Upon low-dose-rate low-level irradiation, among the apoptosis regulatory genes selected in Example 2-1, genes, the RNA-level expression of which was increased compared to the non-irradiated cell group, were detected. The detected genes were Adm, Btg2, II12a, Mnda, Bmf, Nod1, Bik, Ddit3, and Tnfrsf19.

[0043] In the high-dose-rate low-level-irradiated cell group and the high-dose-rate high-level-irradiated cell group, the apoptosis regulatory gene tended to decrease in RNA-level expression.

EXAMPLE 3

Measurement of Expression of Apoptosis Regulatory Protein of Irradiated Mouse Thymic Lymphoma Cells

[0044] In order to measure protein expression of the apoptosis regulatory gene detected in Example 2-2, Western blotting was performed.

[0045] A cell lysis buffer was prepared by mixing 150 mM NaCl, 1% Triton X0199, 0.1% SDS, 0.5% sodium deoxycholate, 50 mM Tris (pH 7.4) and 1 mM EDTA. Also, the prepared cell lysis buffer was added with a protease inhibitor (Thermo Scientific, USA) at a concentration of 1% based on the total concentration of the solution.

[0046] The low-dose-rate low-level-irradiated cell group of Example 1 was mixed with the cell lysis buffer, and thus the cells were lysed to give a protein sample. Western blotting was performed using the protein sample, and the amount of protein expression was measured. Upon Western blotting, an antibody (1:200, Abcam, Cambridge, Mass.) for detecting Ddit3 and Tnfrsf19 and an antibody (1:200, OriGene) for detecting Nod1, Bmf, and Bik were used.

[0047] Also, in the high-dose-rate low-level-irradiated cell group and the high-dose-rate high-level-irradiated cell group of Example 1, the amount of apoptosis regulatory protein expression was measured in the same manner as above.

[0048] The results of measurement of the amount of apoptosis regulatory protein expression upon irradiation are shown in FIG. 2. In the low-dose-rate low-level-irradiated cell group, Bmf, Nod1, Bik, Ddit3 and Tnfrsf19, which are the apoptosis regulatory proteins, were increased in protein expression compared to the non-irradiated group.

[0049] Based on the above results, apoptosis regulatory genes, the RNA-level expression and protein-level expression of which were increased when applying the low-dose-rate low-level radiation to mouse thymic lymphoma cells, were detected. The detected genes were Bmf, Nod1, Bik, Ddit3, and Tnfrsf19. The detected apoptosis regulatory genes were increased in RNA-level expression and protein-level expression when applying the low-dose-rate low-level radiation to mouse thymic lymphoma cells, thus promoting apoptosis to thereby suppress thymic lymphoma (FIG. 3).

[0050] Although the preferred embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that these embodiments are merely set forth to illustrate but are not to be construed to limit the scope of the present invention. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.