Novel Anti-PCSK9 Antibodies

20190233542 ยท 2019-08-01

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure provides monoclonal antibodies against Proprotein Convertase Subtilisin/Kexin type 9 (PCSK9), which can block the binding of PCSK9 to LDL receptor, and therefore lower the level LDL-C. The antibodies of disclosure provide very potent agents for the treatment of multiple CVDs.

    Claims

    1. An isolated antibody or an antigen binding fragment thereof, comprising a heavy chain CDR sequence[[s]] selected from the group consisting of: SEQ ID NOs: 1, 3, 5, 13, 15, 17, 25, 27, 29, 37, 39, 41, 49, 55, 57, 59, 67 and 69, and/or a light chain CDR sequence selected from the group consisting of: SEQ ID NOs: 7, 9, 11, 19, 21, 23, 31, 33, 35, 43, 45, 47, 51, 53, 61, 63, 65 and 71.

    2. (canceled)

    3. The antibody or an antigen binding fragment thereof of claim 1, comprising a heavy chain variable region selected from the group consisting of: a) a heavy chain variable region comprising SEQ ID NO: 1, SEQ ID NO: 3, and/or SEQ ID NO: 5; b) a heavy chain variable region comprising SEQ ID NO: 13, SEQ ID NO: 15, and/or SEQ ID NO: 17; c) a heavy chain variable region comprising SEQ ID NO: 25, SEQ ID NO: 27, and/or SEQ ID NO: 29; d) a heavy chain variable region comprising SEQ ID NO: 37, SEQ ID NO: 39, and/or SEQ ID NO: 41; e) a heavy chain variable region comprising SEQ ID NO: 13, SEQ ID NO: 49, and/or SEQ ID NO: 17; f) a heavy chain variable region comprising SEQ ID NO: 55, SEQ ID NO: 57, and/or SEQ ID NO: 59; and g) a heavy chain variable region comprising SEQ ID NO: 1, SEQ ID NO: 67, and/or SEQ ID NO: 69 and/or a light chain variable region selected from the group consisting of: h) a light chain variable region comprising SEQ ID NO: 7, SEQ ID NO: 9, and/or SEQ ID NO: 11; i) a light chain variable region comprising SEQ ID NO: 19, SEQ ID NO: 21, and/or SEQ ID NO: 23; j) a light chain variable region comprising SEQ ID NO: 31, SEQ ID NO: 33, and/or SEQ ID NO: 35; k) a light chain variable region comprising SEQ ID NO: 43, SEQ ID NO: 45, and/or SEQ ID NO: 47; 1) a light chain variable region comprising SEQ ID NO: 51, SEQ ID NO: 53, and/or SEQ ID NO: 23; m) a light chain variable region comprising SEQ ID NO: 61, SEQ ID NO: 63, and/or SEQ ID NO: 65; and n) a light chain variable region comprising SEQ ID NO: 7, SEQ ID NO: 9, and/or SEQ ID NO: 71.

    4. (canceled)

    5. The antibody or an antigen binding fragment thereof of claim 1, comprising: a) a heavy chain variable region comprising SEQ ID NO: 1, SEQ ID NO: 3, and/or SEQ ID NO: 5; and a light chain variable region comprising SEQ ID NO: 7, SEQ ID NO: 9, and/or SEQ ID NO: 11; b) a heavy chain variable region comprising SEQ ID NO: 13, SEQ ID NO: 15, and/or SEQ ID NO: 17; and a light chain variable region comprising SEQ ID NO: 19, SEQ ID NO: 21, and/or SEQ ID NO: 23; c) a heavy chain variable region comprising SEQ ID NO: 25, SEQ ID NO: 27, and/or SEQ ID NO: 29; and a light chain variable region comprising SEQ ID NO: 31, SEQ ID NO: 33, and/or SEQ ID NO: 35; d) a heavy chain variable region comprising SEQ ID NO: 37, SEQ ID NO: 39, and/or SEQ ID NO: 41; and a light chain variable region comprising SEQ ID NO: 43, SEQ ID NO: 45, and/or SEQ ID NO: 47; e) a heavy chain variable region comprising SEQ ID NO: 13, SEQ ID NO: 49, and/or SEQ ID NO: 17; and a light chain variable region comprising SEQ ID NO: 51, SEQ ID NO: 53, and/or SEQ ID NO: 23; f) a heavy chain variable region comprising SEQ ID NO: 55, SEQ ID NO: 57, and/or SEQ ID NO: 59; and a light chain variable region comprising SEQ ID NO: 61, SEQ ID NO: 63, and/or SEQ ID NO: 65; or g) a heavy chain variable region comprising SEQ ID NO: 1, SEQ ID NO: 67, and/or SEQ ID NO: 69; and a light chain variable region comprising SEQ ID NO: 7, SEQ ID NO: 9, and/or SEQ ID NO: 71.

    6. The antibody or an antigen binding fragment thereof of claim 1, comprising a heavy chain variable region selected from the group consisting of: SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 81, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 93, and SEQ ID NO: 97, and the homologue sequences of at least 80% sequence identity thereof, and/or a light chain variable region selected from the group consisting of: SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 95, and SEQ ID NO: 99 and the homologue sequences of at least 80% sequence identity thereof.

    7. (canceled)

    8. The antibody or an antigen binding fragment thereof of claim 1, comprising: a) a heavy chain variable region comprising SEQ ID NO: 73 and a light chain variable region comprising SEQ ID NO: 75; b) a heavy chain variable region comprising SEQ ID NO: 77 and a light chain variable region comprising SEQ ID NO: 79; c) a heavy chain variable region comprising SEQ ID NO: 81 and a light chain variable region comprising SEQ ID NO: 83; d) a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 87; e) a heavy chain variable region comprising SEQ ID NO: 89 and a light chain variable region comprising SEQ ID NO: 91; f) a heavy chain variable region comprising SEQ ID NO: 93 and a light chain variable region comprising SEQ ID NO: 95; g) a heavy chain variable region comprising SEQ ID NO: 97 and a light chain variable region comprising SEQ ID NO: 99; or h) a heavy chain variable region and a light chain variable region of at least 80% sequence identity to a), b), c), d), d), f), or g).

    9-15. (canceled)

    16. The antibody or an antigen binding fragment thereof of claim 1, which is a fully human monoclonal antibody.

    17-19. (canceled)

    20. An antibody or an antigen binding fragment thereof, which competes for the same epitope with the antibody or the antigen binding fragment thereof of claim 1.

    21. The antibody or antigen-binding fragment thereof of claim 1, which is a camelized single domain antibody, a diabody, a scFv, an scFv dimer, a BsFv, a dsFv, a (dsFv)2, a dsFv-dsFv, an Fv fragment, a Fab, a Fab, a F(ab)2, a ds diabody, a nanobody, a domain antibody, or a bivalent domain antibody.

    22. The antibody or antigen-binding fragment thereof of claim 1, further comprising an immunoglobulin constant region.

    23. The antibody or antigen-binding fragment thereof of claim 1, further comprising a conjugate.

    24. An isolated polynucleotide encoding the antibody or an antigen binding fragment thereof of claim 1.

    25. A vector comprising the isolated polynucleotide of claim 24.

    26. A host cell comprising the vector of claim 25.

    27. A method of expressing the antibody or antigen-binding fragment thereof of claim 1, comprising culturing the host cell of comprising a vector comprising an isolated polynucleotide encoding the antibody or an antigen binding fragment thereof under the condition at which the polynucleotide is expressed.

    28. A kit comprising the antibody or antigen-binding fragment thereof of claim 1.

    29. A method of treating a disease or condition mediated by PCSK9 in an individual, comprising: administering a therapeutically effective amount of antibody or antigen-binding fragment thereof of claim 1 to the individual.

    30. The method of claim 29, wherein the individual has been identified as having a disorder or a condition likely to respond to a PCSK9 inhibitor.

    31. The method of claim 30, wherein the individual has been identified as upregulated level of serum LDL cholesterol, total cholesterol and/or non-HDL cholesterol in a test biological sample from the individual.

    32. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of claim 1 and one or more pharmaceutically acceptable carriers.

    33. A method of treating a condition in a subject that would benefit from upregulation of immune response, comprising administering a therapeutically effective amount of the antibody or antigen-binding fragment thereof of claim 1 to the subject.

    34. The method of claim 33, wherein the subject has upregulated level of serum LDL cholesterol, total cholesterol and/or non-HDL cholesterol.

    35. (canceled)

    36. The method of claim 33, wherein the condition is cardiovascular diseases, inflammatory diseases, or infectious diseases.

    37. The method of claim 36, wherein the infectious disease is sepsis.

    Description

    BRIEF DESCFRIPTION OF FIGURES

    [0064] FIG. 1 presents the selected mutations in the CDR3 of the heavy chains of 11.4.

    [0065] FIG. 2 shows the staining of fully human antibody 18.156.8 (hIgG4) in SDS-PAGE gel. M: Protein Marker; Lane5: 18.156.8 (hIgG4), Reduced; Lane6: 18.156.8 (hIgG4), Non-reduced.

    [0066] FIG. 3 shows 99.6% purity of the fully human 18.156.8 (hIgG4) as measured by HPLC-SEC.

    [0067] FIG. 4 shows the staining of fully human antibody 40409 (hIgG4) in SDS-PAGE gel. M: Protein Marker; Lanel: 40409 (hIgG4), Reduced; Lane2: 40409 (hIgG4), Non-reduced.

    [0068] FIG. 5 shows 98% purity of the fully human 40409 (hIgG4) as measured by HPLC-SEC.

    [0069] FIG. 6 shows the staining of fully human antibody 15.14.2-uAb-IgG4L in SDS-PAGE gel. M: Protein Marker; Lanel: 15.14.2-uAb-IgG4L, Reduced; Lane2: 15.14.2-uAb-IgG4L, Non-reduced.

    [0070] FIG. 7 shows 99.8% purity of the fully human 15.14.2-uAb-IgG4L as measured by HPLC-SEC.

    [0071] FIG. 8 shows the staining of fully human antibody 17.72.3-uAb2-IgG4K in SDS-PAGE gel. M: Protein Marker; Lanel: 17.72.3-uAb2-IgG4K, Reduced; Lane2: 17.72.3-uAb2-IgG4K, Non-reduced.

    [0072] FIG. 9 shows 98.9% purity of the fully human 17.72.3-uAb2-IgG4K as measured by HPLC-SEC.

    [0073] FIG. 10 shows the staining of fully human antibody 18.136.7-IgG4K in SDS-PAGE gel. M: Protein Marker; Lanel: 18.136.7-IgG4K, Reduced; Lane2: 18.136.7-IgG4K, Non-reduced.

    [0074] FIG. 11 shows 99.2% purity of the fully human 18.136.7-IgG4K as measured by HPLC-SEC.

    [0075] FIG. 12 shows the staining of fully human antibody 19.3.8-uAbl-IgG4L in SDS-PAGE gel. M: Protein Marker; Lanel: 19.3.8-uAbl-IgG4L, Reduced; Lane2: 19.3.8-uAbl-IgG4L, Non-reduced.

    [0076] FIG. 13 shows 99.9% purity of the fully human 19.3.8-uAbl-IgG4L as measured by HPLC-SEC.

    [0077] FIG. 14 presents the binding of fully human anti-PCSK9 antibodies to human PCSK9 as measured by ELISA.

    [0078] FIG. 15 presents the blocking of fully human anti-PCSK9 antibodies to the binding of PCSK9 to LDL receptor (LDL-R) as measured by ELISA.

    [0079] FIG. 16 shows the results of restoring the low-density lipoprotein (LDL)-uptake assay of the fully human anti-PCSK9 antibody 18.156.8 in liver hepatocellular carcinoma (HepG2) cell and in Huh-7 cell by binding wild type (FIG. 16A and 16B) and mutant PCSK9 (D374Y) (FIG. 16C and 16D), respectively.

    [0080] FIG. 17 shows the results of restoring the low-density lipoprotein (LDL)-uptake assay of the fully human anti-PCSK9 antibody 40409 in HepG2 cell and in Huh-7 cell using both wild type (FIG. 17A and 17B) and mutant PCSK9 (D374Y) (FIG. 17C and 17D).

    [0081] FIG. 18 shows the results of restoring the low-density lipoprotein (LDL)-uptake assay of the fully human anti-PCSK9 antibody 15.14.2-uAbl-IgG4L, 17.72.3-uAbl-IgG4K and 19.3.8-uAbl-IgG4L in HepG2 cell.

    [0082] FIG. 19 illustrates the stability of fully human PCSK9 antibodies (FIG. 19A: 18.156.8; 19B: B4G2; 19C: 15.14.2, 19.3.8 and 17.72.3) incubated with human serum as indicated by the concentration measured by ELISA binding assay.

    [0083] FIG. 20 shows LDL-C change percentage of antibody 18, 156.8, 40409 and BMK.115 treated cynomolgus monkeys. FIG. 20A shows the result of a single dose of 10 mg/kg injection, and FIG. 20B shows the result of a single dose of 30 mg/kg injection.

    [0084] FIG. 21 shows High Density Lipoprotein cholesterol (HDL-C) change percentage of antibody 18, 156.8, 40409 and BMK.115 treated cynomolgus monkeys. FIG. 21A shows the result of a single dose of 10 mg/kg injection, and FIG. 21B shows the result of a single dose of 30 mg/kg injection.

    [0085] FIG. 22 shows LDL-C change percentage of antibody 15.14.2, 19.3.8, 17.72.3, 18.136.7 and Repatha treated cynomolgus monkeys. FIG. 22A shows the result of a single dose of 3 mg/kg injection, and FIG. 22B shows the result of a single dose of 10 mg/kg injection.

    [0086] FIG. 23 shows High Density Lipoprotein cholesterol (HDL-C) change percentage of antibody 15.14.2, 19.3.8, 17.72.3, 18.136.7 and Repatha treated cynomolgus monkeys. FIG. 23A shows the result of a single dose of 3 mg/kg injection, and FIG. 23B shows the result of a single dose of 10 mg/kg injection.

    [0087] FIG. 24 shows antibody concentration of 18.156.8, 40409 or BMK.115 of predose and postdose in cynomolgus monkey serum, as measured by ELISA. FIG. 24A shows the result of a single dose of 10 mg/kg injection, and FIG. 24B shows the result of a single dose of 30 mg/kg injection.

    [0088] FIG. 25 shows antibody concentration of 15.14.2(hIgG4), 19.3.8(hIgG4), 17.72.3(hIgG4), 18.136.7(hIgG4) or Repatha of predose and postdose in cynomolgus monkey serum, as measured by ELISA. FIG. 25A shows the result of a single dose of 3 mg/kg injection, and FIG. 25B shows the result of a single dose of 10 mg/kg injection.

    [0089] FIG. 26 shows anti-drug antibody (ADA) against 18.156.8(hIgG4), 40409(hIgG4) or BMK.115 in cynomolgus monkey serum samples of predose and postdose. FIG. 26A, 26C and 26E show the result of a single dose of 10 mg/kg injection, and FIG. 26B, 26D and 26F show the result of a single dose of 30 mg/kg injection.

    [0090] FIG. 27 shows ADA against 15.14.2, 19.3.8, 17.72.3, 18.136.7 or Repatha in cynomolgus monkey serum samples of predose and postdose. FIG. 27A, 27C, 27E, 27G and 271 show the result of a single dose of 3 mg/kg injection, and FIG. 27B, 27D, 27F, 27H and 27J show the result of a single dose of 10 mg/kg injection.

    [0091] FIGS. 28A, 28B and 28C show the result of generation of reference antibodies 12H11.1 and 24B9.1. FIG. 28A presents results of SDS-PAGE of 12H11.1.uIgG4K and 24B9.1.uIgG4L. M: Protein Marker; Lanel: 24B9.1.uIgG4L, reduced; Lane2: 12H11.1.uIgG4K, reduced; Lane3: 24B9.1.uIgG4L, non-reduced; Lane4: 12H11.1.uIgG4K, non-reduced. FIGS. 28B and 28C reveal the HPLC-SEC detection of 24B9.1.uIgG4L and 12H11.1.uIgG4K.

    [0092] FIG. 29 indicates the comparison of binding to human PCSK9 of antibody 18.156.8 and reference antibodies 24B9.1, 12H11.1 and BMK.115, as measured by ELISA.

    [0093] FIG. 30 shows the results of comparison of antibody 18.156.8 and reference antibodies 24B9.1, 12H11.1 and BMK.115 in blocking the binding of PCSK9 to LDLR, as measured by ELISA.

    [0094] FIG. 31 reveals ability of restoration of LDL-uptake in HepG2 cells for the antibody 18.156.8 and reference antibodies 12H11.1 and BMK.115.

    DETAILED DESCRIPTION OF THE INVENTION

    [0095] The following description of the disclosure is merely intended to illustrate various embodiments of the disclosure. As such, the specific modifications discussed are not to be construed as limitations on the scope of the disclosure. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of the disclosure, and it is understood that such equivalent embodiments are to be included herein. All references cited herein, including publications, patents and patent applications are incorporated herein by reference in their entirety.

    [0096] Definitions

    [0097] The term antibody as used herein includes any immunoglobulin, monoclonal antibody, polyclonal antibody, multispecific antibody, or bispecific (bivalent) antibody that binds to a specific antigen. A native intact antibody comprises two heavy chains and two light chains. Each heavy chain consists of a variable region and a first, second, and third constant region, while each light chain consists of a variable region and a constant region. Mammalian heavy chains are classified as , , , , and , and mammalian light chains are classified as X, or K. The antibody has a Y shape, with the stem of the Y consisting of the second and third constant regions of two heavy chains bound together via disulfide bonding. Each arm of the Y includes the variable region and first constant region of a single heavy chain bound to the variable and constant regions of a single light chain. The variable regions of the light and heavy chains are responsible for antigen binding. The variables region in both chains generally contain three highly variable loops called the complementarity determining regions (CDRs) (light (L) chain CDRs including LCDR1, LCDR2, and LCDR3, heavy (H) chain CDRs including HCDR1, HCDR2, HCDR3). CDR boundaries for the antibodies and antigen-binding fragments disclosed herein may be defined or identified by the conventions of Kabat, Chothia, or Al-Lazikani (Al-Lazikani, B., Chothia, C., Lesk, A. M., J. Mol. Biol., 273(4), 927 (1997); Chothia, C. et al., J Mol Biol. December 5;186(3):651-63 (1985); Chothia, C. and Lesk, A. M., J. Mol. Biol., 196,901 (1987); Chothia, C. et al., Nature. December 21-28; 342(6252):877-83 (1989) ; Kabat E. A. et al., National Institutes of Health, Bethesda, Md. (1991)). The three CDRs are interposed between flanking stretches known as framework regions (FRs), which are more highly conserved than the CDRs and form a scaffold to support the hypervariable loops. The constant regions of the heavy and light chains are not involved in antigen binding, but exhibit various effector functions. Antibodies are assigned to classes based on the amino acid sequence of the constant region of their heavy chain. The five major classes or isotypes of antibodies are IgA, IgD, IgE, IgG, and IgM, which are characterized by the presence of , , , , , and heavy chains, respectively. Several of the major antibody classes are divided into subclasses such as IgG1 (1 heavy chain), IgG2 (2 heavy chain), IgG3 (3 heavy chain), IgG4 (4 heavy chain), IgA1 (1 heavy chain), or IgA2 (2 heavy chain).

    [0098] The term antigen-binding fragment as used herein refers to an antibody fragment formed from a portion of an antibody comprising one or more CDRs, or any other antibody fragment that binds to an antigen but does not comprise an intact native antibody structure. Examples of antigen-binding fragment include, without limitation, a diabody, a Fab, a Fab, a F(ab).sub.2, an Fv fragment, a disulfide stabilized Fv fragment (dsFv), a (dsFv).sub.2, a bispecific dsFv (dsFv-dsFv), a disulfide stabilized diabody (ds diabody), a single-chain antibody molecule (scFv), an scFv dimer (bivalent diabody), a multispecific antibody, a camelized single domain antibody, a nanobody, a domain antibody, and a bivalent domain antibody. An antigen-binding fragment is capable of binding to the same antigen to which the parent antibody binds. In certain embodiments, an antigen-binding fragment may comprise one or more CDRs from a particular human antibody grafted to a framework region from one or more different human antibodies.

    [0099] Fab with regard to an antibody refers to that portion of the antibody consisting of a single light chain (both variable and constant regions) bound to the variable region and first constant region of a single heavy chain by a disulfide bond.

    [0100] Fab refers to a Fab fragment that includes a portion of the hinge region.

    [0101] F(ab).sub.2 refers to a dimer of Fab.

    [0102] Fc with regard to an antibody refers to that portion of the antibody consisting of the second and third constant regions of a first heavy chain bound to the second and third constant regions of a second heavy chain via disulfide bonding. The Fc portion of the antibody is responsible for various effector functions such as ADCC, and CDC, but does not function in antigen binding.

    [0103] Fv with regard to an antibody refers to the smallest fragment of the antibody to bear the complete antigen binding site. An Fv fragment consists of the variable region of a single light chain bound to the variable region of a single heavy chain.

    [0104] Single-chain Fv antibody or scFv refers to an engineered antibody consisting of a light chain variable region and a heavy chain variable region connected to one another directly or via a peptide linker sequence (Huston JS et al. Proc Natl Acad Sci USA, 85:5879(1988)). Single-chain Fv-Fc antibody or scFv-Fc refers to an engineered antibody consisting of a scFv connected to the Fc region of an antibody.

    [0105] Camelized single domain antibody, heavy chain antibody, or HCAb refers to an antibody that contains two V.sub.H domains and no light chains (Riechmann L. and Muyldermans S., J Immunol Methods. December 10;231(1-2):25-38 (1999); Muyldermans S., J Biotechnol. June;74(4):277-302 (2001); WO94/04678; WO94/25591; U.S. Pat. No. 6,005,079). Heavy chain antibodies were originally derived from Camelidae (camels, dromedaries, and llamas). Although devoid of light chains, camelized antibodies have an authentic antigen-binding repertoire (Hamers-Casterman C. et al., Nature. June 3;363(6428):446-8 (1993); Nguyen V K. et al. Heavy-chain antibodies in Camelidae; a case of evolutionary innovation, Immunogenetics. April;54(1):39-47 (2002); Nguyen V K. et al Immunology. May;109(1):93-101 (2003)). The variable domain of a heavy chain antibody (VHH domain) represents the smallest known antigen-binding unit generated by adaptive immune responses (Koch-Nolte F. et al., FASEB J. November;21(13):3490-8. Epub 2007 June 15 (2007)).

    [0106] A nanobody refers to an antibody fragment that consists of a VHH domain from a heavy chain antibody and two constant domains, CH2 and CH3.

    [0107] Diabodies include small antibody fragments with two antigen-binding sites, wherein the fragments comprise a V.sub.H domain connected to a V.sub.L domain in the same polypeptide chain (V.sub.H-V.sub.L or V.sub.L-V.sub.H) (see, e.g., Holliger P. et al., Proc Natl Acad Sci U S A. July 15;90(14):6444-8 (1993); EP404097; WO93/11161). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain, thereby creating two antigen-binding sites. The antigen-binding sites may target the same of different antigens (or epitopes).

    [0108] A domain antibody refers to an antibody fragment containing only the variable region of a heavy chain or the variable region of a light chain. In certain instances, two or more V.sub.H domains are covalently joined with a peptide linker to create a bivalent or multivalent domain antibody. The two V.sub.H domains of a bivalent domain antibody may target the same or different antigens.

    [0109] In certain embodiments, a (dsFv).sub.2 comprises three peptide chains: two V.sub.H moieties linked by a peptide linker and bound by disulfide bridges to two V.sub.L moieties.

    [0110] In certain embodiments, a bispecific ds diabody comprises V.sub.H1-V.sub.L2 (linked by a peptide linker) bound to V.sub.L1-V.sub.H2 (also linked by a peptide linker) via a disulfide bridge between V.sub.H1 and V.sub.L1.

    [0111] In certain embodiments, a bispecific dsFv or dsFv-dsFv comprises three peptide chains: a V.sub.H1-V.sub.H2 moiety wherein the heavy chains are linked by a peptide linker (e.g., a long flexible linker) and bound to V.sub.L1 and V.sub.L2 moieties, respectively, via disulfide bridges, wherein each disulfide paired heavy and light chain has a different antigen specificity.

    [0112] In certain embodiments, an scFv dimer is a bivalent diabody or bivalent ScFv (BsFv) comprising V.sub.H-V.sub.L (linked by a peptide linker) dimerized with another V.sub.H-V.sub.L moiety such that V.sub.H's of one moiety coordinate with the V.sub.L's of the other moiety and form two binding sites which can target the same antigens (or eptipoes) or different antigens (or eptipoes). In other embodiments, an scFv dimer is a bispecific diabody comprising V.sub.H1- V.sub.L2 (linked by a peptide linker) associated with V.sub.L1-V.sub.H2 (also linked by a peptide linker) such that V.sub.H1 and V.sub.L1 coordinate and V.sub.H2 and V.sub.L2 coordinate and each coordinated pair has a different antigen specificity.

    [0113] The term fully human as used herein, with reference to antibody or antigen-binding fragment, means that the antibody or the antigen-binding fragment has or consists of amino acid sequence(s) corresponding to that of an antibody produced by a human or a human immune cell, or derived from a non-human source such as a transgenic non-human animal that utilizes human antibody repertoires or other human antibody-encoding sequences. In certain embodiments, a fully human antibody does not comprise amino acid residues (in particular antigen-binding residues) derived from a non-human antibody.

    [0114] The term humanized as used herein, with reference to antibody or antigen-binding fragment, means that the antibody or the antigen-binding fragment comprises CDRs derived from non-human animals, FR regions derived from human, and when applicable, the constant regions derived from human. A humanized antibody or antigen-binding fragment is useful as human therapeutics in certain embodiments because it has reduced immunogenicity in human. In some embodiments, the non-human animal is a mammal, for example, a mouse, a rat, a rabbit, a goat, a sheep, a guinea pig, or a hamster. In some embodiments, the humanized antibody or antigen-binding fragment is composed of substantially all human sequences except for the CDR sequences which are non-human. In some embodiments, the FR regions derived from human may comprise the same amino acid sequence as the human antibody from which it is derived, or it may comprise some amino acid changes, for example, no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 changes of amino acid. In some embodiments, such change in amino acid could be present in heavy chain FR regions only, in light chain FR regions only, or in both chains. In some preferable embodiments, the humanized antibodies comprise human FR1-3 and human JH and Jx.

    [0115] The term chimeric as used herein, means an antibody or antigen-binding fragment, having a portion of heavy and/or light chain derived from one species, and the rest of the heavy and/or light chain derived from a different species. In an illustrative example, a chimeric antibody may comprise a constant region derived from human and a variable region from a non-human species, such as from mouse.

    [0116] PCSK9 as used herein refers to Proprotein Convertase Subtilisin/Kexin type 9, a naturally-occurring human proprotein convertase belonging to the proteinase K subfamily of the secretory subtilase family. PCSK9 is synthesized as a soluble zymogen that undergoes autocatalytic intramolecular processing in the endoplasmic reticulum, and is thought to function as a proprotein convertase. PCSK9 has critical role in regulating blood cholesterol levels. Gain of function mutations of PCSK9 (such as S127R, F216L, and D374Y) may associate with a form of autosomal dominant familial hypercholesterolemia, in which PCSK9 mutants enhance the level of LDL receptor. See, e.g., Burnett and Hooper, Clin Biochem Rev (2008) 29(1): 11-26, Benjannet et al. J. Biol. Chem., (2004) 279(47):48865-48875 and Fasano T et al., Atherosclerosis. (2009) 203(1):166-71. Representative amino acid sequence of human PCSK9 is disclosed under the GenBank accession number: NP 777596.2, and the representative mRNA nucleic acid sequence encoding the human PCSK9 is shown under the GenBank accession number: FJ525880.1. In certain embodiments, the term PCSK9 encompasses PCSK9 molecules of post-translational modifications of the PCSK9 amino acid sequence, such as glycosylated, PEGylated PCSK9 sequences, PCSK9 sequences with its signal sequence being cleaved, or PCSK9 sequence with its pro domain being cleaved from the catalytic domain but not separated from the catalytic domain.

    [0117] LDL-C as used herein refers to low-density lipoprotein cholesterol and HDL-C refers to high-density lipoprotein cholesterol. LDL and HDL are within the five major groups of lipoprotein: chylomicrons, very low-density lipoprotein (VLDL), intermediate-density lipoprotein (IDL), low-density lipoprotein and high-density lipoprotein (HDL) (in the order from the largest particles to most dense (smallest particles). LDL (bad cholesterol containing particle) can transport lipid/sterol molecules, such as cholesterol (i.e. LDL-C) into artery walls, attract macrophages thus triggering atherosclerosis. In contrast, HDL (good cholesterol containing particle) can remove lipid molecules, such as cholesterol (i.e. HDL-C) from macrophages in the wall of arteries. Thus, high level of LDL-C has been a major risk of cardiovascular diseases (CVDs), such as peripheral artery disease, coronary artery diseases (CAD, such as angina and myocardial infarction (commonly known as a heart attack), hyperlipidemia, hypercholesterolemia, or hypertriglyceridemia), atherosclerosis, stroke, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, heart arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysms, peripheral artery disease, obesity, cholestatic liver disease, nephrotic syndrome, hypothyroidism and venous thrombosis, or a combination thereof.

    [0118] LDL-R or LDL receptor is a mosaic cell-surface protein of 839 amino acids (after removal of 21-amino acid signal peptide) that mediates the endocytosis of LDL-C and removes LDL-C from the blood. Representative amino acid sequence of human LDL-R is disclosed under the GenBank accession number: P01130.1, and the representative mRNA nucleic acid sequence encoding the human LDL-R is shown under the GenBank accession number: NM_000527.4. When PCSK9 binds to the LDL receptor, the receptor is broken down and cannot remove LDL-C from the blood. In contrary, when PCSK9 is blocked, more LDL receptors will be present on the surface of the liver and will remove more LDL cholesterol from the blood. Anti-PCSK9 antibody as used herein refers to an antibody that is capable of specific binding to PCSK9 (e.g. human or monkey PCSK9) with an affinity which is sufficient to provide for diagnostic and/or therapeutic use.

    [0119] The term specific binding or specifically binds as used herein refers to a non-random binding reaction between two molecules, such as for example between an antibody and an antigen. In certain embodiments, the antibodies or antigen-binding fragments provided herein specifically bind human and/or PCSK9 with a binding affinity (K.sub.D) of 10.sup.6 M (e.g., 510.sup.7 M, 210.sup.7M, 10.sup.7 M, 510.sup.8M, 210.sup.8 M, 10.sup.8 M, 510.sup.9 M, 210.sup.9 M, 10.sup.9 M, 10.sup.10 M). K.sub.D as used herein refers to the ratio of the dissociation rate to the association rate (k.sub.off/k.sub.on), may be determined using surface surface plasmon resonance methods for example using instrument such as Biacore.

    [0120] The ability to block binding or compete for the same epitope as used herein refers to the ability of an antibody or antigen-binding fragment to inhibit the binding interaction between two molecules (e.g. human PCSK9 and an anti-PCSK9 antibody) to any detectable degree. In certain embodiments, an antibody or antigen-binding fragment that blocks binding between two molecules inhibits the binding interaction between the two molecules by at least 50%. In certain embodiments, this inhibition may be greater than 60%, greater than 70%, greater than 80%, or greater than 90%.

    [0121] The term epitope as used herein refers to the specific group of atoms or amino acids on an antigen to which an antibody binds. Two antibodies may bind the same epitope within an antigen if they exhibit competitive binding for the antigen. For example, if an antibody or antigen-binding fragment as disclosed herein blocks binding of the exemplary antibodies such as 11.4, 18.156.8, 15.14.2, 17.72.3, 18.136.7, 19.3.8, 40409 to human PCSK9, then the antibody or antigen-binding fragment may be considered to bind the same epitope as those exemplary antibodies.

    [0122] The various symbols used in the antibody names as provided herein are of different representation: hIgG4 refers to an antibody with human constant region of IgG4 isotype; uAb refers to a human antibody and uAb 1, uAb2 and the like refer to different versions of the human antibody; K or L refers to an antibody using the kappa or lambda light chain.

    [0123] 11.4 as used herein refers to a fully human monoclonal antibody having a heavy chain variable region of SEQ ID NO: 73, and a light chain variable region of SEQ ID NO: 75. Antibody 11.4.1 is a subclone of 11.4.

    [0124] 18.156.8 as used herein refers to a fully human monoclonal antibody having a heavy chain variable region of SEQ ID NO: 77, and a light chain variable region of SEQ ID NO: 79. 18.156.8 (hIgG4) as used herein refers to the antibody of 18.156.8 with a human constant region of IgG4 isotype.

    [0125] 15.14.2 as used herein refers to a fully human monoclonal antibody having a heavy chain variable region of SEQ ID NO: 81, and a light chain variable region of SEQ ID NO: 83. 15.14.2-uAb-IgG4L as used herein refers to the fully human monoclonal antibody of 15.14.2 with a human constant region of IgG4 isotype.

    [0126] 17.72.3 as used herein refers to a fully human monoclonal antibody having a heavy chain variable region of SEQ ID NO: 85, and a light chain variable region of SEQ ID NO: 87. 17.72.3-uAbl-IgG4K and 17.72.3-uAb2-IgG4K as used herein refer to different versions of the fully human monoclonal of 17.72.3 with a human constant region of IgG4 isotype.

    [0127] 18.136.7 as used herein refers to a fully human monoclonal antibody having a heavy chain variable region of SEQ ID NO: 89, and a light chain variable region of SEQ ID NO: 91. 18.136.7-IgG4K as used herein refers to the fully human monoclonal of 18.136.7 with a human constant region of IgG4 isotype.

    [0128] 19.3.8 as used herein refers to a fully human monoclonal antibody having a heavy chain variable region of SEQ ID NO: 93, and a light chain variable region of SEQ ID NO: 95. 19.3.8-uAb1-IgG4L as used herein refers to the fully human monoclonal of 19.3.8 with a human constant region of IgG4 isotype.

    [0129] 40409 as used herein refers to an engineered antibody based on 11.4 that comprises a heavy chain variable region of SEQ ID NO: 97, and a light chain variable region of SEQ ID NO: 99. 40409 has improved affinity as compared with its parent antibody 11.4. 40409 (hIgG4) and 40409 (hIgG2) as used herein refers to the fully human monoclonal of 40409 with a human constant region of IgG4 isotype and IgG2 isotype, respectively.

    [0130] A conservative substitution with reference to amino acid sequence refers to replacing an amino acid residue with a different amino acid residue having a side chain with similar physiochemical properties. For example, conservative substitutions can be made among amino acid residues with hydrophobic side chains (e.g. Met, Ala, Val, Leu, and Ile), among residues with neutral hydrophilic side chains (e.g. Cys, Ser, Thr, Asn and Gln), among residues with acidic side chains (e.g. Asp, Glu), among amino acids with basic side chains (e.g. His, Lys, and Arg), or among residues with aromatic side chains (e.g. Trp, Tyr, and Phe). As known in the art, conservative substitution usually does not cause significant change in the protein conformational structure, and therefore could retain the biological activity of a protein.

    [0131] Percent (%) sequence identity with respect to amino acid sequence (or nucleic acid sequence) is defined as the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to the amino acid (or nucleic acid) residues in a reference sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve the maximum number of identical amino acids (or nucleic acids). Conservative substitution of the amino acid residues may or may not be considered as identical residues. Alignment for purposes of determining percent amino acid (or nucleic acid) sequence identity can be achieved, for example, using publicly available tools such as BLASTN, BLASTp (available on the website of U.S. National Center for Biotechnology Information (NCBI), see also, Altschul S. F. et al, J. Mol. Biol., 215:403-410 (1990); Stephen F. et al, Nucleic Acids Res., 25:3389-3402 (1997)), ClustalW2 (available on the website of European Bioinformatics Institute, see also, Higgins D. G. et al, Methods in Enzymology, 266:383-402 (1996); Larkin M. A. et al, Bioinformatics (Oxford, England), 23(21): 2947-8 (2007)), and ALIGN or Megalign (DNASTAR) software. Those skilled in the art may use the default parameters provided by the tool, or may customize the parameters as appropriate for the alignment, such as for example, by selecting a suitable algorithm.

    [0132] Effector functions as used herein refer to biological activities attributable to the binding of Fc region of an antibody to its effectors such as Cl complex and Fc receptor. Exemplary effector functions include: complement dependent cytotoxicity (CDC) induced by interaction of antibodies and Clq on the Cl complex; antibody-dependent cell-mediated cytotoxicity (ADCC) induced by binding of Fc region of an antibody to Fc receptor on an effector cell; and phagocytosis.

    [0133] Treating or treatment of a condition as used herein includes preventing or alleviating a condition, slowing the onset or rate of development of a condition, reducing the risk of developing a condition, preventing or delaying the development of symptoms associated with a condition, reducing or ending symptoms associated with a condition, generating a complete or partial regression of a condition, curing a condition, or some combination thereof.

    [0134] An isolated substance has been altered by the hand of man from the natural state. If an isolated composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not isolated, but the same polynucleotide or polypeptide is isolated if it has been sufficiently separated from the coexisting materials of its natural state so as to exist in a substantially pure state. In certain embodiments, the antibodies and antigen-binding fragments have a purity of at least 90%, 93%, 95%, 96%, 97%, 98%, 99% as determined by electrophoretic methods (such as SDS-PAGE, isoelectric focusing, capillary electrophoresis), or chromatographic methods (such as ion exchange chromatography or reverse phase HPLC).

    [0135] The term vector as used herein refers to a vehicle into which a polynucleotide encoding a protein may be operably inserted so as to bring about the expression of that protein. A vector may be used to transform, transduce, or transfect a host cell so as to bring about expression of the genetic element it carries within the host cell. Examples of vectors include plasmids, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), or P1-derived artificial chromosome (PAC), bacteriophages such as lambda phage or M13 phage, and animal viruses. Categories of animal viruses used as vectors include retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, baculovirus, papillomavirus, and papovavirus (e.g., SV40). A vector may contain a variety of elements for controlling expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selectable elements, and reporter genes. In addition, the vector may contain an origin of replication. A vector may also include materials to aid in its entry into the cell, including but not limited to a viral particle, a liposome, or a protein coating.

    [0136] The phrase host cell as used herein refers to a cell into which an exogenous polynucleotide and/or a vector has been introduced.

    [0137] A disease or condition mediated by PCSK9 as used herein refers to a disease or condition caused by or characterized by a change in PCSK9, e.g. a change in expression level, in activity, and/or the presence of a variant or mutation of PCSK9. Examples of a disease or condition mediated by PCSK9 includes, but not limited to, a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, high blood pressure, a cardiovascular disease or condition, an inflammatory or autoimmune disease or condition. Methods of identification/diagnosis of above diseases or conditions are known in the art. With regard to the use of the antibodies or antigen-binding fragments disclosed herein to treat CVD (such as acute myocardial infarction (AMI), acute coronary syndrome (ACS), stroke, and CV death), a therapeutically effective amount as used herein refers to the dosage or concentration of the antibody or antigen-binding fragment capable of lowering lipid (such as cholesterol) in the plasma or serum, ameliorating any symptom or marker associated with CVD condition, preventing or delaying the development of a CVD condition, or some combination thereof.

    [0138] The term pharmaceutically acceptable indicates that the designated carrier, vehicle, diluent, excipient(s), and/or salt is generally chemically and/or physically compatible with the other ingredients comprising the formulation, and physiologically compatible with the recipient thereof.

    [0139] Anti-PCSK9 Antibody

    [0140] In certain embodiments, the present disclosure provides exemplary fully human monoclonal antibodies 11.4, 18.156.8, 15.14.2, 17.72.3, 18.136.7, 19.3.8, 40409, whose CDR sequences are shown in the below Table 1, and heavy or light chain variable region sequences are also shown below.

    TABLE-US-00001 TABLE1 CDR1 CDR2 CDR3 SEQIDNO:1 SEQIDNO:3 SEQIDNO:5 11.4-VH SNSAAWN RTYSRSKWYHDYAVSVKG DWETSIWNDDGPNYYNYGMDV SEQIDNO:2 SEQIDNO:4 SEQIDNO:6 AGCAACAGTGCT AGGACATACTCC GATTGGGAGACC GCTTGGAAC AGGTCCAAGTGG TCTATCTGGAAC TATCATGATTAT GACGACGGTCCC GCAGTATCTGTG AACTACTACAAC AAAGGT TACGGTATGGAC GTC SEQIDNO:7 SEQIDNO:9 SEQIDNO:11 11.4-VL RASQGIRNDLG GASSLQS LQHNNYPWT SEQIDNO:8 SEQIDNO:10 SEQIDNO:12 CGGGCAAGTCAG GGTGCATCCAGT CTACAGCATAAT GGCATTAGAAAT TTGCAAAGT AATTACCCGTGG GATTTAGGC ACG SEQIDNO:13 SEQIDNO:15 SEQIDNO:17 18.156.8-VH SYGMH VIWYDGTNKYYADSVKG EKGLD SEQIDNO:14 SEQIDNO:16 SEQIDNO:18 AGCTATGGCATG GTTATATGGTAT GAGAAGGGGCTG CAC GATGGAACTAAT GAC AAATACTATGCA GACTCCGTGAAG GGC SEQIDNO:19 SEQIDNO:21 SEQIDNO:23 18.156.8-VL KSSQSVLYSSTNKNYLV WASTRES QQYYSTPWT SEQIDNO:20 SEQIDNO:22 SEQIDNO:24 AAGTCCAGCCAG TGGGCATCTACC CAGCAATATTAT AGTGTTTTATAC CGGGAATCC AGTACTCCGTGG AGCTCCACCAAT ACG AAGAACTACTTA GTT SEQIDNO:25 SEQIDNO:27 SEQIDNO:29 15.14.2-VH RFAMS SISDNAGRTYFADSVKG LSNWGPYGMDV SEQIDNO:26 SEQIDNO:28 SEQIDNO:30 AGATTTGCCATG AGTATTAGTGAC CTCTCAAACTGG AGC AATGCTGGTAGG GGTCCTTACGGT ACATACTTCGCA ATGGACGTC GACTCCGTGAAG GGC SEQIDNO:31 SEQIDNO:33 SEQIDNO:35 15.14.2-VL TGTSSDVGYYNYVS EVNKRPS SSYAGSKNFVV SEQIDNO:32 SEQIDNO:34 SEQIDNO:36 ACTGGAACCAGC GAGGTCAATAAG AGCTCATATGCA AGTGACGTTGGT CGGCCCTCA GGCAGCAAAAAT TATTATAACTAT TTTGTGGTA GTCTCC SEQIDNO:37 SEQIDNO:39 SEQIDNO:41 17.72.3-VH SYNWWS EIHHSGTTNYNPSLKS DYSGSYFDY SEQIDNO:38 SEQIDNO:40 SEQIDNO:42 AGTTATAACTGG GAAATCCATCAT GATTATAGTGGG TGGAGT AGTGGGACCACC AGCTACTTTGAC AACTACAACCCG TAC TCCCTCAAGAGT SEQIDNO:43 SEQIDNO:45 SEQIDNO:47 17.72.3-VL RTSQSLSSYVA DASKRAT HQRGNWMSS SEQIDNO:44 SEQIDNO:46 SEQIDNO:48 AGGACCAGTCAG GATGCATCCAAA CACCAGCGTGGC AGTCTAAGCAGC AGGGCCACT AACTGGATGTCT TACGTAGCC AGT SEQIDNO:13 SEQIDNO:49 SEQIDNO:17 18.136.7-VH SYGMH IIWYDGSNKYYADSVKG EKGLD SEQIDNO:14 SEQIDNO:50 SEQIDNO:18 AGCTATGGCATG ATTATATGGTAT GAGAAGGGGCTG CAC GATGGAAGTAAC GAC GACTCCGTGAAG GGC SEQIDNO:51 SEQIDNO:53 SEQIDNO:23 18.136.7-VL KSSQSVLYSSNNKNYLV WTSTRES QQYYSTPWT SEQIDNO:52 SEQIDNO:54 SEQIDNO:24 AAGTCCAGCCAG TGGACATCTACC CAGCAATATTAT AGTGTTTTATAC CGGGAATCC AGTACTCCGTGG AGCTCCAACAAT ACG AAGAACTACTTA GTT SEQIDNO:55 SEQIDNO:57 SEQIDNO:59 19.3.8-VH GYYIN RINPNSGGTNYAQKFQG WEGTVTTWDFYYYYGMDV SEQIDNO:56 SEQIDNO:58 SEQIDNO:60 GGCTACTATATA CGGATCAACCCT TGGGAGGGAACG AAC AACAGTGGTGGC GTGACTACGTGG ACAAACTATGCA GATTTCTACTAT CAGAAGTTTCAG TACTACGGTATG GGC GACGTC SEQIDNO:61 SEQIDNO:63 SEQIDNO:65 19.3.8-VL TGTSSDVDTYNYVS DVSNRPS SSYTSSSTLVV SEQIDNO:62 SEQIDNO:64 SEQIDNO:66 ACTGGAACCAGC GATGTCAGTAAT AGCTCATATACA AGTGACGTTGAT CGGCCCTCA AGCAGCAGCACT ACTTATAACTAT CTCGTGGTA GTCTCC SEQIDNO:1 SEQIDNO:67 SEQIDNO:69 40409-VH SNSAAWN RIYSRSKWYHDYAV SVKG DWETIIWGDDGPNY YNYGLDV SEQIDNO:2 SEQIDNO:68 SEQIDNO:70 AGCAACAGTGCT AGGATATACTCC GATTGGGAGACC GCTTGGAAC AGGTCCAAGTGG ATTATCTGGGGC TATCATGATTAT GACGACGGTCCC GCAGTATCTGTG AACTACTACAAC AAAGGT TACGGTTTGGAC GTC SEQIDNO:7 SEQIDNO:9 SEQIDNO:71 40409-VL RASQGIRNDLG GASSLQS LQHNNYLWT SEQIDNO:8 SEQIDNO:10 SEQIDNO:72 CGGGCAAGTCAG GGTGCATCCAGT CTACAGCATAAT GGCATTAGAAAT TTGCAAAGT AATTACCTGTGG GATTTAGGC ACG Aminoacidsequence(SEQIDNO:73): [00001]embedded image Nucleicacidsequence(SEQIDNO:74) CAGCTAAACCTGCAGCAGTCAGGTCCAGGACTGGTGAACCCCTCGCAGACCCTCT [00002]embedded image 11.4-VL: Aminoacidsequence(SEQIDNO:75): [00003]embedded image Nucleicacidsequence(SEQIDNO:76) GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAG [00004]embedded image 18.156.8-VH Aminoacidsequence(SEQIDNO:77): [00005]embedded image VTVSS Nucleicacidsequence(SEQIDNO:78) CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTG [00006]embedded image [00007]embedded image 18.156.8-VL Aminoacidsequence(SEQIDNO:79): [00008]embedded image Nucleicacidsequence(SEQIDNO:80) GACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGG [00009]embedded image 15.14.2-VH Aminoacidsequence(SEQIDNO:81): [00010]embedded image QGTTVTVSS Nucleicacidsequence(SEQIDNO:82) GAAGTGCAGATGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTG [00011]embedded image 15.14.2-VL Aminoacidsequence(SEQIDNO:83): [00012]embedded image Nucleicacidsequence(SEQIDNO:84) CAGTCTGCCCTGACTCAGCCTCCCTCCGCGTCCGGGTCTCCTGGACAGTCAGTCA [00013]embedded image 17.72.3-VH Aminoacidsequence(SEQIDNO:85): [00014]embedded image LVTVSS Nucleicacidsequence(SEQIDNO:86) TCTCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGGGACC [00015]embedded image 17.72.3-VL Aminoacidsequence(SEQIDNO:87): [00016]embedded image Nucleicacidsequence(SEQIDNO:88) GAGGTTGTGTTGACACAGTCTCCCGCCACCCTGTCTTTGTCTCCAGGGGAAAGAG [00017]embedded image 18.136.7-VH Aminoacidsequence(SEQIDNO:89): [00018]embedded image Nucleicacidsequence(SEQIDNO:90) CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTG [00019]embedded image 18.136.7-VL Aminoacidsequence(SEQIDNO:91): [00020]embedded image Nucleicacidsequence(SEQIDNO:92) GACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGG [00021]embedded image 19.3.8-VH Aminoacidsequence(SEQIDNO:93): [00022]embedded image Nucleicacidsequence(SEQIDNO:94) CAGGTGCAGTTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTG [00023]embedded image 19.3.8-VL Aminoacidsequence(SEQIDNO:95): [00024]embedded image Nucleicacidsequence(SEQIDNO:96) CAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGATCTCCTGGACAGTCGATCA [00025]embedded image 40409-VH Aminoacidsequence(SEQIDNO:97): [00026]embedded image Nucleicacidsequence(SEQIDNO:98) CAGCTAAACCTGCAGCAGTCAGGTCCAGGACTGGTGAACCCCTCGCAGACCCTCT [00027]embedded image 40409-VL Aminoacidsequence(SEQIDNO:99): [00028]embedded image Nucleicacidsequence(SEQIDNO:100) GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAG [00029]embedded image

    [0141] In certain embodiments, one or more CDR sequences provided herein can be modified or changed such that the resulting antibody is improved over the parent antibody in one or more properties (such as improved antigen-binding, improved glycosylation pattern, reduced risk of glycosylation on a CDR residue, reduced deamination on a CDR residue, increased pharmacokinetic half-life, pH sensitivity, and compatibility to conjugation), and is otherwise comparable to the parent antibody (i.e. antibody having otherwise the same set of CDR sequences except for the above-mentioned modification or change), or at least substantially retains the antigen-binding property of the parent antibody.

    [0142] A skilled artisan will understand that the CDR sequences provided in Table 1 can be modified to contain one or more substitutions of amino acids, so as to provide for an improved biological activity such as improved binding affinity to human PCSK9. For example, a library of antibody variants (such as Fab or scFv variants) can be generated and expressed with phage display technology, and then screened for the binding affinity to human PCSK9. For another example, computer software can be used to virtually simulate the binding of the antibodies to human PCSK9, and identify the amino acid residues on the antibodies which form the binding interface. Such residues may be either avoided in the substitution so as to prevent reduction in binding affinity, or targeted for substitution to provide for a stronger binding. In certain embodiments, at least one (or all) of the substitution(s) in the CDR sequences is conservative substitution.

    [0143] In certain embodiments, the antibodies and the antigen-binding fragments thereof comprise one or more CDR sequences having at least 80% (e.g. at least 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity to that (or those) listed in Table 1, and in the meantime retain the binding affinity to human PCSK9 at a level similar to or even higher than its parental antibody having substantially the same sequence except that the corresponding CDR sequence is in 100% sequence identity to that (or those) listed in Table 1.

    [0144] In certain embodiments, the anti-PCSK9 antibodies and the antigen-binding fragments thereof are fully human. Theses fully human antibodies retain the binding affinity to human PCSK9, preferably at a level similar to one of the exemplary antibodies: 11.4, 18.156.8, 15.14.2, 17.72.3, 18.136.7, 19.3.8, 40409.

    [0145] Also contemplated herein are antibodies and the antigen-binding fragments that compete for the same epitope with the anti-PCSK9 antibodies and the antigen-binding fragments thereof provided herein. In certain embodiments, the antibodies block binding of 11.4, 18.156.8, 15.14.2, 17.72.3, 18.136.7, 19.3.8, 40409 to human or monkey PCSK9, for example, at an IC.sub.50 value (i.e. 50% inhibition concentration) of below10.sup.6M, below 10.sup.7 M, below 10.sup.7-5M, below 10.sup.8M, below 10.sup.8.5 M, below 10.sup.9M, or below 10.sup.10 M, below 10.sup.11 M or below 10.sup.12 M. The IC.sub.50 values are determined based on a competition assay such as ELISA assays and radioligand competition binding assays.

    [0146] In some embodiments, the anti-PCSK9 antibodies and the antigen-binding fragments thereof provided herein are capable of specifically binding to human PCSK9 and/or monkey with a binding affinity (Kd) of no more than 10.sup.8 M, no more than 10.sup.9 M or no more than 10.sup.10 M (e.g., 2.510.sup.8 M, 210.sup.8 M, 7.510.sup.9 M, 3.510.sup.9 M, 710.sup.10 M, 610.sup.10 M, 510.sup.10 M, 2.510.sup.10 M, 210.sup.10 M, 1.510.sup.10 M, 7.510.sup.11 M, 6.510.sup.11 M, or 5.510.sup.11 M) as measured by surface plasmon resonance binding assay or ELISA. The binding affinity can be represented by K.sub.D value, which is calculated as the ratio of dissociation rate to association rate (k.sub.off/k.sub.on) when the binding between the antigen and the antigen-binding molecule reaches equilibrium. The antigen-binding affinity (e.g. K.sub.D) can be appropriately determined using suitable methods known in the art, including, for example, surface plasmon resonance binding assay using instruments such as Biacore (see, for example, Murphy, M. et al, Current protocols in protein science, Chapter 19, unit 19.14, 2006).

    [0147] In certain embodiments, the antibodies and the fragments thereof provided herein binds to human PCSK9 with an EC.sub.50 (i.e. 50% binding concentration) of 0.01 nM-0.2 nM (e.g. 0.02 nM-0.2 nM, 0.02 nM-0.15 nM, 0.02 nM-0.05 nM, 0.01 nM-0.05 nM, or 0.02 nM-0.3 nM). Binding of the antibodies to human PCSK9 can be measured by methods known in the art, for example, sandwich assay such as ELISA, Western Blot, other binding assay. In an illustrative example, the test antibody (i.e. first antibody) is allowed to bind to immobilized human PCSK9, after washing away the unbound antibody, a labeled secondary antibody is introduced which can bind to and thus allow detection of the bound first antibody. The detection can be conducted with a microplate reader when immobilized PCSK9 is used.

    [0148] In certain embodiments, the antibodies and the fragments thereof provided herein inhibit the binding of human PCSK9 to human LDL receptor at an IC.sub.50 of 0.5 nM-3 nM (e.g. 0.5 nM-2.5 nM, 1 nM-2.5 nM, 1 nM-2 nM, or 1 nM-1.5 nM), as measured in a competition assay.

    [0149] In certain embodiments, the antibodies and antigen-binding fragments thereof bind to monkey PCSK9 with a binding affinity similar to that of human PCSK9. For example, binding of the exemplary antibodies 11.4, 18.156.8, 15.14.2, 17.72.3, 18.136.7, 19.3.8, 40409 to monkey PCSK9 is at a similar affinity or EC50 value to that of human PCSK9.

    [0150] In some embodiments, the anti-PCSK9 antibodies and the antigen-binding fragments thereof further comprise an immunoglobulin constant region. In some embodiments, an immunoglobulin constant region comprises a heavy chain and/or a light chain constant region. The heavy chain constant region comprises CH1, CH1-CH2, or CH1-CH3 regions. In some embodiments, the constant region may further comprise one or more modifications to confer desirable properties. For example, the constant region may be modified to reduce or deplete one or more effector functions, to improve FcRn receptor binding, or to introduce one or more cysteine residues. In some embodiments, the anti-PCSK9 antibodies and the antigen-binding fragments thereof have a constant region of IgG4 isotype, which has reduced or depleted effector function. Various assays are known to evaluate ADCC or CDC activities, for example, Fc receptor binding assay, Clq binding assay, and cell lysis assay, and can be readily selected by people in the art.

    [0151] In certain embodiments, the antibodies and antigen-binding fragments thereof can be used as the base of antibody-drug conjugates, bispecific or multivalent antibodies.

    [0152] The anti-PCSK9 antibodies or antigen-binding fragments thereof provided herein can be a monoclonal antibody, polyclonal antibody, fully human antibody, humanized antibody, chimeric antibody, recombinant antibody, bispecific antibody, labeled antibody, bivalent antibody, or anti-idiotypic antibody. A recombinant antibody is an antibody prepared in vitro using recombinant methods rather than in animals. A bispecific or bivalent antibody is an artificial antibody having fragments of two different monoclonal antibodies and can bind two different antigens. An antibody or antigen-binding fragment thereof that is bivalent comprises two antigen-binding sites. The two antigen binding sites may bind to the same antigen, or they may each bind to a different antigen, in which case the antibody or antigen-binding fragment is characterized as bispecific.

    [0153] In some embodiments, the anti-PCSK9 antibodies or antigen-binding fragments thereof provided herein are fully human antibodies. In certain embodiments, the fully human antibodies are prepared using recombinant methods. For example, transgenic animal such as a mouse can be made to carry transgenes or transchromosomes of human immunoglobulin genes, and therefore capable of producing fully human antibodies after immunization with proper antigen such as human PCSK9. Fully human antibodies can be isolated from such transgenic animal, or alternatively, can be made by hybridoma technology by fusing the spleen cells of the transgenic animal with an immortal cell line to generate hybridoma cells secreting the fully human antibodies. Exemplary transgenic animals include, without limitation, OmniRat, whose endogenous expression of rat immunoglobulin genes are inactivated and at the same time engineered to contain functional recombinant human immunoglobulin loci; OmniMouse, whose endogenous expression of mouse immunoglobulin genes are inactivated and at the same time engineered to contain recombinant human immunoglobulin loci having J-locus deletion and a C-kappa mutation; OmniFlic, which is a transgenic rat whose endogenous expression of rat immunoglobulin genes are inactivated and at the same time engineered to contain recombinant human immunoglobulin loci having a single common, rearranged VkJk light chain and functional heavy chain. Detailed information can be further found at: Osborn M. et al, Journal of Immunology, 2013, 190: 1481-90; Ma B. et al, Journal of Immunological Methods 400-401 (2013) 78-86; Geurts A. et al, Science, 2009, 325:433; U.S. Pat. 8,907,157; EP patent 2152880B1; EP patent 2336329B1, all of which are incorporated herein by reference to its entirety. Other suitable transgenic animals can also be used, for example, HuMab mice (see, for details, Lonberg, N. et al. Nature 368(6474): 856 859 (1994)), Xeno-Mouse (Mendez et al. Nat Genet., 1997, 15:146- 156), TransChromo Mouse (Ishida et al. Cloning Stem Cells, 2002, 4:91-102) and Veloclmmune Mouse (Murphy et al. Proc Natl Acad Sci USA, 2014, 111:5153-5158), Kymouse (Lee et al. Nat Biotechnol, 2014, 32:356-363), and transgenic rabbit (Flisikowska et al. PLoS One, 2011, 6:e21045).

    [0154] In some embodiments, the anti-PCSK9 antibodies and the antigen-binding fragments thereof is a camelized single domain antibody, a diabody, a scFv, an scFv dimer, a BsFv, a dsFv, a (dsFv)2, a dsFv-dsFv, an Fv fragment, a Fab, a Fab, a F(ab)2, a ds diabody, a nanobody, a domain antibody, or a bivalent domain antibody.

    [0155] In some embodiments, the anti-PCSK9 antibodies and the antigen-binding fragments thereof further comprise a conjugate. It is contemplated that a variety of conjugates may be linked to the antibodies or antigen-binding fragments provided herein (see, for example, Conjugate Vaccines, Contributions to Microbiology and Immunology, J. M. Cruse and R. E. Lewis, Jr. (eds.), Carger Press, New York, (1989)). These conjugates may be linked to the antibodies or antigen-binding fragments by covalent binding, affinity binding, intercalation, coordinate binding, complexation, association, blending, or addition, among other methods. In certain embodiments, the antibodies and antigen-binding fragments disclosed herein may be engineered to contain specific sites outside the epitope binding portion that may be utilized for binding to one or more conjugates. For example, such a site may include one or more reactive amino acid residues, such as for example cysteine or histidine residues, to facilitate covalent linkage to a conjugate. In certain embodiments, the antibodies may be linked to a conjugate indirectly, or through another conjugate. For example, the antibody or antigen-binding fragments may be conjugated to biotin, then indirectly conjugated to a second conjugate that is conjugated to avidin. The conjugate can be a detectable label, a pharmacokinetic modifying moiety, a purification moiety, or a cytotoxic moiety. Examples of detectable label may include a fluorescent labels (e.g. fluorescein, rhodamine, dansyl, phycoerythrin, or Texas Red), enzyme-substrate labels (e.g. horseradish peroxidase, alkaline phosphatase, luceriferases, glucoamylase, lysozyme, saccharide oxidases or P-D-galactosidase), radioisotopes (e.g. .sup.123I, .sup.124I, .sup.125I, .sup.131I, .sup.35S, .sup.3H, .sup.111In, .sup.112In .sup.14C, .sup.64Cu, .sup.67Cu, .sup.86Y, .sup.88Y, .sup.90Y, .sup.177Lu, .sup.211At, .sup.186Re, .sup.188Re, .sup.153Sm, .sup.212Bi, and .sup.32P, other lanthanides, luminescent labels), chromophoric moiety, digoxigenin, biotin/avidin, a DNA molecule or gold for detection. In certain embodiments, the conjugate can be a pharmacokinetic modifying moiety such as PEG which helps increase half-life of the antibody. Other suitable polymers include, such as, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, copolymers of ethylene glycol/propylene glycol, and the like. In certain embodiments, the conjugate can be a purification moiety such as a magnetic bead. A cytotoxic moiety can be any agent that is detrimental to cells or that can damage or kill cells. Examples of cytotoxic moiety include, without limitation, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin and analogs thereof, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine).

    [0156] Polynucleotides and Recombinant Methods

    [0157] The present disclosure provides isolated polynucleotides that encode the anti-PCSK9 antibodies and the antigen-binding fragments thereof. In certain embodiments, the isolated polynucleotides comprise one or more nucleotide sequences as shown in Table 1, which encodes the CDR sequences provided in Table 1.

    [0158] In some embodiments, the isolated polynucleotides encodes a heavy chain variable region and comprise a sequence selected from the group consisting of: SEQ ID NO: 26, SEQ ID NO: 30, SEQ ID NO: 34, and a homologous sequence thereof having at least 80% (e.g. at least 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity. In some embodiments, the isolated polynucleotides encodes a light chain variable region and comprise a sequence selected from the group consisting of: SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, and a homologous sequence thereof having at least 80% (e.g. at least 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity. In certain embodiments, the percentage identity is due to genetic code degeneracy, while the encoded protein sequence remains unchanged.

    [0159] The isolated polynucleotide that encodes the anti-PCSK9 antibodies and the antigen-binding fragments thereof (e.g. including the sequences in Table 1) can be inserted into a vector for further cloning (amplification of the DNA) or for expression, using recombinant techniques known in the art. In another embodiment, the antibody may be produced by homologous recombination known in the art. DNA encoding the monoclonal antibody is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody). Many vectors are available. The vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter (e.g. SV40, CMV, EF-1), and a transcription termination sequence.

    [0160] In some embodiments, the vector system includes mammalian, bacterial, yeast systems, etc, and comprises plasmids such as, but not limited to, pALTER, pBAD, pcDNA, pCal, pL, pET, pGEMEX, pGEX, pCI, pCMV, pEGFP, pEGFT, pSV2, pFUSE, pVITRO,pVIVO, pMAL, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p15TV-L, pPro18, pTD, pRS420, pLexA, pACT2.2 etc, and other laboratorial and commercially available vectors. Suitable vectors may include, plasmid, or viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses).

    [0161] Vectors comprising the polynucleotide sequence encoding the antibody or antigen-binding fragment can be introduced to a host cell for cloning or gene expression. Suitable host cells for cloning or expressing the DNA in the vectors herein are the prokaryote, yeast, or higher eukaryote cells described above. Suitable prokaryotes for this purpose include eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis, Pseudomonas such as P. aeruginosa, and Streptomyces.

    [0162] In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for anti-PCSK9 antibody-encoding vectors. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein, such as Schizosaccharomyces pombe; Kluyveromyces hosts such as, e.g., K. lactis, K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906), K. thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070); Candida; Trichoderma reesia (EP 244,234); Neurospora crassa; Schwanniomyces such as Schwanniomyces occidentalis; and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium, and Aspergillus hosts such as A. nidulans and A. niger.

    [0163] Suitable host cells for the expression of glycosylated antibodies or antigen-fragment provided here are derived from multicellular organisms. Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruiffly), and Bombyx mori have been identified. A variety of viral strains for transfection are publicly available, e.g., the L-1 variant of Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV, and such viruses may be used as the virus herein according to the present invention, particularly for transfection of Spodoptera frugiperda cells. Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can also be utilized as hosts.

    [0164] However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure. Examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells/-DHFR (CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2). In some preferable embodiments, the host cell is 293F cell.

    [0165] Host cells are transformed with the above-described expression or cloning vectors for anti-PCSK9 antibody production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.

    [0166] The host cells used to produce the antibodies or antigen-binding fragments provided herein may be cultured in a variety of media. Commercially available media such as Hams F10 (Sigma), Minimal Essential Medium (MEM), (Sigma), RPMI-1640 (Sigma), and Dulbeccos Modified Eagles Medium (DMEM), Sigma) are suitable for culturing the host cells. In addition, any of the media described in Ham et al., Meth. Enz. 58:44 (1979), Barnes et al., Anal. Biochem. 102:255 (1980), U.S. Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 4,560,655; or 5,122,469; WO 90/03430; WO 87/00195; or U.S. Pat. Re. 30,985 may be used as culture media for the host cells. Any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as GENTAMYCIN drug), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art. The culture conditions, such as temperature, pH, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

    [0167] When using recombinant techniques, the antibody can be produced intracellularly, in the periplasmic space, or directly secreted into the medium. If the antibody is produced intracellularly, as a first step, the particulate debris, either host cells or lysed fragments, is removed, for example, by centrifugation or ultrafiltration. Carter et al., Bio/Technology 10:163-167 (1992) describe a procedure for isolating antibodies which are secreted to the periplasmic space of E. coli. Briefly, cell paste is thawed in the presence of sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonylfluoride (PMSF) over about 30 min. Cell debris can be removed by centrifugation. Where the antibody is secreted into the medium, supernatants from such expression systems are generally first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be included to prevent the growth of adventitious contaminants.

    [0168] The antibody prepared from the cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, DEAE-cellulose ion exchange chromatography, ammonium sulfate precipitation, salting out, and affinity chromatography, with affinity chromatography being the preferred purification technique. The suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain that is present in the antibody. Protein A can be used to purify antibodies that are based on human .gamma.1, .gamma.2, or .gamma.4 heavy chains (Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)). Protein G is recommended for all mouse isotypes and for human .gamma.3 (Guss et al., EMBO J. 5:1567 1575 (1986)). The matrix to which the affinity ligand is attached is most often agarose, but other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. Where the antibody comprises a CH3 domain, the Bakerbond ABX resin (J. T. Baker, Phillipsburg, N.J.) is useful for purification. Other techniques for protein purification such as fractionation on an ion-exchange column, ethanol precipitation, Reverse Phase HPLC, chromatography on silica, chromatography on heparin SEPHAROSE' chromatography on an anion or cation exchange resin (such as a polyaspartic acid column), chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation are also available depending on the antibody to be recovered.

    [0169] Following any preliminary purification step(s), the mixture comprising the antibody of interest and contaminants may be subjected to low pH hydrophobic interaction chromatography using an elution buffer at a pH between about 2.5-4.5, preferably performed at low salt concentrations (e.g., from about 0-0.25M salt).

    [0170] Kits

    [0171] The present disclosure provides kits comprising the anti-PCSK9 antibodies or the antigen-binding fragments thereof. In some embodiments, the kits are useful for detecting the presence or level of PCSK9 in a biological sample. The biological sample can comprise serum. In some embodiments, the kit comprises an anti-PCSK9 antibody or the antigen-binding fragment thereof which is conjugated with a detectable label. In certain other embodiments, the kit comprises an unlabeled anti-PCSK9 antibody or antigen-binding fragment, and further comprises a secondary labeled antibody which is capable of binding to the unlabeled anti-PCSK9 antibody. The kit may further comprise an instruction of use, and a package that separates each of the components in the kit.

    [0172] In some embodiments, the kits are useful for treating, preventing, or delaying diseases or conditions mediated by PCSK9. In certain embodiments, the anti-PCSK9 antibody or the antigen-binding fragment thereof are associated with a substrate or a device useful in a sandwich assay such as ELISA, or in an immunographic assay. Useful substrate or device can be, for example, microtiter plate and test strip.

    [0173] In certain embodiments, the kit further comprises one or more agents known to be beneficial for reducing cholesterol. Exemplary agents include statin, an HMG-CoA reductase inhibitor other than a statin, niacin (nicotinic acid), a cholesterol absorption inhibitor, a cholesteryl ester transfer protein (CETP), a bile acid sequestrant, a fibrate, a phytosterol; or a modulator of lipid/lipid concentration ratios selected from a small molecule, peptidomimetic, an antisense RNA, a small interfering RNA (siRNA), and a natural or modified lipid. In certain embodiments, a cholesterol absorption inhibitor is ezetimibe or SCH-48461; a CETP is evacetrapib, anacetrapib or dalcetrapib; a bile acid sequestrant is preferably colesevelam, cholestyramine or colestipol; a fibrate is preferably fenofibrate, gemfibrozil, clofibrate, or bezafibrate; or the combination thereof.

    [0174] Pharmaceutical Composition and Method of Treatment

    [0175] The present disclosure further provides pharmaceutical compositions comprising the anti-PCSK9 antibodies or the antigen-binding fragments thereof and one or more pharmaceutically acceptable carriers.

    [0176] Pharmaceutical acceptable carriers for use in the pharmaceutical compositions disclosed herein may include, for example, pharmaceutically acceptable liquid, gel, or solid carriers, aqueous vehicles, nonaqueous vehicles, antimicrobial agents, isotonic agents, buffers, antioxidants, anesthetics, suspending/dispending agents, sequestering or chelating agents, diluents, adjuvants, excipients, or non-toxic auxiliary substances, other components known in the art, or various combinations thereof.

    [0177] Suitable components may include, for example, antioxidants, fillers, binders, disintegrants, buffers, preservatives, lubricants, flavorings, thickeners, coloring agents, emulsifiers or stabilizers such as sugars and cyclodextrins. Suitable antioxidants may include, for example, methionine, ascorbic acid, EDTA, sodium thiosulfate, platinum, catalase, citric acid, cysteine, thioglycerol, thioglycolic acid, thiosorbitol, butylated hydroxanisol, butylated hydroxytoluene, and/or propyl gallate. As disclosed herein, inclusion of one or more antioxidants such as methionine in a composition comprising an antibody or antigen-binding fragment and conjugates as provided herein decreases oxidation of the antibody or antigen-binding fragment. This reduction in oxidation prevents or reduces loss of binding affinity, thereby improving antibody stability and maximizing shelf-life. Therefore, in certain embodiments compositions are provided that comprise one or more antibodies or antigen-binding fragments as disclosed herein and one or more antioxidants such as methionine. Further provided are methods for preventing oxidation of, extending the shelf-life of, and/or improving the efficacy of an antibody or antigen-binding fragment as provided herein by mixing the antibody or antigen-binding fragment with one or more antioxidants such as methionine.

    [0178] To further illustrate, pharmaceutical acceptable carriers may include, for example, aqueous vehicles such as sodium chloride injection, Ringer's injection, isotonic dextrose injection, sterile water injection, or dextrose and lactated Ringer's injection, nonaqueous vehicles such as fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil, or peanut oil, antimicrobial agents at bacteriostatic or fungistatic concentrations, isotonic agents such as sodium chloride or dextrose, buffers such as phosphate or citrate buffers, antioxidants such as sodium bisulfate, local anesthetics such as procaine hydrochloride, suspending and dispersing agents such as sodium carboxymethylcelluose, hydroxypropyl methylcellulose, or polyvinylpyrrolidone, emulsifying agents such as Polysorbate 80 (TWEEN-80), sequestering or chelating agents such as EDTA (ethylenediaminetetraacetic acid) or EGTA (ethylene glycol tetraacetic acid), ethyl alcohol, polyethylene glycol, propylene glycol, sodium hydroxide, hydrochloric acid, citric acid, or lactic acid. Antimicrobial agents utilized as carriers may be added to pharmaceutical compositions in multiple-dose containers that include phenols or cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoic acid esters, thimerosal, benzalkonium chloride and benzethonium chloride. Suitable excipients may include, for example, water, saline, dextrose, glycerol, or ethanol. Suitable non-toxic auxiliary substances may include, for example, wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers, or agents such as sodium acetate, sorbitan monolaurate, triethanolamine oleate, or cyclodextrin.

    [0179] The pharmaceutical compositions can be a liquid solution, suspension, emulsion, pill, capsule, tablet, sustained release formulation, or powder. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, polyvinyl pyrollidone, sodium saccharine, cellulose, magnesium carbonate, etc.

    [0180] In certain embodiments, the pharmaceutical compositions are formulated into an injectable composition. The injectable pharmaceutical compositions may be prepared in any conventional form, such as for example liquid solution, suspension, emulsion, or solid forms suitable for generating liquid solution, suspension, or emulsion. Preparations for injection may include sterile and/or non-pyretic solutions ready for injection, sterile dry soluble products, such as lyophilized powders, ready to be combined with a solvent just prior to use, including hypodermic tablets, sterile suspensions ready for injection, sterile dry insoluble products ready to be combined with a vehicle just prior to use, and sterile and/or non-pyretic emulsions. The solutions may be either aqueous or nonaqueous.

    [0181] In certain embodiments, unit-dose parenteral preparations are packaged in an ampoule, a vial or a syringe with a needle. All preparations for parenteral administration should be sterile and not pyretic, as is known and practiced in the art.

    [0182] In certain embodiments, a sterile, lyophilized powder is prepared by dissolving an antibody or antigen-binding fragment as disclosed herein in a suitable solvent. The solvent may contain an excipient which improves the stability or other pharmacological components of the powder or reconstituted solution, prepared from the powder. Excipients that may be used include, but are not limited to, water, dextrose, sorbital, fructose, corn syrup, xylitol, glycerin, glucose, sucrose or other suitable agent. The solvent may contain a buffer, such as citrate, sodium or potassium phosphate or other such buffer known to those of skill in the art at, in one embodiment, about neutral pH. Subsequent sterile filtration of the solution followed by lyophilization under standard conditions known to those of skill in the art provides a desirable formulation. In one embodiment, the resulting solution will be apportioned into vials for lyophilization. Each vial can contain a single dosage or multiple dosages of the anti-PCSK9 antibody or antigen-binding fragment thereof or composition thereof. Overfilling vials with a small amount above that needed for a dose or set of doses (e.g., about 10%) is acceptable so as to facilitate accurate sample withdrawal and accurate dosing. The lyophilized powder can be stored under appropriate conditions, such as at about 4 C. to room temperature.

    [0183] Reconstitution of a lyophilized powder with water for injection provides a formulation for use in parenteral administration. In one embodiment, for reconstitution the sterile and/or non-pyretic water or other liquid suitable carrier is added to lyophilized powder. The precise amount depends upon the selected therapy being given, and can be empirically determined.

    [0184] Therapeutic methods are also provided, comprising: administering a therapeutically effective amount of the antibody or antigen-binding fragment as provided herein to a subject in need thereof, thereby treating or preventing a condition or a disorder associated with related to PCSK9. In another aspect, methods are provided to treat a condition in a subject that would benefit from upregulation of immune response, comprising administering a therapeutically effective amount of the antibody or antigen-binding fragment as provided herein to a subject in need thereof.

    [0185] The therapeutically effective amount of an antibody or antigen-binding fragment as provided herein will depend on various factors known in the art, such as for example body weight, age, past medical history, present medications, state of health of the subject and potential for cross-reaction, allergies, sensitivities and adverse side-effects, as well as the administration route and extent of CVD development. Dosages may be proportionally reduced or increased by one of ordinary skill in the art (e.g., physician or veterinarian) as indicated by these and other circumstances or requirements.

    [0186] In certain embodiments, an antibody or antigen-binding fragment as provided herein may be administered at a therapeutically effective dosage of about 0.01 mg/kg to about 100 mg/kg (e.g., about 0.01 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 5 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, about 30 mg/kg, about 35 mg/kg, about 40 mg/kg, about 45 mg/kg, about 50 mg/kg, about 55 mg/kg, about 60 mg/kg, about 65 mg/kg, about 70 mg/kg, about 75 mg/kg, about 80 mg/kg, about 85 mg/kg, about 90 mg/kg, about 95 mg/kg, or about 100 mg/kg). In certain of these embodiments, the antibody or antigen-binding fragment is administered at a dosage of about 50 mg/kg or less, and in certain of these embodiments the dosage is 10 mg/kg or less, 5 mg/kg or less, 3 mg/kg or less, 1 mg/kg or less, 0.5 mg/kg or less, or 0.1 mg/kg or less. In certain embodiments, the administration dosage may change over the course of treatment. For example, in certain embodiments the initial administration dosage may be higher than subsequent administration dosages. In certain embodiments, the administration dosage may vary over the course of treatment depending on the reaction of the subject.

    [0187] Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single dose may be administered, or several divided doses may be administered over time.

    [0188] The antibodies and antigen-binding fragments disclosed herein may be administered by any route known in the art, such as for example parenteral (e.g., subcutaneous, intraperitoneal, intravenous, including intravenous infusion, intramuscular, or intradermal injection) or non-parenteral (e.g., oral, intranasal, intraocular, sublingual, rectal, or topical) routes.

    [0189] Methods of Use

    [0190] The present disclosure further provides methods of using the anti-PCSK9 antibodies or the antigen-binding fragments thereof.

    [0191] In some embodiments, the present disclosure provides methods of treating a condition or a disorder associated with or mediated by PCSK9 in an individual, comprising administering a therapeutically effective amount of the anti-PCSK9 antibody or antigen- binding fragment thereof. In certain embodiments, the individual has been identified as having a disorder or condition likely to respond to a PCSK9 inhibitor. In certain embodiments, the individual is at risk of having or developing a disease or condition mediated by PCSK9 that exhibits one or more symptoms of said disease or condition, such as being overweight, having elevated cholesterol level, having genetic mutation in the genes encoding LDL-R or APOB, or having family history of such a disease or condition. In certain embodiments, the individual is resistant to or intolerable to another cholesterol lowering agents in a therapy, for example, statin, such that the level of cholesterol cannot be effectively lowered to an acceptable level in such therapy. In certain embodiments, the diseases or conditions mediated by PCSK9 include infectious disease such as severe cellulitis, gastroenteritis, sepsis, pneumonia, skin and soft tissue infections, pyelonephritis, viral infection, for example, viral infection of hepatitis B, hepatitis C, herpes virus, Epstein-Barr virus, HIV, cytomegalovirus, herpes simplex virus type I, herpes simplex virus type 2, human papilloma virus, adenovirus, Kaposi West sarcoma associated herpes virus epidemics, thin ring virus (Torquetenovirus), JC virus or BK virus, or include inflammatory diseases, such as Alzheimer's, ankylosing spondylitis, arthritis (osteoarthritis, rheumatoid arthritis (RA), psoriatic arthritis), asthma, atherosclerosis, Crohns disease, colitis, dermatitis, diverticulitis, fibromyalgia, hepatitis, irritable bowel syndrome (IBS), systemic lupus erythematous (SLE), nephritis, Parkinson's disease and ulcerative colitis.

    [0192] The presence or level of LDL-C on an interested biological sample can be indicative of whether the individual from whom the biological sample is derived could likely respond to a PCSK9 inhibitor. Various methods can be used to determine the presence or level of LDL-C in a test biological sample from the individual. Milligrams (mg) per deciliter (dL) of blood of cholesterol levels are measured in the USA, while millimoles (mmol) per liter (L) of blood are used in Canada and many European countries.

    [0193] In certain embodiments, presence or upregulated level of the LDL-C, total cholsterol or non-HDL-C in the test biological sample indicates likelihood of responsiveness. The term upregulated as used herein, refers to an overall increase of no less than 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or greater, in the cholsterol level in the test sample as detected using the antibodies or antigen-binding fragments provided herein, as compared to the cholsterol level in a reference sample as detected using the same antibody. The reference sample can be a control sample obtained from a healthy or non-diseased individual, or a healthy or non-diseased sample obtained from the same individual from whom the test sample is obtained.

    [0194] The antibodies or antigen-binding fragments disclosed herein may be administered alone or in combination with one or more additional therapeutic means or agents. For example, the antibodies or antigen-binding fragments disclosed herein may be administered in combination with statin, an HMG-CoA reductase inhibitor other than a statin, niacin (nicotinic acid), a cholesterol absorption inhibitor, a cholesteryl ester transfer protein (CETP), a bile acid sequestrant, a fibrate, a phytosterol; or a modulator of lipid/lipid concentration ratios selected from a small molecule, peptdomimetic, an antisense RNA, a small interfering RNA (siRNA), and a natural or modified lipid. In certain embodiments, a cholesterol absorption inhibitor is ezetimibe or SCH-48461; a CETP is evacetrapib, anacetrapib or dalcetrapib; a bile acid sequestrant is preferably colesevelam, cholestyramine or colestipol; a fibrate is preferably fenofibrate, gemfibrozil, clofibrate, or bezafibrate.

    [0195] In certain of these embodiments, an antibody or antigen-binding fragment as disclosed herein that is administered in combination with one or more above additional therapeutic agents may be administered simultaneously with the one or more additional therapeutic agents, and in certain of these embodiments the antibody or antigen-binding fragment and the additional therapeutic agent(s) may be administered as part of the same pharmaceutical composition. However, an antibody or antigen-binding fragment administered in combination with another therapeutic agent does not have to be administered simultaneously with or in the same composition as the agent. An antibody or antigen-binding fragment administered prior to or after another agent is considered to be administered in combination with that agent as the phrase is used herein, even if the antibody or antigen-binding fragment and second agent are administered via different routes. Where possible, additional therapeutic agents administered in combination with the antibodies or antigen-binding fragments disclosed herein are administered according to the schedule listed in the product information sheet of the additional therapeutic agent, or according to the Physicians Desk Reference 2003 (Physicians' Desk Reference, 57th Ed; Medical Economics Company; ISBN: 1563634457; 57th edition (November 2002)) or protocols well known in the art.

    [0196] The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. All specific compositions, materials, and methods described below, in whole or in part, fall within the scope of the present invention. These specific compositions, materials, and methods are not intended to limit the invention, but merely to illustrate specific embodiments falling within the scope of the invention. One skilled in the art may develop equivalent compositions, materials, and methods without the exercise of inventive capacity and without departing from the scope of the invention. It will be understood that many variations can be made in the procedures herein described while still remaining within the bounds of the present invention. It is the intention of the inventors that such variations are included within the scope of the invention.

    EXAMPLE 1

    Antibody and Other Proteins Generation

    [0197] 1.1 Human and murine PCSK9

    [0198] Human and murine PCSK9 genes were inserted into expression vector pcDNA 3.3 with a 6-His tag or murine Fc (mFc) fused at the C-terminus. The plasmids were then transfected to HEK293 cells using PlasFect (Bioline USA, BIO-46026). The His-tag proteins were purified from harvested supernatant using a Ni-column (Qiagen Inc). The mFc-fused proteins were purified using Protein A column (Mab Select SuRe, GE).

    [0199] 1.2 Human LDL-R

    [0200] The gene of LDL receptor extracellular domain was inserted into vector pcDNA 3.3 with a C-terminal 6-His tag. The plasmid was transfected to HEK293 cells using PlasFect (Bioline USA, BIO-46026). LDL-R protein was firstly purified from harvested supernatant using a Ni column (Qiagen Inc), followed by purification using ion-exchange column.

    [0201] 1.3 Reference antibody

    [0202] Reference antibody BMK.115 was generated based on the sequence of 21B12 in the US Patent No. 8889834B2. The plasmids containing VH and VL gene were co-transfected into HEK293 cells. Antibody was purified form harvested supernatant using Protein A column (Mab Select SuRe, GE).

    EXAMPLE 2

    Antibody Generation

    [0203] 2.1 Immunization

    [0204] OmniRat (OMT) which contains human immunoglobulin variable domain genes were used to generate antibodies with fully human VH and VL. OmniRat were injected with human PCSK9 protein via foot pads approximately every 3 days. First titer test was performed after 6 times injection. Afterwards, the rats were injected every other week.

    [0205] 2.2 Serum Titer Detection

    [0206] Enzyme linked immunosorbent assay (ELISA) was used to measure titers of antibody in rat serum. ELISA plates (Nunc) were coated with human PCSK9 at 1 m/ml overnight at 4 C., and then blocked with blocking buffer (1XPBS/ 2% BSA) for 1 h at room temperature. Rat serum was 1:3 titrated starting at 1:100 dilution in blocking buffer and incubated for 1 h at room temperature. The plates were then washed and subsequently incubated with secondary antibody goat anti rat IgG1 HRP (Bethyl) and goat anti rat IgG2b HRP (Bethyl) for 45 min. After washing, TMB substrate was added and the interaction was stopped by 2M HCl. The absorbance at 450 nm was read using a microplate reader (Molecular Device).

    [0207] 2.3 Immunization and Hybridoma Generation

    [0208] Lymph nodes and spleen were collected from immunized mice under sterile condition, and lymphocytes were prepared using Ficoll-Paque PLUS gradient centrifugation. The isolated cells were then fused with myeloma cell P3 at a ratio of 1:1 using electrofusion device (BTX ECM2001). Cells were transferred to HA media after fusion. 510.sup.5 cells were seeded per 96-well plate.

    [0209] Titers of the antigen-specific antibody in serum were determined by ELISA assay. The rats with serum titer of 312500 or higher were selected for hybridoma fusion.

    [0210] 2.4 Hybridoma Screening

    [0211] Binding assay by ELISA: Plates (Nunc) were coated with Streptavidin at 1 g/ml overnight at 4 C. After blocking and washing, 250 ng/ml PCSK9-biotin was added and incubated for 1 h. Then hybridoma supernatants were transferred to the plates and incubate at room temperature for 1 h. The plates were then washed and subsequently incubated with secondary antibody goat anti rat IgG1 HRP (Bethyl) and goat anti rat IgG2b HRP (Bethyl) for 45 min. After washing, TMB substrate was added and the interaction was stopped by 2M HCl. The absorbance at 450 nm was read using a microplate reader (Molecular Device).

    [0212] Blocking assay by ELISA: Plates (Nunc) were coated with LDL-R overnight at 4 C. Hybridoma supernatants were mixed with 250 ng/ml PCSK9-mFc-biotin and incubated at 4 C. overnight. After blocking and washing, the mixture were added to the plates and incubated for 1 h. The plates were then washed and subsequently incubated with streptavidin- HRP. After washing, TMB substrate was added and the interaction was stopped by 2M HCl. The absorbance at 450 nm was read using a microplate reader (Molecular Device).

    [0213] Hybridoma supernatant was used for primary screen. The primary binding screen identified a total of 13000 antigen-specific hybridomas from 4 fusions. The antigen specific hybridomas were then screened by ELISA blocking assay. The blocking assay resulted in 104 hybridomas which can block the binding of human PCSK9 to human LDL-R. The selected antibodies with both binding and blocking activities were purified from hybridoma supernatant. In the meanwhile, the selected hybridoma lines were subcloned by limiting dilution. Hybridoma subclones were verified by binding and blocking ELISA assay, and their isotypes were also detected.

    [0214] Cellular LDL uptake assay was performed using purified antibodies. Binding and blocking activities were also further evaluated using ELISA. The selection of final lead clones was based on binding affinity, blocking IC50 of PCSK9 binding to LDL-R, and restoration activity of cellular LDL-uptake.

    [0215] 2.5 Subcloning

    [0216] Hybridoma cells of each selected lines were plated in 96-well plates at densities of 0.5, 1 and 5 cell/well. The single clones were picked and tested in binding ELISA. Three subclones of each hybridoma line were selected and frozen.

    [0217] 2.6 Isotype

    [0218] Antibody Isotype was identified by ELISA (see Table 2). Plates (Nunc) were coated with goat anti rat IgG1, IgG2a, IgG2b, IgG2c and IgM antibodies (Bethyl) at 1 g/ml overnight at 4 C. After blocking and washing, the hybridoma supernatants were transferred to the coated plates and incubate at room temperature for 1 h. The plates were then incubated with secondary antibody goat anti-human kappa HRP or goat anti human lambda HRP (Southern Biotech) for 45 min. After washing, TMB substrate was added and the interaction was stopped by 2M HCl. The absorbance at 450 nm was read using a microplate reader (Molecular Device).

    TABLE-US-00002 TABLE 2 Antibody Isotype Ab Isotype 18.156.8 IgG1/kappa 11.4.1 IgG1/kappa 15.14.2 IgG2b/Lambda 17.72.3 IgG1/kappa 19.3.8 IgG1/Lambda 18.136.7 IgG1/kappa

    [0219] Antibody Purification

    [0220] Harvested hybridoma supernatants were loaded to Protein A column (MabSelect SuRe, GE) after adjusting pH to 7.0. Antibodies were eluted by Glycine followed with immediately neutralization using 1 M Tris. Antibody concentration was tested by Nano Drop (Thermal-Fisher). The purity of proteins was evaluated by SDS-PAGE (Invitrogen, NuPAGE 4%-12% Bis-Tris Gel) and HPLC-SEC (Agilent).

    EXAMPLE 3

    Generation of Fully Human Antibody

    [0221] 3.1 Hybridoma Sequencing

    [0222] Extract RNA from hyridoma cell using Trizol reagent (Invitrogen-15596018). cDNA was amplifiedy using 5-RACE kit (Takara-28001488), followed by PCR amplification using 3-degenerated primers and 3-adaptor primers (ExTaq: Takara-RR001B). PCR fragments was inserted into pMD18-T vector (Takara-D101C) and sent for sequencing (Shanghai Biosune). Variable region sequences (amino acid sequences and nucleic acid sequences) of selected antibodies 11.4, 18.156.8, 15.14.2, 17.72.3, 18.136.7, 19.3.8 and 40409 are shown as SEQ ID NOs: 73-100.

    [0223] 3.2 Generation of Recombinant Fully Human Antibody

    [0224] The V-region DNA of each antibody (human-rat chimeric antibody) was cloned into a pcDNA3.3 vector containing human constant region gene. HEK293 cell was transfected with plasmids that encode antibody heavy and light chains. Supernatant from transfected cells was harvested by removing cells and filtration. Antibodies were purified by Protein A column (Mab Select SuRe, GE) and buffer exchanged into PBS. Antibody concentration was detected by Nanodrop. Purity was evaluated by SDS-PAGE (Invitrogen, NuPAGE4%-12% Bis-Tris Gel) and HPLC-SEC (Agilent).

    [0225] 3.3 Affinity Maturation

    [0226] A saturated mutagenesis of 11.4 heavy chain (HC)-CDR3 library was generated and screened by binding ELISA assay, and single mutations that increased PCSK9 binding compared to the parental clone were selected. A combinatorial library of selected mutations was then generated. The clones with certain mutation combinations were selected based on ELISA binding and SPR k.sub.off ranking results.

    [0227] Two random mutant libraries were generated using 11.4 as a template. The libraries were selected by 2 rounds of panning and screening. Mutations that improve the binding affinity were selected and combined with mutations selected with the saturated library.

    [0228] A saturated mutagenesis library of 11.4 HC-CDR3 was generated and screened by binding ELISA assay, and single mutations that increased PCSK9 binding compared to the parental clone were selected (FIG. 1). A combinatorial library of selected mutations was then generated. The clones with certain mutation combinations were selected based on ELISA binding and SPR k.sub.off ranking results. Combination of 3 mutations in one CDR yielded 10-fold affinity improvement in IgG-converted clones B4G2 and C1B4 (Table 3).

    TABLE-US-00003 TABLE 3 Binding affinity of affinity matured antibodies Antibody ka (1/Ms) kd (1/s) KD (M) A1D11 5.53E+05 3.73E04 6.73E10 B1F6 1.25E+06 2.41E04 1.93E10 B4G2 1.23E+06 1.66E04 1.35E10 B5C1 5.96E+05 3.87E04 6.49E10 C1B4 1.56E+06 2.01E04 1.29E10 11.4.4 1.31E+06 1.31E03 1.00E09 BMK.115 1.48E+05 1.86E05 1.25E10

    [0229] Two random mutant libraries were also generated using 11.4 as a template. Libraries selection by 2 rounds of panning yielded 5 clones with the affinity-improving mutations. 3 combinations of these mutations were selected and introduced into B4G2 to yield clones 40408, 40409 and 40410. The additional mutation resulted 2-fold further affinity improvement. The final affinity matured lead Abs have 2-fold higher affinity compared to BMK.115 (Table 4).

    TABLE-US-00004 TABLE 4 Binding affinity of affinity matured antibodies Antibody ka (1/Ms) kd (1/s) KD (M) 40408 1.38E+06 9.90E05 7.17E11 40409 1.73E+06 9.05E05 5.23E11 40410 1.48E+06 9.50E05 6.41E11 B4G2 1.14E+06 1.89E04 1.65E10

    [0230] 3.4 Production of Fully Human Antibodies from Transient Transfected Cell Line

    [0231] 3.4.1 18.156.8 (hIgG4)

    [0232] Fully human antibody 18.156.8 (hIgG4) migrates with the apparent molecular mass of 25 kDa and 55 kDa in SDS-PAGE under reducing conditions corresponding to light chain and heavy chain (see FIG. 2). The main band under non-reducing condition is the whole IgG with M.W. of 150 KD. The purity is 99.6% as determined by HPLC-SEC (FIG. 3). Endotoxin is <0.5 EU/mg.

    [0233] 3.4.2 40409 (hIgG4)

    [0234] Fully human antibody 18.156.8 (hIgG4) migrates with the apparent molecular mass of 25 kDa and 55 kDa in SDS-PAGE under reducing conditions corresponding to light chain and heavy chain (see FIG. 4). The main band under non-reducing condition is the whole IgG with M.W. of 150 KD. The purity is 98% as determined by HPLC-SEC (see FIG. 5). Endotoxin is <0.5 EU/mg.

    [0235] 3.4.3 15.14.2-uAb-IgG4L

    [0236] Fully human antibody 15.14.2-uAb-IgG4L migrates with the apparent molecular mass of 25 kDa and 55 kDa in SDS-PAGE under reducing conditions corresponding to light chain and heavy chain (see FIG. 6). The main band under non-reducing condition is the whole IgG with M.W. of 150 KD. The purity is 99.8% as determined by HPLC-SEC (see FIG. 7). Endotoxin is <0.5 EU/mg.

    [0237] 3.4.4 17.72.3-uAb2-IgG4K

    [0238] Fully human antibody 17.72.3-uAb2-IgG4K migrates with the apparent molecular mass of 25 kDa and 55 kDa in SDS-PAGE under reducing conditions corresponding to light chain and heavy chain (see FIG. 8). The main band under non-reducing condition is the whole IgG with M.W. of 150 KD. The purity is 98.9% as determined by HPLC-SEC (see FIG. 9). Endotoxin is <0.5 EU/mg.

    [0239] 3.4.5 18.136.7-IgG4K

    [0240] Fully human antibody 18.136.7-IgG4K migrates with the apparent molecular mass of 25 kDa and 55 kDa in SDS-PAGE under reducing conditions corresponding to light chain and heavy chain (see FIG. 10). The main band under non-reducing condition is the whole IgG with M.W. of 150 KD. The purity is 99.2% as determined by HPLC-SEC (see FIG. 11). Endotoxin is <0.5 EU/mg.

    [0241] 3.4.6 19.3 .8-uAb 1-IgG4L

    [0242] Fully human antibody 19.3.8-uAbl-IgG4L migrates with the apparent molecular mass of 25 kDa and 55 kDa in SDS-PAGE under reducing conditions corresponding to light chain and heavy chain (see FIG. 12). The main band under non-reducing condition is the whole IgG with M.W. of 150 KD. The purity is 99.9% as determined by HPLC-SEC (see FIG. 13). Endotoxin is <0.5 EU/mg.

    EXAMPLE 4

    Lead Antibody Characterization

    [0243] 4.1 Binding and Blocking Activities of Fully Human Antibodies

    [0244] The activities of fully human antibodies binding to PCSK9 were confirmed by ELISA. (FIG. 14). The activities of fully human antibodies to blocking the binding of PCSK9 to LDL-R were confirmed by competitive ELISA (FIG. 15). The binding EC50 and blocking IC50 values were summarized in Tables 5 and 6. The lead antibodies 18.156.8(hIgG4), 40409 (hIgG4), 15.14.2-uAb-IgG4L and 17.72.3-uAb2-IgG4K exhibited comparable binding and blocking activities with BMK.115 and Repetha.

    TABLE-US-00005 TABLE 5 Summary of binding activity Binding Antibody EC50 (nM) 18.156.8 (hIgG4) 0.028 40409 (hIgG4) 0.024 15.14.2-IgG4L 0.031 17.72.3-IgG4K 0.036 19.3.8-IgG4L 0.13 Repatha 0.044 BMK.115 0.041

    TABLE-US-00006 TABLE 6 Summary of blocking activity Antibody Blocking IC50 (nM) 18.156.8 (hIgG4) 1.22 40409 (hIgG4) 1.75 15.14.2-IgG4L 1.121 17.72.3-IgG4K 1.673 19.3.8-IgG4L 2.004 Repatha 2.207 BMK.115 2.233

    [0245] 4.2 LDL Uptake Assay of Fully Human Antibodies

    [0246] HepG2 or Huh-7 cells were seeded in a 96-well plate at a density of 110.sup.5 cells/well in DMEM medium containing 10% FBS. The plate was kept in a 37 C. incubator overnight. The medium was replaced with DMEM without FBS. Mixture of human PCSK9 and various concentrations of antibodies were added to the cells. The final concentration of wild type PCSK9 and mutant PCSK9 (D374Y) was 20 g/ml and 1.3 g/ml, respectively. After 1 hour, Bodipy FL-labeled LDL (Invitrogen L-3483) was added to the cells to make a final concentration of 1.5 g/ml. After incubation in a 37 C. incubator for 3 hours, medium containing LDL in the plate was discarded. The cells were trypsinized and washed twice. LDL-uptake was characterized by the fluorescence of Bodipy FL-labeled LDL in the cells determined by FACS. LDL-uptake restoration rate was calculated following the formula: LDL-uptake restoration (%) (MFI.sub.sampleMFI.sub.LDL+Ag1H)/(MFI.sub.LDL onlyMTI.sub.LDL+Ag1H)100%.

    [0247] The final lead antibodies 18.156.8 and 40409 were evaluated in LDL-uptake assay in HepG2 and Huh-7 cells (see FIGS. 16 and 17) using both of wild type and mutant PCSK9. The result demonstrates that 18.156.8 and 40409 can efficiently restore the cellular LDL-uptake when WT PCSK9 or mutant PCSK9 exist. The ability of antibody 15.14.2, 17.72.3 and 19.3.8 to restore cellular LDL-uptake was evaluated using HepG2 cell with wild type PCSK9 (see FIG. 18). The result demonstrates that 15.14.2, 17.72.3 and 19.3.8 can efficiently restore the cellular LDL-uptake when WT PCSK9 exists. The IC50 value of each antibody was summarized in Table 7 and 8.

    TABLE-US-00007 TABLE 7 IC50 of antibody in LDL-uptake restoration assay HepG2 Huh-7 PCSK9 PCSK9 IC50 (nM) PCSK9 (WT) (D374Y) PCSK9 (WT) (D374Y) BMK.115 52.3 4.8 76.8 3.6 18.156.8 65.1 10.8 76.1 5.2 (hIgG4) BMK.115 48.9 4.6 43.7 2.9 40409 (hIgG2) 38.3 2.3 63.7 2.7

    TABLE-US-00008 TABLE 8 LDL-uptake assay in HepG2 Antibody IC50 (nM) 15.14.2-IgG4L 80 17.72.3-IgG4K 106 19.3.8-IgG4L 115 Repatha 77.6 BMK.115 84.7

    [0248] 4.3 Kinetic Affinity

    [0249] 4.3.1 Binding Kinetics by SPR

    [0250] Antibody binding affinity to human and rhesus PCSK9 was detected by SPR assay using Biacore T200. Each antibody was captured on a Protein A or or anti-human IgG Fc antibody immobilized CM5 sensor chip (GE). Human or rhesus PCSK9 at different concentrations were injected over the sensor chip at a flow rate of 30 L/min for an association phase of 180 s, followed by 1200 s dissociation. The chip was regenerated by 2 M MgCl.sub.2 after each binding cycle.

    [0251] The sensorgrams for blank surface and buffer channel were subtracted from the test sensorgrams. The experimental data was fitted by 1:1 model using Langmiur analysis. Molecular weight of 85 KDa was used to calculate the molar concentration of analyte.

    [0252] 4.3.2 Cross-Reactivity to Rhesus PCSK9 by ELISA

    [0253] ELISA plates (Nunc) were coated with anti-His Ab (Genscript) at 1 g/ml overnight at 4 C. After blocking and washing, 1 g/ml rhesus PCSK9-His (Sino Biological) was added and incubated for 1 h. The antibody samples were added to the plates and incubate at room temperature for 1 h. The plates were then washed and subsequently incubated with secondary antibody goat anti rat IgG1 HRP (Bethyl) and goat anti rat IgG2b HRP (Bethyl) for 45 min. After washing, TMB substrate was added and the interaction was stopped by 2M HCl. The absorbance at 450 nm was read using a microplate reader (Molecular Device).

    [0254] Kinetic affinities of antibody leads were measured by SPR assay. The affinities to human and monkey PCSK9 are summarized in Table 9.

    TABLE-US-00009 TABLE 9 Kinetic affinity to human and monkey PCSK9 Kinetic affinity to human PCSK9 Antibody ka (1/Ms) kd (1/s) KD (M) 18.156.8 2.48E+05 1.46E04 5.89E10 40409 1.73E+06 9.05E05 5.23E11 15.14.2 3.24E+05 8.09E05 2.50E10 17.72.3 1.37E+04 4.68E05 3.42E09 19.3.8 1.54E+04 2.71E04 1.75E08 BMK.115 1.48E+05 1.86E05 1.25E10 Kinetic affinity to monkey PCSK9 Antibody ka (1/Ms) kd (1/s) KD (M) 18.156.8 8.61E+05 3.19E05 3.71E11 40409 2.27E+06 9.39E04 4.13E10 15.14.2 4.52E+05 3.10E04 6.87E10 17.72.3 1.10E+05 0.002256 2.05E08 19.3.8 6.16E+05 4.41E03 7.16E09 BMK.115 1.15E+06 6.62E05 5.75E11

    [0255] 4.4 Serum Stability

    [0256] Antibodies were incubated in freshly isolated human serum (serum content>95%) at 37 C. for 0, 1, 3, 7, 14 days, respectively. After incubation at 37 C., samples were rapidly frozen in dry-ice-ethanol bath and kept at 80 C. The samples were rapidly thawed before stability test. The plates were coated with streptavidin in Na.sub.2CO.sub.3/NaHCO.sub.3 (pH 9.2) buffer at 4 C. overnight. The plates were washed with 0.1% Tween-PBS once before being blocked with 2% BSA/PBS. Biotin-labeled PCSK9 was added and incubated for 1 hr. After washing, then diluted serum samples were transferred to the plates and incubated for 1 hr at room temperature. Goat anti-human-HRP antibody were added to the wells and incubated for 1 hr. After washing, TMB substrate was added and the interaction was stopped by 2 M HCl. The absorbance at 450 nm was read using a microplate reader (Molecular Device).

    [0257] The antibody binding to human PCSK9 was tested by ELISA after incubation in human serum at 37 C. (FIG. 19). The binding of antibody 18.156.8 and B4G2 after incubation of 1, 3, 7 and 14 days did not show significant difference from the pre-incubation sample. Therefore, antibody 18.156.8 and B4G2 are both stable in human serum for 14 days at 37 C. The binding of antibody 15.14.2, 17.72.3 and 19.3.8 after incubation of 3 days did not show significant difference from the pre-incubation sample.

    EXAMPLE 5

    Animal Study

    [0258] 5.1 Single-Dose Efficacy in Non-Human Primates

    [0259] LDL-C and HDL-C concentration in monkey serum was tested on Roche/Hitachi cobas c systems using LDLC and HDLC3 kits (Roche). Total cholesterol (TCHO) was tested by cholesterol FS kit (DiaSys).

    [0260] 5.1.1 Study 1: A total of 6 female cynomolgus monkeys, approximately 3 to 4 years old and weighing 2.6 to 2.9 kg, at dosing initiation. Six female monkeys were randomly assigned to 6 groups of 1 female/group. Six groups of 1 female monkey each received 10 or 30 mg/kg of BMK.115, 18.156.8 (hIgG4) or 40409 (hIgG4) by a single dose intravenous injection. The first dosing day was defined as Day 1. The animals of each group were observed for 36 days following dosing:

    TABLE-US-00010 Dose.sup.a Numbering Group/ Dose Volume of Animals Label color Test Article (mg/kg) (mL/kg) Female 1/Green BMK.115 10 mg/kg 1.39 1501 2/Yellow BMK.115 30 mg/kg 4.17 2501 3/Red 18.156.8 (hIgG4) 10 mg/kg 2.60 3501 4/Cyan 18.156.8 (hIgG4) 30 mg/kg 7.80 4501 5/Magenta 40409 (hIgG4) 10 mg/kg 1.04 5501 6/Blue 40409 (hIgG4) 30 mg/kg 3.13 6501 Note: In this report, dose level and dosage are used interchangeably. .sup.aDoses represent active ingredient.

    [0261] LDL-C lowering effect of antibody 18.156.8 and 40409 in cynomolgus monkey. Administration of BMK.115 and 18.156.8 (hIgG4) resulted in a rapid and sustained reduction in LDL-C and total cholesterol (TCHO) at 10 mg/kg and 30 mg/kg in cynomolgus monkeys.

    [0262] Percentage reduction of LDL was up to 83.4% and 89.6% in the BMK.115 10 mg/kg and 30 mg/kg dose groups, respectively, compared with predose value. 18.156.8 (hIgG4) yielded significant reductions in LDL-C up to 79.5% and 83.5% in 10 mg/kg and 30 mg/kg dose groups, respectively. The maximum reduction was reached on day 8. Reductions in LDL-C were sustained throughout the in-life phase for 18.156.8 (hIgG4) treated animals in both 10 mg/kg and 30 mg/kg dose groups. Reductions in LDL-C were sustained throughout the in-life phase for BMK.115 treated animals in 30 mg/kg dose group, but the LDL-C of 10 mg/kg group started to restore from day 24 and returned to predose level on day 28 (FIG. 20A and 20B). Therefore, reduction in LDL-C was sustained longer period in 18.156.8 treated animal at 10 mg/kg dose compared with Repatha treated group.

    [0263] 40409 (hIgG4) reduced LDL-C up to 32.2% and 38.1% in 10 mg/kg and 30 mg/kg dose groups, respectively (see FIG. 20A and 20B).

    [0264] High Density Lipoprotein cholesterol (HDL-C) was generally well maintained in the monkeys given 18.156.8 (hIgG4) or 40409 (hIgG4) at 10 mg/kg and 30 mg/kg. HDL-C was generally maintained in the monkey given BMK.115 at 10 mg/kg dose, but decrease of HDL-C (up to 30.4%) was noted in BMK.115 30 mg/kg group compared to the predose value (FIGS. 21A and 21B).

    [0265] 5.1.2 Study 2: A total of 10 female cynomolgus monkeys, approximately 3 to 4 years old and weighing 2.5 to 3.5 kg, at dosing initiation. 10 female monkeys were randomly assigned to 8 groups of 1 female/group. 10 groups of 1 female monkey each received 3 mg/kg or 10 mg/kg of Repatha, 15.14.2, 17.72.3, 18.136.7 or 19.3.8 by a single dose intravenous injection. The first dosing day was defined as Day 1. The animals of each group were observed for 36 days following dosing:

    TABLE-US-00011 Dose.sup.a Numbering of Group/Label Dose Volume Animals color Test Article (mg/kg) (mL/kg) Female 1/White Repatha 3 0.06 1501 2/Green Repatha 10 0.2 2501 3/Yellow 15.14.2 3 0.5 3501 4/Red 15.14.2 10 1.67 4501 5/Cyan 19.3.8 3 0.6 5501 6/Magenta 19.3.8 10 2 6501 7/Blue 17.72.3 3 0.57 7501 8/Cyan 17.72.3 10 1.89 8501 9/White 18.136.7 3 0.59 9501 10/Green 18.136.7 10 1.98 10501 Note: In this report, dose level and dosage are used interchangeably. .sup.aDoses represent active ingredient.

    [0266] LDL-C lowering effect of antibody 15.14.2, 17.72.3, 18.136.7 and 19.3.8 in cynomolgus monkey.

    [0267] Administration of Repetha and 15.14.2 resulted in a rapid and sustained reduction of LDL-C and total cholesterol (TCHO) at 3 mg/kg and 10 mg/kg in cynomolgus monkeys (FIG. 22A and 22B). 18.136.7 also showed significant reduction of LDL-C up to 50% at 3 mg/kg and 10 mg/kg. 17.72.3 and 19.3.8 showed moderate reduction of LDL-C at 10 mg/kg.

    [0268] Percentage reduction of LDL was up to 80% and 77% in Repatha 3 mg/kg and 10 mg/kg dose groups, respectively, compared with predose value. In 15.14.2 yielded significant reductions in LDL-C up to 77% in both 3 mg/kg and 10 mg/kg dose groups, respectively. The maximum reduction was reached on day 8-16. In the 10 mg/kg dose groups, reduction of LDL-C was sustained throughout the in-life phase for 15.14.2 treated animal, but the LDL-C level started to restore from day 24 and returned to predose level till day 36 for Repatha treated animal (FIG. 22A and 22B). In the 10 mg/kg dose groups, the LDL-C level of Repatha treated monkey restored to 80% of predose level on day 12 and completely returned to predose level on day 20. The reduction of LDL-C for 3 mg/kg 15.14.2 treated monkey retained lower than 50% till day 28. Therefore, reductions in LDL-C were sustained longer period in 15.14.2 treated animals in both 3 mg/kg and 10 mg/kg dose groups compared with Repatha treated groups.

    [0269] High Density Lipoprotein cholesterol (HDL-C) was generally well maintained in the monkeys treated with all the tested antibodies at 3 mg/kg and 10 mg/kg (FIG. 23A and 23B).

    [0270] 5.2 Pharmacokinetics (PK) Study

    [0271] To determine systemic exposure (TK), serum concentrations of BMK.115, 18.156.8-hIgG4, 40409-hIgG4, 15.14.2, 17.72.3, 18.136.7 and 19.3.8 were determined. Blood samples were collected from all available monkeys at 0 (predose), 0.5, 1, 2, 4, 24, 48, 96, 168, 336, 504, 672, 744, and 840 hours postdose.

    [0272] Approximately 2 mL of blood was collected from the animals via a cephalic or a femoral vein. Blood was collected into appropriately labeled tubes without anticoagulant. The tubes were placed at room temperature for at least 30 min, and serum was obtained within 2 hour of collection by centrifugation at 2000g and 4 C. for 10 minutes. Serum was transferred into uniquely labeled polypropylene tubes and frozen in the upright position immediately over dry ice and stored in a freezer set to maintain 60 C.

    [0273] The serum samples were rapidly thawed before PK test. The plates were coated with polyclonal goat anti-human antibody in Na.sub.2CO.sub.3/NaHCO.sub.3 buffer at 4 C. overnight. The plates were washed with 0.1% Tween-PBS once before being blocked with 2% BSA/PBS. Diluted cynomolgus serum samples were transferred to the plates and incubated for lhr at room temperature. Biotin-labeled goat anti-human IgG antibody and streptavidin-HRP were added to the wells and incubated for lhr respectively. The OD value at 450 nm of each well was read after the addition of the substrate and stop solution. The concentrations of antibodies in serum samples were determined by the standard curves.

    [0274] TK parameter values, including (where data allows), but not necessarily limited to, the initial serum concentrations (C.sub.0), and the area under the serum concentration vs time curve (AUC) from time zero to 840 hours postdose AUC.sub.0.840h, were determined using a validated WinNonlin program (Pharsight, Version 6.2.1). AUC.sub.0-840h was calculated using the linear up/log down trapezoidal rule by noncompartmental methods from drug treated animals only. Serum concentrations below the lower limit of quantification (BLQ) were set to zero for TK parameters calculations.

    [0275] The antibody concentration in monkey serum was tested by ELISA (FIGS. 24 and 25). The C.sub.0 and AUC.sub.0-840h for BMK.115, 18.156.8 (hIgG4), 40409 (hIgG4) following once single IV injection of BMK.115, 18.156.8 (hIgG4), 40409 (hIgG4) at 10 or 30 mg/kg to female monkeys are presented below. The half-life of each antibody was also listed in Table 10.

    [0276] As the dosage increased from 10 mg/kg to 30 mg/kg, the systemic exposure (AUC.sub.0-840h and/or C.sub.0) to 18.156.8 and 40409 increased dose-proportionally, but increased more than dose-proportionally to BMK.115.

    TABLE-US-00012 TABLE 10 Summary of PK data I Dose C.sub.0 AUC.sub.0-840 h Analyte (mg/kg) (ug/mL) (h * ug/mL) T.sub.1/2 (h) BMK.115 10 643 25700 57.9 30 1970 156000 112.2 18.156.8 10 405 25300 128.8 30 1960 89800 162.8 40409 10 282 46200 186.8 30 2030 218000 135.0

    [0277] The C.sub.0 and AUC.sub.0-840h for Repatha, 15.14.2, 17.72.3, 18.136.7 and 19.3.8 following once single IV injection at 3 or 10 mg/kg to female monkeys are presented below (see Table 11). The half-life of each antibody was also listed in Table 11. 15.14.2, 17.72.3, 18.136.7 and 19.3.8 all exhibited longer than Repatha in both doses.

    [0278] As the dosage increased from 3 mg/kg to 10 mg/kg, the systemic exposure (AUC.sub.0-840h and/or C.sub.0) to Repatha, 15.14.2, 17.72.3, 18.136.7 and 19.3.8 increased dose-proportionally.

    TABLE-US-00013 TABLE 11 Summary of PK data II Dose C.sub.0 AUC.sub.0-840 h Analyte (mg/kg) (ug/mL) (h * ug/mL) T (h) Repatha 3 30 14000 62 10 802 88900 145.2 15.14.2 3 240 39800 177.7 10 600 181000 385.6 19.3.8 3 140 38700 270.9 10 360 99100 446.8 17.72.3 3 232 25700 154.1 10 725 117000 353 18.136.7 3 235 12600 122 10 520 46100 240.7

    [0279] 5.3 Immunogenicity

    [0280] Blood was collected from the animals at 0 (predose), 336, 672 and 840 hours postdose via a cephalic or a femoral vein.

    [0281] The plates were coated with BMK.115, 18.156.8, 40409, 15.14.2, 17.72.3, 18.136.7 or 19.3.8 in Na.sub.2CO.sub.3/NaHCO.sub.3 buffer at 4 C. overnight. The plates were washed with 0.1% Tween-PBS once before being blocked with 2% BSA/PBS. PBS-diluted cynomolgus serum samples were transferred to the plates and incubated for lhr at room temperature. After washing, goat anti-cynomolgus IgG-HRP antibody (no cross-interaction with human IgG) was added. The OD value at 450 nm of each well was read after the addition of the substrate and stop solution.

    [0282] The immunogenicity test results of BMK.115, 18.156.8 (hIgG4), 40409 (hIgG4) are shown in FIG. 26. The titers of anti-drug antibody (ADA) against BMK.115, 18.156.8 (hIgG4), 40409 (hIgG4) in monkey serum at 336, 672, 840 hours post dose have no significant difference from predose. Therefore, after single IV injection of BMK.115, 18.156.8 (hIgG4), 40409 (hIgG4) at 10 or 30 mg/kg to female monkeys, the results show that BMK.115, 18.156.8 (hIgG4), 40409 (hIgG4) induced low immunogenicity in serum.

    [0283] [000263] The immunogenicity test results of Repatha, 15.14.2, 17.72.3, 18.136.7 and 19.3.8 are shown in FIG. 27. The titers of anti-drug antibody (ADA) against Repatha, 15.14.2, 17.72.3, 18.136.7 and 19.3.8 in monkey serum at 336, 672, 840 hours post dose have no significant difference from predose. Therefore, after single IV injection of the antibodies at 3 or 10 mg/kg to female monkeys, the results show that Repatha, 15.14.2, 17.72.3, 18.136.7 and 19.3.8 induced low immunogenicity in serum.

    [0284] 5.4 Toxicity

    [0285] Mortality/Moribundity: The health status of each animal was reported twice a day during the study, once in the morning and once in the afternoon, except on animal release and the day of in-life completion where animals were examined once.

    [0286] There were no unscheduled deaths during the course of the study.

    [0287] Detailed observations: Detailed observations were conducted once during pretest for all animals (including spare animals), once on dosing day (20.5 hours post dose), and once weekly thereafter during the study for all study animals.

    [0288] There were no test article-related clinical signs observed during the in-life phase.

    [0289] Cage side observations: Cage side observation was conducted daily during pretest from Day 2 for all animals (including spare animals), once predose on Day 1, and twice daily during the dosing day (within 30 minutes, and at approximately 60.5 hours post dose) and once daily during the recovery phase. Cage side observation was not conducted if a detailed observation was scheduled at the same time slot.

    [0290] Body weights: Each animal was weighed once during pretest for all animals, once on Day 1 prior to dosing, and once weekly thereafter for study animals.

    [0291] No test article-related findings were observed on body weight, and all changes were considered within biological variation.

    [0292] Food consumption: Food consumption was estimated daily for all animals 2 days prior to dose initiation and throughout the dosing day and observation period. Daily food evaluation was assessed by visual inspection for overall appetite (the documentation was consist of whether the animal was eating or not).

    [0293] There were no test article-related changes in food consumption.

    EXAMPLE 6

    Activity Comparison Between Antibody 18.156.8 and Reference Antibodies

    [0294] 1. Reference Antibody Generation

    [0295] Reference antibody 12H11.1.uIgG4K and 24B9.1.uIgG4L were generated based on the sequence of 12H11.1 and 24B9.1 in Patent CN101932607 using methods described in EXAMPLE 1 and EXAMPLE 2.

    [0296] Antibodies 12H11.1.uIgG4K and 24B9.1.uIgG4L migrate with the apparent molecular mass of 25 kDa and 55 kDa in SDS-PAGE under reducing conditions corresponding to light chain and heavy chain (FIG. 28A). The main band under non- reducing condition is the whole IgG with M.W. of 150 KD. The purity of 24B9.1.uIgG4L is 96.8% as determined by HPLC-SEC (FIG. 28B). The purity of 12H11.1.uIgG4K is 95.3% as determined by HPLC-SEC (FIG. 28C).

    [0297] 2. Binding to Human PCSK9 by ELISA

    [0298] The activities of reference antibodies 12H11.1.uIgG4K and 24B9.1.uIgG4L binding to human PCSK9 were confirmed by ELISA (FIG. 29), according to the method described in Section 2.4 Hybridoma screening of EXAMPLE 2. The binding EC50 values were summarized in Table 12. The reference antibodies 12H11.1.uIgG4K showed lower binding activity than 18.156.8 and BMK.115. The reference antibody 24B9.1.uIgG4L does not bind to human PCSK9.

    TABLE-US-00014 TABLE 12 Binding activity Binding Antibody EC50 (nM) 24B9.1.uIgG4L No binding 12H11.1.uIgG4K 0.11 18.156.8 0.034 BMK.115 0.046

    [0299] 3. Blocking Assay by ELISA

    [0300] The activities of reference antibodies 12H11.1.uIgG4K and 24B9.1.uIgG4L to blocking the binding of PCSK9 to LDLR were evaluated by competitive ELISA (FIG. 30) according to the methods described in Section 2.4 Hybridoma screening of EXAMPLE 2. The IC50 values were summarized in Table 13. The antibody 24B9.1.uIgG4L showed no blocking activity. The antibody 12H11.1.uIgG4K showed similar IC50 to 18.156.8, but it cannot completely block the binding of PCSK9 and LDLR.

    TABLE-US-00015 TABLE 13 Blocking activity Blocking Antibody IC50 (nM) 24B9.1.uIgG4L No blocking 12H11.1.uIgG4K 1.0 18.156.8 0.97 BMK.115 1.8

    [0301] 4. Affinity by SPR

    [0302] The kinetic affinity of antibody 12H11.1.uIgG4K is much lower than 18.156.8, as tested using the same method described in Section 4.3.1 Binding kinetics by SPR of EXAMPLE 4. The results are shown in Table 14.

    TABLE-US-00016 TABLE 14 Kinetic affinity to human PCSK9 Kinetic affinity to human PCSK9 Antibody ka (1/Ms) kd (1/s) KD (M) 18.156.8 6.49E+05 4.47E05 6.88E11 12H11.1.uIgG4K 5.89E+05 1.34E03 2.27E09

    [0303] 5. LDL-Uptake Assay

    [0304] The antibodies 18.156.8 and 12H11.1.uIgG4K were evaluated in LDL-uptake assay in HepG2 cells (see Table 15 and FIG. 31), according to the method described in Section 4.2 LDL uptake assay of fully human antibodies of EXAMPLE 4. 12H11.1.uIgG4K showed slightly lower activity to restore cellular LDL-uptake in HepG2 cell.

    TABLE-US-00017 TABLE 15 LDL-uptake assay Antibody EC50 (nM) 12H11.1.uIgG4K 229.7 BMK.115 134.9 18.156.8 155.7

    [0305] While the disclosure has been particularly shown and described with reference to specific embodiments (some of which are preferred embodiments), it should be understood by those having skill in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present disclosure as disclosed herein.