METHODS OF ENHANCING CHROMOSOMAL HOMOLOGOUS RECOMBINATION
20190233846 ยท 2019-08-01
Assignee
Inventors
- Guoping Feng (Newton, MA, US)
- Jonathan Wilde (Cambridge, MA, US)
- Tomomi Aida (Arlington, MA, US)
- Martin Wienisch (Arlington, MA, US)
- Qiangge Zhang (Quincy, MA, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
A01K67/0275
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K35/54
HUMAN NECESSITIES
International classification
C12N15/90
CHEMISTRY; METALLURGY
C12N15/877
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K35/54
HUMAN NECESSITIES
A61K31/136
HUMAN NECESSITIES
Abstract
Described herein are methods of enhancing chromosomal homologous recombination to stimulate a loss of heterozygosity at a gene locus of interest in a living cell. These methods are driven by an enhancer component and a target-specific endonuclease component and proceed through a mechanism whereby: exogenous donor DNA that is homologous to the gene locus of interest is not introduced into the living cell; the desired allele of the gene locus of interest remains uncleaved; and the undesired allele is either uncleaved, cleaved at a single location, or cleaved at multiple locations. These methods have numerous applications, including the repair of risk alleles for disease prevention, the correction of heterozygous mutations in dividing cells, the design of cancer therapeutics, and the design of novel gene-drive strategies.
Claims
1. A method of stimulating a loss of heterozygosity at a gene locus of interest in a living cell comprising: identifying at least one gene locus of interest in a living cell, wherein each of the at least one gene locus of interest comprises a desired allele and an undesired allele; and introducing an enzymatic unit into the living cell, wherein the enzymatic unit enhances chromosomal homologous recombination between the desired allele and the undesired allele of each of the at least one gene locus of interest and wherein the enzymatic unit comprises at least one enhancer component and at least one target-specific endonuclease component.
2. The method of claim 1, wherein the enzymatic unit cleaves the undesired allele of each of the at least one gene locus of interest and wherein: a. each of the at least one enhancer component is selected from the group consisting of a Rad51, Rad51 G151D, Rad52, Rad54, BRCA1, BRCA2, PALB2, USP1, WDR48, BCCIP, BLM, C19ORF40, EME1, EME2, FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANC1, FANCL, MRE11A, MSH4, MSH5, and MUS81 component; b. the undesired allele of each of the at least one gene locus of interest is cleaved only once; c. the desired allele of each of the at least one gene locus of interest remains uncleaved; d. the chromosomal homologous recombination generates homozygosity at each of the at least one gene locus of interest, wherein each of the at least one gene of interest comprises two desired alleles after chromosomal homologous recombination; and e. exogenous donor DNA is not introduced into the living cell, wherein the exogenous donor DNA comprises at least one polynucleic sequence that is homologous to one or more of the at least one gene locus of interest.
3. The method of claim 2, wherein: a. the enzymatic unit cleaves the undesired allele of one or more of the at least one gene locus of interest through the introduction of a single-strand break; b. the enzymatic unit cleaves the undesired allele of one or more of the at least one gene locus of interest through the introduction of a double-strand break; or c. the enzymatic unit cleaves at least two undesired alleles, and wherein one or more of the at least two undesired alleles is cleaved through the introduction of a single-strand break and one or more of the at least two undesired alleles is cleaved through the introduction of a double-strand break.
4.-34. (canceled)
35. The method of claim 1, wherein the enzymatic unit lacks the ability to cleave DNA; and wherein: a. each of the at least one enhancer component is selected from the group consisting of a Rad51, Rad51 G151D, Rad52, Rad54, BRCA1, BRCA2, PALB2, USP1, WDR48, BCCIP, BLM, C19ORF40, EME1, EME2, FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANC1, FANCL, MRE11A, MSH4, MSH5, and MUS81 component; b. the chromosomal homologous recombination generates homozygosity at each of the at least one gene locus of interest, wherein each of the at least one gene of interest comprises two desired alleles after chromosomal homologous recombination; and c. exogenous donor DNA is not introduced into the living cell, wherein the exogenous donor DNA comprises at least one polynucleic sequence that is homologous to one or more of the at least one gene locus of interest.
36. The method of claim 35, wherein the at least one target-specific endonuclease component specifically binds to the undesired allele of one or more of the at least one gene locus of interest.
37. The method of claim 1, wherein; a. one or more of the at least one enhancer component comprises a polynucleic acid that encodes for a polypeptide sequence that comprises the polypeptide sequence of Rad51, Rad51 G151D, Rad52, Rad54, BRCA1, BRCA2, PALB2, USP1, WDR48, BCCIP, BLM, C19ORF40, EME1, EME2, FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANC1, FANCL, MRE11A, MSH4, MSH5, or MUS81; or b. one or more of the at least one enhancer component comprises a polypeptide that comprises the polypeptide sequence of Rad51, Rad51 G151D, Rad52, Rad54, BRCA1, BRCA2, PALB2, USP1, WDR48, BCCIP, BLM, C19ORF40, EME1, EME2, FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANC1, FANCL, MRE11A, MSH4, MSH5, or MUS81.
38. The method of claim 1, wherein one or more of the at least one enhancer component is a Rad51, Rad51 G151D, or BCCIP component.
39. The method of claim 38, wherein the Rad51, Rad51 G151D, or BCCIP component comprises: a. a polynucleic acid sequence that encodes for a polypeptide sequence that comprises the polypeptide sequence of Rad51, Rad51 G151D, or BCCIP, respectively; or b. a polypeptide sequence that comprises the polypeptide sequence of Rad51, Rad51 G151D, or BCCIP, respectively.
40. (canceled)
41. The method of claim 38, wherein the Rad51 component comprises a small molecule that enhances homologous directed repair; optionally wherein the small molecule is RS-1.
42. (canceled)
43. The method of claim 1, wherein one or more of the at least one target-specific endonuclease component comprises: a. a polynucleic acid that encodes for a polypeptide sequence that comprises the polypeptide sequence of a target-specific endonuclease; or b. a polypeptide that comprises the polypeptide sequence of a target-specific endonuclease.
44. (canceled)
45. The method of claim 43, wherein the target-specific endonuclease is a RNA-dependent endonuclease.
46. The method of claim 45, wherein; a. the RNA-dependent endonuclease is a CRISPR/Cas protein, optionally wherein the CRISPR/Cas protein is a mutated CRISPR/Cas protein, wherein the mutated CRISPR/Cas protein comprises a mutated nuclease domain and wherein the mutated CRISPR/Cas protein generates single-strand breaks; b. the enzymatic unit further comprises at least one crRNA, at least one tracrRNA, and/or at least one sgRNA; or c. a combination thereof.
47.-49. (canceled)
50. The method of claim 43, wherein the target-specific endonuclease is a RNA-independent endonuclease.
51. The method of claim 50, wherein the RNA-independent endonuclease is selected from the group consisting of a meganuclease, a zinc-finger nuclease, a transcription activator-like effector nuclease, and a restriction enzyme, optionally wherein the restriction enzyme is a site-specific DNA-nicking enzyme.
52. (canceled)
53. The method of claim 1, wherein the loss of heterozygosity is enhanced by at least 20% relative to the loss of heterozygosity in the absence of the at least one enhancer component.
54. (canceled)
55. The method of claim 1, wherein the enhancer component stimulates essentially error-free chromosomal homologous recombination.
56. (canceled)
57. The method of claim 1, wherein the living cell is; a. a cell of a multicellular organism, wherein the multicellular organism is administered a composition comprising: the at least one enhancer component; the at least one target-specific endonuclease component; and optionally a cellular delivery component; optionally wherein the multicellular organism is a human patient suffering from a disease, wherein the disease is caused by heterozygosity at one or more gene locus of interest; or b. a unicellular organism, optionally wherein the unicellular organism is a bacteria.
58.-64. (canceled)
65. The method of claim 1, wherein the living cell is a cell of a genetically engineered transgenic organism and wherein one or more of the at least one gene locus of interest comprises a transgenic gene locus, wherein the desired allele of the transgenic gene locus is a transgenic payload gene and the undesired allele of the transgenic gene locus is an endogenous sequence.
66. A therapeutic composition for use in a method of preventing or treating a medical condition caused by heterozygosity at an allele of a gene of interest, the composition comprising: at least one enhancer component; at least one target-specific endonuclease component; and optionally a cellular delivery component.
67. The therapeutic composition of claim 66, wherein the medical condition is: a. an autosomal dominant disorder; or b. caused by codominance or incomplete dominance.
68.-70. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. It is to be understood that the data illustrated in the drawings in no way limit the scope of the disclosure.
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
DETAILED DESCRIPTION
[0040] Recent advances in CRISPR/Cas-based genome editing, including three-component CRISPR (Aida T., et al., Genome Biol. 2015 Apr. 29; 16: 87), long single-strand donors (Quadros R. M., et al., Genome Biol. 2017 May 17; 18(1): 92), enhanced microhomology-mediated end-joining (MMEJ) (Aida T., et al., BMC Genomics. 2016 Nov. 28; 17(1): 979.4), and pharmacological approaches (Li G., et al., Sci. Rep. 2007 Aug. 21; 7(1): 8943; Maruyama T., et al., Nat. Biotechnol. 2015 May; 33(5): 538-42; Song J., et al., Nat. Commun. 2016 Jan. 28; 10548; Yu C., et al., Cell Stem Cell. 2015 Feb. 5; 16(2): 142-7) have greatly improved knock-in (KI) efficiency.
[0041] In a search for factors to further improve KI efficiency for broad therapeutic use and efficient generation of primate disease models, it is reported herein that the strand exchange protein RAD51 can significantly increase CRISPR/Cas9-mediated homology-dependent KI efficiency in mouse embryos. Surprisingly, it was found that in the presence of exogenous RAD51, most KI embryos are homozygous. More importantly, it was found that exogenous RAD51 greatly enhances interchromosomal homologous recombination/repair (ICHR) for both generating homozygous KI animals from wildtype zygotes with exogenous donors and for converting heterozygous alleles into homozygous alleles without exogenous templates. These results provide both conclusive evidence supporting the previous controversial finding of interchromosomal homologous recombination in human embryos (Ma H., et al. Nature. 2017 Aug. 24; 548(7668): 413-19; Egli D., et al., bioRxiv. 2017 Aug. 28; doi:10.1101/181255) and a new method to significantly improve ICHR efficiency.
[0042] Described herein are methods of enhancing ICHR to stimulate a loss of heterozygosity at a gene locus of interest in a living cell. These methods have broad implications for applications in basic sciences, disease modeling, and therapeutic gene editing. In some embodiments, the methods enhance interchromosomal homologous recombination, or recombination between two or more chromosomes. In other embodiments, the methods enhance intrachromosomal homologous recombination, or recombination within a single chromosome. For example, in some embodiments, the methods enhance intrachromosomal homologous recombination between gene homologs on the same chromosome.
[0043] As used herein, the term gene locus of interest refers to at least two homologous polynucleic acid sequences, or alleles or homologs, encoded on at least one chromosome of a cell. As used herein, the terms allele and homolog can be used interchangeably. As used herein, homologous polynucleic acid sequences refers to sequences that have at least 90% sequence identity over a sequence length of at least 30 base pairs. In some embodiments, the homologous polynucleic acid sequences have 90%, 95%, 96%, 97%, 98%, 99%, or 99.9% sequence identity over a sequence length of at least 30, 40, 50, 100, 500, 1000, 10,000, or greater than 10,000 base pairs.
[0044] In some embodiments, the gene locus of interest comprises two alleles on a single chromosome of a cell. For example, a desired allele and an undesired allele of a gene locus of interest may be on the same chromosome. In other embodiments, the gene locus of interest comprises two alleles on at least two pair chromosomes of a cell. For example, a desired allele and an undesired allele of a gene locus of interest may be on homologous chromosomes. In some embodiments, the cell is diploid (i.e., has two sets of chromosomes). In other embodiments, the cell is polyploid. For example, a cell may be tetraploid (i.e., has four sets of chromosomes) or hexaploid (i.e., has six sets of chromosomes).
[0045] A gene locus of interest may be homozygous (i.e., the polynucleic acid sequence of each allele of a gene of interest is identical) or heterozygous (i.e., the polynucleic acid sequence of the alleles of a gene of interest differ). Thus, a gene of interest that is heterozygous may comprise at least one desired allele (on at least one chromosome) and at least one undesired allele (on at least one chromosome). In some embodiments, the at least one desired allele and the at least one undesired allele are on the same chromosome. In some embodiments, the at least one desired allele and the at least one undesired allele are on different chromosomes.
[0046] In some embodiments, a desired allele and an undesired allele of a heterozygous gene of interest differ by only a single nucleotide. In other embodiments, a desired allele and an undesired allele of a heterozygous gene of interest differ by multiple nucleotides. As used herein, loss of heterozygosity refers to the conversion of a heterozygous gene of interest into a homozygous gene of interest. Methods of identifying genes of interest, comprising heterozygous alleles, in a living cell are known to those having skill in the art. For example, the genome of a parent or a sister cell can be sequenced or the transcriptome or proteome of the living cell can be sequenced.
[0047] In some embodiments, the homologous polynucleic acid sequence of a gene of interest comprises a gene coding segment of DNA. In other embodiments, the homologous polynucleic acid sequence comprises a noncoding segment of DNA. For example, in some embodiments, the homologous polynucleic acid sequence of a gene of interest comprises the sequence of a regulatory element, an intron, a noncoding functional RNA, a repeat sequence, or a telomere. In some embodiments, the regulatory element is selected from the group consisting of an operator, an enhancer, a silencer, a promoter, or an insulator. In some embodiments, a homologous polynucleic acid sequence comprises a gene coding and noncoding segment of DNA.
[0048] The length of each particular gene locus of interest can vary. For example, in some embodiments, a gene locus of interest is less than 1 kb in length. In other embodiments, a gene locus of interest is greater than 1 kb in length. For example, in some embodiments, a gene locus of interest is greater than 5 kb, 10 kb, 50 kb, 100 kb, or 1000 kb in length.
[0049] In some embodiments, the disclosure relates to methods of stimulating a loss of heterozygosity at a gene locus of interest in a living cell comprising: (a) identifying at least one gene locus of interest in a living cell, wherein each of the at least one gene locus of interest comprises a desired allele and an undesired allele, and (b) introducing an enzymatic unit into the living cell, wherein the enzymatic unit enhances chromosomal homologous recombination between the desired allele and the undesired allele of each of the at least one gene locus of interest and wherein the enzymatic unit comprises at least one enhancer component and at least one target-specific endonuclease component and wherein the chromosomal homologous recombination generates homozygosity at each of the at least one gene locus of interest, wherein each of the at least one gene of interest comprises only desired alleles after chromosomal homologous recombination.
[0050] In some embodiments, exogenous donor DNA is not introduced into the living cell, wherein the exogenous donor DNA comprises at least one polynucleic sequence that is homologous to at least one of the at least one gene locus of interest. In other embodiments, exogenous donor DNA is introduced into the living cell.
[0051] The enhancer component of the enzymatic unit, in some embodiments, is selected from the group consisting of a Rad51, Rad51 G151D, Rad52, Rad54, BRCA1, BRCA2, PALB2, XRCC1, XRCC4, USP1, WDR48, DMC1, BCCIP, BLM, C19ORF40, EME1, EME2, FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANC1, FANCL, MRE11A, MSH4, MSH5, and MUS81 component. In some embodiments, at least one of the at least one enhancer component comprises a polynucleic acid that encodes for a polypeptide sequence that comprises the polypeptide sequence of Rad51 (e.g., NCBI Reference Sequences NM_001164269.1, NM_001164270.1, NM_002875.4, NM_133487.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), Rad51 G151D (e.g., sequence in Table 2 below; Chen et al. Nucleic Acids Res. 2015 Jan. 30; 43(2): 1098-1111, Rad52 (e.g., NCBI Reference Sequences NM_001297419.1, NM_001297420.1, NM_001297421.1, NM_001297422.1, NM_134424.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), Rad54 (e.g., NCBI Reference Sequences NM_000489.4, NM_138270.2, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), BRCA1 (e.g., NCBI Reference Sequences NM_007294.3, NM_007297.3, NM_007298.3, NM_007299.3, NM_007300.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), BRCA2 (e.g., NCBI Reference Sequences NM_000059.3 and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), PALB2 (e.g., NCBI Reference Sequence NM_024675.3 and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), XRCC1 (e.g., NCBI Reference Sequence NM_006297.2 and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), XRCC4 (e.g., NCBI Reference Sequences NM_001318012.1, NM_001318013.1, NM_003401.4, NM_022406.3, NM_022550.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), USP1 (e.g., NCBI Reference Sequences NM_001017415.1, NM_001017416.1, NM_003368.4, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), WDR48 (e.g., NCBI Reference Sequences NM_001303402.1, NM_001303403.1, NM_001346225.1, NM_001346226.1, NM_001346227.1, NM_001346228.1, NM_020839.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), DMC1 (e.g., NCBI Reference Sequences NM_001278208.1, NM_007068.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), BCCIP (e.g., NCBI Reference Sequences NM_016567.3, NM_078468.2, NM_078469.2, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), BLM (e.g., NCBI Reference Sequences NM_000057.3, NM_001287246.1, NM_001287247.1, NM_001287248.1, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), C19ORF40 (e.g., NCBI Reference Sequences NM_001300978.1, NM_152266.4, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), EME1 (e.g., NCBI Reference Sequences NM_001166131.1, NM_152463.2, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), EME2 (e.g., NCBI Reference Sequences NM_001257370.1, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), FANCA (e.g., NCBI Reference Sequences NM_000135.3, NM_001018112.2, NM_001286167.2, NM_001351830.1, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), FANCB (e.g., NCBI Reference Sequences NM_001018113.2, NM_001324162.2, NM_152633.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), FANCC (e.g., NCBI Reference Sequences NM_000136.2, NM_001243743.1, NM_001243744.1, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), FANCD2 (e.g., NCBI Reference Sequences NM_001018115.2, NM_001319984.1, NM_033084.4, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), FANCE (e.g., NCBI Reference Sequences NM_021922.2, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), FANCF (e.g., NCBI Reference Sequences NM_022725.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), FANCG (e.g., NCBI Reference Sequences NM_004629.1, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), FANCI (e.g., NCBI Reference Sequences NM_001113378.1, NM_018193.2, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), FANCL (e.g., NCBI Reference Sequences NM_001114636.1, NM_018062.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), MRE11A (e.g., NCBI Reference Sequences NM_001330347.1, NM_005590.3, NM_005591.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), MSH4 (e.g., NCBI Reference Sequences NM_002440.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), MSH5 (e.g., NCBI Reference Sequences NM_002441.4, NM_025259.5, NM_172165.3, NM_172166.3, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof), or MUS81 (e.g., NCBI Reference Sequences NM_001350283.1, NM_025128.4, and polynucleic acid sequences encoding for polypeptide sequences that comprise functional variants, thereof).
[0052] In some embodiments, at least one of the at least one enhancer component comprises a polypeptide that comprises the polypeptide sequence of Rad51 (e.g., NCBI Reference Sequences NP_001157741.1, NP_001157742.1, NP_002866.2, NP_597994.3, and functional variants, thereof), Rad51 G151D (e.g., Chen et al. Nucleic Acids Res. 2015 Jan. 30; 43(2): 1098-1111, Rad52 (e.g., NCBI Reference Sequences NP_001284348.1, NP_001284349.1, NP_001284350.1, NP_001284351.1, NP_602296.2, and functional variants, thereof), Rad54 (e.g., NCBI Reference Sequences NP_000480.3, NP_612114.2, and functional variants, thereof), BRCA1 (e.g., NCBI Reference Sequences NP_009225.1, NP_009228.2, NP_009229.2, NP_009230.2, NP_009231.2, v), BRCA2 (e.g., NCBI Reference Sequence NP_000050.2, and functional variants, thereof), PALB2 (e.g., NCBI Reference Sequence NP_078951.2, and functional variants, thereof), XRCC1 (e.g., NCBI Reference Sequences NP_006288.2, and functional variants, thereof), XRCC4 (e.g., NCBI Reference Sequences NP_001304941.1, NP_001304942.1, NP_003392.1, NP_071801.1, NP_072044.1, and functional variants, thereof), USP1 (e.g., NCBI Reference Sequences NP_001017415.1, NP_001017416.1, NP_003359.3, and functional variants, thereof), WDR48 (e.g., NCBI Reference Sequences NP_001290331.1, NP_001290332.1, NP_001333154.1, NP_001333155.1, NP_001333156.1, NP_001333157.1, NP_065890.1, and functional variants, thereof), DMC1 (e.g., NCBI Reference Sequences NP_001265137.1, NP_008999.2, and functional variants, thereof), BCCIP (e.g., NCBI Reference Sequences NP_057651.1, NP_510868.1, NP_510869.1, and functional variants, thereof), BLM (e.g., NCBI Reference Sequences NP_000048.1, NP_001274175.1, NP_001274176.1, NP_001274177.1, and functional variants, thereof), C19ORF40 (e.g., NCBI Reference Sequences NP_001287907.1, NP_689479.1, and functional variants, thereof), EME1 (e.g., NCBI Reference Sequences NP_001159603.1, NP_689676.2, and functional variants, thereof), EME2 (e.g., NCBI Reference Sequences NP_001244299.1, and functional variants, thereof), FANCA (e.g., NCBI Reference Sequences NP_000126.2, NP_001018122.1, NP_001273096.1, NP_001338759.1, and functional variants, thereof), FANCB (e.g., NCBI Reference Sequences NP_001018123.1, NP_001311091.1, NP_689846.1, and functional variants, thereof), FANCC (e.g., NCBI Reference Sequences NP_000127.2, NP_001230672.1, NP_001230673.1, and functional variants, thereof), FANCD2 (e.g., NCBI Reference Sequences NP_001018125.1, NP_001306913.1, NP_149075.2, and functional variants, thereof), FANCE (e.g., NCBI Reference Sequences NP_068741.1, and functional variants, thereof), FANCF (e.g., NCBI Reference Sequences NP_073562.1, and functional variants, thereof), FANCG (e.g., NCBI Reference Sequences NP_004620.1, and functional variants, thereof), FANCI (e.g., NCBI Reference Sequences NP_001106849.1, NP_060663.2, and functional variants, thereof), FANCL (e.g., NCBI Reference Sequences NP_001108108.1, NP_060532.2, and functional variants, thereof), MRE11A (e.g., NCBI Reference Sequences NP_001317276.1, NP_005581.2, NP_005582.1, and functional variants, thereof), MSH4 (e.g., NCBI Reference Sequences NP_002431.2, and functional variants, thereof), MSH5 (e.g., NCBI Reference Sequences NP_002432.1, NP_079535.4, NP_751897.1, NP_751898.1, and functional variants, thereof), or MUS81 (e.g., NCBI Reference Sequences NP_001337212.1, NP_079404.3, and functional variants, thereof).
[0053] Inhibition of 53BP1 increases the efficiency of homology-dependent repair (Canny M. D., et al., Nat. Biotechnol., 2018 January; 36(1): 95-102). As such, the enhancer component of the enzymatic unit, in some embodiments, is a 53BP1 component. In some embodiments, the 53BP1 component comprises a polynucleic acid that encodes for a polypeptide sequence that comprises the polypeptide sequence of a dominant negative form of 53BP1. In some embodiments, the 53BP1 component comprises a polypeptide sequence that comprises the polypeptide sequence of a dominant negative form of 53BP1. In some embodiments the dominant negative form of 53BP1 is the previously published i53 variant (Canny M. D., et al., Nat. Biotechnol., 2018 January; 36(1): 95-102). In some embodiments, the 53BP1 component comprises a small molecule inhibitor of 53BP1.
[0054] In some embodiments, at least one of the at least one enhancer component is a Rad51, Rad51 G151D, or BCCIP component. In some embodiments, the Rad51, Rad51 G151D, or BCCIP component comprises a polynucleic acid sequence that encodes for a polypeptide sequence that comprises the polypeptide sequence of Rad51, Rad51 G151D, or BCCIP, respectively. In some embodiments, the Rad51, Rad51 G151D, or BCCIP component comprises a polypeptide sequence that comprises the polypeptide sequence of Rad51, Rad51 G151D, or BCCIP, respectively. Of note, BCCIP and RAD51 G151D are capable of stimulating essentially error-free (and, at least in some contexts, error-free) ICHR. As used herein, error-free means that 100% of the potential cellular editing events occur during chromosomal homologous recombination/repair (i.e., there are no indels/errors, each cell is edited). The term essentially error-free means that at least 70% of the potential cellular editing events occur during chromosomal homologous recombination/repair (i.e., at least 70% of the events are indel/error free). As such, in some embodiments, chromosomal homologous recombination/repair is essentially error-free when at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or between 99% and 100% of the events are indel/error free.
[0055] In some embodiments, the Rad51 component comprises a small molecule that enhances homologous directed repair. In some embodiments, the small molecule that enhances homologous directed repair knocks down the expression of a repressor of Rad51 expression (e.g., an siRNA or chemical inhibitor). In some embodiments, the small molecule that enhances homologous directed repair enhances expression of Rad51 (e.g., doxorubicin). In some embodiments, the small molecule enhances the activity of Rad51. For example, in some embodiments, the small molecule is RS-1. Other examples of small molecules that stimulate the activity of Rad51 are known to those having skill in the art (e.g., US published patent application 2017/0014360, the entirety of which is incorporated, herein).
[0056] In some embodiments, the enzymatic unit is catalytically dead in that the introduction of the enzymatic unit does not result in DNA cleavage. In other embodiments, the enzymatic unit cleaves the undesired allele of each of the at least one gene locus of interest. As used herein, the term cleaves refers to a reaction that breaks the covalent sugar-phosphate linkage between nucleotides of a polynucleic acid sequence. In some embodiments, the enzymatic unit cleaves the undesired allele of at least one of the at least one gene locus of interest through the introduction of a single-strand break. In some embodiments, the enzymatic unit cleaves the undesired allele of at least one of the at least one gene locus of interest through the introduction of a double-strand break. In some embodiments comprising at least two genes of interest, at least one of the at least two undesired alleles is cleaved through the introduction of a single-strand break and at least one of the at least two undesired alleles is cleaved through the introduction of a double-strand break.
[0057] In some embodiments, the undesired allele of each of the at least one gene locus of interest is cleaved only once. In some embodiments, the undesired allele of the only gene of interest is cleaved only once. In other embodiments, at least two genes of interest are identified in the living cell and the undesired allele of at least one gene locus of interest is cleaved only once and the undesired allele of at least one gene of interest is cut more than once. In other embodiments, the undesired allele of each of the at least one gene of interest is cleaved more than once. In some embodiments, the undesired allele of the only gene of interest is cleaved more than once. Introduction of multiple cuts in an undesired allele may be particularly desirable for the enhancement of chromosomal recombination long genes of interest.
[0058] In some embodiments, the desired allele of each of the at least one gene locus of interest remains uncleaved. In some embodiments, the desired allele of the only gene of interest remains uncleaved. In other embodiments, at least two genes of interests are identified in the living cell and the desired allele of at least one gene locus of interest remains uncleaved and the desired allele of at least one gene of interest is cleaved at least once. For example, in some embodiments the genome of the living cell comprises two genes of interest, with the desired allele of one gene of interest remaining uncleaved and the desired allele of the other gene of interest being cleaved at least once. In other embodiments, the desired allele of each of the at least one gene of interest is cleaved at least once. In other embodiments, the desired allele of each of the at least one gene of interest is cleaved more than once. In some embodiments, the desired allele of the only gene of interest is cleaved more than once.
[0059] The target-specific endonuclease component of the enzymatic unit provides for target specificity. In some embodiments, at least one of the at least one target-specific endonuclease component comprises a polynucleic acid that encodes for a polypeptide sequence that comprises the polypeptide sequence of a target-specific endonuclease. In some embodiments, at least one of the at least one target-specific endonuclease component comprises a polypeptide that comprises the polypeptide sequence of a target-specific endonuclease.
[0060] In some embodiments, the polypeptide sequence of the target-specific endonuclease comprises the polypeptide sequence of an RNA-dependent endonuclease. As used herein the term RNA-dependent endonuclease refers to an endonuclease that utilizes an RNA molecule for targeting and/or binding of a specific DNA sequence. In some embodiments, the RNA-dependent endonuclease cleaves both strands of a double-stranded DNA molecule. In other embodiments, the RNA-dependent endonuclease cleaves only one strand of a double-stranded DNA molecule (e.g., a nickase). In some embodiments, the RNA-dependent endonuclease is a CRISPR/Cas protein.
[0061] As used herein, the term CRISPR/Cas protein refers to an RNA-guided DNA endonuclease, including, but not limited to, Cas9, Cpf1, C2c1, and C2c3 and each of their orthologs and functional variants. CRISPR/Cas protein orthologs have been identified in many species and are known or recognizable to those of ordinary skill in the art. For example, Cas9 orthologs have been described in various species, including, but not limited to Bacteroides coprophilus (e.g., NCBI Reference Sequence: WP_008144470.1), Campylobacter jejuni susp. jejuni (e.g., GenBank: AJP35933.1), Campylobacter lari (e.g., GenBank: AJD02827.1), Fancisella novicida (e.g., UniProtKB/Swiss-Prot: A0Q5Y3.1), Filifactor alocis (e.g., NCBI Reference Sequence: WP_083799662.1), Flavobacterium columnare (e.g., GenBank: AMA50561.1), Fluviicola taffensis (e.g., NCBI Reference Sequence: WP_013687888.1), Gluconacetobacter diazotrophicus (e.g., NCBI Reference Sequence: WP_041249387.1), Lactobacillus farciminis (e.g., NCBI Reference Sequence: WP_010018949.1), Lactobacillus johnsonii (e.g., GenBank: KXN76786.1), Legionella pneumophila (e.g., NCBI Reference Sequence: WP_062726656.1), Mycoplasma gallisepticum (e.g., NCBI Reference Sequence: WP_011883478.1), Mycoplasma mobile (e.g., NCBI Reference Sequence: WP_041362727.1), Neisseria cinerea (e.g., NCBI Reference Sequence: WP_003676410.1), Neisseria meningitidis (e.g., GenBank: ODP42304.1), Nitratifractor salsuginis (e.g., NCBI Reference Sequence: WP_083799866.1), Parvibaculum lavamentivorans (e.g., NCBI Reference Sequence: WP_011995013.1), Pasteurella multocida (e.g., GenBank: KUM14477.1), Sphaerochaeta globusa (e.g., NCBI Reference Sequence: WP_013607849.1), Staphylococcus aureus (e.g., GenBank: HE980450.1), Streptococcus pasteurianus (e.g., Gene ID: 901176), Streptococcus pyogenes (e.g., NCBI Reference Sequence: WP_061100419.1), Streptococcus thermophilus (e.g., GenBank: ANJ62426.1), Sutterella wadsworthensis (e.g., NCBI Reference Sequence: WP_005430658.1), and Treponema denticola (e.g., NCBI Reference Sequence: WP_002684945.1). In some embodiments, the CRISPR/Cas protein is Cas9.
[0062] In some embodiments, the CRISPR/Cas protein is a mutated CRISPR/Cas protein, wherein the mutated CRISPR/Cas protein comprises a mutated nuclease domain and wherein the mutated CRISPR/Cas protein generates single-strand breaks. For example, nickase Streptococcus pyogenes Cas9 (i.e., SpCas9) mutants have been generated through incorporation of D10 and H480 mutations (Jinek et al., Science 337, 816-21 (2012); Ran et al., Cell 154, 1380-89 (2013)). In other embodiments, the CRISPR/Cas protein is a mutated CRISPR/Cas protein, wherein the mutated CRISPR/Cas protein comprises a mutated nuclease domain and wherein the mutated CRISPR/Cas protein is catalytically inactive. The term catalytically-inactive as used herein refers to a CRISPR/Cas protein variant or mutant that lacks endonuclease activity (i.e., the ability to cleave a polynucleic acid molecule). For example, catalytically-inactive SpCas9 mutants have been generated through incorporation of D10 and H481 mutations (Jinek et al., Science 337, 816-21 (2012)). Catalytically-inactive Acidaminococcus sp. BV3L6 Cpf1 (i.e., AsCpf1) and catalytically-inactive Lachnospiraceae bacterium ND2006 (i.e., LbCpf1) mutants have been generated through incorporation of D908 and D832 mutations, respectively (Zetsche et al., Cell 163, 759-71 (2015)).
[0063] In some embodiments, the enzymatic unit further comprises at least one crRNA, at least one tracrRNA (i.e., trans-activating crRNA), and/or at least one sgRNA. crRNAs and sgRNAs are polynucleic acid molecules that have sequences that complement the target site, which mediate the binding of the CRISPR/Cas complex to the target site, providing the specificity of the CRISPR/Cas complex. Typically, crRNAs and sgRNAs that exist as single RNA species comprise two domains: (1) a guide domain that shares homology to a target nucleic acid (e.g., directs binding of a CRISPR/Cas complex to a target site); and (2) a direct repeat domain that binds a CRISPR/Cas protein. In this way, the sequence and length of a small guide RNA may vary depending on the specific guide RNA target site and/or the specific CRISPR/Cas protein (Zetsche et al. Cell 163, 759-71 (2015)). The term CRISPR/Cas complex refers to a CRISPR/Cas protein that is bound to a crRNA or a sgRNA. A tracrRNA plays a role in the maturation of some crRNAs.
[0064] In some embodiments, the polypeptide sequence of the target-specific endonuclease comprises the polypeptide sequence of an RNA-independent endonuclease. As used herein, the term RNA-independent endonuclease refers to an endonuclease that does not utilize an RNA molecule for targeting and/or binding of a specific DNA sequence. In some embodiments, the RNA-independent endonuclease is selected from the group consisting of a meganuclease, a zinc-finger nuclease, a transcription activator-like effector nuclease, and a restriction enzyme, including functional variants thereof. In some embodiments, the RNA-independent endonuclease is a restriction enzyme, wherein the restriction enzyme is a site-specific DNA-nicking enzyme.
[0065] As used herein, the term functional variant includes polypeptides which are about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to a protein's native amino acid sequence (i.e., wild-type amino acid sequence) and which retain functionality.
[0066] The term functional variant also includes polypeptides which are shorter or longer than a protein's native amino acid sequence by about 5 amino acids, by about 10 amino acids, by about 15 amino acids, by about 20 amino acids, by about 30 amino acids, by about 40 amino acids, by about 50 amino acids, by about 75 amino acids, by about 100 amino acids or more and which retain functionality.
[0067] The term functional variant also includes orthologs found in other species.
[0068] The term functional variant also includes fusion/chimeric/hybrid proteins which retain functionality (e.g., fusion proteins that contain the binding domain of a CRISPR/Cas protein). The term fusion protein, chimeric protein, or hybrid protein refers to the combination of two or more polypeptides/peptides in a single polypeptide chain. Fusion/chimeric/hybrid proteins typically are produced genetically through the in-frame fusing of the nucleotide sequences encoding for each of the said polypeptides/peptides. Expression of the fused/chimeric/hybrid coding sequence results in the generation of a single protein without any translational terminator between each of the polypeptides/peptides. Alternatively, fusion/chimeric/hybrid proteins also can be produced by chemical synthesis. Examples of fusion/chimeric/hybrid proteins include, but are not limited to, a fusion between a target-specific endonuclease and a nuclease-domain (e.g., FokI or TEV) and/or a homing endonuclease.
[0069] In the context of an enhancer component, the term retain functionality refers to a protein that retains at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, or more, of the enhancement of chromosomal homologous recombination between the desired allele and the undesired allele of each of the at least one gene locus of interest as described herein. Methods of measuring and comparing levels of chromosomal homologous recombination are known to those skilled in the art and are disclosed herein. In the context of a Rad51 component, examples of known Rad51 functional variants include, but are not limited to Rad51 G151D, Rad51 G135C, Rad51 T131P, Rad51 P339S, Rad51 I345T, and Rad51 V328A (Marsden C. G., et al., PLoS Genet. 2016 Aug. 11; 12(8): e1006208; Malik P. S. and Symington L. S., Nucleic Acids Res. 2008 November; 36(20): 6504-10). Methods of generating additional Rad51 functional variants, such as directed evolution, are known to those having skill in the art.
[0070] In the context of a target-specific endonuclease component, the term retain functionality refers to the target-specific endonuclease variant's ability to specifically target DNA at least about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, or more than 100% as efficiently as the respective non-variant (i.e., wild-type) target-specific endonuclease. Methods of measuring and comparing the efficiency of DNA targeting are known to those skilled in the art.
[0071] Methods of introducing material into a living cell are known to those having skill in the art. Examples include, but are not limited to, transduction, transfection (e.g., DEAE dextran-mediated transfection, CaPO4-mediated transfection, lipid-mediated DNA uptake, and PEI-mediated DNA uptake, laser transfection), transformation (e.g., calcium chloride, electroporation, and heat-shock), gene transfer, particle bombardment, and viral (or bacteriophage) infection.
[0072] In some embodiments, the enzymatic unit is packaged within a viral (or bacteriophage) delivery system that is cell-specific. In some embodiments, the viral delivery system comprises a single viral particle (i.e., the entire enzymatic unit is packaged within a single viral particle). In other embodiments, the viral delivery system comprises multiple viral particles. For examples, in some embodiments, the enhancer component and the target-specific endonuclease component of an enzymatic unit are contained in different viral particles. In some embodiments, the enhancer or target-specific endonuclease component are contained in more than one viral particle.
[0073] In some embodiments, the enzymatic unit is introduced into the cell in vitro. In other embodiments the enzymatic unit is introduced into the cell in vivo.
[0074] The term enhances chromosomal homologous recombination refers to an increase in the levels of chromosomal homologous recombination by at least 15%, 20%, 25%, 30%, 40%, 50%, 100%, 200%, 300% or more than 300% relative to the levels of chromosomal homologous recombination in the absence of the enzymatic unit. Methods of measuring and comparing levels of chromosomal homologous recombination are known to those skilled in the art. Various methods of doing so are provided herein (e.g., Materials and Methods and Example 3). In some embodiments, the loss of heterozygosity is enhanced by at least 15%, 20%, 25%, 30%, 40%, 50%, 100%, 200%, 300% or more than 300% relative to the loss of heterozygosity in the absence of the enhancer component. In some embodiments, the loss of heterozygosity is enhanced by at least 20% relative to the loss of heterozygosity in the absence of the at least one enhancer component. In some embodiments, the loss of heterozygosity is enhanced by at least 100% relative to the loss of heterozygosity in the absence of the at least one enhancer component.
[0075] In some embodiments, the living cell is a unicellular organism. In some embodiments, the unicellular organism is selected from the group consisting of a bacteria, archaea, protozoa, unicellular algae, and unicellular fungi. In some embodiments, the living cell is a cultured cell.
[0076] In some embodiments, the living cell is a cell of a multicellular organism, wherein the multicellular organism is administered a composition comprising: the at least one enhancer component; the at least one target-specific endonuclease component; and optionally a cellular delivery component. In some embodiments, the multicellular organism comprises multiple cell types.
[0077] As used herein the term cellular delivery component refers to any mechanism where by a cell of a multicellular organisms can be induced to uptake a composition. Examples of cellular delivery components include, but are not limited to, liposomes, micelles, nanoparticles, extracellular vesicles, cell membrane coated particles, and viruses (included bacteriophages).
[0078] In some embodiments, the multicellular organism is an animal. In some embodiments, the animal is a human patient suffering from a disease, wherein the disease is caused by heterozygosity at at least one gene locus of interest. In other embodiments, the multicellular organism is an insect. In other embodiments, the multicellular organism is a plant.
[0079] In some aspects, the disclosure relates to novel gene drive technologies (see Macias V. M. et al., Int. J. Environ. Res. Public Health, 14(9): ppi: E1006 (2017); Gene Drives on the Horizon: Advancing Science, Navigating Uncertainty, and Aligning Research with Public Values, National Academies Press (US), (2016); Sinkins and Gould, Nat. Rev. Genet., 7(6): 427-35 (2006) for background on current gene drive technologies, the entire contents of which are incorporated here by reference. As such, in some embodiments, the living cell is a cell of a genetically engineered transgenic organism, wherein at least one of the at least one gene locus of interest comprises a transgenic gene locus, wherein the desired allele of the transgenic gene locus is a transgenic payload gene and the undesired allele of the transgenic gene locus is an endogenous sequence. Thus, introduction of an enzymatic unit into a living cell of the genetically engineered transgenic organism enhances chromosomal homologous recombination between the transgenic payload gene and the undesired allele, generating cells that are homozygous for the transgenic payload gene. In some embodiments, the transgenic payload gene does not include an enzymatic component or an enhancer component. In some embodiments, the transgenic payload gene comprises at least one enhancer component. In some embodiments, the transgenic payload gene comprises at least one enzymatic unit. In some embodiments, the transgenic payload gene comprises at least one enhancer component and at least one enzymatic unit.
[0080] In other aspects, the disclosure relates to a therapeutic composition for use in a method of treating a medical condition caused by heterozygosity at an allele of a gene of interest. In other aspects, the disclosure relates to a therapeutic composition for use in a method of preventing a medical condition caused by a homozygosity at an allele of a gene of interest. For example, one potentially immediate application is the treatment and prevention of HIV infection. The CC chemokine receptor type 5 (CCR5) is a co-receptor for HIV infection of white blood cells. 1% Europeans has a homozygous loss-of-function mutation of the gene (CCR5-delta32 mutation), and they are healthy and resistant to HIV infection. See Example 9.
[0081] The cause of the medical conditions that can be treated or prevented by the methods disclosed herein vary. For example, in some embodiments, the medical condition is monogenetic or Mendelian (i.e., caused by a single mutation). In other embodiments, the medical condition is polygenetic or a common complex diseases (i.e., caused by multiple mutations). With regard to polygenetic or common complex diseases, in some embodiments, the therapeutic composition can be used for the treatment of risk alleles or SNPs associated with the medical condition. Many risk alleles are often detected by genome-wide association studies. Risk alleles associated with various medical conditions are known to those having skill in the art.
[0082] The medical condition may be an autosomal dominant disorder. Examples of autosomal dominant disorders include, but are not limited to, Tuberous sclerosis, Marfan syndrome, Huntington's disease, Waardenburg syndrome, myotonic dystrophy, familial hypercholesterolemia, adult polycystic kidney disease, Von Hippel Lindau syndrome, Peutz-Jeghers syndrome, hereditary spherocytosis, Ehlor's Danlos, acute intermittent porphyria, hypertrophic obstructive cardiomyopathy, Von Willebrand Disease, polydactyly, and osteogenesis imperfecta.
[0083] The medical condition may be a disease caused by codominance or incomplete dominance, such as sickle cell anemia.
[0084] The medical condition may be an autosomal recessive disease. For example, a patient may be at risk of developing an autosomal recessive disease due to heterozygosity of allele at a particular gene of interest. Alternatively, a patient may be at risk of passing on a heterozygous allele to a biological offspring. Examples of autosomal recessive disease are known to those having skill in the art.
[0085] The therapeutic compositions described herein comprise an enzymatic unit, wherein the enzymatic unit enhances chromosomal homologous recombination between the desired allele and the undesired allele of each of the at least one gene locus of interest and wherein the enzymatic unit comprises at least one enhancer component and at least one target-specific endonuclease component and wherein the chromosomal homologous recombination generates homozygosity at each of the at least one gene locus of interest, wherein each of the at least one gene of interest comprises only desired alleles after chromosomal homologous recombination, as described above.
[0086] The therapeutic compositions can include a pharmaceutically-acceptable carrier. Generally, for pharmaceutical use, the therapeutic may be formulated as a pharmaceutical preparation or composition comprising at least one enzymatic unit and at least one pharmaceutically acceptable carrier, diluent or excipient, and optionally one or more further pharmaceutically active compounds. Such a formulation may be in a form suitable for oral administration, for parenteral administration (such as by intravenous, intramuscular or subcutaneous injection or intravenous infusion), for topical administration, for administration by inhalation, by a skin patch, by an implant, by a suppository, etc. Such administration forms may be solid, semi-solid or liquid, depending on the manner and route of administration. For example, formulations for oral administration may be provided with an enteric coating that will allow the formulation to resist the gastric environment and pass into the intestines. More generally, formulations for oral administration may be suitably formulated for delivery into any desired part of the gastrointestinal tract. In addition, suitable suppositories may be used for delivery into the gastrointestinal tract. Various pharmaceutically acceptable carriers, diluents and excipients useful in therapeutic compositions are known to the skilled person.
[0087] In other aspects, the disclosure relates to the use of an enzymatic unit, as described herein, in the manufacture of a medicament for the treatment of a medical condition caused by a heterozygosity at an allele of a gene of interest. In yet other aspects, the disclosure relates to the use of an enzymatic unit, as described herein, in the manufacture of a medicament for the prevention of a medical condition caused by a homozygosity at an allele of a gene of interest.
[0088] In other aspects, the disclosure relates to a method of generating homozygous animal models comprising administering the animal a composition comprising an enzymatic unit, as described herein, and a single or double-stranded DNA donor, wherein the single or double-stranded donor DNA comprises terminal regions of homology to the target integration site. Examples of this methodology are provided in Example 1 and Example 2. This methodology facilitates the single-step generation of homozygous animal models. For example, ongoing efforts to generate primate models of human diseases have been hindered by low efficiency, long generation times, and high costs associated with obtaining homozygotes. However, this method has the potential to generate F.sub.0 homozygotes with high efficiency, significantly decreasing costs and study length.
EXAMPLES
Methods and Materials
Animal Care and Use:
[0089] All mouse work was performed with the supervision of the Massachusetts Institute for Technology Division of Comparative Medicine (DCM) under protocol 0416-024-19, which was approved by the Committee for Animal Care (CAC). All procedures were in accordance with the guidelines set forth by the Guide for Care and Use of Laboratory Animals, National Research Council, 1996 (institutional animal assurance no. A-3125-01). All embryos injected for the experiments described herein were on a C57BL/6NTac background (Taconic; referred to as C57BL/6N herein).
Preparation of Injection Mixtures:
[0090] tracrRNA, crRNAs, and ssODNs were synthesized by Integrated DNA Technologies (TABLE 1). All injection mixtures were prepared in a final volume of 50 L according to the following methodology: Using RNase-free water, reagents, and consumables, crRNA (final concentration 0.61 M), tracrRNA (final concentration 0.61 M), and ultrapure Tris-HCl, pH 7.39 (final concentration 10 mM, ThermoFisher) were mixed and incubated at 95 C. for 5 minutes. The mixtures were cooled to room temperature for 10 minutes on the benchtop, and then, EnGen Cas9-NLS S. pyogenes (New England Biolabs) was added to a final concentration of 30 ng/L. The mixtures were incubated at 37 C. for 15 minutes before adding any remaining components: ssODN (final concentration 3 ng/L or 30 ng/L), RAD51 (Creative Biomart, final concentration 10 ng/L). Injection mixtures were stored on ice and briefly heated to 37 C. prior to injection. For experiments utilizing RS-1, embryos were cultured in KSOM-AA (EMD Millipore MR-121-D) with 7.504 RS-1 (Sigma) dissolved in DMSO or DMSO (Sigma, 1:1000) for 24 hours, washed, and cultured in EmbryoMax FHM HEPES Buffered Medium (Sigma) until collection for genotyping.
TABLE-US-00001 TABLE1 SequencesofInjectionComponents.Guide sequencesareunderlined. SEQ ID Component Sequence NO: tracrRNA AAACAGCAUAGCAAGUUAAAAUAAGGCUAGU 1 CCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCU Chd2.sup.R1684H GCGGUAGCUCCCAGAACGGUGUUUUAGAGCU 2 crRNA AUGCUGUUUUG Chd2.sup.R1684H TCAGTATGAGCAGCATTGGTATAAGGACCAC 3 ssODN CACTATGGTGACCGGAGGCATATGGATGCTC ACCATTCTGGGAGCTACCGCCCTAACAACAT GTCCAGAAAGAGGCCGTATGAGCAGTACAAC AG Chd2.sup.GT TCAGTATGAGCAGCATTGGTATAAGGACCAC 4 Variant CACTATGGTGACCGGAGGCATATGGATGCCA Donor CCTTTCTGGGAGCTACCGCCCTAACAACATG TCCAGAAAGAGGCCGTATGAGCAGTACAACA G Tyr.sup.C89S GAAGUUGCCUGAGCACUGGCGUUUUAGAGCU 5 crRNA AUGCUGUUUUG Tyr.sup.C89S GTTCCCCTTCAAAGGGGTGGATGACCGTGAG 6 ssODN TCCTGGCCCTCTGTGTTTTATAATAGGACAA GCCAGTGCTCAGGCAACTTCATGGGTTTCAA CTGCGGAAACTGTAAGTTTGGATTTGGGG
Recombinant Proteins:
[0091] For experiments using wildtype recombinant proteins, the following proteins were used: RAD51 (Creative Biomart RAD51-134H), USP1/WDR48 (Creative Biomart USP1&WDR48-1067H), BCCIP (Origene TP303061), XRCC1 (TP304952), XRCC4 (Origene TP312684), DMC1 (Origene TP318311). For experiments using mutant RAD51, custom RAD51 preparations were produced by Creative Biomart according to their standard protocol for producing the wildtype RAD51 used in all other experiments. Mutant DNA sequences used for cloning are described in TABLE 2. All RAD51 mutants were modeled in human RAD51 transcript variant 4 (NCBI accession NM_001164269), as this is the transcript variant of the wildtype RAD51-134H protein used in all other experiments.
TABLE-US-00002 TABLE2 DNASequencesforProductionofRecombinant RAD51MutantProteins.Mutatednucleotides areboldandunderlined. RAD51 Mutant DNASequence T131P atggcaatgcagatgcagcttgaagcaaatgcagatactt (SEQ cagtggaagaagaaagctttggcccacaacccatttcacg ID gttagagcagtgtggcataaatgccaacgatgtgaagaaa NO: ttggaagaagctggattccatactgtggaggctgttgcct 7) atgcgccaaagaaggagctaataaatattaagggaattag tgaagccaaagctgataaaattctgacggagtctcgctct gttgccaggctggagtgcaatagcgtgatcttggtctact gcaccctccgcctctcaggttcaagtgattctcctgcctc agcctcccgagtagttgggactacaggtggaattgagact ggatctatcacagaaatgtttggagaattccgacctggga agacccagatctgtcatacgctagctgtcacctgccagct tcccattgaccggggtggaggtgaaggaaaggccatgtac attgacactgagggtacctttaggccagaacggctgctgg cagtggctgagaggtatggtctctctggcagtgatgtcct ggataatgtagcatatgctcgagcgttcaacacagaccac cagacccagctcctttatcaagcatcagccatgatggtag aatctaggtatgcactgcttattgtagacagtgccaccgc cctttacagaacagactactcgggtcgaggtgagctttca gccaggcagatgcacttggccaggtttctgcggatgcttc tgcgactcgctgatgagtttggtgtagcagtggtaatcac taatcaggtggtagctcaagtggatggagcagcgatgttt gctgctgatcccaaaaaacctattggaggaaatatcatcg cccatgcatcaacaaccagattgtatctgaggaaaggaag aggggaaaccagaatctgcaaaatctacgactctccctgt cttcctgaagctgaagctatgttcgccattaatgcagatg gagtgggagatgccaaagactga G151D atggcaatgcagatgcagcttgaagcaaatgcagatactt (SEQ cagtggaagaagaaagctttggcccacaacccatttcacg ID gttagagcagtgtggcataaatgccaacgatgtgaagaaa NO: ttggaagaagctggattccatactgtggaggctgttgcct 8) atgcgccaaagaaggagctaataaatattaagggaattag tgaagccaaagctgataaaattctgacggagtctcgctct gttgccaggctggagtgcaatagcgtgatcttggtctact gcaccctccgcctctcaggttcaagtgattctcctgcctc agcctcccgagtagttgggactacaggtggaattgagact ggatctatcacagaaatgtttggagaattccgaactggga agacccagatctgtcatacgctagctgtcacctgccagct tcccattgaccgggatggaggtgaaggaaaggccatgtac attgacactgagggtacctttaggccagaacggctgctgg cagtggctgagaggtatggtctctctggcagtgatgtcct ggataatgtagcatatgctcgagcgttcaacacagaccac cagacccagctcctttatcaagcatcagccatgatggtag aatctaggtatgcactgcttattgtagacagtgccaccgc cctttacagaacagactactcgggtcgaggtgagctttca gccaggcagatgcacttggccaggtttctgcggatgcttc tgcgactcgctgatgagtttggtgtagcagtggtaatcac taatcaggtggtagctcaagtggatggagcagcgatgttt gctgctgatcccaaaaaacctattggaggaaatatcatcg cccatgcatcaacaaccagattgtatctgaggaaaggaag aggggaaaccagaatctgcaaaatctacgactctccctgt cttcctgaagctgaagctatgttcgccattaatgcagatg gagtgggagatgccaaagactga SA208- atggcaatgcagatgcagcttgaagcaaatgcagatactt 209ED cagtggaagaagaaagctttggcccacaacccatttcacg (SEQ gttagagcagtgtggcataaatgccaacgatgtgaagaaa ID ttggaagaagctggattccatactgtggaggctgttgcct NO: atgcgccaaagaaggagctaataaatattaagggaattag 9) tgaagccaaagctgataaaattctgacggagtctcgctct gttgccaggctggagtgcaatagcgtgatcttggtctact gcaccctccgcctctcaggttcaagtgattctcctgcctc agcctcccgagtagttgggactacaggtggaattgagact ggatctatcacagaaatgtttggagaattccgaactggga agacccagatctgtcatacgctagctgtcacctgccagct tcccattgaccggggtggaggtgaaggaaaggccatgtac attgacactgagggtacctttaggccagaacggctgctgg cagtggctgagaggtatggtctctctggcagtgatgtcct ggataatgtagcatatgctcgagcgttcaacacagaccac cagacccagctcctttatcaagcagaagacatgatggtag aatctaggtatgcactgcttattgtagacagtgccaccgc cctttacagaacagactactcgggtcgaggtgagctttca gccaggcagatgcacttggccaggtttctgcggatgcttc tgcgactcgctgatgagtttggtgtagcagtggtaatcac taatcaggtggtagctcaagtggatggagcagcgatgttt gctgctgatcccaaaaaacctattggaggaaatatcatcg cccatgcatcaacaaccagattgtatctgaggaaaggaag aggggaaaccagaatctgcaaaatctacgactctccctgt cttcctgaagctgaagctatgttcgccattaatgcagatg gagtgggagatgccaaagactga
Production of RAD51 mRNA:
[0092] Human RAD51 mRNA was prepared as described previously (Aida et al., BMC Genomics 17:979, 2016). pCMV-hRAD51 cDNA plasmid (a gift from Tetsushi Sakuma and Takashi Yamamoto, Hiroshima University) was linearized with SmaI (NEB) at 37 C. overnight, purified using DNA Clean & Concentrator kit (Zymo Research), eluted with nuclease-free water (Thermo Fisher Scientific), and used for T7-based in vitro transcription. RAD51 mRNA was in vitro transcribed using T7 mScript Standard mRNA Production System (Cellscript), purified using MEGAclear Kit (Thermo Fisher Scientific) according to manufacturer's instructions, and eluted with nuclease-free water. The quality of RAD51 mRNA was analyzed by NanoDrop (Thermo Fisher Scientific) and Bioanalyzer (Agilent Technologies).
Natural Mating for Zygotic Injections:
[0093] Female mice (4-5 weeks old, C57BL/6N) were superovulated by IP injection of PMS (5 IU/mouse, three days prior to microinjection) and hCG (5 IU/mouse, 47 hours after PMS injection) and then paired with males. Plugged females were sacrificed by cervical dislocation at day 0.5pcd and zygotes were collected into 0.1% hyaluronidase/FHM (Sigma). Zygotes were washed in drops of FHM and cumulus cells were removed. Zygotes were cultured in KSOM-AA for one hour and then used for microinjection.
In Vitro Fertilization for Zygotic Injections:
[0094] In vitro fertilization was performed using FERTIUP Mouse Preincubation Medium and CARD MEDIA (Kyudo Company) according to the manufacturer's protocol. Non-virgin Chd2.sup.R1684H/R1684H males that were >8 weeks old were used as sperm donors. Following IVF, embryos were cultured for 8 hours and then injected using the PNI protocol described below.
Zygotic Microinjections:
[0095] For all experiments except those described in
Embryo Collection and DNA Purification:
[0096] Embryos were collected at morula-to-blastocyst stage in 4 L nuclease-free water. After collection, 4 L of 2 embryo digestion buffer was added to each sample (final concentrations: 125 g/mL proteinase K, 100 mM Tris-HCl pH 8.0, 100 mM KCl, 0.02% gelatin, 0.45% Tween-20, 60 g/mL yeast tRNA) and embryos were lysed for 1 hour at 56 C. Proteinase K was inactivated via incubation at 95 C. for 10 minutes and DNA was stored at 20 C. until use.
Tail DNA Purification:
[0097] Tail snips (0.5 cm length) were collected from animals, placed in 75 L alkaline lysis buffer (25 mM NaOH, 0.2 mM EDTA), and incubated at 95 C. for 30 minutes. Digestion was stopped via addition of 75 L neutralization buffer (40 mM Tris-HCl pH 5.0). Samples were stored at 4 C. until genotyping.
Chd2.SUP.R1684H .PCR:
[0098] Chd2.sup.R1684H genotyping was performed via a two-step, nested approach. Except for experiments described in
Tyr.SUP.C89S .PCR:
[0099] Initial PCR was performed using 2 L purified tail DNA. The longer amplification of the nested PCR reaction was performed using the Tyr-Long_F/R primer pair listed in TABLE 3. PCR was performed using Biolase DNA polymerase (Bioline) and a final concentration of 2% DMSO. Twenty cycles of PCR were run with 30 second annealing and extension steps and an annealing temperature of 66 C. Nested PCR was performed using 2 L of the initial 25 L PCR reaction and the Tyr-Short_F/R primer pair listed in TABLE 3. The same PCR conditions were used for the nested PCR as were used for the initial PCR.
TABLE-US-00003 TABLE3 SequencesofPCRprimersandexpectedproduct sizes.C2RH-Long/Short_F1/R1primerswereused forexperimentsperformedinFIGS.1A-1E,FIGS. 2A-2E,FIGS.3A-3G,FIG.5,FIGS.7A-7C,FIG.8, andFIG.9.Inanattempttofurtherruleout largedeletionsasasourceofapparenthetero- zygosity,anewgenotypingstrategywasdesigned withaninitial~1.3kbamplimerandusedprimer setsC2RH-Long/Short_F2/R2forallother experiments. Pro- SEQ SEQ duct Forward ID Reverse ID Size Primer Sequence NO: Primer Sequence NO: (bp) C2RH- ACTGACACAT 10 C2RH- TCTCCTTATAAC 19 429 Long_ GGGAGAAGCC Long_ AGGCCAACC F1 R1 C2RH- AGTGCCTCACC 11 C2RH- ACTGGCAGAGG 20 266 short_ TCTCACACC short_ GAAAGAAAG F1 R1 C2RH- TCACTGGGTCA 12 C2RH- GAAGCAGATGC 21 1279 Long_ CAAGCAAAG Long_ CCATCTCAG F2 R2 C2RH- ACTGACACAT 10 C2RH- GATCGAGGAGA 22 358 Short_ GGGAGAAGCC Short_ CTGGCAGAG F2 R2 Tyr- TCAATTTAGTT 13 Tyr- CAAGTACTCATC 23 992 Long_ ACCTCACTATG Long_ TGTGCAAATGTC F GGC R Tyr- TTTGGCCATAG 14 Tyr- GAGCCTGTGCCT 24 411 Short_ GTGCCTG Short_ CCTCTAAG F R Shank3- AGGAAAGCAA 15 Shank3- CTCTGAGGCTTG 25 584 Long_ GGTTGAGCTG Long_ CAGACGG F R Shank3- GAGCTCTACTC 16 Shank3- TCCCCCTTTCAC 26 316 Short_ CCTTAGGACTT Short_ TGGACACCC F R Gapdh- TACGGGTGCA 17 Gapdh- CGAAGGACACC 27 396 Long_ CGTAGCTCAG Long_ AGGCAGTC F R Gapdh- TCCCTAGACCC 18 Gapdh- CTCTGCTCCTCC 28 133 Short_ GTACAGTGC Short_ CTGTTCC F R
Sanger Sequencing:
[0100] For all sequencing reactions, 5 L of PCR product was mixed with 3 L dH.sub.2O and 2 L ExoSAP (exonuclease I+shrimp alkaline phosphatase). Products were incubated at 37 C. for 30 minutes to degrade primers and dephosphorylate dNTPs and enzymes were then heat inactivated at 80 C. for 15 minutes. 2.5 L dH.sub.2O and 2.5 L 10 M sequencing primer were then added to each mixture and samples were submitted to Genewiz for Sanger sequencing. Sequence analysis was performed using SnapGene. Sequencing primers used were: Chd2-Short_R1, Chd2-Short_F2, and Tyr-Short_F (TABLE 3).
Total Protein Staining and Western Blotting:
[0101] 1 g of each recombinant protein was mixed with 2 Laemmli Sample Buffer (Bio-Rad) and heated to 95 C. for 5 minutes. After brief centrifugation, samples were loaded into 4-15% Mini-PROTEAN TGX Pre-Cast gels (Bio-Rad) along with 5 L PrecisionPlus Protein Kaleidoscope Prestained Protein Standards (Bio-Rad) and run at 200V for 40 minutes in 1 Tris/Glycine/SDS running buffer. Protein was transferred to nitrocellulose at 100V for 1 hour at 4 C. and total protein was visualized using REVERT Total Protein Stain (LI-COR Biosciences) according to the manufacturer's protocol. For RAD51 Western blotting, REVERT Total Protein Stain was reversed according to the manufacturer's protocol, the membrane was blocked at room temperature for 1 hour in TBST containing 5% non-fat dry milk. Primary antibody (Rb anti-RAD51, Abcam ab63801, 1:500) was diluted in blocking buffer and applied to the membrane overnight at 4 C. Following washes with TBST, secondary antibody (IRDye 800CW Gt anti-rabbit IgG H+L, LI-COR 925-32211, 1:15,000) was diluted in blocking buffer and applied to the membrane for 1 hour at room temperature in the dark. The membrane was then washed and imaged. For all experiments, imaging was performed on an Odyssey CLx Imaging System with ImageStudio (LI-COR Biosciences).
In Vitro Cas9 Digestion Assays:
[0102] Wildtype or Chd2.sup.R1684H/R1684H genomic DNA was used as input for PCR using the conditions described above and the primers specified in
Genomic qPCR:
[0103] To determine copy number at specific genomic loci, a strategy utilizing multiplex nested qPCR was developed. First, multiplex amplification was performed of both the edited Chd2 region and a region of the Gapdh promoter, which is located on a different chromosome, in a short round of PCR (10 cycles). In the case of the Shank3B control experiment, attempts were made to match the input DNA concentration used for experiments utilizing DNA from cultured embryos. Based on an estimation of 6 pg DNA per cell and a PCR input of 30 cells, 180 pg Shank3B.sup.+/+ or Shank3B.sup.+/ genomic DNA was used per initial reaction using the Shank3-Long-F/R and Gapdh-Long_F/R primer pairs described in TABLE 3. The PCR products from the initial multiplex PCR was then used as input for nested qPCR using the Shank3-Short_F/R and Gapdh-Short_F/R primer pairs with Sso Advanced SYBR Green Supermix (Bio-Rad). qPCR was performed on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) and analyzed using CFX Maestro software (Bio-Rad). Shank3B signal was normalized to Gapdh signal to control for input and a second diploid locus. In a second control experiment to test qPCR sensitivity at the Chd2 locus, DNA from wildtype blastocysts was isolated and multiplex PCR was performed for Chd2 using the C2RH-Long_F1/R1 and Gapdh-Long_F/R primer pairs listed in TABLE 3. Genomic qPCR was then performed using the same input amount for Gapdh nested qPCR (Gapdh-Short_F/R primers), but either 1 or 0.5 input for the Chd2 nested qPCR (Chd2-Short_F1/R1 primers). Finally, the same strategy was used to perform nested genomic qPCR using genomic DNA isolated from 5 randomly-selected blastocysts that had genotyped positive for interhomolog repair with no evidence of mosaicism.
Blastomere Collection:
[0104] Zygotes were prepared by IVF as described above and cultured until 24hpf in FHM at 37 C. and 5% CO.sub.2. Two-cell embryos were transferred 10 at a time into room temperature acidified Tyrode's solution. Embryos were monitored by microscopy and were transferred back to FHM once the zona pellucida was dissolved. Individual blastomeres were collected via mechanical dissociation with a glass micropipette and transferred to 4 L nuclease-free water. Blastomeres were then lysed and processed for genotyping as previously described.
Immunocytochemistry:
[0105] Zygotes were fixed overnight at 4 C. in 4% PFA+0.1% Tween-20 in PBS and then briefly transferred to acidified Tyrode's (Sigma T1788) to remove the zona. After washing in PBS+0.1% Tween-20 (PBST), zygotes were permeabilized in PBS+1% Triton X-100 for 1 hour at 4 C. and then blocked for 1 hour at room temperature in blocking solution (PBS+3% BSA+5% normal goat serum). Primary antibody (rabbit anti-RAD51, Abcam ab63801, 1:500) was diluted in blocking solution and applied to coverslips overnight at 4 C. Cells were washed 3 times in PBST before application of secondary antibody (goat anti-rabbit IgG conjugate, Alexa Fluor 488, ThermoFisher A-11008) diluted in blocking solution for 1 hour at room temperature. Nuclei were counterstained with DAPI and coverslips were mounted to slides with Fluoromount Aqueous Mounting Medium (Sigma F4680). Cells were imaged on an Olympus Fluoview FV1000 confocal microscope with a 60 oil immersion objective and variable digital zoom. Raw image files were exported to FIJI.sup.41 for Z-projection (sum slices), channel splitting, and scale bar generation.
Statistical Analyses:
[0106] Statistical analyses were performed using Prism 6 (Graphpad). For chi-square analyses, one-tailed tests were used in analyses of whether a factor could specifically increase interhomolog repair. For all other experiments, two-tailed analyses were performed. Details on statistical tests performed for each experiment are provided in text and figure legends. All graphs display meanSEM.
Example 1: Efficient Homozygous Knock-in with RAD51
[0107] Experiments were performed to develop a methodology that would generate high-efficiency knock-in of an autism-associated point mutation in Chd2 (c.5051G>A; R1685H in human, R1684H in mouse; hereon referred to as Chd2.sup.R1684H;
[0108] Because, RS-1 can be highly dosage-sensitive (Song J., et al., Nat. Commun. 2016 Jan. 28; 10548), exogenous RAD51 protein was tested in combination with a three-component CRISPR (Aida T., et al., BMC Genomics. 2016 Nov. 28; 17(1): 979.; Aida T., et al., Genome Biol. 2015 Apr. 29; 16: 87; Quadros R. M., et al., Genome Biol. 2017 May 17; 18(1): 92; Ma X., et al., Sci. Rep. 2017 Feb. 8; 7: 42244). Both pronuclear (PNI) and cytoplasmic (CPI) injections of crRNA, tracrRNA, Cas9, single-strand oligo donor (ssODN; 30 ng/L for PNI and 100 ng/L for CPI), and RAD51 protein (10 ng/L) were performed in mouse zygotes. The resulting F.sub.0 pups were genotyped (example chromatograms in
[0109] Although all genotyping was performed using primers designed outside of the homology arms, it is possible that the homozygous animals reported by these genotyping experiments were actually compound heterozygoteswith large deletions emanating from the cut site on one allele (Shin H. Y., et al., Nat. Commun. 2017 May 31; 8: 15464). Therefore, six of the F.sub.0 homozygous KI mice were bred with wildtype C57BL/6N animals, and the resulting F.sub.1 progeny were genotyped. This revealed that 100% of F.sub.1 pups (n=36) were heterozygous mutants and confirmed the homozygosity of F.sub.0 animals (
TABLE-US-00004 TABLE 4 Confirmation of F0 homozygosity. Genotyping results for all F0 pups obtained from either cytoplasmic (CPI) or pronuclear (PNI) injections for Chd2R1684H knock-in experiments described in FIG. 1. Sex Injection Type Genotype Notes Female CPI RH/RH Female CPI RH/Indel Female CPI RH/RH Male CPI RH/RH Male CPI RH/RH Female CPI Indel/Indel Same Indel Female CPI RH/Indel Female CPI RH/RH Male CPI Indel/Indel Different Indels Female PNI RH/RH Male PNI RH/RH Male PNI RH/RH Female PNI Indel/Indel Different Indels Male PNI Indel/Indel Same Indel Male PNI RH/RH Male PNI Indel/Indel Same Indel Female PNI Indel/Indel Same Indel Female PNI RH/RH
Example 2: Exogenous RAD51 Enhances KI Efficiency at Multiple Loci
[0110] Additional experiments were performed to directly assess the ability of RAD51 to increase KI efficiency. Zygotic pronuclear injections were performed with and without RAD51, embryos were cultured for two days, and nested PCR (1.3 kb first-round PCR, 358 bp nested) was performed for genotyping. Sanger sequencing revealed that RAD51 only slightly increased overall KI efficiency (
[0111] Strikingly, RAD51 co-injection more than doubled the observed homozygous KI rate at both the Chd2 and Tyr loci (
Example 3: RAD51 Enhances Interchromosomal Homologous Recombination
[0112] Previous experiments in mouse ES cells found evidence of interchromosomal homologous recombination/repair (ICHR) events (Moynahan M. E. and Jasin M., Proc. Natl. Acad. Sci. U.S.A. 1997 Aug. 19; 94(17): 8988-93; Richardson C., et al., Genes Dev. 1998 Dec. 15; 12(24): 3831-42). While these ICHR events are well-understood in meiotic cells, their occurrence in zygotes and somatic cells is poorly described. However, several recent studies have described a potential zygotic ICHR mechanism whereby one allele can serve as the repair template for the other after induction of a double-strand break (DSB) by Cas9 (Ma H., et al. Nature. 2017 Aug. 24; 548(7668): 413-19; Wu Y., et al., Cell Stem Cell. 2013 Dec. 5; 13(6): 659-62).
[0113] To test whether RAD51 promotes homozygous KI through a similar mechanism, PNI was performed using an injection mixture containing an equimolar ratio of two separate ssODNs containing different point mutations at the same loci, facilitating the identification of independent knock-in events via the observation of compound heterozygosity (
[0114] To more directly test the ICHR mechanism, experiments were performed to generate homozygous Chd2.sup.R1684H embryos without the use of an exogenous donor through homozygous conversion. Using wildtype C57Bl/6N eggs and sperm from homozygous Chd2.sup.R1684H male mice, heterozygous zygotes were generated by IVF and specifically targeted Cas9 to the maternal Chd2 locus. As illustrated in
[0115] Although previous studies have shown that large indels occur at far too low of a frequency to account for the loss-of-heterozygosity observed in these experiments (Shin H. Y., et al., Nat. Commun. 2017 May 31; 8: 15464.), multiple experiments were performed to directly rule out the possibility of false positives resulting from monoallelic deletion of the maternal allele. First, a multiplex genomic qPCR assay was developed and performed to analyze copy number at the targeted locus (see Materials and Methods). Using genomic DNA from wildtype mice and Shank3B.sup.+/ mice harboring a heterozygous deletion of exon 13 of Shank3 (Peca J., et al., Nature. 2011 Apr. 28; 472(7344): 437-42), it was confirmed that this method was capable of identifying heterozygous deletions (
Example 4: Timing of ICHR
[0116] After fertilization, the maternal and paternal pronuclei remain until the completion of S-phase, at which time the pronuclei fuse in preparation for mitosis. This poses a significant problem for ICHR, which requires physical association of the maternal and paternal chromosomes and suggests that ICHR must occur after pronuclear fusion, either during G2 or M-phase. To begin to address the timing of zygotic ICHR, genotyping of individual blastomeres was performed in early 2-cell embryos generated through the IVF strategy and co-injected with RAD51. Blastomeres collected at 24hpf revealed mosaicism in 4/6 of embryos with an ICHR event in at least one cell (
TABLE-US-00005 TABLE 5 Chi-square analyses of immunocytochemistry data from FIG. 4B. p-Value vs. p-Value vs. p-Value vs. p-Value vs. Condition Positive Negative Tot. Uninjected RAD51-only Cas9-only Cas9 + Rad51 Uninjected 0 15 15 0.0677 0.002 <0.0001 RAD51-only 6 25 31 0.0677 0.016 0.0003 Cas9-only 17 22 39 0.002 0.016 0.0646 Cas9 + RAD51 22 14 36 <0.001 0.0003 0.0646
Example 5: Identification of Additional Proteins Capable of Promoting ICHR
[0117] In an effort to identify additional proteins capable of promoting zygotic ICHR, a series of injections in Cas9-injected Chd2.sup.+/R1684H zygotes was performed with the following HR- and DSB repair-associated proteins: USP1/WDR48 [promotes HR via Fanconi-Anemia (FA) pathway (Mural J., et al., Mol. Cell Biol. 2011 June; 31(12): 2462-69)], BCCIP (promotes BRCA2-mediated HR (Lu H., et al., Mol. Cell Biol. 2005 May; 25(5): 1949-57; Wray J., et al., Cancer Res. 2008 Apr. 15; 68(8): 2699-707; Kelso A. A., et al., Nucleic Acids Res. 2017 Jan. 25; 45(2): 711-25), participates in FA pathway (Moldovan G. L. and D'Andrea, A. D., Annu. Rev. Genet. 2009; 43: 223-49)), XRCC1 (promotes MMEJ and co-localizes with RAD51 (Taylor R. M., et al., Mol. Cell Biol. 2000 January; 20(2): 735-40; Dutta A., et al., Nucleic Acids Res. 2017 Mar. 17; 45(5): 2585-99)), XRCC4 (promotes NHEJ and regulator of V(D)J recombination (Critchlow S. E., et al., Curr. Biol. 1997 Aug. 1; 7(8): 588-98; Normanno D., et al., Elife. 2017 May 13; 6)), and DMC1 (meiotic HR regulator (Sehorn M. G., et al., Nature. 2004 May 27; 429(6990): 433-37)). XRCC1, XRCC4, and DMC1 were not capable of inducing ICHR at rates above baseline (
Example 6: Analyses of RAD51 Mutants
[0118] RAD51 mutations have been identified in multiple human cancers and Fanconi-Anemia, and several of these mutations have been studied in-depth. In an effort to better understand the role of RAD51 in ICHR, three different recombinant RAD51 mutant proteins were co-injected with Cas9 and Chd2.sup.R1684H crRNA into IVF-generated Chd2.sup.R1684H/+ embryos. The mutants were as follows: T131P [deficient in interstrand crosslink repair (ICL), but not homologous recombination (HR) (Critchlow S. E., et al., Curr. Biol. 1997 Aug. 1; 7(8): 588-98; Normanno D., et al., Elife. 2017 May 13; 6)], G151D (gain-of-function mutant with increased strand exchange activity (Marsden C. G., PLoS Genet. 2016 Aug. 11; 12(8): e1006208)), and SA208-209ED (disrupted BRCA2-association (Yu D. S., et al., Mol. Cell. 2003 October; 12(4): 1029-41)). T131P injection was not capable of increasing ICHR frequency compared to Cas9-only embryos (
Example 7: Discussion
[0119] This data demonstrates that RAD51, the BRCA2-interacting protein BCCIP, and the FA pathway-associated protein complex of USP1 and WDR48 are capable of significantly enhancing the rate of zygotic interhomolog repair. Furthermore, this enhancement can be utilized for both donor-free homozygous conversion and de novo homozygous KI using the targeted endonuclease Cas9. Importantly, these results provide the most comprehensive analysis of mammalian zygotic ICHR to-date. While previous work has described the induction of interhomolog repair in zygotes, comprehensive analysis of zygosity and dissection of the underlying mechanisms has been lacking (Egli D., et al., bioRxiv. 2017 Aug. 28; doi:10.1101/181255). This disclosure supports these findings and builds upon them through comprehensive analysis of copy number, identification of pathways involved in zygotic ICHR, visualization of the timing of putative ICHR events, and demonstration of methods for enhancing ICHR for gene editing applications.
[0120] Interestingly, this disclosure suggests that the FA pathway may be directly involved in zygotic ICHR. While the FA pathway plays many roles within the cell, its primary function is the repair of DNA interstrand crosslinks (ICLs) (Moldovan G. L. and D'Andrea, A. D., Annu. Rev. Genet. 2009; 43: 223-49). Therefore, the observation that the RAD51 T131P mutant is not capable of enhancing ICHR is intriguing, as this mutant has been shown to function normally in homologous recombination, but not ICL repair (Marsden C. G., et al., PLoS Genet. 2016 Aug. 11; 12(8): e1006208; Yu D. S., et al., Mol. Cell. 2003 October; 12(4): 1029-41). Therefore, these results indicate that ICHR-related proteins may overlap with those involved in ICL and suggest that additional FA pathway members could be capable of enhancing ICHR.
[0121] The mechanistic characterization of ICHR in zygotes suggests a model whereby Cas9-induced DSBs are repaired through the use of a homologous chromosome as a template during G2. At this time, the maternal and paternal genomes have already undergone replication and the pronuclei undergo fusion prior to the start of M-phase. This creates a significant hurdle for pure, non-mosaic ICHR, as the cell must now edit two alleles instead of one. This is highlighted by the high degree of mosaicism observed in embryos exhibiting ICHR (
[0122] Single-cell RNA-sequencing has shown that Rad51 mRNA is present in zygotes at relatively low levels (FPKM<50) (Deng Q., et al., Science. 2014 Jan. 10; 343(6167): 193-96). Nonetheless, the existence of endogenous RAD51 in zygotes begs the question of exactly how exogenous RAD51 enhances ICHR. It is possible that increased concentrations of RAD51 in the zygotic pronuclei increase the probability of RAD51 locating and binding to a DSB. Previous work has shown that accumulation of endogenous RAD51 can occur at zygotic DSBs in genetic models of genome instability. Here, RAD51 puncta in uninjected cells was not observed at any stage of the cell cycle. However, injection of RAD51 protein alone revealed a small number of cells with RAD51 puncta (
[0123] In addition to providing a valuable insight into the basic mechanisms of ICHR zygotes, this disclosure's demonstration of enhanced ICHR also has great potential value for therapeutic gene editing. The observation that BCCIP and RAD51 G151D are capable of stimulating essentially error-free (at least in some contexts, error-free) ICHR highlights their potential for the development of safe and effective gene therapies that do not require the use of exogenous DNA as a donor template. In addition to the capability of these proteins to stimulate what is near-100% efficient ICHR, the strikingly low rate of indels observed in cells co-injected with either protein highlights their potential use in safe therapeutic gene editing strategies. Recently developed base editing technologies show promise for the error-free repair of point mutations (Gaudelli N. M., et al., Nature. 2017 Nov. 23; 551(7681): 464-71; Komor A. C., et al., Nature. 2016 May 19; 533(7603): 420-24; 25; Nishida K., Science. 2016 Sep. 16; 353(6305); aaf8729-aaf8729), but similar technologies do not exist for repairing insertions and deletions. Although these studies focused on repairing a single point mutation, Chd2.sup.R1684H animals actually harbor two separate point mutations spaced 5 bp apart (
Example 8: Gene Drive Application
[0124] One major application of RAD51 in gene editing is the development of novel gene drive technologies. Current CRISPR-based gene drive strategies rely solely upon CRISPR/Cas9, but these strategies fail to show long-term propagation of the desired allele due to ablation of the guide RNA target site by Cas9-induced indels (
Example 9: Enhancing Inter-Homolog Recombination in Stem and Somatic Cells for AIDS Treatment and Gene Therapy
[0125] Recent advances in CRISPR/Cas-based genome editing technologies have provided unprecedented opportunity for preventing and curing human diseases. These technologies can be used to modify genes in particular cell types to lower disease or infection risks and to correct genetic mutations to cure monogenic disorders. Although the CRISPR/Cas system is efficient in disrupting genes through non-homologous end joining (NHEJ), precise repair of genetic mutations (knockin), especially with homozygosity, remains inefficient. Disclosed herein are novel approaches for the enhancement of ICHR. ICHR can convert heterozygous WT/mutant alleles into homozygous mutant alleles without the need for supplying an exogenous repair template and can also convert WT alleles into homozygous mutant alleles with (knockin) or without (knockout) exogenous templates. Thus, this work provides a highly efficient, potentially error-free ICHR method for use in disease prevention and treatment.
[0126] One potentially immediate application is for the treatment and prevention of HIV infection. The CC chemokine receptor type 5 (CCR5) is a co-receptor for HIV infection of white blood cells. 1% Europeans has a homozygous loss-of-function mutation of the gene (CCR5-delta32 mutation), and they are healthy and resistant to HIV infection. The ICHR method can be harnessed to generate hematopoietic stem cells that harbor the homozygous CCR5 mutation in HIV-infected patients. These stem cells can produce HIV-resistant white blood cells, and they can gradually take over the population since they will not be killed by HIV.
[0127] Another potential application is to correct genetic mutations in severe monogenic disorders. Most human monogenic disorders are heterozygous. Thus, using the ICHR system, one could effectively use the endogenous normal copy to repair the mutant copy. In addition to the high efficiency of repairing mutations, one significant advantage of ICHR is that in the event of off-target cutting by CRISPR/Cas, it will be effectively repaired from the other normal copy.
Example 10. Enhancement of ICHR in Human Cells
[0128] CC Chemokine Receptor Type 5 (CCR5) is the main co-receptor used by macrophage-tropic strains of HIV-1 and HIV-2, which are responsible for viral transmission. The CCR5 delta 32 mutation (a deletion of 32 base pairs) results in the generation of a premature and non-functional CCR5 receptor. Homozygous CCR5 delta 32 individuals are resistant to CCR5-tropic HIV infection, and heterozygous carriers exhibit slowed AIDS progression (Liu R. et al., Cell. 1996 Aug. 9; 86(3):367-77). Carriers of hetero- and homozygous delta 32 mutations are found in approximately 10% and 1% of the European population, respectfully. HEK293T cells have a heterozygous delta 32 deletion (Qi C. et al., PLoS One. 2016; 11(4): e0152975; Lin Y. C. et al., Nat. Commun. 2014 Sep. 3; 5:4767) (
[0129] Experiments were designed to assess whether ICHR can be stimulated in human cells (e.g., HEK293T cells) via the enhancement methodologies described herein (
[0130] These experiments demonstrate that ICHR can be stimulated in human cells via the enhancement methodologies described herein.
Example 11. ICHR Reporter Mice
[0131] ICHR reporter mice (Line-1: P2A-donor and Line-2: EGFP-donor) were designed that allow rapid ICHR visualization/identification in vivo in mice of all ages. Two novel mouse lines were generated from the pre-existing Rosa26.sup.(Cas9/+) transgenic mouse (Platt R. J. et al., Cell. 2014 Oct. 9; 159(2): 440-55). The Rosa26.sup.(Cas9/+) transgene consists of a 33 FLAG-tagged S. pyogenes Cas9 linked via a self-cleaving P2A peptide to an enhanced green fluorescent protein (EGFP). The transgene is driven by the ubiquitous CAG promoter and is interrupted by a loxP-stop (33 polyA signal)-loxP (LSL) cassette. For Line-1: P2A-donor, a premature stop codon was introduced at the 3 end of the nucleic acid sequence of EGFP (EGFP-I188X), and for Line-2: EGFP-donor, a premature stop codon was introduced in the nucleic acid sequence of P2A (
[0132] EGFP conversion (i.e., EGFP production) can be stimulated in Line-1/2 transgenic mice via two ICHR mechanisms. Conversion may result from an ICHR event that eliminates the premature stop codon at the 3 end of the nucleic acid sequence of EGFP (e.g., using guideRNA.sup.StopEGFP) (
[0133] These ICHR reporter mice facilitate visualization/identification of ICHR in vivo and can be utilized to evaluate: enhancers of ICHR; ICHR dynamics; and ICHR mosaicism. They can also be used for genome-wide CRISPR screening.
REFERENCES
[0134] 1. Aida T., Chiyo K., Usami T., Ishikubo H., Imahashi R., Wada Y., Tanaka K. F., Sakuma T., Yamamoto T., and Tanaka K., Cloning-free CRISPR/Cas system facilitates functional cassette knock-in in mice. Genome Biol. 2015 Apr. 29; 16: 87. [0135] 2. Aida T., Nakade S., Sakuma T., Izu Y., Oishi A., Mochida K., Ishikubo H., Usami T., Aizawa H., Yamamoto T., and Tanaka K., Gene cassette knock-in in mammalian cells and zygotes by enhanced MMEJ. BMC Genomics. 2016 Nov. 28; 17(1): 979. [0136] 3. Chen J., Morrical M. D., Donigan K. A., Weidhaas J. B., Sweasy J. B., Averill A. M., Tomczak J. A., and Morrical S. W., Tumor-associated mutations in a conserved structural motif alter physical and biochemical properties of human RAD51 recombinase. Nucleic Acids Res. 2015 January; 43(2): 1098-111. [0137] 4. Critchlow S. E., Bowater R. P., and Jackson S. P., Mammalian DNA double-strand break repair protein XRCC4 interacts with DNA ligase IV. Curr. Biol. 1997 Aug. 1; 7(8): 588-98. [0138] 5. Deng Q., Ramskold D., Reinius B., and Sandberg R., Single-cell RNA-seq reveals dynamic, random monoallelic gene expression in mammalian cells. Science. 2014 Jan. 10; 343(6167): 193-96. [0139] 6. Dutta A., Eckelmann B., Adhikari S., Ahmed K. M., Sengupta S., Pandey A., Hegde P. M., Tsai M. S., Tainer J. A., Weinfeld M., Hedge M. L., and Mitra S., Microhomology-mediated end joining is activated in irradiated human cells due to phosphorylation-dependent formation of the XRCC1 repair complex. Nucleic Acids Res. 2017 Mar. 17; 45(5): 2585-99. [0140] 7. Egli D., Zuccaro M., Kosicki M., Church G., and Bradley A., Inter-homologue repair in fertilized human eggs? bioRxiv. 2017 Aug. 28; doi:10.1101/181255. [0141] 8. Gaudelli N. M., Komor A. C., Rees H. A., Packer M. S., Badran A. H., Bryson D. I., and Liu D. R., Programmable base editing of A.Math.T to G.Math.C in genomic DNA without DNA cleavage. Nature. 2017 Nov. 23; 551(7681): 464-71. [0142] 9. Ghodsinejad Kalahroudi V., Kamalidehghan B., Arasteh Kani A., Aryani O., Tondar M., Ahmadipour F., Chung L. Y., and Houshmand M., Two novel tyrosinase (TYR) gene mutations with pathogenic impact on oculocutaneous albinism type 1 (OCA1). PLoS ONE. 2014 Sep. 12; 9(9): e106656. [0143] 10. Kelso A. A., Goodson S. D., Watts L. E., Ledford L. L., Waldvogel S. M., Diehl J. N., Shah S. B., Say A. F., White J. D., and Sehorn M. G., The -isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing. Nucleic Acids Res. 2017 Jan. 25; 45(2): 711-25. [0144] 11. Komor A. C., Kim Y. B., Packer M. S., Zuris J. A., and Liu, D. R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature. 2016 May 19; 533(7603): 420-24. [0145] 12. Li G., Zhang X., Zhong C., Mo J., Quan R., Yang J., Liu D., Li Z., Yang H., and Wu Z., Small molecules enhance CRISPR/Cas9-mediated homology-directed genome editing in primary cells. Sci. Rep. 2007 Aug. 21; 7(1): 8943. [0146] 13. Ladsttter S. and Tachibana-Konwalski K., A Surveillance Mechanism Ensures Repair of DNA Lesions during Zygotic Reprogramming. Cell. 2016 Dec. 15; 167(7): 1774-87. [0147] 14. LaRocque J. R., Stark J. M., Oh J., Bojilova E., Yusa K., Horie. K., Takeda J., and Jasin M., Interhomolog recombination and loss of heterozygosity in wild-type and Bloom syndrome helicase (BLM)-deficient mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 2011 Jul. 19; 108(29): 11971-76. [0148] 15. Lim D. S. and Hasty P. A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53. Mol. Cell Biol. 1996 December; 16(12): 7133-43. [0149] 16. Lu H., Guo X., Meng X., Liu J., Allen C., Wray J., Nickoloff J. A., and Shen Z., The BRCA2-Interacting Protein BCCIP Functions in RAD51 and BRCA2 Focus Formation and Homologous Recombinational Repair. Mol. Cell Biol. 2005 May; 25(5): 1949-57. [0150] 17. Ma H., Marti-Gutierrez N., Park S. W., Wu J., Lee Y., Suzuki K., Koski A., Ji D., Hayama T., Ahmed R., Darby H., Van Dyken C., Li Y., Kang E., Park A. R., Kim D., Kim S. T., Gong J., Gu Y., Xu X., Battaglia D., Krieg S. A., Lee D. M., Wu D. H., Wolf D. P., Heitner S. B., Belmonte J. C. I., Amato P., Kim J. S., Kaul S., and Mitalipov S., Correction of a pathogenic gene mutation in human embryos. Nature. 2017 Aug. 24; 548(7668): 413-9. [0151] 18. Ma X., Chen C., Veevers J., Zhou X., Ross R. S., Feng W., and Chen J., CRISPR/Cas9-mediated gene manipulation to create single-amino-acid-substituted and floxed mice with a cloning-free method. Sci. Rep. 2017 Feb. 8; 7: 42244. [0152] 19. Marsden C. G., Jensen R. B., Jagelbaum J., Rothenberg E., Morrical S. W., Wallace S. S., and Sweasy J. B., The Tumor-Associated Variant RAD51 G151D Induces a Hyper-Recombination Phenotype. PLoS Genet. 2016 Aug. 11; 12(8): e1006208. [0153] 20. Maruyama T., Dougan S. K., Truttman M. C., Bilate A. M., Ingram J. R., and Ploegh H. L., Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nat. Biotechnol. 2015 May; 33(5): 538-42. [0154] 21. McVey M. and Lee S. E., MMEJ repair of double-strand breaks (director's cut): deleted sequences and alternative endings. Trends Genet. 2008 November; 24(11): 529-38. [0155] 22. Moldovan G. L. and D'Andrea, A. D., How the fanconi anemia pathway guards the genome. Annu. Rev. Genet. 2009; 43: 223-49. [0156] 23. Moynahan M. E. and Jasin M., Loss of heterozygosity induced by a chromosomal double-strand break. Proc. Natl. Acad. Sci. U.S.A. 1997 Aug. 19; 94(17): 8988-93. [0157] 24. Murai J., Yang K., Dejsuphong D., Hirota K., Takeda S., and D'Andrea A. D., The USP1/UAF1 complex promotes double-strand break repair through homologous recombination. Mol. Cell Biol. 2011 June; 31(12): 2462-69. [0158] 25. Nishida K., Arazoe T., Yachie N., Banno S., Kakimoto M., Tabata M., Mochizuki M., Miyabe A., Araki M., Hara K. Y., Shimatani Z., and Kondo A., Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science. 2016 Sep. 16; 353(6305); aaf8729-aaf8729. [0159] 26. Normanno D., Negrel A., de Melo A. J., Betzi S., Meek K., and Modesti M., Mutational phospho-mimicry reveals a regulatory role for the XRCC4 and XLF C-terminal tails in modulating DNA bridging during classical non-homologous end joining. Elife. 2017 May 13; 6. [0160] 27. Paquet D., Kwart D., Chen A., Sproul A., Jacob S., Teo S., Olsen K. M., Gregg A., Noggle S., and Tessier-Lavigne M., Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9. Nature. 2016 May 5; 533(7601): 125-9. [0161] 28. Peca J., Feliciano C., Ting J. T., Wang W., Wells M. F., Venkatraman T. N., Lascola C. D., Fu Z., and Feng G., Shank3 mutant mice display autistic-like behaviours and striatal dysfunction. Nature. 2011 Apr. 28; 472(7344): 437-42. [0162] 29. Quadros R. M., Miura H., Harms D. W., Akatsuka H., Sato T., Aida T., Redder R., Richardson G. P., Inagaki Y., Sakai D., Buckley S. M., Seshacharyulu P., Batra S. K., Behlke M. A., Zeiner S. A., Jacobi A. M., Izu Y., Thoreson W. B., Urness L. D., Mansour S. L., Ohtsuka M., and Gurumurthy C. B., Easi-CRISPR: a robust method for one-step generation of mice carrying conditional and insertion alleles using long ssDNA donors and CRISPR ribonucleoproteins. Genome Biol. 2017 May 17; 18(1): 92. [0163] 30. Richardson C., Moynahan M. E., and Jasin M., Double-strand break repair by interchromosomal recombination: suppression of chromosomal translocations. Genes Dev. 1998 Dec. 15; 12(24): 3831-42. [0164] 31. Richardson C. D., Ray G. J., DeWitt M. A., Curie G. L., and Corn J. E., Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat. Biotechnol. 2016 March; 34(3): 339-44. [0165] 32. Schindelin J. et al., Arganda-Carreras I., Frise E., Kaynig V., Longair M., Pietzsh T., Preibisch S., Rueden C., Saalfeld S., Schmid B., Tinevez J. Y., White D. J., Hartenstein V., Eliceiri K., Tomancak P., and Cardona A., Fiji: an open-source platform for biological-image analysis. Nat. Methods. 2012 Jun. 28; 9(7): 676-82. [0166] 33. Schwacha A. and Kleckner N., Interhomolog bias during meiotic recombination: meiotic functions promote a highly differentiated interhomolog-only pathway. Cell. 1997 Sep. 19; 90(6): 1123-35. [0167] 34. Sehorn M. G., Sigurdsson S., Bussen W., Unger V. M., and Sung P., Human meiotic recombinase Dmc1 promotes ATP-dependent homologous DNA strand exchange. Nature. 2004 May 27; 429(6990): 433-37. [0168] 35. Shin H. Y., Wang C., Lee H. K., Yoo K. H., Zeng X., Kuhns T., Yang C. M., Mohr T., Liu C., and Hennighausen L., CRISPR/Cas9 targeting events cause complex deletions and insertions at 17 sites in the mouse genome. Nat. Commun. 2017 May 31; 8: 15464. [0169] 36. Song J., Yang D., Xu J., Zhu T., Chen Y. E., and Zhang J., RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency. Nat. Commun. 2016 Jan. 28; 10548. [0170] 37. Stark J. M. and Jasin M., Extensive loss of heterozygosity is suppressed during homologous repair of chromosomal breaks. Mol. Cell Biol. 2003 January; 23(2): 733-43. [0171] 38. Takayama K., Igai K., Hagihara Y., Hashimoto R., Hanawa M., Sakuma T., Tachibana M., Sakurai F., Yamamoto T., and Mizuguchi H., Highly efficient biallelic genome editing of human ES/iPS cells using a CRISPR/Cas9 or TALEN system. Nucleic Acids Res. 2017 May 19; 45(9): 5198-207. [0172] 39. Taylor R. M., Moore D. J., Whitehouse J., Johnson P., and Caldecott K. W., A cell cycle-specific requirement for the XRCC1 BRCT II domain during mammalian DNA strand break repair. Mol. Cell Biol. 2000 January; 20(2): 735-40. [0173] 40. Tsuzuki T., Fujii Y., Sakumi K., Tominaga Y., Nakao K., Sekiguchi M., Matsashiro A., Yoshimura Y., and Morita T., Targeted disruption of the Rad51 gene leads to lethality in embryonic mice. Proc. Natl. Acad. Sci. U.S.A. 1996 Jun. 25; 93(13): 6236-40. [0174] 41. Wray J., Liu J., Nickoloff J. A., and Shen Z., Distinct RAD51 Associations with RAD52 and BCCIP in Response to DNA Damage and Replication Stress. Cancer Res. 2008 Apr. 15; 68(8): 2699-707. [0175] 42. Wu Y., Liang D., Wang Y., Bai M., Tang W., Bao S., Yan Z., Li D., and Li J., Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell. 2013 Dec. 5; 13(6): 659-62. [0176] 43. Yu C., Liu Y., Ma T., Liu K., Xu S., Zhang Y., Liu H., La Russa M., Xie M., Ding S., and Qi L. S., Small molecules enhance CRISPR genome editing in pluripotent stem cells. Cell Stem Cell. 2015 Feb. 5; 16(2): 142-7. [0177] 44. Yu D. S., Sonoda E., Takeda S., Huang C. L., Pellegrini L., Blundell T. L., and Venkitaraman A. R., Dynamic control of Rad51 recombinase by self-association and interaction with BRCA2. Mol. Cell. 2003 October; 12(4): 1029-41. [0178] 45. Liu R., Paxton W. A., Choe S., Ceradini D., Martin S. R., MacDonald M. E., Stuhlmann H., Koup R. A., and Landau N. R., Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell. 1996 Aug. 9; 86(3):367-77. [0179] 46. Qi C., Jia X., Lu L., Ma P., and Wei M., HEK293T Cells are Heterozygous for CCR5 Delta 32 Mutation. PLoS One. 2016 Apr. 4; 11(4): e0152975. [0180] 47. Lin Y. C., Boone M., Meuris L., Lemmens I., Van Roy N., Soete A., Reumers J., Moisse M., Plaisance S., Drmanac R., Chen J., Speleman F., Lambrechts D., Ban de Peer Y., Tavernier J., and Callewaert N., Genome dynamics of the human embryonic kidney 293 lineage in response to cell biology manipulations. Nat. Commun. 2014 Sep. 3; 5:4767. [0181] 48. Platt R. J., Chen S., Zhou Y., Yim M. J., Swiech L., Kempton H. R., Dahman J. E., Parnas O., Eisenhaure T. M., Jovanic M., Graham D. B., Jhunjhunwala S., Heidenreich M., Xavier R. J., Langer R., Anderson D. G., Hacohen N., Refev A., Feng G., Sharp P. A., and Zhang F., CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell. 2014 Oct. 9; 159(2): 440-55.
Other Embodiments
[0182] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0183] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
EQUIVALENTS
[0184] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
[0185] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
[0186] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0187] The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
[0188] The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0189] As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0190] As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0191] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0192] In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., comprising) are also contemplated, in alternative embodiments, as consisting of and consisting essentially of the feature described by the open-ended transitional phrase. For example, if the disclosure describes a composition comprising A and B, the disclosure also contemplates the alternative embodiments a composition consisting of A and B and a composition consisting essentially of A and B.