MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE

Abstract

The invention provides a method for generating an oligonucleotide with which an exon may be skipped in a pre-mRNA and thus excluded from a produced mRNA thereof. Further provided are methods for altering the secondary structure of an mRNA to interfere with splicing processes and uses of the oligonucleotides and methods in the treatment of disease. Further provided are pharmaceutical compositions and methods and means for inducing skipping of several exons in a pre-mRNA.

Claims

1-34. (canceled)

35. An antisense oligonucleotide of 15 to 24 nucleotides in length, comprising at least 12 consecutive bases of a base sequence of the sequence CUGUUGCCUCCGGUUCUG (SEQ ID NO: 29), in which uracil bases are thymine bases, wherein the antisense oligonucleotide is a morpholino phosphorodiamidate antisense oligonucleotide, and wherein the antisense oligonucleotide induces exon 53 skipping in the human dystrophin pre-mRNA.

36. The oligonucleotide of claim 35, which is 21 nucleotides in length.

37. A pharmaceutical composition, comprising the oligonucleotide of claim 35 and a pharmaceutically acceptable excipient.

38. A pharmaceutical composition, comprising the oligonucleotide of claim 36 and a pharmaceutically acceptable excipient.

39. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD), comprising administering to a subject a therapeutically effective amount of the oligonucleotide of claim 35.

40. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD), comprising administering to a subject a therapeutically effective amount of the oligonucleotide of claim 36.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0116] FIGS. 1A-1F show RT-PCR and sequence analyses of dystrophin mRNA fragments of the AON-treated DMD patient myotube cultures. (FIG. 1A) patient DL 515.2; (FIG. 1B) patient DL363.2; (FIG. 1C) patient 50685.1A; (FIG. 1D) patient DL 589.2; (FIG. 1E) patient 53914.1; (FIG. 1F) patient 50423.1, focusing on the regions encompassing the exons targeted for skipping. Shorter novel transcripts were observed when compared to the untransfeeted myotube cultures (NT). Sequence analyses confirmed the precise skipping of the targeted exons. An alternatively spliced product, detected for patient 50685.1 (FIG. 1C) was sequenced and found to be derived from activation of a cryptic splice site in, exon 51. Shorter fragments, detected in untransfected myotube cultures from DL 363.2 (FIG. 1B), DL 589.2 (FIG. 1D) and 53914.1 (FIG. 1E), were sequenced and found to be the result of the spontaneous skipping of exons 44, 50 and 53, respectively. Note that in some analyses, additional fragments, slightly shorter than the wild-type products, were present. This was due to heteroduplex formation. 100 bp: size marker, -RT-PCR: negative control.

[0117] FIGS. 24-2F illustrate immuno-histochemical analyses of the AON-treated myotube cultures from the six different DMD patients. (FIG. 2A) patient DL 515.2; (FIG. 2B) patient DL363.2; (FIG. 2C) patient 50685.1; (FIG. 2D) patient DL 589.2; (FIG. 2E) patient 53914.1; (FIG. 2F) patient 50423.1. Cells were stained for myosin to identify fully differentiated myotubes (not shown). Monoclonal antibodies MANDYS1 (middle panel) and Dys2 (right panel) were used to detect dystrophin 1 to 4 days post-transfection. No dystrophin signals could be detected in untreated cells stained with MANDYS1 (left panel) nor Dys2 (not shown), whereas clear, mainly cvtoplasmatic dystrophin signals could be detected for each patient upon the induced exon skipping. In patients DL 363.2 (FIG. 2B), DL 589.2 (FIG. 2D) and 53914.1 (FIG. 2E), dystrophin membrane signals could be observed. Note that membrane signals were more often found for Dys2, which recognizes the full-length dystrophin. MANDYS1 recognizes an internal part of dystrophin and is more prone to generate cytoplasmatic signals, since it also detects dystrophin in the first stages of synthesis. Magnification 63.

[0118] FIGS. 3A-3F show western blot analyses of the AON-treated myotube cultures. Monoclonal antibody DY4 was used to detect dystrophin. (FIG. 3A) patient DL515 2; (FIG. 3B) patient DL363.2; (FIG. 3C) patient 53914.1; (FIG. 3D) patient 50685.1; (FIG. 3E) patient DL 589.2; (FIG. 3E) patient 50423.1, Protein extracts isolated from human control myotube cultures (RC) were used as a positive control (FIGS. 3C and 3F). To avoid overexposure, this sample was 1 to diluted. To demonstrate equal loading of protein samples, blots were additionally stained with an antibody against myosin. No, or, as a result of spontaneous exon skipping, very low (FIGS. 3B and 3C) levels of dystrophin were detected in non-transfected myotube cultures (NT). Clear dystrophin signals were observed in AON-treated myotube cultures for each of the patients. For 50685.1 and DL 363.2, a time-course experiment was performed. Dystrophin could be detected 16 h post-transfection and was found at increasing levels at 24 hand 48 h post-transfection for 50685.1 (FIG. 3D). For DL 363.2 (FIG. 3B) dystrophin could be detected in increasing levels up to 7 days post-transfection. For patients DL 515.2 (FIG. 3), DL 363.2 (FIG. 3B) and DL 589.2 (FIG. 3E), the detected dystrophin was significantly shorter than the control dystrophin. This is due to the size of the deletions in these patients.

[0119] FIGS. 4A-4B show immuno-histochemical analyses of 4 DGE proteins from treated myotube cultures from patient DL 363.2. Cells were stained for myosin to identify sufficiently differentiated myotubes (not shown). Monoclonal antibodies NOL-a-BARO, NCL-b-SARC, NCL-g-SARC and NCL-b-DO were used to detect -sarcoglycan, -sarcoglycan, -sarcoglycan and -dystroglycan, respectively. (FIG. 4A) These proteins were detected in reduced percenta (40%) in untreated myotubes, and were mainly located in the cytoplasm. (FIG. 4B) Following AON treatment, however, -sarcoglycan was detected in 70%, -sarcoglycan was detected in 90%, -sarcoglycan was detected in 90% and -dystroglycan was detected in 80% of the myotubes, and the proteins were mostly membrane-bound. Magnification 63.

[0120] FIGS. 5A-5I are RT-PCR analyses of human dystrophin rRNA in the regions encompassing the exons targeted for skipping. Exon skipping was assessed using. AONs directed to (FIGS. 5A and 5B) exon 2; (FIG. 5C) exon 29 (FIG. 5D) exon 40, 41 or 42; (FIG. 5E) exon 43, 44 or 45; (FIG. 5F) exon 46; (FIG. 5G) exon 47, 48, 49 or 50; (FIG. 5H) exon 51 and (FIG. 5I) exon 53. Shorter novel transcript fragments were observed following transfection with the different AONs when compared to non-transfected myotube cultures (NT). Sequence analyses (not shown) confirmed the skipping of the targeted exons, as indicated by the labels adjacent to the images. Alternatively spliced products, detected in the regions around exon 2 (FIG. 5B), exon 29 (FIG. 5C), and exon 51 (FIG. 5H), were sequenced and found to be derived from either co-skipping of adjacent exons or usage of a cryptic splice site. No specific (RT-) PCR products were obtained. In some analyses, additional fragments, lightly shorter than the wild-type products, were present. This was due to heteroduplex formation.

[0121] FIG. 6 shows double-exon skipping in DMD patient DL90.3 carrying a nonsense mutation in the out-of-frame exon 43. RT-PCR analyses of dystrophin mRNA fragments of AON-treated myotubes from this patient showed a shorter, novel transcript not present in untransfected myotubes (NT). Sequence analyses confirmed the precise skipping of the targeted exons 43 and 44. Besides this double-skip, we also detected a single exon 44 skip. Note that the additional fragment, slightly shorter than the wild-type product., is due to heteroduplex formation. 100 bp: size marker, -RT-PCR: negative control.

[0122] FIGS. 7A-7D show double- and multi-exon skipping in human control myotubes (FIG. 7A) KM109, (FIG. 7B) DMD patient DL 470.2, carrying a deletion of exons 46 to 50, and (FIG. 7C) DMD patient 50685.1, carrying a deletion of exons 48 to 50. RT-PCR analyses of dystrophin mRNA fragments in the myotube cultures treated with either a mixture of h45AON5 and h51AON2 (mix) or with a U-linked combination of AONs (U:h45AON5 linked to h51AON2 by 10 uracil nucleotides). In all samples treated with either the mix of AONs or the U-linker AON, a shorter transcript fragment was detected that contained exon 44 spliced to exon 52, and that was not present in untreated myotubes (NT). This novel, in-frame transcript arose from double-exon skipping in patient DL 470.2 (the targeted exons 45 and 51 are directly flanking the deletion), but from multi-exon skipping in both the human control and patient 50685.1. In the treated patient myotube cultures, additional shorter fragments were observed, due to single-exon 45 and single-exon 51 skipping. Note that in some lanes, other fragments, slightly shorter than the wild-type products, were present. This was due to heteroduplex formation. 100 bp: site marker, -RT-PCR: negative control. (FIG. 7D) All fragments were quantified using the DNA7500 labchip and the Bioanalyzer (Agilent). The percentage of double- or multi-exon 45 to 51 skipping was determined by the ratio of this fragment to the total of transcript fragments. The U-combined AON seems less efficient in DIL 470.2, but more efficient in KM 109 and 50685.1, when compared to the mixture of AONs.

REFERENCES (TO THE GENERAL PART, EXCLUDING EXAMPLE 2)

[0123] 1. Hoffman, E. P., Brown, R. H., Jr., Kunkel, L. M. (1987) Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell, 51, 919-928.

[0124] 2. Hoffman, E. P., Fischbeck, K. H., Brown, R. H., Johnson, M., Medori, R., Loike, J. D., Harris, J. B., Waterston, R., Brooke, M., Specht, L., et al. (1988) Characterization of dystrophin in muscle-biopsy specimens from patients with Duchenne's or Becker's muscular dystrophy. N. Engl. J. Med., 318, 1363-1368.

[0125] 3. Den Dunnen, J. T., Grootscholien, P. M., Bakker, E., Blonden, L. A., Ginjaar, H. B., Wapenaar, M. C., van Paassen, H. M., van Broeckhoven, C., Pearson, P. L., van Ommen, G. J. (1989) Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications. Am. J. Hum. Genet., 45, 835-847.

[0126] 4. Koenig, M., Beggs, A. H., Moyer, M., Scherpf, S., Heindrich, K., Bettecken, T., Meng, G., Muller, C. R., Lindlof, M., Kaariainen, H., et al. (1989) The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am. J. Hum. Genet., 45, 498-506.

[0127] 5. Tuffery-Giraud, S., Chambert, S., Demaille, J., Claustres, M. (1999) Point mutations in the dystrophin gene: evidence for frequent use of cryptic splice sites as a result of splicing defects. Hum. Mutat., 14, 359-368.

[0128] 6. Prior, T. W., Bartolo, C., Pearl, D. K., Papp, A. C., Snyder, P. J., Sedra, M. S., Burghes, A. H., Mendell, J. R. (1995) Spectrum of small mutations in the dystrophin coding region. Am. J. Hui 3 Genet., 57, 22-33.

[0129] 7. Moser, H. (1984) Duchenne muscular dystrophy: pathogenetic aspects and genetic prevention. Hum. Genet., 66, 17-40,

[0130] 8. Emery, A. E. (2002) The muscular dystrophies. Lancet, 359, 687-695.

[0131] 9. Yoshida, M., Ozawa, E. (1990) Glycoprotein complex anchoring dystrophin to sarcolemma. J. Biochem. (Tokyo), 108, 748-752.

[0132] 10. Ervasti, J. M., Campbell, K. P. (1991) Membrane organization of the dystrophin-glycoprotein complex. Cell, 66, 1121-1131.

[0133] 11. Di Blasi, C., Morandi, L., Barresi, R, Blasevich, F., Cornelio, F., Mora, M. (1996) Dystrophin-associated protein abnormalities in dystrophin-deficient muscle fibers from symptomatic and asymptomatic DuchennefBecker muscular dystrophy carriers. Acta Neuropathol. (Berl), 92, 369-377.

[0134] 12. Ervasti, J. M., Ohlendieck, K., Kahl, S. D., Gayer, M. G., Campbell, K. P. (1990) Deficiency of a glycoprotein component of the dystrophin complex in dystrophic muscle. Nature, 345, 315-319.

[0135] 13. Matsumura, K., Burghes, A. H., Mora, M., Tome, F. M., Morandi, L., Cornello, F., Leturcq, F., Jeanpierre, M., Kaplan, J. C., Reinert, P., et al. (1994) Immunohistochemical analysis of dystrophin-associated proteins in Becker/Duchenne muscular dystrophy with huge in-frame deletions in the NH2-terminal and rod domains of dystrophin. J. Clin. Invest., 93, 99-105.

[0136] 14. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. (1988) An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics, 2, 90-95.

[0137] 15. Clemens, P. R., Duncan, F. J. (2001) Progress in gene therapy for Duchenne muscular dystrophy. Curr. Neurol. Neurosci. Rep., 1, 89-96.

[0138] 16. Khan, M. A. (1993) Corticosteroid therapy in Duchenne muscular dystrophy. J. Neurol. Sci, 120, 8-14.

[0139] 17. De Angelis, F. G., &handier, O., Berarducci, B., Toso, S., Galluzzi, G., Ricci, E., Cossu, G., Bozzoni, I. (2002) Chimeric snRNA molecules carrying antisense sequences against the splice junctions of oxen 51 of the dystrophin pre-mRNA induce oxen skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc. Natl. Acad. Sci. USA, 99, 9456-9461.

[0140] 18. Mann, C. J., Honeyman, K., Cheng, A. J., Ly. T., Lloyd, F., Fletcher, S., Morgan, J. E., Partridge, T. A., Wilton, S. D. (2001) Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc. Natl. Acad. Sci. USA, 98, 42-47.

[0141] 19. van Deutekom, J. C., Bremmer-Bout, M., Janson, A. A., Ginjaar, I. B., Baas, F., den Dunnen, J. T., van Ommen, G. J. (2001) Antisense-induced oxen skipping restores dystrophin expression in DMD patient derived muscle cells. Hum. Mol. Genet., 10, 1547-1554,

[0142] 20. Wilton, S. D., Lloyd, F., Corvine, K., Fletcher, S., Honeyman, K., Agrawal, S., Kole, R. (1999) Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides. Neuromuscul. Disord., 9, 330-338.

[0143] 21. Dunkley, M. G., Manobaran, M., Villiet, P., Eperon, I. C., Dickson, G. (1998) Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides. Hum. Mel, Genet, 7, 1083-1090.

[0144] 22. Takeshima, Y., Wada, H., Yogi, M., Ishikawa, Y., Minami, R., Nakamura, H., Matsuo, M. (2001) Oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a Duchemie muscular dystrophy patient. Brain Dev., 23, 788-790.

[0145] 23. Aartsma-Rus, A., Bremmer-Bout, M., Janson, A., den Dunnen, J., van Ommen, G., van Deutekom, J. (2002) Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. Neuromuscul. Disord., 12, S71.

[0146] 24. Shiga, N., Takeshima, Sakamoto, H., Inoue, K., Yokota, Y., Yokoyama, M., Matsuo, M. (199) Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy. J. Clin, Invest., 100, 2204-2210.

[0147] 25. Cartegni, L., Chew, S. L. Krainer, A. R. (2002) Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat. Rev. Genet., 3, 285-298.

[0148] 26. Schaal, T. D., Maniatis, T. (1999) Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA. Mol. Cell. Biol., 19, 261-273.

[0149] 27. Takeshima, Y., Nishin, H., Sakamoto, H., Nakamura, H., Matsuo, M. (1995) Modulation of in vitro splicing of the upstream intron by modifying an intra-exon sequence which is deleted from the dystrophin gene in dystrophin. Kobe. J. Clin. Invest., 95, 515-520.

[0150] 28. Pramono, Z. A., Takeshima, Y., Alimsardjono, H., Ishii, A., Takeda, S., Matsuo, M. (1996) Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem, Biophys. Res. Commun., 226, 445-449.

[0151] 29. Koenig, M., Monaco, A. P., Kunkel., L. M. (1988) The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell, 53, 219-226.

[0152] 30. Den Dunnen, J. (1996) The Leiden. Muscular Dystrophy pages; http://www.dmd.nl.

[0153] 31, Mann, C. J., Honeyman, K, McClorey, G., Fletcher, S., Wilton, S. D. (2002) Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. J. Gene Med., 4, 644-654.

[0154] 32. Kerr, T. P., Sewry, C. A., Robb, S. A., Roberts, R. G. (2001) Long mutant dystrophins and variable phenotypes: evasion of nonsense-mediated decay? Hum. Genet., 109, 402-407.

[0155] 33. Klein, C. 4., Coovert, D. D., Bulman, D. E., Ray, P. N., Mendell, J. R., Burghes, A. H. (1992) Somatic reversionisuppression in Duchenne muscular dystrophy (DMD): evidence supporting a frame-restoring mechanism in rare dystrop bin-positive fibers. Am. J. Hum. Genet., 50, 950-959.

[0156] 34. Sherratt, T. G., Vulliamy, T., Dubowitz, V., Sewry, C. A., Strong, P. N. (1993) Exon skipping and translation in patients with fmtneshift deletions in the dystrophin gene. Am, J. Hum. Genet., 53, 1007-1015.

[0157] 35, Lu, Q. L., Morris, G. E., Wilton, S. D., Ly, T., Artem'yeva, O. V., Strong, P., Partridge, T. A. (2000) Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion. J. Cell Biol., 148, 985-996.

[0158] 36. Nicholson, L. V. Johnson, M. A., Bushby, K. M., Gardner-Medwin, D. (1993) Functional significance of dystrophin positive fibres in Duchenne muscular dystrophy. Arch. Dis. Child, 68, 632-636.

[0159] 37. Vainzof, M., Passos-Bueno, M. R., Takata, R. I., Pavanello Rde, C., Zatz, M. (1993) Intrafamilial variability in dystrophin abundance correlated with difference in the severity of the phenotype. J. Neurol. Sci., 119, 38-42.

[0160] 38. Singh, V., Sinha, S., Mishra, S., Chaturvedi, L. S., Pradhan, S. Mittal, R. D., Mittal, B. (1997) Proportion and pattern of dystrophin gene deletions in north Indian Duchenne and Becker muscular dystrophy patients. Hum. Genet., 99, 206-208.

[0161] 39. Melacini, P., Fanin, M., Danieli, G. A., Fasoli, 7., Villanova, C., Angelini, C., Vitiello, L., Miorelli, M., Buja, G. F., Mostacciuolo, M. L., et al. (1993) Cardiac involvement in Becker muscular dystrophy. J. Am. Coll. Cardiol, 22, 19274934.

[0162] 40. Melis, M. A., Cau, Muntoni, F., Mateddu, A., Galanello, R., Boccone, L., Deidda, F., Loi, D., Cao, A. (1998) Elevation of serum creatine kinase as the only manifestation of an intragenic deletion of the dystrophin gene in three unrelated families. Europ, Paediotr. Neurol, 2, 255-261.

[0163] 41. Onengut, S., Kavaslar, O. N., Battaloglu, E., Serdaroglu, P., Deymeer, F., Ozdemir, C., Calafell, F., Tolun, A. (2000) Deletion pattern in the dystrophin gene in Turks and a comparison with Europeans and Indians. Ann. Hum. Genet., 64, 33-40.

[0164] 42. Rosenberg, C., Navajas, L., Vagenas, D. F., Bakker, E., Vainzof, M., Passos-Bueno, M. R. Takata, R. I., Van Ommen, G. J., Zatz, M., Den Dunnen, J. T. (1998) Clinical diagnosis of heterozygous dystrophin gene deletions by fluorescence in situ hybridization. Neuromuscul. Disord., 8, 447-452.

[0165] 43. Sertic, J., Barisic, N., Sostarko, M., Brzovic, Z., Stasiljenic-Rukavina, A. (1997) Deletion screening of the Duchenne/Becker muscular dystrophy gene in Croatian population. Coll. Antropol., 21, 151-156.

[0166] 44. Randa, T. A., Blau, H. M. (1994) Primary mouse myoblast purification, characterization, and transplantation for cell-mediated gene therapy. J. Cell Biol., 125, 12754287.

[0167] 45. Murry, C. E., Kay, M. A., Bartosek, T., Hauschka, S. D., Schwartz, S. M. (1996) Muscle differentiation during repair of myocardial necrosis in rats via gene transfer with MyoD. J. Clin. Invest., 98, 2209-2217.

[0168] 46. Roost, P. A., van der Tuijn, A. C., Ginjaar, H. B., Hoeben, R. C., Hoger-Vorst, F. B., Bakker, E., den Dunnen, J. T., van Ommen, G. J. (1996) Application of in vitro Myo-differentiation of non-muscle cells to enhance gene expression and facilitate analysis of muscle proteins. Neuromuscul Disord., 6, 195-202.

[0169] 47. Havenha, M. J., Lemekert, A. A., Ophorst, O. J., van Meijer, M., Clermeraad, W. T., Grimbergen, J., van Den Doel, M. A., Vogels, R., van Deutekom, J., Janson, A. A., et al. (2002) Exploiting the natural diversity in adenovirus tropism for therapy and prevention of disease. J. Virol., 76, 4612-4620.

[0170] 48. Anderson, L. V., Davison, K. (1999) Multiplex Western blotting system for the analysis of muscular dystrophy proteins. Am. J. Pathol., 154, 1017-1022.

[0171] 49. Neugebauer, K M, et al., J Cell Biol. 129:899-908 (1995).

[0172] 50. Tacke R and Manley J L, Proc Soc Exp Biel Med. 220:59-63 (1999).

[0173] 51. Graveley B R et al., Curr Biol 9:R6-7 (1999).

[0174] 52, T et al, Nature 387:523-527 (1997).

[0175] 53. Gorman L, Suter D, Emerick V, et al. Stable alteration of pre mRNA splicing patterns by modified U7 small nuclear RNAs. Proc Natl Acad Sci USA 1998; 95:4929 4934.

[0176] 54. Suter D, Tomasini R, Reber U, et al. Double target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta thalassemie mutations. Hum Mel Genet 1999; 8:2415 2423

TABLE-US-00001 TABLE 1 Overview of the patients, the AONs and the primer sets used in this study Primary Nested Targeted RT- PCR PCR Patients Mutations exons AONs.sup.a primers.sup.b sets.sup.b sets.sup.b DL 515.2 Deletion exon 45-50 Exon 51 h51AON1 h53r h41f-h53r h42f-h52r DL 363.2 Deletion exon 45-54 Exon 44 h44AON1 h55r2 h42f-h55r2 h44f-h55r 50685.1 Deletion exon 48-50 Exon 51 h51AON1 h53r h46f-h53r h47f-h52r DL 589.2 Deletion exon 51-55 Exon 50 h50AON1 h58r h47f-h58r h49f-h57r 53914.1 Deletion exon 52 Exon 51 h51AON1 h55r h49f-h55r h50f-h54r Exon 53 h53AON1 50423.1 Point mutation exon 49 Exon 49 h49AON1 h52r h46f-h52r h47f-h51r .sup.aAON sequences were published, previously (23). .sup.bPrimer sequences available upon request.

TABLE-US-00002 TABLE2 CharacteristicsoftheAONsusedtostudythetargetedskippingof15 differentDMDexons.sup.a Length Exon Name Antisensesequence(5-3) (bp) G/C% U/C% skip Transcript h2AON1 cccauuuucuaaauguuuucuuuu 24 29 75 + OF h2AON2 uugugcauuuacccauuuugug 22 36 68 - OF h29AON1 uauccucugaaugucgcauc 20 45 65 + IF h29AON2 gguuauccucugaaugucgc 20 50 60 + IF h40AON1 gagccuuuuuucuucuuug 19 37 79 + IF h40AON2 uccuuucgucucugggcuc 19 58 79 + TT h41AON1 cuccucuuucuucuucugc 19 47 95 + IF h41AON2 cuucgaaacugagcaaauuu 20 35 50 + IF h42AON1 cuugugagacaugagug 17 47 41 + IF h42AON2 cagagacuccucuugcuu 18 50 67 + IF h43AON1 ugcugcugucuucuugcu 18 50 78 - OF h43AON2 uuguuaacuuuuucccauu 19 26 79 + OF h44AON1 cgccgccauuucucaacag 19 58 63 + OF h44AON2 uuuguauuuagcauguuccc 20 35 70 + OF h45AON1 gcugaauuauuucuucccc 19 42 74 - OF h45AON5 gcccaaugccauccugg 17 65 58 + OF h46AON4b cugcuuccuccaacc 15 60 80 + OF h46AON8b gcuuuucuuuuaguugcugc 20 40 75 + OF b47AON1 ucuugcucuucugggcuu 18 50 78 - IF h47AON2 cuugagcuuauuuucaaguuu 21 29 67 - IF h48AON1 uuucuccuuguuucuc 16 38 94 - IF h48AON2 ccauaaauuuccaacugauuc 21 33 62 - IF h49AON1 cuuccacauccgguuguuu 19 47 74 + IF h49AON2 guggcugguuuuuccuugu 19 47 68 + IF h50AON1 cucagagcucagaucuu 17 47 59 + OF h50AON2 ggcugcuuugcccuc 15 67 73 - OF h51AON1 ucaaggaagauggcauuucu 20 40 45 + OF h51AON2 ccucugugauuuuauaacuugau 23 30 65 + OF h53AON1 cuguugccuccgguucug 18 61 72 + OF h53AON2 uuggcucuggccuguccu 18 61 72 - OF .sup.aTwo AONs were tested per exon, Their different lengths and GIC contents (%) did not correlate to their effectivity in exon skipping (1, induced skipping, 2, no skipping), The AONs were directed to purine (A/G)-rich sequences as indicated by their (antisense) U/C content (%). Skipping of the target exons resulted in either an in-frame (IF) or an out-of-frame (OF) transcript. bvan Deutekon et al., 2001 (213,

TABLE-US-00003 TABLE 3 Primer sets used for the RT-PCR analyses to detect the skipping of the targeted exons.sup.a Primary PCR Nested PCR Target exon RT-primer primer set primer set 2 h4r h1f1-h4r h1f2-h3r 2 h9r h1f1-h9r h1f2-h8r 29 h31r h25f-h31r h26f-h30r 40 h44r h38f-h44r h39f-h43r 41 h44r h38f-h44r h39f-h43r 42 h44r h38f-h44r h39f-h43r 43 h47r h41f-h47r h42f-h46r 44 h47r h41f-h47r h42f-h46r 45 h47r h41f-h47r h42f-h46r 46 h48r h44f-h48r h45f-h47r 47 h52r h44f-h52r h46f-h51r 48 h52r h44f-h52r h46f-h51r 49 h52r h44f-h52r h46f-h51r 50 h52r h44f-h52r h46f-h51r 51 h53r h47f-h53r h49f-h52r 53 h55r h50f-h55r h51f-h54r .sup.aPrimer sequences are available upon request.

TABLE-US-00004 TABLE 4 Overview and frequency of the DMD-causing mutations in the Leiden DMD (LDMD) Database, theoretically correctable by skipping one of the 12 exons successfully targeted in this study Therapeutic for DMD-mutations: % of No. of % of dupli- nonsense Skip- Deletions deletions Dupli- cations mutations pable (exons) in LDMD cations in LDMD in LDMD exon (exons) Database (exons) Database Database 2 3-7, 3-19, 3-21 2.9 2 9.0 29 5 40 1 41 4 42 0 43 44, 44-47, 41-49, 3.7 43 3.0 44-51 44 5-43, 14-43, 19-43, 7.8 44 3.0 30-43, 35-43, 36-43, 40-43, 42-43, 45, 45-54 46 21-45, 45, 47-54, 5.6 47-56 49 1 50 51, 51-53, 51-55 5.2 50 3.0 51 45-50, 47-50, 48-50, 17.5 51 1.5 49-50, 50, 52, 52-63 53 10-52, 45-52, 46-52, 7.5 47-52, 48-52, 49-52, 50-52, 52

TABLE-US-00005 TABLE 5 Overview of the patients, the AONs and the primer sets used in example 3 Primary Nested PCR PCR Targeted RT- primer primer Patients 1 Mutations exons AONs primers.sup.b sets.sup.b sets.sup.b DL 90.3 Nonsense mutation exon Exon 43 h43AON2.sup.a h48r h41f-h48r h42f-h47r 43 Exon 44 h44AON1.sup.a DL 470.2 Deletion exon 46-50 Exon 45 h45AON5 h53r h42f-h53r h43-h52r Exon 51 h51AON2.sup.a Exon 45 U-linker h53r h42f-h53r h43f-h52r Exon 51 AON.sup.c .sup.aSeperate AON sequences were published previously [Aartsma-Rus, 2002.] .sup.bPrimer sequences available upon request. .sup.cU linker AON consists of h45AON5 linked to h51AON2 by 10 uracils.