COMPOSITIONS FOR THE TREATMENT OF DISEASE

20190224339 ยท 2019-07-25

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention provides compositions and methods for the preparation, manufacture and therapeutic use of viral vectors, such as adeno-associated virus (AAV) particles having viral genomes encoding one or more antibodies or antibody fragments or antibody-like polypeptides, for the prevention and/or treatment of diseases and/or disorders.

    Claims

    1. An AAV particle comprising a capsid and a viral genome, said viral genome comprising at least one inverted terminal repeat (ITR) region and a payload region, said payload region comprising a regulatory sequence operably linked to at least a first nucleic acid segment, said first nucleic acid segment encoding one or more polypeptides selected from the group consisting of any member given in Table 3 and fragments thereof.

    2. The AAV particle of claim 1, wherein the capsid is selected from the group of serotypes consisting of Table 1.

    3. The AAV particle of claim 2, wherein the regulatory sequence comprises a promoter.

    4. The AAV particle of claim 3, wherein the promoter is selected from the group consisting of human elongation factor 1-subunit (EF1), cytomegalovirus (CMV) immediate-early enhancer and/or promoter, chicken -actin (CBA) and its derivative CAG, glucuronidase (GUSB), or ubiquitin C (UBC). Tissue-specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, muscle specific promoters, B cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, or nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes.

    5. The AAV particle of claim 1, wherein the viral genome is single stranded.

    6. The AAV particle of claim 1, wherein the viral genome is self-complementary.

    7. The AAV particle of claim 1, wherein at least one region of the viral genome is codon-optimized.

    8. The AAV particle of claim 7, wherein the first nucleic acid segment is codon-optimized.

    9. The AAV particle of any of claims 1-8, wherein the first nucleic acid segment encodes one or more polypeptides selected from the group consisting of an antibody heavy chain, an antibody light chain, a linker, and combinations thereof.

    10. The AAV particle of claim 9, wherein any of the polypeptides encoded by first nucleic acid segment of the payload region is humanized.

    11. The AAV particle of claim 9, wherein the linker is selected from one or more of the members of the group given in Table 2.

    12. The AAV particle of claim 9, wherein the first nucleic acid segment encodes from 5 to 3, an antibody heavy chain, a linker, and an antibody light chain.

    13. The AAV particle of claim 9, wherein the first nucleic acid segment encodes from 5 to 3, an antibody light chain, a linker, and an antibody heavy chain.

    14. The AAV particle of claim 9, wherein the first nucleic acid segment encodes one or more antibody heavy chains.

    15. The AAV particle of claim 14, wherein the first nucleic acid segment encodes one or more antibody heavy chains selected from those listed in Table 3.

    16. The AAV particle of claim 9, wherein the first nucleic acid segment encodes one or more antibody light chains.

    17. The AAV particle of claim 16, wherein the first nucleic acid segment encodes one or more antibody light chains selected from those listed in Table 3.

    18. The AAV particle of claim 9, wherein the first nucleic acid segment encodes one or more antibody heavy chains and one or more antibody light chains and, optionally one or more linkers.

    19. The AAV particle of any of claims 9-18, wherein said linker is selected from the group consisting of Table 2 and combinations thereof.

    20. The AAV particle of claim 1, wherein the first nucleic acid segment encodes an antibody, having at least 95% identity to any of the sequences selected from the group consisting of SEQ ID NO: 2948-4269 and 4276-4320 (Table 3 and Table 4).

    21. An AAV particle comprising a capsid and a viral genome, said viral genome comprising at least one inverted terminal repeat (ITR) region and a payload region comprising a regulatory sequence operably linked to at least, a first nucleic acid segment, said first nucleic acid segment encoding a bispecific antibody derived from any of the sequences listed in Tables 3 or 4 or portions or fragments thereof.

    22. The AAV particle of claim 21, wherein the bispecific antibody comprises a light and a heavy chain selected from two different starting antibodies selected from the group consisting of SEQ ID NO: 2948-4269and 4276-4320 (Table 3 and Table 4).

    23. A method of producing a functional antibody in a subject in need thereof, comprising administering to said subject the AAV particle of any of claims 1-22.

    24. The method of claim 23, wherein the level or amount of the functional antibody in the target cell or tissue after administration to the subject is from about 0.001 ug/mL to 100 mg/mL.

    25. The method of claim 23, wherein the functional antibody is encoded by a single first nucleic acid segment of a viral genome within said AAV particle.

    26. The method of claim 23, wherein the functional antibody is encoded by two different viral genomes, said two different viral genomes packaged in separate capsids.

    27. A pharmaceutical composition comprising an AAV particle of any of the preceding claims in a pharmaceutieally acceptable excipient.

    28. The pharmaceutical composition of claim 27, wherein the pharmaceutieally acceptable excipient is saline.

    29. The pharmaceutical composition of claim 27, wherein the pharmaceutically acceptable excipient is 0.001% pluronic in saline.

    30. A method of expressing an antibody in a cell or tissue comprising administering the AAV particle of any of claims 1-29 via a delivery route selected from the group consisting of enteral (into the intestine), gastroenteral, epidural (into the dura mater), oral (by way of the mouth), transdermal, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intra-arterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraparenchymal (into brain tissue), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye), intracavernous injection (into a pathologic cavity) intracavitary (into the base of the penis), intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), transvaginal, insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), or in ear drops, auricular (in or by way of the ear), buccal (directed toward the cheek), conjunctival, cutaneous, dental (to a tooth or teeth), electro-osmosis, endocervical, endosinusial, endotracheal, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra-amniotic, intra-articular, intrabiliary, intrabronchial, intrabursal, intracartilaginous (within a cartilage), intracaudal (within the cauda equine), intracisternal (within the cisterna magna cerebellomedularis), intracorneal (within the cornea), dental intracoronal, intracoronary (within the coronary arteries), intracorporus cavernosum (within the dilatable spaces of the corporus cavernosa of the penis), intradiscal (within a disc), intraductal (within a duct of a gland), intraduodenal (within the duodenum), intradural (within or beneath the dura), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (within the stomach), intragingival (within the gingivae), intraileal (within the distal portion of the small intestine), intralesional (within or introduced directly to a localized lesion), intraluminal (within a lumen of a tube), intralymphatic (within the lymph), intramedullary (within the marrow cavity of a bone), intrameningeal (within the meninges), intramyocardial (within the myocardium), intraocular (within the eye), intraovarian (within the ovary), intrapericardial (within the pericardium), intrapleural (within the pleura), intraprostatic (within the prostate gland), intrapulmonary (within the lungs or its bronchi), intrasinal (within the nasal or periorbital sinuses), intraspinal (within the vertebral column), intrasynovial (within the synovial cavity of a joint), intratendinous (within a tendon), intratesticular (within the testicle), intrathecal (within the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (within the thorax), intratubular (within the tubules of an organ), intratumor (within a tumor), intratympamc (within the aurus media), intravascular (within a vessel or vessels), intraventricular (within a ventricle), iontophoresis (by means of electric current where ions of soluble salts migrate into the tissues of the body), irrigation (to bathe or flush open wounds or body cavities), laryngeal (directly upon the larynx), nasogastric (through the nose and into the stomach), occlusive dressing technique (topical route administration which is then covered by a dressing which occludes the area), ophthalmic (to the external eye), oropharyngeal (directly to the mouth and pharynx), parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (within the respiratory tract by inhaling orally or nasally for local or systemic effect), retrobulbar (behind the pons or behind the eyeball), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (across or through the tympanic cavity), ureteral (to the ureter), urethral (to the urethra), vaginal, caudal block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photopheresis and spinal.

    31. The method of claim 30, wherein the delivery route is intramuscular.

    32. The method of claim 31, wherein the intramuscular administration is to at least one limb.

    33. The method of claim 30, wherein the delivery route is intravascular.

    34. The method of claim 30, wherein the delivery route is intrathecal.

    35. The method of claim 30, wherein the delivery route is intracerebroventricular.

    36. The method of claim 30, wherein the delivery route is intraparenchymal.

    37. The method of claim 30, wherein the AAV particle is encapsulated in a nanoparticle.

    38. The method of claim 30, wherein the AAV particle is delivered by a device.

    39. The method of claim 38, wherein the device is a gene gun.

    40. A method of preventing a disease or disorder in a subject comprising administering to said subject the pharmaceutical composition of any of claims 27-29.

    41. The method of claim 40, wherein the administration is at a prophylactically effective dose.

    42. The method of claim 41, wherein the dose is from about 1 ug/mL to about 500 ug/mL of expressed polypeptide or 110e4 to 110e16 VG/mL from the pharmaceutical composition.

    43. The method of claim 42, wherein the pharmaceutical composition is administered once.

    44. The method of claim 42, wherein the pharmaceutical composition is administered more than once.

    45. The method of claim 42, wherein the pharmaceutical composition is administered daily, weekly, monthly or yearly.

    46. The method of claim 42, wherein the pharmaceutical composition is co-administered as part of a combination therapy.

    47. A method of treating a disease or disorder in a subject in need thereof comprising administering to said subject, the pharmaceutical composition of any of claims 27-29.

    48. The method of claim 47, wherein said disease or disorder is selected from the group consisting of tauopathies, tau-associated diseases, Alzheimer's disease (AD), frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), Frontotemporal lobar degeneration (FTLD), chronic traumatic encephalopathy (CTE), Progressive Supranuclear Palsy (PSP), Down's syndrome, Pick's disease, Corticobasal degeneration (CBD), Amyotrophic lateral sclerosis (ALS), Prion diseases, Creutzfeldt-Jakob disease (CJD), Multiple system atrophy, Tangle-only dementia, and Progressive subcortical gliosis, neurodegenerative disease and stroke.

    49. The AAV particle of claim 1, wherein the viral genome comprises 2 ITR regions.

    50. The AAV particle of claim 1, wherein the at least one ITR region is derived from the same parental serotype as the capsid.

    51. The AAV particle of claim 1, wherein the at least one ITR region is derived from a different serotype as the capsid.

    52. The AAV particle of claim 1, wherein the at least one ITR region is derived from AAV2.

    53. The AAV particle of claim 1, wherein she at least one ITR region is 100-150 nucleotides in length.

    54. The AAV particle of claim 1, wherein the at least one ITR region is 102 nucleotides in length.

    55. The AAV particle of claim 1, wherein the at least one ITR region is 140-142 nucleotides in length.

    56. The AAV particle of claim 1, wherein the at least one ITR region is 140 nucleotides in length.

    57. The AAV particle of claim 1, wherein the at least one ITR region is 141 nucleotides in length.

    58. The AAV particle of claim 1, wherein the at least one ITR region is 142 nucleotides in length.

    59. The AAV particle of claim 1, wherein the viral genome further comprises an intron or stuffer sequence.

    60. A method of producing an antibody in a subject comprising administering the AAV particle of claim 1 to said subject, with the proviso that the antibody is not a virus neutralizing antibody.

    61. A method of producing an antibody in a subject comprising administering the AAV particle of claim 1 to said subject, with the proviso that the antibody is not an HIV or HCV virus neutralizing antibody.

    62. The AAV particle of claim 1, wherein the payload region of the viral genome comprises a second nucleic acid segment, said second nucleic acid segment encoding an aptamer, siRNA, saRNA, ribozyme, microRNA, mRNA or combination thereof.

    63. The AAV particle of claim 62, wherein the second nucleic acid segment encodes an siRNA and said siRNA is designed to target the mRNA that encodes the target of the antibody encoded by the first nucleic acid segment.

    64. The AAV particle of claim 62, wherein the second nucleic acid segment encodes a microRNA and said microRNA is selected to target the mRNA that encodes the target of the antibody encoded by the first nucleic acid segment.

    65. The AAV particle of claim 62, wherein the second nucleic acid segment encodes an mRNA and said mRNA encodes one or more peptides inhibitors of the same target of the antibody encoded by the first nucleic acid segment.

    66. The AAV particle of claim 1 or 62, wherein the payload region of the viral genome comprises a third nucleic acid segment.

    67. The AAV particle of claim 66, wherein the third nucleic acid segment encodes a nuclear export signal.

    68. The AAV particle of claim 66, wherein the third nucleic acid segment encodes a polynucleotide or polypeptide which acts as a regulator of expression of the viral genome in which it is encoded.

    69. The AAV particle of claim 66, wherein the third nucleic acid segment encodes a polynucleotide or polypeptide which acts as a regulator of expression of the payload region of the viral genome in which it is encoded.

    70. The AAV particle of claim 66, wherein the third nucleic acid segment encodes a polynucleotide or polypeptide which acts as a regulator of expression of the first nucleic acid segment of the payload region of the viral genome in which it is encoded.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0034] The foregoing and other objects, features, and advantages will be apparent from the following description of particular embodiments of the invention, as illustrated in the accompanying drawings. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating the principles of various embodiments of the invention.

    [0035] FIG. 1 is a schematic of vectored antibody delivery.

    [0036] FIG. 2 is a schematic of a viral genome of the invention.

    [0037] FIG. 3 is a schematic of payload regions. Figure discloses SEQ ID NO: 4321.

    DETAILED DESCRIPTION OF THE INVENTION

    I. COMPOSITIONS OF THE INVENTION

    [0038] According to the present invention, compositions for delivering functional antibodies and/or antibody-based compositions by adeno-associated viruses (AAVs) are provided. AAV particles of the invention may be provided via any of several routes of administration, to a cell, tissue, organ, or organism, in vivo, ex vivo, or in vitro.

    [0039] As used herein, an AAV particle is a virus which comprises a. viral genome with at least one payload region and at least one inverted, terminal repeat (ITR) region.

    [0040] As used herein, viral genome or vector genome refers to the nucleic acid sequenced) encapsulated in an AAV particle. Viral genomes comprise at least one payload region encoding polypeptides of the invention, e.g., antibodies, antibody-based compositions or fragmenis thereof.

    [0041] As used herein, a payload or payload region is any nucleic acid molecule which encodes one or more polypeptides of the invention. At a minimum, a payload region comprises nucleic acid sequences that encode an antibody, an antibody-based composition, or a fragment thereof, but may also optionally comprise one or more functional or regulatory elements to facilitate transcriptional expression and/or polypeptide translation.

    [0042] The nucleic acid sequences and polypeptides disclosed herein may be engineered to contain modular elements and/or sequence motifs assembled to enable expression of the antibodies or antibody-based compositions of the invention, in some embodiments, the nucleic acid sequence comprising the payload region may comprise one or more of a promoter region, an intron, a Kozak sequence, an enhancer, or a polyadenylation sequence. Payload regions of the invention typically encode antibodies or antibody based compositions, which may include an antibody heavy chain domain, an antibody light chain domain, both antibody heavy and light chain domains, or fragments of the foregoing in combination with each other or in combination with other polypeptide moieties. In some cases, payload regions may also encode one or more linkers or joining regions between antibody heavy and light chain domains or fragments. The order of expression, structural position, or concatemer count (heavy chain, light chain, or linker) may be different within or among different payload regions. The identity, position and number of linkers expressed by payload regions may also vary.

    [0043] The payload regions of the invention may be delivered to one or more target cells, tissues, organs, or organisms within the viral genome of an AAV particle.

    Adeno-Associated Viruses (AAVs) and AAV Particles

    [0044] Viruses of the Parvoviridae family are small non-enveloped icosahedral capsid viruses characterized by a single stranded DNA genome. Parvoviridae family viruses consist of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. Due to its relatively simple structure, easily manipulated using standard molecular biology techniques, this virus family is useful as a biological tool. The genome of the virus may be modified to contain a minimum of components for the assembly of a functional recombinant virus, or viral particle, which is loaded with or engineered to express or deliver a desired payload, which may be delivered to a target cell, tissue, organ, or organism.

    [0045] The parvoviruses aid other members of the Parvoviridae family are generally described in Kenneth I. Berns, Parvoviridae: The Viruses and Their Replication, Chapter 69 in FIELDS VIROLOGY (3d Ed. 1996), the contents of which are incorporated by reference in their entirety.

    [0046] The Parvoviridae family comprises the Dependovirus genus which includes adeno-associated viruses (AAV) capable of replication in vertebrate hosts including, but not limited to, human, primate, bovine, canme, equine, and ovine species.

    [0047] The AAV vector genome is a linear, single-stranded DNA (ssDNA) molecule approximately 5,000 nucleotides (nt) in length. The AAV viral genome can comprise a payload region and at least one inverted terminal repeat (ITR) or ITR region. ITRs traditionally flank the coding nucleotide sequences for the non-structural proteins (encoded by Rep genes) and the structural proteins (encoded by capsid genes or Cap genes). While not wishing to be bound by theory, an AAV viral genome typically comprises two ITR sequences. The AAV vector genome comprises a characteristic T-shaped hairpin structure defined by the self-complementary terminal 145 nt of the 5 and 3 ends of the ssDNA which form, an energetically stable double stranded region. The double stranded hairpin structures comprise multiple functions including, but not limited to, acting as an origin for DNA replication by functioning as primers for the endogenous DNA polymerase complex of the host viral replication cell.

    [0048] In addition to the encoded heterologous payload, AAV vectors may comprise the viral genome, in whole or in part, of any naturally occurring and/or recombinant AAV serotype nucleotide sequence or variant. AAV variants may have sequences of significant homology at the nucleic acid (genome or capsid) and amino acid levels (capsids), to produce constructs which are generally physical and functional equivalents, replicate by similar mechanisms, and assemble by similar mechanisms. Chiorini et al., J. Vir. 71: 6823-33(1997); Srivastava et al., J. Vir. 45: 555-64 (1983), Chiorini et al., J. Vir. 73: 1309-1319 (1999): Rutladge et al., J. Vir. 72: 309-319 (1998); and Wu et al., J. Vir. 74: 8635-47 (2000), the contents of each of which are incorporated herein by reference in their entirety.

    [0049] In one embodiment, AAV particles of the present invention are recombinant AAV viral vectors which are replication defective and lacking sequences encoding functional Rep and Cap proteins within their viral genome. These defective AAV vectors may lack most or all parental coding sequences and essentially carry only one or two AAV ITR sequences and the nucleic acid of interest for delivery to a cell, a tissue, an organ, or an organism.

    [0050] In one embodiment, the viral genome of the AAV particles of the present invention comprise at least one control element which provides for the replication, transcription, and translation of a coding sequence encoded therein. Not all of the control elements need always be present as long as the coding sequence is capable of being replicated, transcribed, and/or translated in an appropriate host cell. Non-limiting examples of expression control elements include sequences for transcription initiation and/or termination, promoter and/or enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation signals, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficacy (e.g., Kozak consensus sequence), sequences that enhance protein stability, and/or sequences that enhance protein processing and/or secretion.

    [0051] According to the present invention, AAV particles for use in therapeutics and/or diagnostics comprise a virus that has been distilled or reduced to the minimum components necessary for transduction of a nucleic acid payload or cargo of interest. In this manner, AAV particles are engineered as vehicles for specific delivery while lacking the deleterious replication and/or integration features found in wild-type viruses.

    [0052] AAV vectors of the present invention may be produced recombinants and may be based on adeno-associated virus (AAV) parent or reference sequences. As used herein, a vector is any molecule or moiety which transports, transduces, or otherwise acts as a carrier of a heterologous molecule such as the nucleic acids described herein.

    [0053] In addition to single stranded AAV viral genomes (e.g., ssAAVs), the present invention also provides for self-complementary AAV (scAAVs) viral genomes, scAAV vector genomes contain DNA strands which anneal together to form double stranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the cell.

    [0054] In one embodiment, the AAV particle of the present invention is an scAAV.

    [0055] In one embodiment, the AAV particle of the present invention is an ssAAV.

    [0056] Methods for producing and/or modifying AAV particles are disclosed in the art such as pseudotyped AAV vectors (PCX Patent Publication Nos. WO200028004; WO0200123001; WO2004112727; WO2005005610; and WO2005072364, the content of each of which is incorporated herein by reference in its entirety).

    [0057] AAV particles may be modified to enhance the efficiency of delivery. Such modified AAV particles can be packaged efficiently and be used to successfully infect the target cells at high frequency and with minimal toxicity. In some embodiments, the capsids of the AAV particles are engineered according to the methods described in US Publication Number US20195801, the contents of which are incorporated herein by reference in their entirety.

    [0058] In one embodiment, the AAV particles comprising a payload region encoding the polypeptides of the invention may be introduced into mammalian cells.

    AAV Serotypes

    [0059] AAV particles of the present invention may comprise or be derived from any natural or recombinant AAV serotype. According to the present invention, the AAV particles may utilize or be based on a serotype selected from any of the following AAV 1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV 9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV 12, AAV 16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV 42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44.2, AAV 44.5, AAV 223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV1-7/rh.48, AAV1-8/rh.49, AAV2-15/rh.62, AAV2-3/rh,61, AAV2-4/rh.50, AAV2-5/rh.51, AAV3.1/hu.6, AAV3.1/hu.9, AAV3-9/rh.52, AAV3-11/rh.53, AAV4-8/r11.64, AAV4-9/rh.54, AAV4-19/rh.55, AAV5-3/rh.57, AAV5-22/rh.58, AAV7.3/hu.7, AAV16.8/hu.10, AAV16.12/hu.11, AAV29.3/bb.1, AAV29.5/bb.2, AAV106.1/hu.37, AAV114.3/hu.40, AAV127.2/hu.41, AAV127.5/hu.42, AAV128.3/hu.44, AAV130.4/hu.48, AAV145.1/hu.53, AAV145.5/hu.54, AAV145.6/hu.55, AAV161.10/hu.60, AAV161.6/hu.61. AAV33.12/hu.17, AAV33.4/hu.15, AAV33.8/hu.1, AAV52/hu.19, AAV52.1/hu.20, AAV58.2/hu.25, AAVA3.3, AAVA3.4, AAVA3.5, AAV A3.7, AAVC1, AAVC2, AAVC5, AAV-DJ, AAV-DJ8, AAVF3, AAVF5, AAVH2, AAVrh.72, AAVhu.8, AAVrh.68, AAVrh.70, AAVpi.1, AAVpi.3, AAVpi.2, AAVrh.60, AAVrh.44, AAVrh.65, AAVrh.55, AAVrh.47, AAVrh.69, AAVrh.45, AAVrh.59, AAVhu. 12, AAVH6, AAVLK03, AAVH-1/hu.1, AAVH-5/hu.3, AAVLG-10/rh.40, AAVLG-4/rh.38, AAVLG-9/hu.39, AAVN721-8/rh.43, AAVCh.5, AAVCh.5R1, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVCy.5R1, AAVCy.5R2, AAVCy.5R3, AAVCy.5R4, AAVcy.6, AAVhu.1, AAVhu.2, AAVhu.3, AAVhu.4, AAVhu.5, AAVhu.6, AAVhu.7, AAVhu.9, AAVhu.10, AAVhu.11, AAVhu.13, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.20, AAVhu.21, AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44, AAVhu.44R1, AAVhu.44R2, AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47, AAVhu.48, AAVhu.48R1, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.51, AAVhu.52, AAVhu.54, AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.14/9, AAVhu.t 19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh.8R, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAV A. 36, AAVrh.37, AAVA.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.46, AAVrh.48, AAVrh.48.4, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.51, AAVrh.52, AAVrh. 53, AAVrh. 54, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, AAAV, BAAV, caprine AAV, bovine AAV, AAVhE1 1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK.03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuffle 100-1, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV Shuffle 100-2, AAV SM 10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh. 62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8/rh.64, AAVLG-9/hu.39, AAV54.5/hu.23, AAV54.2/hu.22, AAV54.7/hu.24, AAV54.1/hu.21, AAV54.4R/hu.27, AAV46.2/hu.28, AAV46.6/hu.29, AAV128.1/hu.43, true type AAV (ttAAV), UPENN AAV 10, Japanese AAV 10 serotypes, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV C-Br-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CK.d-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3, AAV Ckd-H4, AAV CKd-H5, AAV CKd-H6, AAV CKd-N3, AAV CKd-N4, AAV CKd-N9, AAV CLg-F1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5, AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV Clv1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV CLv1-4, AAV Clv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3, AAV CLv-4, AAV CLv-6, AAV CLv-8, AAV CLv-D1, AAV CLv-D2, AAV CLv-D3, AAV CLv-D4, AAV CLv-D5, AAV CLv-D6, AAV CLv-D7, AAV CLv-D8, AAV CLv-E1, AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7, AAV CSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1/HSC1, AAVF11/HSC11, AAVF12/HSC12, AAVF13/HSC13, AAVF14/HSC14, AAVF15/HSC15, AAVF16/HSC16, AAVF17/HSC17, AAVF2/HSC2, AAVF3/HSC3, AAVF4/HSC4, AAVF5/HSC5, AAVF6/HSC6, AAVF7/HSC7, AAVF8/HSC8, AAVF9/HSC9, PHP.B, PHP.A, G2B-26, G2B-13, TH1.1-32, and or TH1-35 and volants thereof.

    [0060] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Publication No. US20030138772, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV1 (SEQ ID NO: 6 and 64 of US20030138772), AAV2 (SEQ ID NO: 7 and 70 of US20030138772), AAV3 (SEQ ID NO: 8and 71 of US20030138772), AAV4 (SEQ ID NO: 63 of US20030138772), AAV5 (SEQ ID NO: 114 of US20030138772), AAV6 (SEQ ID NO: 65 of US20030138772), AAV7 (SEQ ID NO: 1-3 of US20030138772). AAV8 (SEQ ID NO: 4 and 95 of US20030138772), AAV9 (SEQ ID NO: 5 and 100 of US20030138772), AAV10 (SEQ ID NO: 117 of US20030138772), AAV11 (SEQ ID NO: 118 of US 20030138772), AAV12 (SEQ ID NO: 119 of US20030138772), AAVrb10 (amino acids 1 to 738 of SEQ ID NO: 81 of US20030138772), AAV16.3 (US20030138772 SEQ ID NO: 10), AAV29.3/bb. 1 (US20030138772 SEQ ID NO: 11), AAV29.4 (US20030138772SEQ ID NO: 12), AAV29.5/bb.2 (US20030138772 SEQ ID NO: 13), AAV1.3 (US20030138772SEQ ID NO: 14), AAV13.3 (US20030138772 SEQ ID NO: 15), AAV24.1 (US20030138772SEQ ID NO: 16). AAV27.3 (UJS20030138772 SEQ ID NO: 17), AAV7.2 (US20030138772 SEQ ID NO: 18), AAVC1 (US20030138772 SEQ ID NO: 19), AAVC3 (US20030138772 SEQ ID NO: 20), AAVC5 (US20030138772 SEQ ID NO: 21). AAVF I (US20030138772 SEQ ID NO: 22), AAVF3 (US20030138772 SEQ ID NO: 23). AAVF5 (US20030138772 SEQ ID NO: 24), AAVH6 (US20030138772 SEQ ID NO: 25), AAVH2 (US20030138772 SEQ ID NO: 26), AAV42-8 (US20030138772 SEQ ID NO: 27), AAV42-15 (US20030138772 SEQ ID NO: 28), AAV42-5b (US20030138772 SEQ ID NO: 29), AAV42-1b (US20030138772 SEQ ID NO: 30), AAV42-13 (US20030138772 SEQ ID NO: 31), AAV42-3a (US20030138772 SEQ ID NO: 32), AAV42-4 (US20030138772 SEQ ID NO: 33), AAV42-5a (UJS20030138772 SEQ ID NO: 34). AAV42-10 (US20030138772 SEQ ID NO: 35), AAV42-3b (US20030138772 SEQ ID NO: 36), AAV42-11 (US20030138772 SEQ ID NO: 37), AAV42-6b (US20030138772 SEQ ID NO: 38), AAV43-1 (US20030138772 SEQ ID NO: 39), AAV43-5 (US20030138772 SEQ ID NO: 40), AAV43-12 (US20030138772 SEQ ID NO: 41), AAV43-20 (US20030138772 SEQ ID NO: 42), AAV43-21 (US20030138772 SEQ ID NO: 43), AAV43-23 (US20030138772 SEQ ID NO: 44). AAV43-25 (US20030138772 SEQ ID NO: 45), AAV44.1 (US20030138772 SEQ ID NO: 46), AAV44.5 (US20030138772 SEQ ID NO: 47), AAV223.1 (US20030138772 SEQ ID NO: 48), AAV223.2 (US20030138772 SEQ ID NO: 49), AAV223.4 (US20030138772 SEQ ID NO: 50), AAV223.5 (US20030138772 SEQ ID NO: 51), AAV223.6 (US20030138772 SEQ ID NO: 52), AAV223.7 (US20030138772 SEQ ID NO: 53), AAVA3.4 (US20030138772 SEQ ID NO: 54), AAVA3.5 (US20030138772 SEQ ID NO: 55), AAVA3.7 (US20030138772 SEQ ID NO: 56), AAVA3.3 (US20030138772 SEQ ID NO: 57), AAV42.12 (US20030138772 SEQ ID NO: 58), AAV44.2 (US20030138772 SEQ ID NO: 59), AAV42-2 (11820030138772 SEQ ID NO: 9), or variants thereof.

    [0061] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Publication No. US20150159173, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV2 (SEQ ID NO: 7 and 23 of US20150159173), rh20 (SEQ ID NO: 1 of US20150159173), rh32/33 (SEQ ID NO: 2 of US20150159173), rh39 (SEQ ID NO: 3, 20 and 36 of US20150159173), rh46 (SEQ ID NO: 4and 22 of US20150159173), rh73 (SEQ ID NO: 5 of US20150159173), rh74 (SEQ ID NO: 6 of US20150159173), AAV6.1 (SEQ ID NO: 29 of US20150159173), rh.8 (SEQ ID NO: 41 of US20150159173), rh.48.1 (SEQ ID NO: 44 of US20150159173), hu.44 (SEQ ID NO: 45 of US20150159173), hu.29 (SEQ ID NO: 42 of US20150159173), hu.48 (SEQ ID NO: 38 of US20150159173), rh.54 (SEQ ID NO: 49 of US20150159173), AAV2 (SEQ ID NO: 7 of US20150159173), cy.5 (SEQ ID NO: 8 and 24 of US20150159173), rh.10 (SEQ ID NO: 9 and 25 of US20150159173), rh.13 (SEQ ID NO: 10 and 26 of US20150159173), AAV1 (SEQ ID NO: 11 and 27 of US20150159173), AAV3 (SEQ ID NO: 12 and 28 of US20150159173), AAV6 (SEQ ID NO: 13 and 29 of US20150159173), AAV7 (SEQ ID NO: 14 and 30 of US20150159173), AAV8 (SEQ ID NO: 15 and 31 of US20150159173), hu.13 (SEQ ID NO: 16 and 32 of US20150159173), hu.26 (SEQ ID NO: 17 and 33 of US20150159173), hu.37 (SEQ ID NO: 1.8 and 34 of US20150159173), hu.53 (SEQ ID NO: 19 and 35 of US20150159173), rh.43(SEQ ID NO: 21 and 37 of US20150159173), rh2 (SEQ ID NO: 39 of US20150159173), rh.37(SEQ ID NO: 40 of US20150159173), rh.64 (SEQ ID NO: 43 of US20150159173), rh.48 (SEQ ID NO: 44 of US20150159173), ch.5 (SEQ ID NO 46 of US20150159173), rh.67 (SEQ ID NO: 47 of US20150159173), rh.58 (SEQ ID NO: 48 of US20150159173), or variants thereof including, but not limited to Cy5R1, Cy5R2, Cy5R3, Cy5R4, rh.13R, rh.37R2, rh.2R, rh.8R, rb 48, rh.48.2, rh.48.1.2, hu.44R1, hu.44R2, hu.44R3, hu.29R, ch.5R1, rh64R1rh64R2, AAV6.2, AAV6.1, AAV6.12, hu.48R1, hu.48R2, and hu.48R3.

    [0062] In some embodiments, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 7,198,951, the contents of which are herein incorporated by reference m their entirety, such as, but not limited to, AAV9 (SEQ ID NO: 1-3 of U.S. Pat. No. 7,198,951), AAV2(SEQ ID NO: 4 of U.S. Pat. No. 7,198,951), AAV1 (SEQ ID NO: 5 of U.S. Pat. No. 7,198,951), AAV3 (SEQ ID NO: 6of U.S. Pat. No. 7,198,951), and AAV8 (SEQ ID NO: 7 of U.S. Pat. No. 7,198,951).

    [0063] In some embodiments, the AAV serotype may be, or have, a mutation in the AAV9sequence as described by N Pulicheria et al. (Molecular Therapy 19(6): 1070-1078 (2011), herein incorporated by reference in its entirety), such as but not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, or AAV9.84.

    [0064] In some embodiments, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 6,156,303, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV3B (SEQ ID NO: 1 and 10 of U.S. Pat. No. 6,156,303), AAV6 (SEQ ID NO: 2, 7 and 11 of U.S. Pat. No. 6,156,303), AAV2 (SEQ ID NO: 3 and 8 of U.S. Pat. No. 6,156,303), AAV3A (SEQ ID NO: 4 and 9, of U.S. Pat. No. 6,156,303), or derivatives thereof.

    [0065] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Publication No. US20140359799, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV8 (SEQ ID NO: 1 of US20140359799), AAVDJ (SEQ ID NO: 2 and 3 of US20140359799), or variants thereof.

    [0066] In some embodiments, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal ofVirology 82(12): 5887-5911 (2008), herein incorporated by reference in its entirety). The amino acid sequence of AAVDJ 8may comprise two or more mutations in order to remove the heparin binding domain (HBD). As anon-limiting example, the AAV-DJ sequence described as SEQ ID NO: 1 in U.S. Pat. No. 7,588,772, the contents of which are herein incorporated by reference in their entirety, may comprise two mutations: (1) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutaxnine (Q; Gln) and (2) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, may comprise three mutations: (.1) K.406R where lysine (K: Lys) at amino acid 406 is changed to arginine (R; Arg), (2) R587Q where arginine (R, Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (3) R590T where arginine (R, Arg) at amino acid 590 is changed to threonine (T; Thr).

    [0067] In some embodiments, the AAV serotype may be, or have, a sequence of AAV4 as described in International Publication No. WO1998011244, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV4 (SEQ ID NO: 1-20of WO 1998011244).

    [0068] In some embodiments, the AAV serotype may be, or have, a mutation in the AAV2 sequence to generate AAV2G9 as described in International Publication No. WO2014144229 and herein incorporated by reference in its entirety.

    [0069] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2005033321, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV3-3 (SEQ ID NO: 217 of WO2005033321), AAV1 (SEQ ID NO: 219 and 202 of WO2005033321), AAV106.1/hu.37(SEQ ID NO: 10 of WO2005033321), AAV114.3/hu.40 (SEQ ID NO: 11 ofWO2005033321). AAV.127.2/hu.41 (SEQ ID NO: 6 and 8 of WO2005033321), AAV128.3/hu.44 (SEQ ID NO: 81of WO2005033321), AAV130.4/hu.48 (SEQ ID NO: 78 of WO2005033321), AAV145.1/hu.53 (SEQ ID NO: 176 and 177 of WO2005033321), AAV145.6/hu.56 (SEQ ID NO: 168 and 192 of WO2005033321), AAV 16.12/hu.11 (SEQ ID NO: 153 and 57 of WO2005033321), AAV16.8/hu.10(SEQ ID NO: 156 and 56 of WO2005033321), AAV161.10/hu.60 (SEQ ID NO: 170 of WO2005033321), AAV161.6/hu.61 (SEQ ID NO: 174 of WO2005033321), AAV1-7/rh,48 (SEQ ID NO: 32 of WO2005033321), AAV1-8/rh.49 (SEQ ID NO: 103 and 25 of WO2005033321), AAV2 (SEQ ID NO: 211 and 221 of WO2005033321), AAV2-15/rh.62 (SEQ ID NO: 33 and 114 of WO2005033321), AAV2-3/rh.61 (SEQ ID NO: 21 ofWO2005033321), AAV2-4/rh.50 (SEQ ID NO: 23 and 108 of WO2005033321), AAV2-5/rh.51 (SEQ ID NO: 104and 22 of WO2005033321), AAV3/hu.6 (SEQ ID NO: 5 and 84 of WO2005033321), AAV3/hu.9 (SEQ ID NO: 155 and 58 of WO2005033321), AAV3-11/rh.53 (SEQ ID NO: 186 and 176 of WO2005033321), AAV3-3 (SEQ ID NO: 200 of WO2005033321), AAV33.12/hu.17 (SEQ ID NO: 4 of WO2005033321), AAV33.4/hu.15 (SEQ ID NO: 50 of WO2005033321), AAV33.8/hu.16 (SEQ ID NO: 51 of WO2005033321), AAV3-9/rh.52 (SEQ ID NO: 96 and 18 of WO2005033321), AAV4-19/rh.55 (SEQ ID NO: 117 of WO2005033321), AAV4-4 (SEQ ID NO: 201 and 218 of WO2005033321), AAV4-9/rh.54 (SEQ ID NO: 116 ofWP2005033321), AAV5 (SEQ ID NO: 199 find 216 of WO2005033321), AAV52.1/hu.20 (SEQ ID NO: 63 of WO 2005033321), AAV52//hu.19 (SEQ ID NO: 133 of WO200503332I), AAV5-22/rh.58 (SEQ ID NO: 27 of WO2005033321), AAV5-3/rh.57 (SEQ ID NO: 105 of WO2005033321), AAV5-3/rh,57 (SEQ ID NO: 26 of WO2005033321), AAV58.2/hu.25 (SEQ ID NO: 49 of WO2005033321), AAV6 (SEQ ID NO: 203 and 220 of WO2005033321), AAV7 (SEQ ID NO: 222 and 213 of WO2005033321), AAV7.3/hu.7 (SEQ ID NO: 55 of WO2005033321), AAV8 (SEQ ID NO: 223 and 214 of WO2005033321), AAVH-1/hu.1 (SEQ ID NO: 46 of WO2005033321), AAVH-5/hu.3 (SEQ ID NO: 44 of WO2005033321), AAVhu.1 (SEQ ID NO: 144 of WO2005033321). AAV hu.10 (SEQ ID NO: 156 of WO2005033321), AAVhu. 11 (SEQ ID NO: 153 of WO2005033321), AAVhu.12 (SEQ ID NO: 59 of WO2005033321), AAVhu.13(SEQ ID NO: 129 of WO2005033321), AAVhu.14/AAV9 (SEQ ID NO: 123 and 3 of WO2005033321), AAVhu.15 (SEQ ID NO: 147 of WO2005033321), AAVhu.16 (SEQ ID NO: 148 of WO2005033321), AAVhu.17 (SEQ ID NO: 83 of WO2005033321), AAVhu.18 (SEQ ID NO: 149 of WO2005033321), AAVhu.19 (SEQ ID NO: 133 ofWO200503332), AAVhu.2 (SEQ ID NO: 143 of WO2005033321), AAVhu.20 (SEQ ID NO: 134 of WO2005033321), AAVhu.21 (SEQ ID NO: 135 of WO2005033321), AAVhu.22 (SEQ ID NO: 138 of WO2005033321), AAVhu.23.2 (SEQ ID NO: 137 of WO2005033321), AAVhu.24 (SEQ ID NO: 136 of WO2005033321), AAVhu.25 (SEQ ID NO: 146 of WO2005033321), AAVhu.27 (SEQ ID NO: 140 of WO2005033321), AAVhu.29 (SEQ ID NO: 132 of WO2005033321), AAVhu.3 (SEQ ID NO: 145 of WO2005033321 ), AAVhu.31 (SEQ ID NO: 121 of WO2005033321), AAVhu.32 (SEQ ID NO: 122 of WO2005033321), AAVhu.34 (SEQ ID NO: 125 of WO2005033321), AAVhu.35 (SEQ ID NO: 164 of WO2005033321), AAVhu.37 (SEQ ID NO: 88 of WO2005033321), AAVhu.39 (SEQ ID NO: 102 of WO2005033321), AAVhu.4 (SEQ ID NO: 141 of WO2005033321), AAVhu.40 (SEQ ID NO: 87 of WO2005033321), AAVhu.41 (SEQ ID NO: 91 of WO2005033321), AAVhu.42 (SEQ ID NO: 85 of WO2005033321), AAVhu.43 (SEQ ID NO: 160 of WO2005033321), AAVhu.44 (SEQ ID NO: 144 of WO2005033321), AAVhu.45 (SEQ ID NO: 127 of WO2005033321), AAVhu.46 (SEQ ID NO: 159 of WO2005033321). AAVhu.47 (SEQ ID NO: 128 of WO2005033321 i. AAVhu.48 (SEQ ID NO: 157 of WO2005033321), AAVhu.49 (SEQ ID NO: 189 of WO2005033321), AAVhu.51 (SEQ ID NO: 190 of WO2005033321), AAVhu.52 (SEQ ID NO: 191 of WO2005033321), AAVhu.53 (SEQ ID NO: 186 of WO2005033321), AAVhu.54 (SEQ ID NO: 88 of WO2005033321), AAVhu.55 (SEQ ID NO: 187 of WO2005033321), AAVhu.56 (SEQ ID NO: 192 of WO2005033321), AAVhu.57 (SEQ ID NO: 193 of WO2005033321), AAVhu.58(SEQ ID NO: 194 of WO2005033321), AAVhu.6 (SEQ ID NO: 84 of WO2005033321), AAVhu.60 (SEQ ID NO: 184 of WO2005033321), AAVhu 61 (SEQ ID NO: 185 of WO2005033321), AAVhu.63 (SEQ ID NO: 195 of WO2005033321), AAVhu.64 (SEQ ID NO: 196 of WO2005033321), AAVhu.66 (SEQ ID NO: 197 of WO2005033321), AAVhu.67 (SEQ ID NO: 198 of WO2005033321), AAVhu.7 (SEQ ID NO: 150 of WO2005033321), AAVhu.8(SEQ ID NO: 12 of WO200503332I), AAVhu.9 (SEQ ID NO: 155 of WO2005033321), AAVLG-10G/rh.40 (SEQ ID No: 14 of WO2005033321), AAVLG-4/rh.38 (SEQ ID NO: 86 of WO2005033321), AAVLG-4/rh.38 (SEQ ID No: 7 of WO2005033321), AAVN721-8/rh.43 (SEQ ID NO: 163 of WO2005033321), AAVN721-8/rh.43 (SEQ ID NO: 43 of WO2005033321), AAVpi.1 (SEQ ID NO: 28 of WO2005033321), AAVpi.2 (SEQ ID NO: 30 of WO2005033321), AAVpi.3 (SEQ ID NO: 29 of WO2005033321), AAVrh.38 (SEQ ID NO: 86 of WO2005033321), AAVrh.40 (SEQ ID NO: 92 of WO2005033321), AAVrh.43 (SEQ ID NO: 163 of WO02005033321), AAVrh.44 (SEQ ID NO: 34 of WO2005033321), AAVrh.45 (SEQ ID NO: 41 of WO2005033321), AAVrh.47 (SEQ ID NO: 38 of WO2005033321), AAVrh.48 (SEQ ID NO: 115 of WO2005033321). AAVrh.49 (SEQ ID NO: 103 of WO2005033321), AAVrh.50 (SEQ ID NO: 108 ofWO2005033321), AAVrh.51 (SEQ ID NO: 104 of WO2005033321), AAVrh. 52 (SEQ ID NO: 96 of WO2005033321), AAVrh.53 (SEQ ID NO: 97 of WO2005033321), AAVrh.55 (SEQ ID NO: 37 of WO2005033321), AAVrh.56 (SEQ ID NO: 152 of WO2005033321), AAVrh.57 (SEQ ID NO: 105 of WO2005033321), AAVrh.58 (SEQ ID NO: 106 of WO2005033321), AAVrh.59 (SEQ ID NO: 42 of WO2005033321), AAVrh. 60(SEQ ID NO: 31 of WO2005033321), AAVrh.61 (SEQ ID NO: 107 of WO2005033321), AAVrh.62 (SEQ ID NO: 114 of WO2005033321), AAVrh.64 (SEQ ID NO: 99 of WO2005033321), AAVrh.65 (SEQ ID NO: 35 of WO2005033321), AAVrh.68 (SEQ ID NO: 16 of WO2005033321), AAVrh.69 (SEQ ID NO: 39 of WO2005033321), AAVrh.70 (SEQ ID NO: 20 of WO2005033321), AAVrh.72 (SEQ ID NO: 9 of WO2005033321), or variants thereof including, but not limited to, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVcy.6, AAVrh.12, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.25/42 15, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh 14. Non-limiting examples of variants include SEQ ID NO: 13, 15, 17, 19, 24, 36, 40, 45, 47, 48, 51-54, 60-62, 64-77, 79, 80, 82, 89, 90, 93-95, 98, 100, 101, 109-113, 118-120, 124, 126, 131, 139, 142, 151,154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, 224-236, of WO2005033321, the contents of which are herein incorporated by reference in their entirety.

    [0070] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015168666, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVrh8R (SEQ ID NO: 9 of WO2015168666), AAVrh8R A586R mutant (SEQ ID NO: 10 of WO2015168666), AAVrh8R R533A mutant (SEQ ID NO: 11 of WO2015168666), or variants thereof.

    [0071] In some embodiments, the AAV seroty pe may be, or have, a sequence as described in U.S. Pat. No. 9,233.131, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVhE1.1 (SEQ ID NO:44 of U.S. Pat. No. 9,233,131), AAVhEr1.5 (SEQ ID NO:45 of U.S. Pat. No. 9,233,131), AAVhER1.14 (SEQ ID NO:46 of U.S. Pat. No. 9,233,131), AAVbEr1.8 (SEQ ID NO:47 of U.S. Pat. No. 9,233,131), AAVhEr1.16 (SEQ IDNO:48 of U.S. Pat. No. 9,233,131), AAVhEr1.18 (SEQ ID NO: 49 of U.S. Pat. No. 9,233,131), AAVhEr1.35 (SEQ ID NO:50 of U.S. Pat. No. 9,233,131), AAVhEr1.7 (SEQ ID NO: 51 of U.S. Pat. No. 9,233,131), AAVhEr1.36 (SEQ ID NO: 52 of U.S. Pat. No. 9,233,131), AAVhEr2.29 (SEQ ID NO:53 of U.S. Pat. No. 9,233,131), AAVhEr2.4 (SEQ ID NO:54 of U.S. Pat. No. 9,233,13131), AAVhEr2.16 (SEQ ID NO:55 of U.S. Pat. No. 9,233,131), AAVhEr2.30 (SEQ ID NO:56 of U.S. Pat. No. 9,233,131), A A VhEr2.31 (SEQ ID NO: 58 of U.S. Pat. No. 9,233,131 ), AAVhEr2.36 (SEQ ID NO: 57 of U.S. Pat. No. 9,233,131), AAVbER1.23 (SEQ ID NO:53 of U.S. Pat. No. 9,233,131), AAVhEr3.1 (SEQ IDNO:59 of U.S. Pat. No. 9,233,131), AAV2.5T (SEQ ID NO:42 of U.S. Pat. No. 9,233,131), or variants thereof.

    [0072] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150376607, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-PAEC (SEQ ID NO: 1 of US20150376607), AAV-LK01 (SEQ ID NO: 2 of US20150376607), AAV-LK.02 (SEQ ID NO: 3 of US20150376607), AAV-LK03 (SEQ ID NO: 4 of US20150376607), AAV-LK04(SEQ ID NO: 5 of US20150376607), AAV-LK05 (SEQ ID NO: 6 of US20150376607), AAV-LK.06 (SEQ ID NO: 7 of US20150376607), AAV-LK07 (SEQ ID NO: 8 of US20150376607), AAV-LK08 (SEQ ID NO: 9 of US20150376607), AAV-LK09 (SEQ ID NO: 10 of US20150376607), AAV-LK10 (SEQ ID NO: 11 of US20150376607), AAV-LK11 (SEQ ID NO: 12 of US20150376607), AAV-LK12 (SEQ ID NO: 13 of US20150376607), AAV-LK13 (SEQ ID NO: 14 of US20150376607), AAV-LK14 (SEQ ID NO: 15 of US20150376607), AAV-LK15 (SEQ ID NO: 16 of US20150376607), AAV-LK16 (SEQ ID NO: 17 of US20150376607), AAV-LK17 (SEQ ID NO: 18 of US20150376607), AAV-LK18 (SEQ ID NO: 19 of US20150376607). AAV-LK19 (SEQ ID NO: 20 of US20150376607), AAV-PAEC2 (SEQ ID NO: 21 of US20150376607), AAV-PAEC4 (SEQ ID NO: 22 of US20150376607), AAV-PAEC6(SEQ ID NO: 23 of US20150376607), AAV-PAEC7 (SEQ ID NO: 24 of US20150376607), AAV-PAEC8 (SEQ ID NO:25 of US20150376607), AAV-PAEC11 (SEQ ID NO: 26 of US20150376607), AAV-PAEC12 (SEQ ID NO: 27, of US20150376607), or variants thereof.

    [0073] In some embodiments, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,163,261, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-2-pre-miRN A101 (SEQ ID NO: 1 of U.S. Pat. No. 9,163,261), or variants thereof.

    [0074] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150376240, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-8h (SEQ ID NO: 6of US20150376240), AAV-8b (SEQ ID NO: 5 of US20150376240), AAV-h (SEQ ID NO: 2 of US20150376240), AAV-b (SEQ ID NO: 1 of US20150376240), or variants thereof.

    [0075] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017295, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV SM 10-2 (SEQ ID NO: 22 of US20160017295), AAV Shuffle 100-1 (SEQ ID NO: 23 of US20160017295), AAV Shuffle 100-3 (SEQ ID NO: 24 of US20160017295), AAV Shuffle 100-7 (SEQ ID NO: 25 of US20160017295), AAV Shuffle 10-2 (SEQ ID NO: 34 of US20160017295), AAV Shuffle 10-6(SEQ ID NO: 35 of US20160017295), AAV Shuffle 10-8 (SEQ ID NO: 36 of US20160017295), AAV Shuffle 100-2 (SEQ ID NO: 37 of US20160017295), AAV SM 10-1 (SEQ ID NO: 38 of US20160017295), AAV SM 10-8 (SEQ ID NO: 39 of US20160017295), AAV SM 100-3 (SEQ ID NO: 40 of US20160017295), AAV SM 100-10 (SEQ ID NO: 41 of US20160017295), or variants thereof.

    [0076] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150238550, the contents of which are herein incorporated by reference in their entirety, such, as, but not limited to, BNP61 AAV (SEQ ID NO: 1 of US20150238550), BNP62 AAV (SEQ ID NO: 3 of US20150238550), BNP63 AAV (SEQ ID NO: 4 of US20150238550), or valiants thereof.

    [0077] In some embodiments, the AAV serotype may be or may have a sequence as described in United States Patent Publication No. US20150315612, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVrh.50 (SEQ ID NO: 108 of US2015031561.2), AAVrh.43 (SEQ ID NO: 163 of US20150315612), AAVrh.62 (SEQ ID NO: 114 of US20150315612), AAVrh.48 (SEQ ID NO: 11.5 of US20150315612), AAVhu.19 (SEQ ID NO: 133 of US20150315612), AAVhu.11 (SEQ ID NO: 153 of US20150315612), AAVhu.53 (SEQ ID NO: 186 of US20150315612), AAV4-8/rh.64 (SEQ ID NO: 15 of US20150315612), AAVLG-9/hu.39 (SEQ ID NO: 24 of US20150315612), AAV54.5/hu.23 (SEQ ID NO: 60 of US20150315612), AAV54.2/hu.22 (SEQ IDNO: 67 of US20150315612), AAV54.7/hu.24 (SEQ ID NO: 66 of US20150315612), AAV54.1/hu.21 (SEQ ID NO: 65 of US20150315612), AAV.54.4R/hu.27 (SEQ ID NO: 64 of US20150315612), AAV46.2/hu.28 (SEQ ID NO: 68 of US20150315612), AAV46.6/hu.29 (SEQ ID NO: 69 of US20150315612), AAV128.1/hu.43 (SEQ ID NO: 80 of US20150315612), or variants thereof.

    [0078] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015121501, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, true type AAV (itAAV) (SEQ ID NO: 2 of WO2015121501), UPenn AAV10 (SEQ ID NO: 8 of WO2015121501), Japanese AAV10 (SEQ ID NO: 9 of WO201512150), or variants thereof.

    [0079] According to the present invention, AAV capsid serotype selection or use may be from a variety of species. In one embodiment, the AAV may be an avian AAV (AAAV). The AAAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,238,800, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAAV (SEQ ID NO: 1, 2, 4, 6, 8, 10, 12, and 14 of U.S. Pat. No. 9,238,800), or variants thereof.

    [0080] In one embodiment, the AAV may be a bovine AAV (BAAV). The BAAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,193,769, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BAAV (SEQ ID NO: 1 and 6 of U9193769), or variants thereof. The BAAV serotype may be or have a sequence as described in U.S. Pat. No. 7,427,396, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BAAV (SEQ ID NO: 5 and 6 of U.S. Pat. No. 7,427,396), or variants thereof.

    [0081] In one embodiment, the AAV may be a caprine AAV. The caprine AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 7,427,396, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, caprine AAV (SEQ ID NO: 3 of U.S. Pat. No. 7,427,396), or variants thereof.

    [0082] In other embodiments, the AAV may be engineered, as a hybrid AAV from two or more parental serotypes. In one embodiment, the AAV may be AAV2G9 which comprises sequences from AAV2 and AAV9. The AAV2G9 AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017005, the contents of which are herein incorporated by reference in its entirety.

    [0083] In one embodiment, the AAV may be a serotype generated by the AAV9 capsid library with mutations in amino acids 390-627 (VPS numbering) as described by Pulicherla et al (Molecular Therapy 19(6):1070-1078 (2011), the contents of which are herein incorporated by reference in their entirety. The serotype and corresponding nucleotide and amino acid substitutions may be, but is not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and 1479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231 A, F4111), AAV9.9 (G1203A, G1785T: W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C. A1769T; T568P, Q590L). AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C. T1560GC, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAY9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T, A1737G: N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T. A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1301A. A1405C, C1664T. G1811T; R134Q, S469R, A555V, G604V), AAV9.54 (C1531A, T1609A; L511, L537M), AAV9.55 (T1605A; F535L), AAV9.58 (C1475T, CI579A; T492I, H527N), AAV.59 (T1336C; Y446H), AAV9.61 (A1493T; N4981), AAV9.64 (C1531A, A1617T; L5111), AAV9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510A; P504T), AAV9.80 (G1441 A, G481R), AAV9.83 (C1402A, A1500T; P468T, E500D), AAV9.87 (T1464C; T1468C: S490P), AAV9.90 (A 1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806C; L439R, K.5281), AAV9.93 (A1273G, A142.1G, A1.638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L) and AAV9.95 (T1605A; F535L).

    [0084] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2016049230, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAVF1/HSC1 (SEQ ID NO: 2 and 20 of WO2016049230), AAVF2/HSC2 (SEQ ID NO: 3 and 21 of WO2016049230), AAVF3/HSC3 (SEQ ID NO: 5 and 22 of WO2016049230), AAVF4/HSC4 (SEQ ID NO: 6 and 23 of WO2016049230), AAVF5/HSC5 (SEQ ID NO: 11 and 25 of WO2016049230), AAVF6/HSC6 (SEQ ID NO: 7 and 24 of WO2016049230), AAVF7/HSC7 (SEQ ID NO: 8 and 27 of WO2016049230), AAVF8/HSC8 (SEQ ID NO: 9 and 28 of WO2016049230), AAVF9/HSC9(SEQ ID NO: 10 and 29 of WO2016049230), AAVF11/HSC11 (SEQ ID NO: 4 and 26 of WO2016049230), AAVF12/HSC12 (SEQ ID NO: 12 and 30 of WO2016049230), AAVF13/HSC13 (SEQ ID NO: 14 and 31 of WO2016049230), AAVF14/HSC14 (SEQ ID NO: 15 and 32 of WO2016049230), AAVF15/HSC15 (SEQ ID NO: 16 and 33 of WO2016049230), AAVF16/HSC16 (SEQ ID NO: 17 and 34 of WO2016049230), AAVF17/HSC17 (SEQ ID NO: 13 and 35 of WO2016049230), or variants or derivatives thereof.

    [0085] In some embodiments, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 8,734,809, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV CBr-E1 (SEQ ID NO: 13 and 87 of U.S. Pat. No. 8,734,809), AAV CBr-E2 (SEQ ID NO: 14 and 88 of U.S. Pat. No. 8,734,809), AAV CBr-E3 (SEQ ID NO: 15 and 89 of U.S. Pat. No. 8,734,809), AAV CBr-E4 (SEQ ID NO: 16 and 90 of U.S. Pat. No. 8,734,809), AAV CBr-E5 (SEQ ID NO: 17 and 91 of U.S. Pat. No. 8,734,809), AAV CBr-e5 (SEQ ID NO: 18 and 92 of U.S. Pat. No. 8,734,809), AAV CBr-E6 (SEQ ID NO: 19 and 93 of U.S. Pat. No. 8,734,809), AAV CBr-E7 (SEQ ID NO: 20 and 94 of U.S. Pat. No. 8,734,809). AAV CBr-E8 (SEQ ID NO: 21 and 95 of U.S. Pat. No. 8,734,809), AAV CLv-D1 (SEQ ID NO: 22 and 96 of U.S. Pat. No. 8,734,809), AAV CLv-D2 (SEQ ID NO: 23 and 97 of U.S. Pat. No. 8,734,809), AAV CLv-D3 (SEQ ID NO: 24 and 98 of U.S. Pat. No. 8,734,809), AAV CLv-D4 (SEQ ID NO: 25 and 99 of U.S. Pat. No. 8,734,809), AAV CLv-D5 (SEQ ID NO: 26 and 100 of U.S. Pat. No. 8,734,809), AAV CLv-D6 (SEQ ID NO: 27 and 101 of U.S. Pat. No. 8,734,809), AAV CLv-D7 (SEQ ID NO: 28 and 102 of U.S. Pat. No. 8,734,809), AAV CLv-D8 (SEQ ID NO: 29 and 103 of U.S. Pat. No. 8,734,809), AAV CLv-E1 (SEQ ID NO: 13 and 87 of U.S. Pat. No. 8,734,809), AAV CLv-R1 (SEQ ID NO: 30 and 104 of U.S. Pat. No. 8,734,809), AAV CLv-R2 (SEQ ID NO: 31 and 105 of U.S. Pat. No. 8,734,809), AAV CLv-R3 (SEQ ID NO: 32 and 106 of U.S. Pat. No. 8,734,809), AAV CLv-R4 (SEQ ID NO: 33 and 107 of U.S. Pat. No. 8,734,809), AAV CLv-R5 (SEQ ID NO: 34 and 108 of U.S. Pat. No. 8,734,809), AAV CLv-R6 (SEQ ID NO: 35 and 109 of U.S. Pat. No. 8,734,809), AAV CLv-R7 (SEQ ID NO: 36 and 110 of U.S. Pat. No. 8,734,809), AAV CLv-R8 (SEQ ID NO: 37 and 111 of U.S. Pat. No. 8,734,809), AAV CLv-R9 (SEQ ID NO: 38 and 112 of U.S. Pat. No. 8,734,809), AAV CLg-F1 (SEQ ID NO: 39 and 113 of U.S. Pat. No. 8,734,809), AAV CLg-F2 (SEQ ID NO: 40 and 114 of U.S. Pat. No. 8,734,809), AAV CLg-F3 (SEQ ID NO: 41 and 115 of U.S. Pat. No. 8,734,809), AAV CLg-F4 (SEQ ID NO: 42 and 116 of U.S. Pat. No. 8,734,809), AAV CLg-F5 (SEQ ID NO: 43 and 117 of U.S. Pat. No. 8,734,809), AAV CLg-F6 (SEQ ID NO: 43 and 117 of U.S. Pat. No. 8,734,809), AAV CLgF7 (SEQ ID NO: 44 and 118 of U.S. Pat. No. 8,734,809), AAV CLg-F8 (SEQ ID NO: 43 and 117 of U.S. Pat. No. 8,734,809), AAV CSp-1 (SEQ ID NO: 45 and 119 of U.S. Pat. No. 8,734,809), AAV CSp-10 (SEQ ID NO: 46 and 120 of U.S. Pat. No. 8,734,809), AAV CSp-11 (SEQ ID NO: 47 and 121 of U.S. Pat. No. 8,734,809), AAV CSp-2 (SEQ ID NO: 48 and 122 of U.S. Pat. No. 8,734,809), AAV CSp-3 (SEQ ID NO: 49 and 123 of U.S. Pat. No. 8,734,809), AAV CSp4 (SEQ ID NO: 50 and 124 of U.S. Pat. No. 8,734,809), AAV CSp-6 (SEQ ID NO: 51 and 125 of U.S. Pat. No. 8,734,809), AAV CSp-7 (SEQ ID NO: 52 and 126 of U.S. Pat. No. 8,734,809), AAV CSp-8 (SEQ ID NO: 53 and 127 of U.S. Pat. No. 8,734,809), AAV CSp-9(SEQ ID NO: 54 and 128 of U.S. Pat. No. 8,734,809), AAV CIit-2 (SEQ ID NO: 55 and 129 of U.S. Pat. No. 8,734,809), AAV CHt-3 (SEQ ID NO: 56 and 130 of U.S. Pat. No. 8,734,809), AAV CKd-I (SEQ ID NO: 57 and 131 of U.S. Pat. No. 8,734,809), AAV CKd-10 (SEQ ID NO: 58 and 132 of U.S. Pat. No. 8,734,809), AAV CKd-2 (SEQ ID NO: 59 and 133 of U.S. Pat. No. 8,734,809), AAV CKd-3 (SEQ ID NO: 60 and 134 of U.S. Pat. No. 8,734,809), AAV CKd-4 (SEQ ID NO: 61 and 135 of U.S. Pat. No. 8,734,809), AAV CKd-6 (SEQ ID NO: 62 and 136 of U.S. Pat. No. 8,734,809), AAV CKd-7 (SEQ ID NO: 63 and 137 of U.S. Pat. No. 8,734,809), AAV CKd-8 (SEQ ID NO: 64 and 138 of U.S. Pat. No. 8,734,809), AAV CLv-1 (SEQ ID NO: 35 and 139 of U.S. Pat. No. 8,734,809), AAV CLv-12 (SEQ ID NO: 66 and 140 of U.S. Pat. No. 8,734,809), AAV CLv-13 (SEQ ID NO: 67 and 141 of U.S. Pat. No. 8,734,809), AAV CLv-2 (SEQ ID NO: 68 and 142 of U.S. Pat. No. 8,734,809), AAV CLv-3 (SEQ ID NO: 69 and 143 of U.S. Pat. No. 8,734,809), AAV CI,v-4 (SEQ ID NO: 70 and 144 of U.S. Pat. No. 8,734,809), AAV CLv-6 (SEQ ID NO: 71and 145 of U.S. Pat. No. 8,734,809), AAV CLv-8 (SEQ ID NO: 72 and 146 of U.S. Pat. No. 8,734,809), AAV CKd-B1 (SEQ ID NO: 73 and 147 of U.S. Pat. No. 8,734,809), AAV CKd-B2 (SEQ ID NO: 74 and 148 of U.S. Pat. No. 8,734,809), AAV CKd-B3 (SEQ ID NO: 75 and 149 of U.S. Pat. No. 8,734,809), AAV CKd-B4 (SEQ ID NO: 76 and 150 of U.S. Pat. No. 8,734,809), AAV CKd-B5 (SEQ ID NO: 77 and 151 of U.S. Pat. No. 8,734,809), AAV CKd-B6 (SEQ ID NO: 78 and 152 of U.S. Pat. No. 8,734,809), AAV CK.d-B7 (SEQ ID NO: 79 and 153 of U.S. Pat. No. 8,734,809), AAV CKd-B8 (SEQ ID NO: 80 and 154 of U.S. Pat. No. 8,734,809), AAV CKd-H1 (SEQ ID NO: 81and 155 of U.S. Pat. No. 8,734,809), AAV CKd-H2 (SEQ ID NO: 82 and 156 of U.S. Pat. No. 8,734,809), AAV CKd-H3 (SEQ ID NO: 83 and. 1.57 of U.S. Pat. No. 8,734,809), AAV CKd-H4 (SEQ ID NO: 84 and 158 of U.S. Pat. No. 8,734,809), AAV CKd-H5 (SEQ ID NO: 85 and 159 of U.S. Pat. No. 8,734,809), AAV CKd-H6 (SEQ ID NO: 77 and 151 of U.S. Pat. No. 8,734,809), AAV CHt-1 (SEQ ID NO: 86 and 160 of U.S. Pat. No. 8,734,809), AAV CLv1-1 (SEQ ID NO: 171 of U.S. Pat. No. 8,734,809), AAV CLv1-2(SEQ ID NO: 172 of U.S. Pat. No. 8,734,809), AAV CLv1-3 (SEQ ID NO: 173 of U.S. Pat. No. 8,734,809), AAV CLv1-4 (SEQ ID NO: 174 of U.S. Pat. No. 8,734,809), AAV Clv1-7 (SEQ ID NO: 175 of U.S. Pat. No. 8,734,809), AAV Clv 1-8 (SEQ ID NO: 176 of U.S. Pat. No. 8,734,809), AAV Clv1-9 (SEQ ID NO: 177 of U.S. Pat. No. 8,734,809), AAV Clv1-1.0 (SEQ ID NO: 1.78 of U.S. Pat. No. 8,734,809), AAV. VR-355 (SEQ ID NO: 181 of U.S. Pat. No. 8,734,809), AAV.hu.48R3 (SEQ ID NO: 183 of U.S. Pat. No. 8,734,809), or variants or derivatives thereof.

    [0086] In some embodiments, the AAV serotype raay be, or have, a sequence as described in International Publication No. WO2016065001, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV CHt-P2 (SEQ ID NO: 1 and 51 of WO2016065001), AAV CHt-P.5 (SEQ ID NO: 2 and 52 of WO2016065001). AAV CH1-P9 (SEQ ID NO: 3 and 53 of WO2016065001), AAV CBr-7.1 (SEQ ID NO: 4 and 54 of WO2016065001), AAV CBr-7.2 (SEQ ID NO: 5 and 55 of WO2016065001), AAV CBr-7.3 (SEQ ID NO: 6 and 56 of WO2016065001), AAV CBr-7.4 (SEQ ID NO: 7 and 57 of WO2016065001), AAV CBr-7.5 (SEQ ID NO: 8 and 58 of WO2016065001), AAV CBr-7.7 (SEQ ID NO: 9 and 59 of WO2016065001), AAV CBr-7.8 (SEQ ID NO: 10 and 60 of WO2016065001), AAV CBr-7.10 (SEQ ID NO: 11 and 61 of WO2016065001), AAV CKd-N3 (SEQ ID NO: 12 and 62 of WO2016065001), AAV CKd-N4 (SEQ ID NO: 13 and 63 of WO2016065001), AAV CKd-N9 (SEQ ID NO: 14 and 64 of WO20160650011 AAV CLv-L4 (SEQ ID NO: 15 and 65 of WO2016065001), AAV CLv-L5 (SEQ ID NO: 16 and 66 of WO2016065001), AAV CLv-L6 (SEQ ID NO: 17 and 67 of WO2016065001), AAV CLv-K1 (SEQ ID NO: 18 and 68 of WO2016065001), AAV CLv-K3 (SEQ ID NO: 19 and 69 of WO2016065001), AAV CLv-K6 (SEQ ID NO: 20 and 70 of WO2016065001), AAV CLv-M1 (SEQ ID NO: 21 and 71 of WO2016065001), AAV CLv-M11 (SEQ ID NO: 22 and 72 of WO2016065001), AAV CLv-M2 (SEQ ID NO: 23 and 73 of WO2016065001), AAV CLv-M5 (SEQ ID NO: 24 and 74 of WO2016065001), AAV CLv-M6 (SEQ ID NO: 25 and 75 of WO2016065001), AAV CLv-M7 (SEQ ID NO: 26 and 76 of WO2016065001), AAV CLv-M8 (SEQ ID NO: 27 and 77 of WO2016065001), AAV CLv-M9 (SEQ ID NO: 28 and 78 of WO2016065001), CHt-P1 (SEQ IDNO: 29 and 79 of WO2016065001), AAV CHt-P6 (SEQ ID NO: 30 and 80 of WO2016065001), AAV CHt-P8 (SEQ IDNO: 31 and 81 of WO2016065001), AAV CHt-6.1 (SEQ ID NO: 32 and 82 of WO2016065001). AAV CHt-6.10 (SEQ ID NO: 33 and 83 of WO2016065001), AAV CHt-6.5 (SEQ ID NO: 34 and 84 of WO2016065001), AAV CHt-6.6 (SEQ ID NO: 35 and 85 of WO2016065001), AAV CHt-6.7 (SEQ ID NO: 36 and 86 of WO2016065001), AAV CHt-6.8 (SEQ ID NO: 37 and 87 of WO2016065001), AAV CSp-8.10 (SEQ ID NO: 38 and 88 of WO2016065001), AAV CSp-8.2 (SEQ ID NO: 39 and 89 of WO2016065001), AAV CSp-8.4 (SEQ ID NO: 40 and 90 of WO2016065001), AAV CSp-8.5 (SEQ ID NO: 41 and 91 of WO2016065001), AAV CSp-8.6 (SEQ ID NO: 42 and 92 of WO2016065001), AAV CSp-8.7 (SEQ ID NO: 43 and 93 of WO2016065001), AAV CSp-8.8 (SEQ ID NO: 44 and 94 of WO2016065001), AAV CSp-8.9 (SEQ ID NO: 45 and 95 of WO2016065001), AAV CBr-B7.3 (SEQ ID NO: 46 and 96 of WO2016065001), AAV CBr-R7.4 (SEQ ID NO: 47 and 97 of WO2016065001), AAV3B (SEQ ID NO: 48 and 98 of WO2016065001). AAV4 (SEQ ID NO: 49 and 99 of WO2016065001). AAV5 (SEQ ID NO: 50 and 100 ofWO2016065001), or variants or derivatives thereof.

    [0087] In one embodiment, the AAV may be a seroty pe selected from any of those found in Table 1.

    [0088] In one embodiment, the AAV may comprise a sequence, fragment or variant thereof. of the sequences in Table 1.

    [0089] In one embodiment, the AAV may be encoded by a sequence, fragment or variant as

    [0090] described in Table 1.

    TABLE-US-00001 TABLE 1 AAV Serotypes SEQ Serotype ID NO Reference Information AAV1 1 US20150159173 SEQ ID NO: 11, US20150315612 SEQ ID NO: 202 AAV1 2 US20160017295 SEQ ID NO: 1, US20030138772 SEQ ID NO: 64, US20150159173 SEQ ID NO: 27, US20150315612 SEQ ID NO: 219, U.S. Pat. No. 7,198,951 SEQ ID NO: 5 AAV1 3 US20030138772 SEQ ID NO: 6 AAV1.3 4 US20030138772 SEQ ID NO: 14 AAV10 5 US20030138772 SEQ ID NO: 117 AAV10 6 WO2015121501 SEQ ID NO: 9 AAV10 7 WO2015121501 SEQ ID NO: 8 AAV11 8 US20030138772 SEQ ID NO: 118 AAV12 9 US20030138772 SEQ ID NO: 119 AAV2 10 US20150159173 SEQ ID NO: 7, US20150315612 SEQ ID NO: 211 AAV2 11 US20030138772 SEQ ID NO: 70, US20150159173 SEQ ID NO: 23, US20150315612 SEQ ID NO: 221, US20160017295 SEQ ID NO: 2, U.S. Pat. No. 6,156,303 SEQ ID NO: 4, U.S. Pat. No. 7,198,951 SEQ ID NO: 4, WO2015121501 SEQ ID NO: 1 AAV2 12 U.S. Pat. No. 6,156,303 SEQ ID NO: 8 AAV2 13 US20030138772 SEQ ID NO: 7 AAV2 14 U.S. Pat. No. 6,156,303 SEQ ID NO: 3 AAV2.5T 15 U.S. Pat. No. 9,233,131 SEQ ID NO: 42 AAV223.10 16 US20030138772 SEQ ID NO: 75 AAV223.2 17 US20030138772 SEQ ID NO: 49 AAV223.2 18 US20030138772 SEQ ID NO: 76 AAV223.4 19 US20030138772 SEQ ID NO: 50 AAV223.4 20 US20030138772 SEQ ID NO: 73 AAV223.5 21 US20030138772 SEQ ID NO: 51 AAV223.5 22 US20030138772 SEQ ID NO: 74 AAV223.6 23 US20030138772 SEQ ID NO: 52 AAV223.6 24 US20030138772 SEQ ID NO: 78 AAV223.7 25 US20030138772 SEQ ID NO: 53 AAV223.7 26 US20030138772 SEQ ID NO: 77 AAV29.3 27 US20030138772 SEQ ID NO: 82 AAV29.4 28 US20030138772 SEQ ID NO: 12 AAV29.5 29 US20030138772 SEQ ID NO: 83 AAV29.5 30 US20030138772 SEQ ID NO: 13 (AAVbb.2) AAV3 31 US20150159173 SEQ ID NO: 12 AAV3 32 US20030138772 SEQ ID NO: 71, US20150159173 SEQ ID NO: 28, US20160017295 SEQ ID NO: 3, U.S. Pat. No. 7,198,951 SEQ ID NO: 6 AAV3 33 US20030138772 SEQ ID NO: 8 AAV3.3b 34 US20030138772 SEQ ID NO: 72 AAV3-3 35 US20150315612 SEQ ID NO: 200 AAV3-3 36 US20150315612 SEQ ID NO: 217 AAV3a 37 U.S. Pat. No. 6,156,303 SEQ ID NO: 5 AAV3a 38 U.S. Pat. No. 6,156,303 SEQ ID NO: 9 AAV3b 39 U.S. Pat. No. 6,156,303 SEQ ID NO: 6 AAV3b 40 U.S. Pat. No. 6,156,303 SEQ ID NO: 10 AAV3b 41 U.S. Pat. No. 6,156,303 SEQ ID NO: 1 AAV4 42 US20140348794 SEQ ID NO: 17 AAV4 43 US20140348794 SEQ ID NO: 5 AAV4 44 US20140348794 SEQ ID NO: 3 AAV4 45 US20140348794 SEQ ID NO: 14 AAV4 46 US20140348794 SEQ ID NO: 15 AAV4 47 US20140348794 SEQ ID NO: 19 AAV4 48 US20140348794 SEQ ID NO: 12 AAV4 49 US20140348794 SEQ ID NO: 13 AAV4 50 US20140348794 SEQ ID NO: 7 AAV4 51 US20140348794 SEQ ID NO: 8 AAV4 52 US20140348794 SEQ ID NO: 9 AAV4 53 US20140348794 SEQ ID NO: 2 AAV4 54 US20140348794 SEQ ID NO: 10 AAV4 55 US20140348794 SEQ ID NO: 11 AAV4 56 US20140348794 SEQ ID NO: 18 AAV4 57 US20030138772 SEQ ID NO: 63, US20160017295 SEQ ID NO: 4, US20140348794 SEQ ID NO: 4 AAV4 58 US20140348794 SEQ ID NO: 16 AAV4 59 US20140348794 SEQ ID NO: 20 AAV4 60 US20140348794 SEQ ID NO: 6 AAV4 61 US20140348794 SEQ ID NO: 1 AAV42.2 62 US20030138772 SEQ ID NO: 9 AAV42.2 63 US20030138772 SEQ ID NO: 102 AAV42.3b 64 US20030138772 SEQ ID NO: 36 AAV42.3B 65 US20030138772 SEQ ID NO: 107 AAV42.4 66 US20030138772 SEQ ID NO: 33 AAV42.4 67 US20030138772 SEQ ID NO: 88 AAV42.8 68 US20030138772 SEQ ID NO: 27 AAV42.8 69 US20030138772 SEQ ID NO: 85 AAV43.1 70 US20030138772 SEQ ID NO: 39 AAV43.1 71 US20030138772 SEQ ID NO: 92 AAV43.12 72 US20030138772 SEQ ID NO: 41 AAV43.12 73 US20030138772 SEQ ID NO: 93 AAV43.20 74 US20030138772 SEQ ID NO: 42 AAV43.20 75 US20030138772 SEQ ID NO: 99 AAV43.21 76 US20030138772 SEQ ID NO: 43 AAV43.21 77 US20030138772 SEQ ID NO: 96 AAV43.23 78 US20030138772 SEQ ID NO: 44 AAV43.23 79 US20030138772 SEQ ID NO: 98 AAV43.25 80 US20030138772 SEQ ID NO: 45 AAV43.25 81 US20030138772 SEQ ID NO: 97 AAV43.5 82 US20030138772 SEQ ID NO: 40 AAV43.5 83 US20030138772 SEQ ID NO: 94 AAV4-4 84 US20150315612 SEQ ID NO: 201 AAV4-4 85 US20150315612 SEQ ID NO: 218 AAV44.1 86 US20030138772 SEQ ID NO: 46 AAV44.1 87 US20030138772 SEQ ID NO: 79 AAV44.5 88 US20030138772 SEQ ID NO: 47 AAV44.5 89 US20030138772 SEQ ID NO: 80 AAV4407 90 US20150315612 SEQ ID NO: 90 AAV5 91 U.S. Pat. No. 7,427,396 SEQ ID NO: 1 AAV5 92 US20030138772 SEQ ID NO: 114 AAV5 93 US20160017295 SEQ ID NO: 5, U.S. Pat. No. 7,427,396 SEQ ID NO: 2, US20150315612 SEQ ID NO: 216 AAV5 94 US20150315612 SEQ ID NO: 199 AAV6 95 US20150159173 SEQ ID NO: 13 AAV6 96 US20030138772 SEQ ID NO: 65, US20150159173 SEQ ID NO: 29, US20160017295 SEQ ID NO: 6, U.S. Pat. No. 6,156,303 SEQ ID NO: 7 AAV6 97 U.S. Pat. No. 6,156,303 SEQ ID NO: 11 AAV6 98 U.S. Pat. No. 6,156,303 SEQ ID NO: 2 AAV6 99 US20150315612 SEQ ID NO: 203 AAV6 100 US20150315612 SEQ ID NO: 220 AAV6.1 101 US20150159173 AAV6.12 102 US20150159173 AAV6.2 103 US20150159173 AAV7 104 US20150159173 SEQ ID NO: 14 AAV7 105 US20150315612 SEQ ID NO: 183 AAV7 106 US20030138772 SEQ ID NO: 2, US20150159173 SEQ ID NO: 30, US20150315612 SEQ ID NO: 181, US20160017295 SEQ ID NO: 7 AAV7 107 US20030138772 SEQ ID NO: 3 AAV7 108 US20030138772 SEQ ID NO: 1, US20150315612 SEQ ID NO: 180 AAV7 109 US20150315612 SEQ ID NO: 213 AAV7 110 US20150315612 SEQ ID NO: 222 AAV8 111 US20150159173 SEQ ID NO: 15 AAV8 112 US20150376240 SEQ ID NO: 7 AAV8 113 US20030138772 SEQ ID NO: 4, US20150315612 SEQ ID NO: 182 AAV8 114 US20030138772 SEQ ID NO: 95, US20140359799 SEQ ID NO: 1, US20150159173 SEQ ID NO: 31, US20160017295 SEQ ID NO: 8, U.S. Pat. No. 7,198,951 SEQ ID NO: 7, US20150315612 SEQ ID NO: 223 AAV8 115 US20150376240 SEQ ID NO: 8 AAV8 116 US20150315612 SEQ ID NO: 214 AAV-8b 117 US20150376240 SEQ ID NO: 5 AAV-8b 118 US20150376240 SEQ ID NO: 3 AAV-8h 119 US20150376240 SEQ ID NO: 6 AAV-8h 120 US20150376240 SEQ ID NO: 4 AAV9 121 US20030138772 SEQ ID NO: 5 AAV9 122 U.S. Pat. No. 7,198,951 SEQ ID NO: 1 AAV9 123 US20160017295 SEQ ID NO: 9 AAV9 124 US20030138772 SEQ ID NO: 100, U.S. Pat. No. 7,198,951 SEQ ID NO: 2 AAV9 125 U.S. Pat. No. 7,198,951 SEQ ID NO: 3 AAV9 126 U.S. Pat. No. 7,906,111 SEQ ID NO: 3; (AAVhu.14) WO2015038958 SEQ ID NO: 11 AAV9 127 U.S. Pat. No. 7,906,111 SEQ ID NO: 123; (AAVhu.14) WO2015038958 SEQ ID NO: 2 AAVA3.1 128 US20030138772 SEQ ID NO: 120 AAVA3.3 129 US20030138772 SEQ ID NO: 57 AAVA3.3 130 US20030138772 SEQ ID NO: 66 AAVA3.4 131 US20030138772 SEQ ID NO: 54 AAVA3.4 132 US20030138772 SEQ ID NO: 68 AAVA3.5 133 US20030138772 SEQ ID NO: 55 AAVA3.5 134 US20030138772 SEQ ID NO: 69 AAVA3.7 135 US20030138772 SEQ ID NO: 56 AAVA3.7 136 US20030138772 SEQ ID NO: 67 AAV29.3 137 US20030138772 SEQ ID NO: 11 (AAVbb.1) AAVC2 138 US20030138772 SEQ ID NO: 61 AAVCh.5 139 US20150159173 SEQ ID NO: 46, US20150315612 SEQ ID NO: 234 AAVcy.2 140 US20030138772 SEQ ID NO: 15 (AAV13.3) AAV24.1 141 US20030138772 SEQ ID NO: 101 AAVcy.3 142 US20030138772 SEQ ID NO: 16 (AAV24.1) AAV27.3 143 US20030138772 SEQ ID NO: 104 AAVcy.4 144 US20030138772 SEQ ID NO: 17 (AAV27.3) AAVcy.5 145 US20150315612 SEQ ID NO: 227 AAV7.2 146 US20030138772 SEQ ID NO: 103 AAVcy.5 147 US20030138772 SEQ ID NO: 18 (AAV7.2) AAV16.3 148 US20030138772 SEQ ID NO: 105 AAVcy.6 149 US20030138772 SEQ ID NO: 10 (AAV16.3) AAVcy.5 150 US20150159173 SEQ ID NO: 8 AAVcy.5 151 US20150159173 SEQ ID NO: 24 AAVCy.5R1 152 US20150159173 AAVCy.5R2 153 US20150159173 AAVCy.5R3 154 US20150159173 AAVCy.5R4 155 US20150159173 AAVDJ 156 US20140359799 SEQ ID NO: 3, U.S. Pat. No. 7,588,772 SEQ ID NO: 2 AAVDJ 157 US20140359799 SEQ ID NO: 2, U.S. Pat. No. 7,588,772 SEQ ID NO: 1 AAVDJ-8 158 U.S. Pat. No. 7,588,772; Grimm et al 2008 AAVDJ-8 159 U.S. Pat. No. 7,588,772; Grimm et al 2008 AAVF5 160 US20030138772 SEQ ID NO: 110 AAVH2 161 US20030138772 SEQ ID NO: 26 AAVH6 162 US20030138772 SEQ ID NO: 25 AAVhE1.1 163 U.S. Pat. No. 9,233,131 SEQ ID NO: 44 AAVhEr1.14 164 U.S. Pat. No. 9,233,131 SEQ ID NO: 46 AAVhEr1.16 165 U.S. Pat. No. 9,233,131 SEQ ID NO: 48 AAVhEr1.18 166 U.S. Pat. No. 9,233,131 SEQ ID NO: 49 AAVhEr1.23 167 U.S. Pat. No. 9,233,131 SEQ ID NO: 53 (AAVhEr2.29) AAVhEr1.35 168 U.S. Pat. No. 9,233,131 SEQ ID NO: 50 AAVhEr1.36 169 U.S. Pat. No. 9,233,131 SEQ ID NO: 52 AAVhEr1.5 170 U.S. Pat. No. 9,233,131 SEQ ID NO: 45 AAVhEr1.7 171 U.S. Pat. No. 9,233,131 SEQ ID NO: 51 AAVhEr1.8 172 U.S. Pat. No. 9,233,131 SEQ ID NO: 47 AAVhEr2.16 173 U.S. Pat. No. 9,233,131 SEQ ID NO: 55 AAVhEr2.30 174 U.S. Pat. No. 9,233,131 SEQ ID NO: 56 AAVhEr2.31 175 U.S. Pat. No. 9,233,131 SEQ ID NO: 58 AAVhEr2.36 176 U.S. Pat. No. 9,233,131 SEQ ID NO: 57 AAVhEr2.4 177 U.S. Pat. No. 9,233,131 SEQ ID NO: 54 AAVhEr3.1 178 U.S. Pat. No. 9,233,131 SEQ ID NO: 59 AAVhu.1 179 US20150315612 SEQ ID NO: 46 AAVhu.1 180 US20150315612 SEQ ID NO: 144 AAVhu.10 181 US20150315612 SEQ ID NO: 56 (AAV16.8) AAVhu.10 182 US20150315612 SEQ ID NO: 156 (AAV16.8) AAVhu.11 183 US20150315612 SEQ ID NO: 57 (AAV16.12) AAVhu.11 184 US20150315612 SEQ ID NO: 153 (AAV16.12) AAVhu.12 185 US20150315612 SEQ ID NO: 59 AAVhu.12 186 US20150315612 SEQ ID NO: 154 AAVhu.13 187 US20150159173 SEQ ID NO: 16, US20150315612 SEQ ID NO: 71 AAVhu.13 188 US20150159173 SEQ ID NO: 32, US20150315612 SEQ ID NO: 129 AAVhu.136.1 189 US20150315612 SEQ ID NO: 165 AAVhu.140.1 190 US20150315612 SEQ ID NO: 166 AAVhu.140.2 191 US20150315612 SEQ ID NO: 167 AAVhu.145.6 192 US20150315612 SEQ ID No: 178 AAVhu.15 193 US20150315612 SEQ ID NO: 147 AAVhu.15 194 US20150315612 SEQ ID NO: 50 (AAV33.4) AAVhu.156.1 195 US20150315612 SEQ ID No: 179 AAVhu.16 196 US20150315612 SEQ ID NO: 148 AAVhu.16 197 US20150315612 SEQ ID NO: 51 (AAV33.8) AAVhu.17 198 US20150315612 SEQ ID NO: 83 AAVhu.17 199 US20150315612 SEQ ID NO: 4 (AAV33.12) AAVhu.172.1 200 US20150315612 SEQ ID NO: 171 AAVhu.172.2 201 US20150315612 SEQ ID NO: 172 AAVhu.173.4 202 US20150315612 SEQ ID NO: 173 AAVhu.173.8 203 US20150315612 SEQ ID NO: 175 AAVhu.18 204 US20150315612 SEQ ID NO: 52 AAVhu.18 205 US20150315612 SEQ ID NO: 149 AAVhu.19 206 US20150315612 SEQ ID NO: 62 AAVhu.19 207 US20150315612 SEQ ID NO: 133 AAVhu.2 208 US20150315612 SEQ ID NO: 48 AAVhu.2 209 US20150315612 SEQ ID NO: 143 AAVhu.20 210 US20150315612 SEQ ID NO: 63 AAVhu.20 211 US20150315612 SEQ ID NO: 134 AAVhu.21 212 US20150315612 SEQ ID NO: 65 AAVhu.21 213 US20150315612 SEQ ID NO: 135 AAVhu.22 214 US20150315612 SEQ ID NO: 67 AAVhu.22 215 US20150315612 SEQ ID NO: 138 AAVhu.23 216 US20150315612 SEQ ID NO: 60 AAVhu.23.2 217 US20150315612 SEQ ID NO: 137 AAVhu.24 218 US20150315612 SEQ ID NO: 66 AAVhu.24 219 US20150315612 SEQ ID NO: 136 AAVhu.25 220 US20150315612 SEQ ID NO: 49 AAVhu.25 221 US20150315612 SEQ ID NO: 146 AAVhu.26 222 US20150159173 SEQ ID NO: 17, US20150315612 SEQ ID NO: 61 AAVhu.26 223 US20150159173 SEQ ID NO: 33, US20150315612 SEQ ID NO: 139 AAVhu.27 224 US20150315612 SEQ ID NO: 64 AAVhu.27 225 US20150315612 SEQ ID NO: 140 AAVhu.28 226 US20150315612 SEQ ID NO: 68 AAVhu.28 227 US20150315612 SEQ ID NO: 130 AAVhu.29 228 US20150315612 SEQ ID NO: 69 AAVhu.29 229 US20150159173 SEQ ID NO: 42, US20150315612 SEQ ID NO: 132 AAVhu.29 230 US20150315612 SEQ ID NO: 225 AAVhu.29R 231 US20150159173 AAVhu.3 232 US20150315612 SEQ ID NO: 44 AAVhu.3 233 US20150315612 SEQ ID NO: 145 AAVhu.30 234 US20150315612 SEQ ID NO: 70 AAVhu.30 235 US20150315612 SEQ ID NO: 131 AAVhu.31 236 US20150315612 SEQ ID NO: 1 AAVhu.31 237 US20150315612 SEQ ID NO: 121 AAVhu.32 238 US20150315612 SEQ ID NO: 2 AAVhu.32 239 US20150315612 SEQ ID NO: 122 AAVhu.33 240 US20150315612 SEQ ID NO: 75 AAVhu.33 241 US20150315612 SEQ ID NO: 124 AAVhu.34 242 US20150315612 SEQ ID NO: 72 AAVhu.34 243 US20150315612 SEQ ID NO: 125 AAVhu.35 244 US20150315612 SEQ ID NO: 73 AAVhu.35 245 US20150315612 SEQ ID NO: 164 AAVhu.36 246 US20150315612 SEQ ID NO: 74 AAVhu.36 247 US20150315612 SEQ ID NO: 126 AAVhu.37 248 US20150159173 SEQ ID NO: 34, US20150315612 SEQ ID NO: 88 AAVhu.37 249 US20150315612 SEQ ID NO: 10, (AAV106.1) US20150159173 SEQ ID NO: 18 AAVhu.38 250 US20150315612 SEQ ID NO: 161 AAVhu.39 251 US20150315612 SEQ ID NO: 102 AAVhu.39 252 US20150315612 SEQ ID NO: 24 (AAVLG-9) AAVhu.4 253 US20150315612 SEQ ID NO: 47 AAVhu.4 254 US20150315612 SEQ ID NO: 141 AAVhu.40 255 US20150315612 SEQ ID NO: 87 AAVhu.40 256 US20150315612 SEQ ID No: 11 (AAV114.3) AAVhu.41 257 US20150315612 SEQ ID NO: 91 AAVhu.41 258 US20150315612 SEQ ID NO: 6 (AAV127.2) AAVhu.42 259 US20150315612 SEQ ID NO: 85 AAVhu.42 260 US20150315612 SEQ ID NO: 8 (AAV127.5) AAVhu.43 261 US20150315612 SEQ ID NO: 160 AAVhu.43 262 US20150315612 SEQ ID NO: 236 AAVhu.43 263 US20150315612 SEQ ID NO: 80 (AAV128.1) AAVhu.44 264 US20150159173 SEQ ID NO: 45, US20150315612 SEQ ID NO: 158 AAVhu.44 265 US20150315612 SEQ ID NO: 81 (AAV128.3) AAVhu.44R1 266 US20150159173 AAVhu.44R2 267 US20150159173 AAVhu.44R3 268 US20150159173 AAVhu.45 269 US20150315612 SEQ ID NO: 76 AAVhu.45 270 US20150315612 SEQ ID NO: 127 AAVhu.46 271 US20150315612 SEQ ID NO: 82 AAVhu.46 272 US20150315612 SEQ ID NO: 159 AAVhu.46 273 US20150315612 SEQ ID NO: 224 AAVhu.47 274 US20150315612 SEQ ID NO: 77 AAVhu.47 275 US20150315612 SEQ ID NO: 128 AAVhu.48 276 US20150159173 SEQ ID NO: 38 AAVhu.48 277 US20150315612 SEQ ID NO: 157 AAVhu.48 278 US20150315612 SEQ ID NO: 78 (AAV130.4) AAVhu.48R1 279 US20150159173 AAVhu.48R2 280 US20150159173 AAVhu.48R3 281 US20150159173 AAVhu.49 282 US20150315612 SEQ ID NO: 209 AAVhu.49 283 US20150315612 SEQ ID NO: 189 AAVhu.5 284 US20150315612 SEQ ID NO: 45 AAVhu.5 285 US20150315612 SEQ ID NO: 142 AAVhu.51 286 US20150315612 SEQ ID NO: 208 AAVhu.51 287 US20150315612 SEQ ID NO: 190 AAVhu.52 288 US20150315612 SEQ ID NO: 210 AAVhu.52 289 US20150315612 SEQ ID NO: 191 AAVhu.53 290 US20150159173 SEQ ID NO: 19 AAVhu.53 291 US20150159173 SEQ ID NO: 35 AAVhu.53 292 US20150315612 SEQ ID NO: 176 (AAV145.1) AAVhu.54 293 US20150315612 SEQ ID NO: 188 AAVhu.54 294 US20150315612 SEQ ID No: 177 (AAV145.5) AAVhu.55 295 US20150315612 SEQ ID NO: 187 AAVhu.56 296 US20150315612 SEQ ID NO: 205 AAVhu.56 297 US20150315612 SEQ ID NO: 168 (AAV145.6) AAVhu.56 298 US20150315612 SEQ ID NO: 192 (AAV145.6) AAVhu.57 299 US20150315612 SEQ ID NO: 206 AAVhu.57 300 US20150315612 SEQ ID NO: 169 AAVhu.57 301 US20150315612 SEQ ID NO: 193 AAVhu.58 302 US20150315612 SEQ ID NO: 207 AAVhu.58 303 US20150315612 SEQ ID NO: 194 AAVhu.6 304 US20150315612 SEQ ID NO: 5 (AAV3.1) AAVhu.6 305 US20150315612 SEQ ID NO: 84 (AAV3.1) AAVhu.60 306 US20150315612 SEQ ID NO: 184 AAVhu.60 307 US20150315612 SEQ ID NO: 170 (AAV161.10) AAVhu.61 308 US20150315612 SEQ ID NO: 185 AAVhu.61 309 US20150315612 SEQ ID NO: 174 (AAV161.6) AAVhu.63 310 US20150315612 SEQ ID NO: 204 AAVhu.63 311 US20150315612 SEQ ID NO: 195 AAVhu.64 312 US20150315612 SEQ ID NO: 212 AAVhu.64 313 US20150315612 SEQ ID NO: 196 AAVhu.66 314 US20150315612 SEQ ID NO: 197 AAVhu.67 315 US20150315612 SEQ ID NO: 215 AAVhu.67 316 US20150315612 SEQ ID NO: 198 AAVhu.7 317 US20150315612 SEQ ID NO: 226 AAVhu.7 318 US20150315612 SEQ ID NO: 150 AAVhu.7 319 US20150315612 SEQ ID NO: 55 (AAV7.3) AAVhu.71 320 US20150315612 SEQ ID NO: 79 AAVhu.8 321 US20150315612 SEQ ID NO: 53 AAVhu.8 322 US20150315612 SEQ ID NO: 12 AAVhu.8 323 US20150315612 SEQ ID NO: 151 AAVhu.9 324 US20150315612 SEQ ID NO: 58 (AAV3.1) AAVhu.9 325 US20150315612 SEQ ID NO: 155 (AAV3.1) AAV-LK01 326 US20150376607 SEQ ID NO: 2 AAV-LK01 327 US20150376607 SEQ ID NO: 29 AAV-LK02 328 US20150376607 SEQ ID NO: 3 AAV-LK02 329 US20150376607 SEQ ID NO: 30 AAV-LK03 330 US20150376607 SEQ ID NO: 4 AAV-LK03 331 WO2015121501 SEQ ID NO: 12, US20150376607 SEQ ID NO: 31 AAV-LK04 332 US20150376607 SEQ ID NO: 5 AAV-LK04 333 US20150376607 SEQ ID NO: 32 AAV-LK05 334 US20150376607 SEQ ID NO: 6 AAV-LK05 335 US20150376607 SEQ ID NO: 33 AAV-LK06 336 US20150376607 SEQ ID NO: 7 AAV-LK06 337 US20150376607 SEQ ID NO: 34 AAV-LK07 338 US20150376607 SEQ ID NO: 8 AAV-LK07 339 US20150376607 SEQ ID NO: 35 AAV-LK08 340 US20150376607 SEQ ID NO: 9 AAV-LK08 341 US20150376607 SEQ ID NO: 36 AAV-LK09 342 US20150376607 SEQ ID NO: 10 AAV-LK09 343 US20150376607 SEQ ID NO: 37 AAV-LK10 344 US20150376607 SEQ ID NO: 11 AAV-LK10 345 US20150376607 SEQ ID NO: 38 AAV-LK11 346 US20150376607 SEQ ID NO: 12 AAV-LK11 347 US20150376607 SEQ ID NO: 39 AAV-LK12 348 US20150376607 SEQ ID NO: 13 AAV-LK12 349 US20150376607 SEQ ID NO: 40 AAV-LK13 350 US20150376607 SEQ ID NO: 14 AAV-LK13 351 US20150376607 SEQ ID NO: 41 AAV-LK14 352 US20150376607 SEQ ID NO: 15 AAV-LK14 353 US20150376607 SEQ ID NO: 42 AAV-LK15 354 US20150376607 SEQ ID NO: 16 AAV-LK15 355 US20150376607 SEQ ID NO: 43 AAV-LK16 356 US20150376607 SEQ ID NO: 17 AAV-LK16 357 US20150376607 SEQ ID NO: 44 AAV-LK17 358 US20150376607 SEQ ID NO: 18 AAV-LK17 359 US20150376607 SEQ ID NO: 45 AAV-LK18 360 US20150376607 SEQ ID NO: 19 AAV-LK18 361 US20150376607 SEQ ID NO: 46 AAV-LK19 362 US20150376607 SEQ ID NO: 20 AAV-LK19 363 US20150376607 SEQ ID NO: 47 AAV-PAEC 364 US20150376607 SEQ ID NO: 1 AAV-PAEC 365 US20150376607 SEQ ID NO: 48 AAV-PAEC11 366 US20150376607 SEQ ID NO: 26 AAV-PAEC11 367 US20150376607 SEQ ID NO: 54 AAV-PAEC12 368 US20150376607 SEQ ID NO: 27 AAV-PAEC12 369 US20150376607 SEQ ID NO: 51 AAV-PAEC13 370 US20150376607 SEQ ID NO: 28 AAV-PAEC13 371 US20150376607 SEQ ID NO: 49 AAV-PAEC2 372 US20150376607 SEQ ID NO: 21 AAV-PAEC2 373 US20150376607 SEQ ID NO: 56 AAV-PAEC4 374 US20150376607 SEQ ID NO: 22 AAV-PAEC4 375 US20150376607 SEQ ID NO: 55 AAV-PAEC6 376 US20150376607 SEQ ID NO: 23 AAV-PAEC6 377 US20150376607 SEQ ID NO: 52 AAV-PAEC7 378 US20150376607 SEQ ID NO: 24 AAV-PAEC7 379 US20150376607 SEQ ID NO: 53 AAV-PAEC8 380 US20150376607 SEQ ID NO: 25 AAV-PAEC8 381 US20150376607 SEQ ID NO: 50 AAVpi.1 382 US20150315612 SEQ ID NO: 28 AAVpi.1 383 US20150315612 SEQ ID NO: 93 AAVpi.2 384 US20150315612 SEQ ID NO: 30 AAVpi.2 385 US20150315612 SEQ ID NO: 95 AAVpi.3 386 US20150315612 SEQ ID NO: 29 AAVpi.3 387 US20150315612 SEQ ID NO: 94 AAVrh.10 388 US20150159173 SEQ ID NO: 9 AAVrh.10 389 US20150159173 SEQ ID NO: 25 AAV44.2 390 US20030138772 SEQ ID NO: 59 AAVrh.10 391 US20030138772 SEQ ID NO: 81 (AAV44.2) AAV42.1B 392 US20030138772 SEQ ID NO: 90 AAVrh.12 393 US20030138772 SEQ ID NO: 30 (AAV42.1b) AAVrh.13 394 US20150159173 SEQ ID NO: 10 AAVrh.13 395 US20150159173 SEQ ID NO: 26 AAVrh.13 396 US20150315612 SEQ ID NO: 228 AAVrh.13R 397 US20150159173 AAV42.3A 398 US20030138772 SEQ ID NO: 87 AAVrh.14 399 US20030138772 SEQ ID NO: 32 (AAV42.3a) AAV42.5A 400 US20030138772 SEQ ID NO: 89 AAVrh.17 401 US20030138772 SEQ ID NO: 34 (AAV42.5a) AAV42.5B 402 US20030138772 SEQ ID NO: 91 AAVrh.18 403 US20030138772 SEQ ID NO: 29 (AAV42.5b) AAV42.6B 404 US20030138772 SEQ ID NO: 112 AAVrh.19 405 US20030138772 SEQ ID NO: 38 (AAV42.6b) AAVrh.2 406 US20150159173 SEQ ID NO: 39 AAVrh.2 407 US20150315612 SEQ ID NO: 231 AAVrh.20 408 US20150159173 SEQ ID NO: 1 AAV42.10 409 US20030138772 SEQ ID NO: 106 AAVrh.21 410 US20030138772 SEQ ID NO: 35 (AAV42.10) AAV42.11 411 US20030138772 SEQ ID NO: 108 AAVrh.22 412 US20030138772 SEQ ID NO: 37 (AAV42.11) AAV42.12 413 US20030138772 SEQ ID NO: 113 AAVrh.23 414 US20030138772 SEQ ID NO: 58 (AAV42.12) AAV42.13 415 US20030138772 SEQ ID NO: 86 AAVrh.24 416 US20030138772 SEQ ID NO: 31 (AAV42.13) AAV42.15 417 US20030138772 SEQ ID NO: 84 AAVrh.25 418 US20030138772 SEQ ID NO: 28 (AAV42.15) AAVrh.2R 419 US20150159173 AAVrh.31 420 US20030138772 SEQ ID NO: 48 (AAV223.1) AAVC1 421 US20030138772 SEQ ID NO: 60 AAVrh.32 422 US20030138772 SEQ ID NO: 19 (AAVC1) AAVrh.32/33 423 US20150159173 SEQ ID NO: 2 AAVrh.33 424 US20030138772 SEQ ID NO: 20 (AAVC3) AAVC5 425 US20030138772 SEQ ID NO: 62 AAVrh.34 426 US20030138772 SEQ ID NO: 21 (AAVC5) AAVF1 427 US20030138772 SEQ ID NO: 109 AAVrh.35 428 US20030138772 SEQ ID NO: 22 (AAVF1) AAVF3 429 US20030138772 SEQ ID NO: 111 AAVrh.36 430 US20030138772 SEQ ID NO: 23 (AAVF3) AAVrh.37 431 US20030138772 SEQ ID NO: 24 AAVrh.37 432 US20150159173 SEQ ID NO: 40 AAVrh.37 433 US20150315612 SEQ ID NO: 229 AAVrh.37R2 434 US20150159173 AAVrh.38 435 US20150315612 SEQ ID NO: 7 (AAVLG-4) AAVrh.38 436 US20150315612 SEQ ID NO: 86 (AAVLG-4) AAVrh.39 437 US20150159173 SEQ ID NO: 20, US20150315612 SEQ ID NO: 13 AAVrh.39 438 US20150159173 SEQ ID NO: 3, US20150159173 SEQ ID NO: 36, US20150315612 SEQ ID NO: 89 AAVrh.40 439 US20150315612 SEQ ID NO: 92 AAVrh.40 440 US20150315612 SEQ ID No: 14 (AAVLG-10) AAVrh.43 441 US20150315612 SEQ ID NO: 43, (AAVN721-R) US20150159173 SEQ ID NO: 21 AAVrh.43 442 US20150315612 SEQ ID NO: 163, (AAVN721-8) US20150159173 SEQ ID NO: 37 AAVrh.44 443 US20150315612 SEQ ID NO: 34 AAVrh.44 444 US20150315612 SEQ ID NO: 111 AAVrh.45 445 US20150315612 SEQ ID NO: 41 AAVrh.45 446 US20150315612 SEQ ID NO: 109 AAVrh.46 447 US20150159173 SEQ ID NO: 22, US20150315612 SEQ ID NO: 19 AAVrh.46 448 US20150159173 SEQ ID NO: 4, US20150315612 SEQ ID NO: 101 AAVrh.47 449 US20150315612 SEQ ID NO: 38 AAVrh.47 450 US20150315612 SEQ ID NO: 118 AAVrh.48 451 US20150159173 SEQ ID NO: 44, US20150315612 SEQ ID NO: 115 AAVrh.48.1 452 US20150159173 AAVrh.48.1.2 453 US20150159173 AAVrh.48.2 454 US20150159173 AAVrh.48 455 US20150315612 SEQ ID NO: 32 (AAV1-7) AAVrh.49 456 US20150315612 SEQ ID NO: 25 (AAV1-8) AAVrh.49 457 US20150315612 SEQ ID NO: 103 (AAV1-8) AAVrh.50 458 US20150315612 SEQ ID NO: 23 (AAV2-4) AAVrh.50 459 US20150315612 SEQ ID NO: 108 (AAV2-4) AAVrh.51 460 US20150315612 SEQ ID NO: 22 (AAV2-5) AAVrh.51 461 US20150315612 SEQ ID NO: 104 (AAV2-5) AAVrh.52 462 US20150315612 SEQ ID NO: 18 (AAV3-9) AAVrh.52 463 US20150315612 SEQ ID NO: 96 (AAV3-9) AAVrh.53 464 US20150315612 SEQ ID NO: 97 AAVrh.53 465 US20150315612 SEQ ID NO: 17 (AAV3-11) AAVrh.53 466 US20150315612 SEQ ID NO: 186 (AAV3-11) AAVrh.54 467 US20150315612 SEQ ID NO: 40 AAVrh.54 468 US20150159173 SEQ ID NO: 49, US20150315612 SEQ ID NO: 116 AAVrh.55 469 US20150315612 SEQ ID NO: 37 AAVrh.55 470 US20150315612 SEQ ID NO: 117 (AAV4-19) AAVrh.56 471 US20150315612 SEQ ID NO: 54 AAVrh.56 472 US20150315612 SEQ ID NO: 152 AAVrh.57 473 US20150315612 SEQ ID NO: 26 AAVrh.57 474 US20150315612 SEQ ID NO: 105 AAVrh.58 475 US20150315612 SEQ ID NO: 27 AAVrh.58 476 US20150159173 SEQ ID NO: 48, US20150315612 SEQ ID NO: 106 AAVrh.58 477 US20150315612 SEQ ID NO: 232 AAVrh.59 478 US20150315612 SEQ ID NO: 42 AAVrh.59 479 US20150315612 SEQ ID NO: 110 AAVrh.60 480 US20150315612 SEQ ID NO: 31 AAVrh.60 481 US20150315612 SEQ ID NO: 120 AAVrh.61 482 US20150315612 SEQ ID NO: 107 AAVrh.61 483 US20150315612 SEQ ID NO: 21 (AAV2-3) AAVrh.62 484 US20150315612 SEQ ID NO: 33 (AAV2-15) AAVrh.62 485 US20150315612 SEQ ID NO: 114 (AAV2-15) AAVrh.64 486 US20150315612 SEQ ID NO: 15 AAVrh.64 487 US20150159173 SEQ ID NO: 43, US20150315612 SEQ ID NO: 99 AAVrh.64 488 US20150315612 SEQ ID NO: 233 AAVRh.64R1 489 US20150159173 AAVRh.64R2 490 US20150159173 AAVrh.65 491 US20150315612 SEQ ID NO: 35 AAVrh.65 492 US20150315612 SEQ ID NO: 112 AAVrh.67 493 US20150315612 SEQ ID NO: 36 AAVrh.67 494 US20150315612 SEQ ID NO: 230 AAVrh.67 495 US20150159173 SEQ ID NO: 47, US20150315612 SEQ ID NO: 113 AAVrh.68 496 US20150315612 SEQ ID NO: 16 AAVrh.68 497 US20150315612 SEQ ID NO: 100 AAVrh.69 498 US20150315612 SEQ ID NO: 39 AAVrh.69 499 US20150315612 SEQ ID NO: 119 AAVrh.70 500 US20150315612 SEQ ID NO: 20 AAVrh.70 501 US20150315612 SEQ ID NO: 98 AAVrh.71 502 US20150315612 SEQ ID NO: 162 AAVrh.72 503 US20150315612 SEQ ID NO: 9 AAVrh.73 504 US20150159173 SEQ ID NO: 5 AAVrh.74 505 US20150159173 SEQ ID NO: 6 AAVrh.8 506 US20150159173 SEQ ID NO: 41 AAVrh.8 507 US20150315612 SEQ ID NO: 235 AAVrh.8R 508 US20150159173, WO2015168666 SEQ ID NO: 9 AAVrh.8R 509 WO2015168666 SEQ ID NO: 10 A586R mutant AAVrh.8R 510 WO2015168666 SEQ ID NO: 11 R533A mutant BAAV 511 U.S. Pat. No. 9,193,769 SEQ ID NO: 8 (bovine AAV) BAAV 512 U.S. Pat. No. 9,193,769 SEQ ID NO: 10 (bovine AAV) BAAV 513 U.S. Pat. No. 9,193,769 SEQ ID NO: 4 (bovine AAV) BAAV 514 U.S. Pat. No. 9,193,769 SEQ ID NO: 2 (bovine AAV) BAAV 515 U.S. Pat. No. 9,193,769 SEQ ID NO: 6 (bovine AAV) BAAV 516 U.S. Pat. No. 9,193,769 SEQ ID NO: 1 (bovine AAV) BAAV 517 U.S. Pat. No. 9,193,769 SEQ ID NO: 5 (bovine AAV) BAAV 518 U.S. Pat. No. 9,193,769 SEQ ID NO: 3 (bovine AAV) BAAV 519 U.S. Pat. No. 9,193,769 SEQ ID NO: 11 (bovine AAV) BAAV 520 U.S. Pat. No. 7,427,396 SEQ ID NO: 5 (bovine AAV) BAAV 521 U.S. Pat. No. 7,427,396 SEQ ID NO: 6 (bovine AAV) BAAV 522 U.S. Pat. No. 9,193,769 SEQ ID NO: 7 (bovine AAV) BAAV 523 U.S. Pat. No. 9,193,769 SEQ ID NO: 9 (bovine AAV) BNP61 AAV 524 US20150238550 SEQ ID NO: 1 BNP61 AAV 525 US20150238550 SEQ ID NO: 2 BNP62 AAV 526 US20150238550 SEQ ID NO: 3 BNP63 AAV 527 US20150238550 SEQ ID NO: 4 caprine AAV 528 U.S. Pat. No. 7,427,396 SEQ ID NO: 3 caprine AAV 529 U.S. Pat. No. 7,427,396 SEQ ID NO: 4 true type AAV 530 WO2015121501 SEQ ID NO: 2 (ttAAV) AAAV 531 U.S. Pat. No. 9,238,800 SEQ ID NO: 12 (Avian AAV) AAAV 532 U.S. Pat. No. 9,238,800 SEQ ID NO: 2 (Avian AAV) AAAV 533 U.S. Pat. No. 9,238,800 SEQ ID NO: 6 (Avian AAV) AAAV 534 U.S. Pat. No. 9,238,800 SEQ ID NO: 4 (Avian AAV) AAAV 535 U.S. Pat. No. 9,238,800 SEQ ID NO: 8 (Avian AAV) AAAV 536 U.S. Pat. No. 9,238,800 SEQ ID NO: 14 (Avian AAV) AAAV 537 U.S. Pat. No. 9,238,800 SEQ ID NO: 10 (Avian AAV) AAAV 538 U.S. Pat. No. 9,238,800 SEQ ID NO: 15 (Avian AAV) AAAV 539 U.S. Pat. No. 9,238,800 SEQ ID NO: 5 (Avian AAV) AAAV 540 U.S. Pat. No. 9,238,800 SEQ ID NO: 9 (Avian AAV) AAAV 541 U.S. Pat. No. 9,238,800 SEQ ID NO: 3 (Avian AAV) AAAV 542 U.S. Pat. No. 9,238,800 SEQ ID NO: 7 (Avian AAV) AAAV 543 U.S. Pat. No. 9,238,800 SEQ ID NO: 11 (Avian AAV) AAAV 544 U.S. Pat. No. 9,238,800 SEQ ID NO: 13 (Avian AAV) AAAV 545 U.S. Pat. No. 9,238,800 SEQ ID NO: 1 (Avian AAV) AAV Shuffle 546 US20160017295 SEQ ID NO: 23 100-1 AAV Shuffle 547 US20160017295 SEQ ID NO: 11 100-1 AAV Shuffle 548 US20160017295 SEQ ID NO: 37 100-2 AAV Shuffle 549 US20160017295 SEQ ID NO: 29 100-2 AAV Shuffle 550 US20160017295 SEQ ID NO: 24 100-3 AAV Shuffle 551 US20160017295 SEQ ID NO: 12 100-3 AAV Shuffle 552 US20160017295 SEQ ID NO: 25 100-7 AAV Shuffle 553 US20160017295 SEQ ID NO: 13 100-7 AAV Shuffle 554 US20160017295 SEQ ID NO: 34 10-2 AAV Shuffle 555 US20160017295 SEQ ID NO: 26 10-2 AAV Shuffle 556 US20160017295 SEQ ID NO: 35 10-6 AAV Shuffle 557 US20160017295 SEQ ID NO: 27 10-6 AAV Shuffle 558 US20160017295 SEQ ID NO: 36 10-8 AAV Shuffle 559 US20160017295 SEQ ID NO: 28 10-8 AAV SM 100-10 560 US20160017295 SEQ ID NO: 41 AAV SM 100-10 561 US20160017295 SEQ ID NO: 33 AAV SM 100-3 562 US20160017295 SEQ ID NO: 40 AAV SM 100-3 563 US20160017295 SEQ ID NO: 32 AAV SM 10-1 564 US20160017295 SEQ ID NO: 38 AAV SM 10-1 565 US20160017295 SEQ ID NO: 30 AAV SM 10-2 566 US20160017295 SEQ ID NO: 10 AAV SM 10-2 567 US20160017295 SEQ ID NO: 22 AAV SM 10-8 568 US20160017295 SEQ ID NO: 39 AAV SM 10-8 569 US20160017295 SEQ ID NO: 31 AAVF1/HSC1 570 WO2016049230 SEQ ID NO: 20 AAVF2/HSC2 571 WO2016049230 SEQ ID NO: 21 AAVF3/HSC3 572 WO2016049230 SEQ ID NO: 22 AAVF4/HSC4 573 WO2016049230 SEQ ID NO: 23 AAVF5/HSC5 574 WO2016049230 SEQ ID NO: 25 AAVF6/HSC6 575 WO2016049230 SEQ ID NO: 24 AAVF7/HSC7 576 WO2016049230 SEQ ID NO: 27 AAVF8/HSC8 577 WO2016049230 SEQ ID NO: 28 AAVF9/HSC9 578 WO2016049230 SEQ ID NO: 29 AAVF11/HSC11 579 WO2016049230 SEQ ID NO: 26 AAVF12/HSC12 580 WO2016049230 SEQ ID NO: 30 AAVF13/HSC13 581 WO2016049230 SEQ ID NO: 31 AAVF14/HSC14 582 WO2016049230 SEQ ID NO: 32 AAVF15/HSC15 583 WO2016049230 SEQ ID NO: 33 AAVF16/HSC16 584 WO2016049230 SEQ ID NO: 34 AAVF17/HSC17 585 WO2016049230 SEQ ID NO: 35 AAVF1/HSC1 586 WO2016049230 SEQ ID NO: 2 AAVF2/HSC2 587 WO2016049230 SEQ ID NO: 3 AAVF3/HSC3 588 WO2016049230 SEQ ID NO: 5 AAVF4/HSC4 589 WO2016049230 SEQ ID NO: 6 AAVF5/HSC5 590 WO2016049230 SEQ ID NO: 11 AAVF6/HSC6 591 WO2016049230 SEQ ID NO: 7 AAVF7/HSC7 592 WO2016049230 SEQ ID NO: 8 AAVF8/HSC8 593 WO2016049230 SEQ ID NO: 9 AAVF9/HSC9 594 WO2016049230 SEQ ID NO: 10 AAVF11/HSC11 595 WO2016049230 SEQ ID NO: 4 AAVF12/HSC12 596 WO2016049230 SEQ ID NO: 12 AAVF13/HSC13 597 WO2016049230 SEQ ID NO: 14 AAVF14/HSC14 598 WO2016049230 SEQ ID NO: 15 AAVF15/HSC15 599 WO2016049230 SEQ ID NO: 16 AAVF16/HSC16 600 WO2016049230 SEQ ID NO: 17 AAVF17/HSC17 601 WO2016049230 SEQ ID NO: 13 AAV CBr-E1 602 U.S. Pat. No. 8,734,809 SEQ ID NO: 13 AAV CBr-E2 603 U.S. Pat. No. 8,734,809 SEQ ID NO: 14 AAV CBr-E3 604 U.S. Pat. No. 8,734,809 SEQ ID NO: 15 AAV CBr-E4 605 U.S. Pat. No. 8,734,809 SEQ ID NO: 16 AAV CBr-E5 606 U.S. Pat. No. 8,734,809 SEQ ID NO: 17 AAV CBr-e5 607 U.S. Pat. No. 8,734,809 SEQ ID NO: 18 AAV CBr-E6 608 U.S. Pat. No. 8,734,809 SEQ ID NO: 19 AAV CBr-E7 609 U.S. Pat. No. 8,734,809 SEQ ID NO: 20 AAV CBr-E8 610 U.S. Pat. No. 8,734,809 SEQ ID NO: 21 AAV CLv-D1 611 U.S. Pat. No. 8,734,809 SEQ ID NO: 22 AAV CLv-D2 612 U.S. Pat. No. 8,734,809 SEQ ID NO: 23 AAV CLv-D3 613 U.S. Pat. No. 8,734,809 SEQ ID NO: 24 AAV CLv-D4 614 U.S. Pat. No. 8,734,809 SEQ ID NO: 25 AAV CLv-D5 615 U.S. Pat. No. 8,734,809 SEQ ID NO: 26 AAV CLv-D6 616 U.S. Pat. No. 8,734,809 SEQ ID NO: 27 AAV CLv-D7 617 U.S. Pat. No. 8,734,809 SEQ ID NO: 28 AAV CLv-D8 618 U.S. Pat. No. 8,734,809 SEQ ID NO: 29 AAV CLv-E1 619 U.S. Pat. No. 8,734,809 SEQ ID NO: 13 AAV CLv-R1 620 U.S. Pat. No. 8,734,809 SEQ ID NO: 30 AAV CLv-R2 621 U.S. Pat. No. 8,734,809 SEQ ID NO: 31 AAV CLv-R3 622 U.S. Pat. No. 8,734,809 SEQ ID NO: 32 AAV CLv-R4 623 U.S. Pat. No. 8,734,809 SEQ ID NO: 33 AAV CLv-R5 624 U.S. Pat. No. 8,734,809 SEQ ID NO: 34 AAV CLv-R6 625 U.S. Pat. No. 8,734,809 SEQ ID NO: 35 AAV CLv-R7 626 U.S. Pat. No. 8,734,809 SEQ ID NO: 36 AAV CLv-R8 627 U.S. Pat. No. 8,734,809 SEQ ID NO: 37 AAV CLv-R9 628 U.S. Pat. No. 8,734,809 SEQ ID NO: 38 AAV CLg-F1 629 U.S. Pat. No. 8,734,809 SEQ ID NO: 39 AAV CLg-F2 630 U.S. Pat. No. 8,734,809 SEQ ID NO: 40 AAV CLg-F3 631 U.S. Pat. No. 8,734,809 SEQ ID NO: 41 AAV CLg-F4 632 U.S. Pat. No. 8,734,809 SEQ ID NO: 42 AAV CLg-F5 633 U.S. Pat. No. 8,734,809 SEQ ID NO: 43 AAV CLg-F6 634 U.S. Pat. No. 8,734,809 SEQ ID NO: 43 AAV CLg-F7 635 U.S. Pat. No. 8,734,809 SEQ ID NO: 44 AAV CLg-F8 636 U.S. Pat. No. 8,734,809 SEQ ID NO: 43 AAV CSp-1 637 U.S. Pat. No. 8,734,809 SEQ ID NO: 45 AAV CSp-10 638 U.S. Pat. No. 8,734,809 SEQ ID NO: 46 AAV CSp-11 639 U.S. Pat. No. 8,734,809 SEQ ID NO: 47 AAV CSp-2 640 U.S. Pat. No. 8,734,809 SEQ ID NO: 48 AAV CSp-3 641 U.S. Pat. No. 8,734,809 SEQ ID NO: 49 AAV CSp-4 642 U.S. Pat. No. 8,734,809 SEQ ID NO: 50 AAV CSp-6 643 U.S. Pat. No. 8,734,809 SEQ ID NO: 51 AAV CSp-7 644 U.S. Pat. No. 8,734,809 SEQ ID NO: 52 AAV CSp-8 645 U.S. Pat. No. 8,734,809 SEQ ID NO: 53 AAV CSp-9 646 U.S. Pat. No. 8,734,809 SEQ ID NO: 54 AAV CHt-2 647 U.S. Pat. No. 8,734,809 SEQ ID NO: 55 AAV CHt-3 648 U.S. Pat. No. 8,734,809 SEQ ID NO: 56 AAV CKd-1 649 U.S. Pat. No. 8,734,809 SEQ ID NO: 57 AAV CKd-10 650 U.S. Pat. No. 8,734,809 SEQ ID NO: 58 AAV CKd-2 651 U.S. Pat. No. 8,734,809 SEQ ID NO: 59 AAV CKd-3 652 U.S. Pat. No. 8,734,809 SEQ ID NO: 60 AAV CKd-4 653 U.S. Pat. No. 8,734,809 SEQ ID NO: 61 AAV CKd-6 654 U.S. Pat. No. 8,734,809 SEQ ID NO: 62 AAV CKd-7 655 U.S. Pat. No. 8,734,809 SEQ ID NO: 63 AAV CKd-8 656 U.S. Pat. No. 8,734,809 SEQ ID NO: 64 AAV CLv-1 657 U.S. Pat. No. 8,734,809 SEQ ID NO: 65 AAV CLv-12 658 U.S. Pat. No. 8,734,809 SEQ ID NO: 66 AAV CLv-13 659 U.S. Pat. No. 8,734,809 SEQ ID NO: 67 AAV CLv-2 660 U.S. Pat. No. 8,734,809 SEQ ID NO: 68 AAV CLv-3 661 U.S. Pat. No. 8,734,809 SEQ ID NO: 69 AAV CLv-4 662 U.S. Pat. No. 8,734,809 SEQ ID NO: 70 AAV CLv-6 663 U.S. Pat. No. 8,734,809 SEQ ID NO: 71 AAV CLv-8 664 U.S. Pat. No. 8,734,809 SEQ ID NO: 72 AAV CKd-B1 665 U.S. Pat. No. 8,734,809 SEQ ID NO: 73 AAV CKd-B2 666 U.S. Pat. No. 8,734,809 SEQ ID NO: 74 AAV CKd-B3 667 U.S. Pat. No. 8,734,809 SEQ ID NO: 75 AAV CKd-B4 668 U.S. Pat. No. 8,734,809 SEQ ID NO: 76 AAV CKd-B5 669 U.S. Pat. No. 8,734,809 SEQ ID NO: 77 AAV CKd-B6 670 U.S. Pat. No. 8,734,809 SEQ ID NO: 78 AAV CKd-B7 671 U.S. Pat. No. 8,734,809 SEQ ID NO: 79 AAV CKd-B8 672 U.S. Pat. No. 8,734,809 SEQ ID NO: 80 AAV CKd-H1 673 U.S. Pat. No. 8,734,809 SEQ ID NO: 81 AAV CKd-H2 674 U.S. Pat. No. 8,734,809 SEQ ID NO: 82 AAV CKd-H3 675 U.S. Pat. No. 8,734,809 SEQ ID NO: 83 AAV CKd-H4 676 U.S. Pat. No. 8,734,809 SEQ ID NO: 84 AAV CKd-H5 677 U.S. Pat. No. 8,734,809 SEQ ID NO: 85 AAV CKd-H6 678 U.S. Pat. No. 8,734,809 SEQ ID NO: 77 AAV CHt-1 679 U.S. Pat. No. 8,734,809 SEQ ID NO: 86 AAV CLv1-1 680 U.S. Pat. No. 8,734,809 SEQ ID NO: 171 AAV CLv1-2 681 U.S. Pat. No. 8,734,809 SEQ ID NO: 172 AAV CLv1-3 682 U.S. Pat. No. 8,734,809 SEQ ID NO: 173 AAV CLv1-4 683 U.S. Pat. No. 8,734,809 SEQ ID NO: 174 AAV Clv1-7 684 U.S. Pat. No. 8,734,809 SEQ ID NO: 175 AAV Clv1-8 685 U.S. Pat. No. 8,734,809 SEQ ID NO: 176 AAV Clv1-9 686 U.S. Pat. No. 8,734,809 SEQ ID NO: 177 AAV Clv1-10 687 U.S. Pat. No. 8,734,809 SEQ ID NO: 178 AAV.VR-355 688 U.S. Pat. No. 8,734,809 SEQ ID NO: 181 AAV.hu.48R3 689 U.S. Pat. No. 8,734,809 SEQ ID NO: 183 AAV CBr-E1 690 U.S. Pat. No. 8,734,809 SEQ ID NO: 87 AAV CBr-E2 691 U.S. Pat. No. 8,734,809 SEQ ID NO: 88 AAV CBr-E3 692 U.S. Pat. No. 8,734,809 SEQ ID NO: 89 AAV CBr-E4 693 U.S. Pat. No. 8,734,809 SEQ ID NO: 90 AAV CBr-E5 694 U.S. Pat. No. 8,734,809 SEQ ID NO: 91 AAV CBr-e5 695 U.S. Pat. No. 8,734,809 SEQ ID NO: 92 AAV CBr-E6 696 U.S. Pat. No. 8,734,809 SEQ ID NO: 93 AAV CBr-E7 697 U.S. Pat. No. 8,734,809 SEQ ID NO: 94 AAV CBr-E8 698 U.S. Pat. No. 8,734,809 SEQ ID NO: 95 AAV CLv-D1 699 U.S. Pat. No. 8,734,809 SEQ ID NO: 96 AAV CLv-D2 700 U.S. Pat. No. 8,734,809 SEQ ID NO: 97 AAV CLv-D3 701 U.S. Pat. No. 8,734,809 SEQ ID NO: 98 AAV CLv-D4 702 U.S. Pat. No. 8,734,809 SEQ ID NO: 99 AAV CLv-D5 703 U.S. Pat. No. 8,734,809 SEQ ID NO: 100 AAV CLv-D6 704 U.S. Pat. No. 8,734,809 SEQ ID NO: 101 AAV CLv-D7 705 U.S. Pat. No. 8,734,809 SEQ ID NO: 102 AAV CLv-D8 706 U.S. Pat. No. 8,734,809 SEQ ID NO: 103 AAV CLv-E1 707 U.S. Pat. No. 8,734,809 SEQ ID NO: 87 AAV CLv-R1 708 U.S. Pat. No. 8,734,809 SEQ ID NO: 104 AAV CLv-R2 709 U.S. Pat. No. 8,734,809 SEQ ID NO: 105 AAV CLv-R3 710 U.S. Pat. No. 8,734,809 SEQ ID NO: 106 AAV CLv-R4 711 U.S. Pat. No. 8,734,809 SEQ ID NO: 107 AAV CLv-R5 712 U.S. Pat. No. 8,734,809 SEQ ID NO: 108 AAV CLv-R6 713 U.S. Pat. No. 8,734,809 SEQ ID NO: 109 AAV CLv-R7 714 U.S. Pat. No. 8,734,809 SEQ ID NO: 110 AAV CLv-R8 715 U.S. Pat. No. 8,734,809 SEQ ID NO: 111 AAV CLv-R9 716 U.S. Pat. No. 8,734,809 SEQ ID NO: 112 AAV CLg-F1 717 U.S. Pat. No. 8,734,809 SEQ ID NO: 113 AAV CLg-F2 718 U.S. Pat. No. 8,734,809 SEQ ID NO: 114 AAV CLg-F3 719 U.S. Pat. No. 8,734,809 SEQ ID NO: 115 AAV CLg-F4 720 U.S. Pat. No. 8,734,809 SEQ ID NO: 116 AAV CLg-F5 721 U.S. Pat. No. 8,734,809 SEQ ID NO: 117 AAV CLg-F6 722 U.S. Pat. No. 8,734,809 SEQ ID NO: 117 AAV CLg-F7 723 U.S. Pat. No. 8,734,809 SEQ ID NO: 118 AAV CLg-F8 724 U.S. Pat. No. 8,734,809 SEQ ID NO: 117 AAV CSp-1 725 U.S. Pat. No. 8,734,809 SEQ ID NO: 119 AAV CSp-10 726 U.S. Pat. No. 8,734,809 SEQ ID NO: 120 AAV CSp-11 727 U.S. Pat. No. 8,734,809 SEQ ID NO: 121 AAV CSp-2 728 U.S. Pat. No. 8,734,809 SEQ ID NO: 122 AAV CSp-3 729 U.S. Pat. No. 8,734,809 SEQ ID NO: 123 AAV CSp-4 730 U.S. Pat. No. 8,734,809 SEQ ID NO: 124 AAV CSp-6 731 U.S. Pat. No. 8,734,809 SEQ ID NO: 125 AAV CSp-7 732 U.S. Pat. No. 8,734,809 SEQ ID NO: 126 AAV CSp-8 733 U.S. Pat. No. 8,734,809 SEQ ID NO: 127 AAV CSp-9 734 U.S. Pat. No. 8,734,809 SEQ ID NO: 128 AAV CHt-2 735 U.S. Pat. No. 8,734,809 SEQ ID NO: 129 AAV CHt-3 736 U.S. Pat. No. 8,734,809 SEQ ID NO: 130 AAV CKd-1 737 U.S. Pat. No. 8,734,809 SEQ ID NO: 131 AAV CKd-10 738 U.S. Pat. No. 8,734,809 SEQ ID NO: 132 AAV CKd-2 739 U.S. Pat. No. 8,734,809 SEQ ID NO: 133 AAV CKd-3 740 U.S. Pat. No. 8,734,809 SEQ ID NO: 134 AAV CKd-4 741 U.S. Pat. No. 8,734,809 SEQ ID NO: 135 AAV CKd-6 742 U.S. Pat. No. 8,734,809 SEQ ID NO: 136 AAV CKd-7 743 U.S. Pat. No. 8,734,809 SEQ ID NO: 137 AAV CKd-8 744 U.S. Pat. No. 8,734,809 SEQ ID NO: 138 AAV CLv-1 745 U.S. Pat. No. 8,734,809 SEQ ID NO: 139 AAV CLv-12 746 U.S. Pat. No. 8,734,809 SEQ ID NO: 140 AAV CLv-13 747 U.S. Pat. No. 8,734,809 SEQ ID NO: 141 AAV CLv-2 748 U.S. Pat. No. 8,734,809 SEQ ID NO: 142 AAV CLv-3 749 U.S. Pat. No. 8,734,809 SEQ ID NO: 143 AAV CLv-4 750 U.S. Pat. No. 8,734,809 SEQ ID NO: 144 AAV CLv-6 751 U.S. Pat. No. 8,734,809 SEQ ID NO: 145 AAV CLv-8 752 U.S. Pat. No. 8,734,809 SEQ ID NO: 146 AAV CKd-B1 753 U.S. Pat. No. 8,734,809 SEQ ID NO: 147 AAV CKd-B2 754 U.S. Pat. No. 8,734,809 SEQ ID NO: 148 AAV CKd-B3 755 U.S. Pat. No. 8,734,809 SEQ ID NO: 149 AAV CKd-B4 756 U.S. Pat. No. 8,734,809 SEQ ID NO: 150 AAV CKd-B5 757 U.S. Pat. No. 8,734,809 SEQ ID NO: 151 AAV CKd-B6 758 U.S. Pat. No. 8,734,809 SEQ ID NO: 152 AAV CKd-B7 759 U.S. Pat. No. 8,734,809 SEQ ID NO: 153 AAV CKd-B8 760 U.S. Pat. No. 8,734,809 SEQ ID NO: 154 AAV CKd-H1 761 U.S. Pat. No. 8,734,809 SEQ ID NO: 155 AAV CKd-H2 762 U.S. Pat. No. 8,734,809 SEQ ID NO: 156 AAV CKd-H3 763 U.S. Pat. No. 8,734,809 SEQ ID NO: 157 AAV CKd-H4 764 U.S. Pat. No. 8,734,809 SEQ ID NO: 158 AAV CKd-H5 765 U.S. Pat. No. 8,734,809 SEQ ID NO: 159 AAV CKd-H6 766 U.S. Pat. No. 8,734,809 SEQ ID NO: 151 AAV CHt-1 767 U.S. Pat. No. 8,734,809 SEQ ID NO: 160 AAV CHt-P2 768 WO2016065001 SEQ ID NO: 1 AAV CHt-P5 769 WO2016065001 SEQ ID NO: 2 AAV CHt-P9 770 WO2016065001 SEQ ID NO: 3 AAV CBr-7.1 771 WO2016065001 SEQ ID NO: 4 AAV CBr-7.2 772 WO2016065001 SEQ ID NO: 5 AAV CBr-7.3 773 WO2016065001 SEQ ID NO: 6 AAV CBr-7.4 774 WO2016065001 SEQ ID NO: 7 AAV CBr-7.5 775 WO2016065001 SEQ ID NO: 8 AAV CBr-7.7 776 WO2016065001 SEQ ID NO: 9 AAV CBr-7.8 777 WO2016065001 SEQ ID NO: 10 AAV CBr-7.10 778 WO2016065001 SEQ ID NO: 11 AAV CKd-N3 779 WO2016065001 SEQ ID NO: 12 AAV CKd-N4 780 WO2016065001 SEQ ID NO: 13 AAV CKd-N9 781 WO2016065001 SEQ ID NO: 14 AAV CLv-L4 782 WO2016065001 SEQ ID NO: 15 AAV CLv-L5 783 WO2016065001 SEQ ID NO: 16 AAV CLv-L6 784 WO2016065001 SEQ ID NO: 17 AAV CLv-K1 785 WO2016065001 SEQ ID NO: 18 AAV CLv-K3 786 WO2016065001 SEQ ID NO: 19 AAV CLv-K6 787 WO2016065001 SEQ ID NO: 20 AAV CLv-M1 788 WO2016065001 SEQ ID NO: 21 AAV CLv-M11 789 WO2016065001 SEQ ID NO: 22 AAV CLv-M2 790 WO2016065001 SEQ ID NO: 23 AAV CLv-M5 791 WO2016065001 SEQ ID NO: 24 AAV CLv-M6 792 WO2016065001 SEQ ID NO: 25 AAV CLv-M7 793 WO2016065001 SEQ ID NO: 26 AAV CLv-M8 794 WO2016065001 SEQ ID NO: 27 AAV CLv-M9 795 WO2016065001 SEQ ID NO: 28 AAV CHt-P1 796 WO2016065001 SEQ ID NO: 29 AAV CHt-P6 797 WO2016065001 SEQ ID NO: 30 AAV CHt-P8 798 WO2016065001 SEQ ID NO: 31 AAV CHt-6.1 799 WO2016065001 SEQ ID NO: 32 AAV CHt-6.10 800 WO2016065001 SEQ ID NO: 33 AAV CHt-6.5 801 WO2016065001 SEQ ID NO: 34 AAV CHt-6.6 802 WO2016065001 SEQ ID NO: 35 AAV CHt-6.7 803 WO2016065001 SEQ ID NO: 36 AAV CHt-6.8 804 WO2016065001 SEQ ID NO: 37 AAV CSp-8.10 805 WO2016065001 SEQ ID NO: 38 AAV CSp-8.2 806 WO2016065001 SEQ ID NO: 39 AAV CSp-8.4 807 WO2016065001 SEQ ID NO: 40 AAV CSp-8.5 808 WO2016065001 SEQ ID NO: 41 AAV CSp-8.6 809 WO2016065001 SEQ ID NO: 42 AAV CSp-8.7 810 WO2016065001 SEQ ID NO: 43 AAV CSp-8.8 811 WO2016065001 SEQ ID NO: 44 AAV CSp-8.9 812 WO2016065001 SEQ ID NO: 45 AAV CBr-B7.3 813 WO2016065001 SEQ ID NO: 46 AAV CBr-B7.4 814 WO2016065001 SEQ ID NO: 47 AAV3B 815 WO2016065001 SEQ ID NO: 48 AAV4 816 WO2016065001 SEQ ID NO: 49 AAV5 817 WO2016065001 SEQ ID NO: 50 AAV CHt-P2 818 WO2016065001 SEQ ID NO: 51 AAV CHt-P5 819 WO2016065001 SEQ ID NO: 52 AAV CHt-P9 820 WO2016065001 SEQ ID NO: 53 AAV CBr-7.1 821 WO2016065001 SEQ ID NO: 54 AAV CBr-7.2 822 WO2016065001 SEQ ID NO: 55 AAV CBr-7.3 823 WO2016065001 SEQ ID NO: 56 AAV CBr-7.4 824 WO2016065001 SEQ ID NO: 57 AAV CBr-7.5 825 WO2016065001 SEQ ID NO: 58 AAV CBr-7.7 826 WO2016065001 SEQ ID NO: 59 AAV CBr-7.8 827 WO2016065001 SEQ ID NO: 60 AAV CBr-7.10 828 WO2016065001 SEQ ID NO: 61 AAV CKd-N3 829 WO2016065001 SEQ ID NO: 62 AAV CKd-N4 830 WO2016065001 SEQ ID NO: 63 AAV CKd-N9 831 WO2016065001 SEQ ID NO: 64 AAV CLv-L4 832 WO2016065001 SEQ ID NO: 65 AAV CLv-L5 833 WO2016065001 SEQ ID NO: 66 AAV CLv-L6 834 WO2016065001 SEQ ID NO: 67 AAV CLv-K1 835 WO2016065001 SEQ ID NO: 68 AAV CLv-K3 836 WO2016065001 SEQ ID NO: 69 AAV CLv-K6 837 WO2016065001 SEQ ID NO: 70 AAV CLv-M1 838 WO2016065001 SEQ ID NO: 71 AAV CLv-M11 839 WO2016065001 SEQ ID NO: 72 AAV CLv-M2 840 WO2016065001 SEQ ID NO: 73 AAV CLv-M5 841 WO2016065001 SEQ ID NO: 74 AAV CLv-M6 842 WO2016065001 SEQ ID NO: 75 AAV CLv-M7 843 WO2016065001 SEQ ID NO: 76 AAV CLv-M8 844 WO2016065001 SEQ ID NO: 77 AAV CLv-M9 845 WO2016065001 SEQ ID NO: 78 AAV CHt-P1 846 WO2016065001 SEQ ID NO: 79 AAV CHt-P6 847 WO2016065001 SEQ ID NO: 80 AAV CHt-P8 848 WO2016065001 SEQ ID NO: 81 AAV CHt-6.1 849 WO2016065001 SEQ ID NO: 82 AAV CHt-6.10 850 WO2016065001 SEQ ID NO: 83 AAV CHt-6.5 851 WO2016065001 SEQ ID NO: 84 AAV CHt-6.6 852 WO2016065001 SEQ ID NO: 85 AAV CHt-6.7 853 WO2016065001 SEQ ID NO: 86 AAV CHt-6.8 854 WO2016065001 SEQ ID NO: 87 AAV CSp-8.10 855 WO2016065001 SEQ ID NO: 88 AAV CSp-8.2 856 WO2016065001 SEQ ID NO: 89 AAV CSp-8.4 857 WO2016065001 SEQ ID NO: 90 AAV CSp-8.5 858 WO2016065001 SEQ ID NO: 91 AAV CSp-8.6 859 WO2016065001 SEQ ID NO: 92 AAV CSp-8.7 860 WO2016065001 SEQ ID NO: 93 AAV CSp-8.8 861 WO2016065001 SEQ ID NO: 94 AAV CSp-8.9 862 WO2016065001 SEQ ID NO: 95 AAV CBr-B7.3 863 WO2016065001 SEQ ID NO: 96 AAV CBr-B7.4 864 WO2016065001 SEQ ID NO: 97 AAV3B 865 WO2016065001 SEQ ID NO: 98 AAV4 866 WO2016065001 SEQ ID NO: 99 AAV5 867 WO2016065001 SEQ ID NO: 100 AAVPHP.B or 868 WO2015038958 SEQ ID NO: 8 and 13; G2B-26 GenBankALU85156.1 AAVPHP.B 869 WO2015038958 SEQ ID NO: 9 AAVG2B-13 870 WO2015038958 SEQ ID NO: 12 AAVTH1.1-32 871 WO2015038958 SEQ ID NO: 14 AAVTH1.1-35 872 WO2015038958 SEQ ID NO: 15

    [0091] Each of the patents, applications and/or publications listed in Table 1 are hereby incorporated by reference in their entirety.

    [0092] In one embodiment, the AAV serotype may be, or may have a sequence as described in International Patent Publication WO2015038958, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV9 (SEQ ID NO: 2 and 11 of WO2015038958, herein SEQ ID NO: 127 and 126 respectively), PHP.R (SEQ ID NO: 8 and 9 of WO2015038958, herein SEQ ID NO: 868 and 869 respectively), G2B-13 (SEQ ID NO: 12 of WO2015038958, herein SEQ ID NO: 870), G2B-26 (SEQ ID NO: 13 of WO2015038958, herein SEQ ID NO: 868 and 869 respectively), TH1.1-32 (SEQ ID NO: 14 of WO2015038958, herein SEQ ID NO: 871), TH1.1-35 (SEQ ID NO: 15 of WO2015038958, herein SEQ ID NO: 872) or variants thereof. Further, any of the targeting peptides or amino acid inserts described in WO2015038958, may be inserted into any parent AAV serotype, such as, but not limited to, AAV9 (SEQ ID NO: 126 for the DNA sequence and SEQ ID NO: 127 for the amino acid sequence). In one embodiment, the amino acid insert is inserted between amino acids 586-592of the parent AAV (e.g., AAV9). In another embodiment, the amino acid insert is inserted between amino acids 588-589 of the parent AAV sequence. The amino acid insert may be, but is not limited to, any of the following amino acid sequences, TLAVPFK (SEQ ID NO: 1 of WO2015038958, herein SEQ ID NO: 873), KFPVALT (SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 874), LAVPFK (SEQ ID NO: 31 of WO2015038958: herein SEQ ID NO: 875), AVPFK (SEQ ID NO: 32 of WO2015038958; herein SEQ ID NO: 876), VPFK (SEQ ID NO: 33 of WO2015038958; herein SEQ ID NO: 877), TLAVPF (SEQ ID NO: 34 of WO2015038958; herein SEQ ID NO: 878), TLA VP (SEQ ID NO: 35 of WO2015038958; herein SEQ ID NO: 879), TLAV (SEQ ID NO: 36 of WO2015038958; herein SEQ ID NO: 880), SVSKPFL (SEQ ID NO: 28 of WO2015038958, herein SEQ ID NO: 881). FTLTTPK (SEQ ID NO: 29 of WO2015038958; herein SEQ ID NO: 882), MNATKNV (SEQ ID NO: 30 of WO2015038958; herein SEQ ID NO: 883), QSSQTPR (SEQ ID NO: 54 of WG2015038958; herein SEQ ID NO: 884), ILGTGTS (SEQ ID NO: 55 of WO2015038958; herein SEQ ID NO: 885), TRTNPEA (SEQ ID NO: 56 of WO2015038958; herein SEQ ID NO: 886), NGGTSSS (SEQ ID NO: 58 of WO2015038958, herein SEQ ID NO: 887), or YTLSQGW (SEQ ID NO: 60 of WO2015038958; herein SEQ ID NO: 888), Non-limiting examples of nucleotide sequences that may encode the amino acid inserts include the following, AAGTTTCCTGTGGCGTTGACT (SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 889), ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO: 24 and 49 of WO2015038958; herein SEQ ID NO: 890), AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 25 of WO2015038958; herein SEQ ID NO: 891), TTTACGTTGACGACGCCTAAG (SEQ ID NO: 26 of WO2015038958, herein SEQ ID NO: 892). ATGAATGCTACGAAGAATGTG (SEQ ID NO: 27 of WO2015038958; herein SEQ ID NO: 893), CAGTCGTCGCAGACGCCTAGG (SEQ ID NO: 48 of WO2015038958, herein SEQ ID NO: 894), ATTCTGGGGACTGGTACTTCG (SEQ ID NO: 50 and 52 of WO2015038958; herein SEQ ID NO: 895), ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51 of WO2015038958; herein SEQ ID NO: 896), AATGGGGGGACTAGTAGTTCT (SEQ ID NO: 53 of WO2015038958, herem SEQ ID NO: 897), or TATACTTTGTCGCAGGGTTGG (SEQ ID NO: 59 of WO2015038958; herem SEQ ID NO: 898).

    Viral Genome Component: Inverted Terminal Repeats (ITRs)

    [0093] The AAV particles of the present invention comprise a viral genome with at least one ITR region and a payload region. In one embodiment, the viral genome has two ITRs. These two ITRs flank the payload region at the 5 and 3 ends. The ITRs function as origins of replication comprising recognition sites for replication. ITRs comprise sequence regions which can be complementary find symmetrically arranged ITRs incorporated into viral genomes of the invention may be comprised of naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.

    [0094] The ITRs may be derived from the same serotype as the capsid, selected from any of the serotypes listed in Table 1, or a derivative thereof. The ITR may be of a different serotype than the capsid. In one embodiment, the AAV particle has more than one ITR. In a non-limiting example, the AAV particle has a viral genome comprising two ITRs. In one embodiment, the ITRs are of the same serotype as one another. In another embodiment, the ITRs are of different serotypes. Non-limiting examples include zero, one or both of the ITRs having the same serotype as the capsid. In one embodiment both ITRs of the viral genome of the AAV particle are AAV2 ITRs.

    [0095] Independently, each ITR may be about 100 to about 150 nucleotides in length. An ITR may be about 100-105 nucleotides in length, 106-110 nucleotides in length, 111-115 nucleotides in length, 116-120 nucleotides in length, 121-125 nucleotides in length, 126-130 nucleotides in length, 131-135 nucleotides in length, 136-140 nucleotides in length, 141-145 nucleotides in length or 146-150 nucleotides in length. In one embodiment, the ITRs are 14-142 nucleotides in length. Non-limiting examples of ITR length are 102, 140, 141, 142, 145 nucleotides in length, and those having at least 95% identity thereto.

    Viral Genome Component: Promoters

    [0096] In one embodiment, the payload region of the viral genome comprises at least one element to enhance the transgene target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety). Non-limiting examples of elements to enhance the transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers and introns.

    [0097] A person skilled in the art may recognize that expression of the polypeptides of the invention in a target cell may require a specific promoter, including but not limited to, a promoter that is species specific, inducible, tissue-specific, or cell cycle-specific (Parr et al., Nat. Med.3:1145-9 (1997); the contents of which are herein incorporated by reference in their entirety).

    [0098] In one embodiment, the promoter is deemed to be efficient when it drives expression of the polypeptide(s) encoded in the payload region of the viral genome of the AAV particle.

    [0099] In one embodiment, the promoter is a promoter deemed to be efficient when it drives expression in the cell being targeted.

    [0100] In one embodiment, the promoter drives expression of the polypeptides of the invention (e.g., a functional antibody) for a period of time in targeted tissues. Expression driven by a promoter may be for a period of 1 hour, 2, hours, 3 hours. 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days. 25 days, 26 days. 27 days. 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months. 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more than 10 years. Expression may be for 1-5 hours, 1-12 hours, 1-2 days, 1-5 days, 1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6 months, 2-6 months, 3-6 months. 3-9 months, 4-8 months, 6-12 months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years, or 5-10 years.

    [0101] In one embodiment, the promoter drives expression of the polypeptides of the invention (e.g., a functional antibody) for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years, 22 years, 23 years, 24 years, 25 years, 26 years, 27 years, 28 years, 29 years, 30 years, 31 years, 32 years, 33 years, 34 years, 35 years, 36 years, 37 years, 38 years, 39 years, 40 years, 41 years, 42 years, 43 years, 44 years, 45 years, 46 years, 47 years, 48 years, 49 years, 50 years, 55 years, 60 years, 65 years, or more than 65 years,

    [0102] Promoters may be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include viral promoters, plant promoters and mammalian promoters. In some embodiments, the promoters may be human promoters. In some embodiments, the promoter may be truncated.

    [0103] Promoters which drive or promote expression in most tissues include, but are not limited to, human elongation factor 1-subunit (EF1), cytomegalovirus (CMV) immediate-early enhancer and/or promoter, chicken -actin (CBA) and its derivative CAG, glucuronidase (GUSB), or ubiquitin C (UBC). Tissue-specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, muscle specific promoters, B cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, or nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes.

    [0104] Non-limiting examples of muscle-specific promoters include mammalian muscle creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, mammalian troponin I (TNNI2) promoter, and mammalian skeletal alpha-actm (ASKA) promoter (see, e.g. U.S. Patent Publication US20110212529, the contents of which are herein incorporated by reference in their entirely).

    [0105] Non-limiting examples of tissue-specific expression elements for neurons include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF-), synapsin (Syn), methyl-CpG binding protein 2 (MeCP2), Ca.sup.2+/calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light (NFL) or heavy (NFH), -globin minigene n2, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2) promoters. Non-limiting examples of tissue-specific expression elements for astrocytes include glial fibrillary acidic protein (GFAP) and EAAT2 promoters. A non-limiting example of a tissue-specific expression element for oligodendrocytes includes the myelin basic protein (MBP) promoter.

    [0106] In one embodiment, the promoter may be less than 1 kb. The promoter may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380. 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, or more than 800 nucleotides. The promoter may have a length between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400. 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800, or 700-800.

    [0107] In one embodiment, the promoter may be a combination of two or more components of the same or different starting or parental promoters such as, but not limited to, CMV and CBA. Each component may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330. 340, 350, 360, 370, 380, 381, 382, 383, 384, 385, 386, 387, 388. 389, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480. 490, 500, 510, 520. 530, 540, 550, 560, 570. 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760. 770, 780, 790, 800, or more than 800. Each component may have a length between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 or 700-800. In one embodiment, the promoter is a combination of a 382 nucleotide CMV-enhancer sequence and a 260 nucleotide CBA-promoter sequence.

    [0108] In one embodiment, the viral genome comprises a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include CMV. CBA (including derivatives CAG, CBh, etc.), EF-1, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3). Yu et al. (Molecular Pain 2011, 7.63; the contents of which are herein incorporated by reference in their entirety) evaluated the expression of eGFP under the CAG, EF, PGK and UBC promoters in rat DRG cells and primary DRG cells using lenti viral vectors and found that UBC showed weaker expression than the other 3 promoters and only 10-12% glial expression was seen for all promoters. Soderblom et al. (E. Neuro 2015; the contents of which are herein incorporated by reference in its entirety) evaluated the expression of eGFP in AAV8 with CMV and UBC promoters and AAV2 with the CMV promoter after injection in the motor cortex. Intranasal administration of a plasmid containing a UBC or EF1 promoter showed a sustained airway expression greater than the expression with the CMV promoter (See e.g., Gill et al, Gene Therapy 2001, Vol. 8, 1539-1546; the contents of which are herein incorporated by reference in their entirety ). Flusam et al. (Gene Therapy 2009; the contents of which are herein incorporated by reference in its entirety) evaluated an TH construct with a hGUSB promoter, aHSV-1LAT promoter and an NSE promoter and found that the HH construct showed weaker expression than NSE in mouse brain. Passini and Wolfe (J. Virol. 2001, 12382-12392, the contents of which are herein incorporated by reference in its entirety) evaluated the long-term effects of the HH vector following an intraventricular injection in neonatal mice and found that there was sustained expression for at least 1 year. Low expression in all brain regions was found by Xu et al. (Gene Therapy 2001. 8, 1323-1332, the contents of which are herein incorporated by reference in their entirety) when NFL and NFH promoters were used as compared to the CMV-lacZ, CMV-luc, EF, GFAP, hENK, nAChR, PPE, PPE+ wpre, NSE (0.3 kb), NSE (1.8 kb) and NSE (1.8 kb+wpre). Xu et al. found that the promoter activity in descending order was NSE (1.8 kb), EF, NSE (0.3 kb), GFAP, CMV, hENK, PPE, NFL and NFH. NFL is a 650 nucleontide promoter and NFH is a 920 nucleotide promoter which are both absent in the liver but NFH is abundant in the sensory proprioceptive neurons, brain and spinal cord and NFH is present in the heart. Scn8a is a 470 nucleotide promoter which expresses throughout the DR.G, spinal cord and brain with particularly high expression seen in the hippocampal neurons and cerebellar Purkinje cells, cortex, thalamus, and hypothalamus (See e.g., Drews et al. Identification of evolutionary conserved, functional noncoding elements in the promoter region of the sodium channel gene SCN8A, Mamm Genome (2007) 18:723-731; and Raymond et al. Expression of Alternatively Spliced Sodium Channel -subunit genes. Journal of Biological Chemistry (2004) 279(44) 46234-46241; the contents of each of which are herein incorporated by reference in their entireties).

    [0109] Any of promoters taught by the aforementioned Yu, Soderblom, Gill, Husain, Passini, Xu, Drews, or Raymond may be used in the present inventions.

    [0110] In one embodiment, the promoter is not cell specific.

    [0111] In one embodiment, the promoter is a ubiquitin c (UBC) promoter. The UBC promoter may have a size of 300-350 nucleotides. As anon-limiting example, the UBC promoter is 332 nucleotides.

    [0112] In one embodiment, the promoter is a -glucuronidase (GUSB) promoter. The GUSB promoter may have a size of 350-400 nucleotides. As anon-limiting example, the GUSB promoter is 378 nucleotides.

    [0113] In one embodiment, the promoter is a neurofilament light (NFL) promoter. The NFL promoter may have a size of 600-700 nucleotides. As a non-limiting example, the NFL promoter is 650 nucleotides,

    [0114] In one embodiment, the promoter is a neurofilament heavy (NFH) promoter. The NFH promoter may have a size of 900-950 nucleotides. As a non-limiting example, the NFH promoter is 920 nucleotides.

    [0115] In one embodiment, the promoter is a scn8a promoter. The scn8a promoter may have a size of 450-500 nucleotides. As a non-limiting example, the scnBa promoter is 470 nucleotides.

    [0116] In one embodiment, the promoter is a. phosphoglycerate kinase 1 (PGK) promoter.

    [0117] In one embodiment, the promoter is a chicken -actin (CBA) promoter.

    [0118] In one embodiment, the promoter is a cytomegalovirus (CMV) promoter.

    [0119] In one embodiment, the promoter is a liver or a skeletal muscle promoter. Non-limiting examples of liver promoters include human -1-antitrypsin (hAAT) and thyroxine binding globulin (TBG). Non-limiting examples of skeletal muscle promoters include Desmin, MCK or synthetic C5-12.

    [0120] In one embodiment, the promoter is a RNA pol III promoter. As a non-limiting example, the RNA pol III promoter is U6. As a non-limiting example, the RN A pol III promoter is HI.

    [0121] In one embodiment, the viral genome comprises two promoters. As a non-limiting example, the promoters are an EF1 promoter and a CMV promoter.

    [0122] In one embodiment, the viral genome comprises an enhancer element, a promoter and/or a 5UTR intron. The enhancer element, also referred to herein as an enhancer, may be, but is not limited to, a CMV enhancer, the promoter may be, but is not limited to, a CMV, CBA, UBC, GUSB, NSE, Synapsm, MeCP2, and GFAP promoter and the 5UTR/intron may be, but is not limited to, SV40, and CBA-MVM. As a non-limiting example, the enhancer, promoter and/or intron used in combination may be: (1) CMV enhancer, CMV promoter, SV40 5UTR intron; (2) CMV enhancer, CBA promoter, SV 40 5UTR intron; (3) CMV enhancer, CBA promoter, CBA-MVM 5UTR intron; (4) UBC promoter; (5) GUSB promoter; (6) NSE promoter, (7) Synapsm promoter; (8) MeCP2 promoter; and (9) GFAP promoter.

    [0123] In one embodiment, the viral genome comprises an engineered promoter.

    [0124] In another embodiment, the viral genome comprises a promoter from a naturally expressed protein.

    Viral Genome Component: Untranslated Regions (UTRs)

    [0125] By definition, wild type untranslated regions (UTRs) of a gene are transcribed but not translated. Generally, the 5UTR starts at the transcription start site and ends at the start codon and the 3 UTR starts immediately following the stop codon and continues until the termination signal for transcription.

    [0126] Features typically found in abundantly expressed genes of specific target organs may be engineered into UTRs to enhance the stability and protein production. As a non-limiting example, a 5 UTR from mRNA normally expressed in the liver (e.g., albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII) may be used in the viral genomes of the AAV particles of the invention to enhance expression in hepatic cell lines or liver.

    [0127] While not wishing to be bound by theory, wild-type 5 untranslated regions (UTRs) include features which play roles in translation initiation, Kozak sequences, which are commonly known to be involved in the process by which the ribosome initiates translation of many genes, are usually included in 5 UTRs. Kozak sequences have the consensus CCR(A/G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), which is followed by another G.

    [0128] In one embodiment, the 5UTR in the viral genome includes a Kozak sequence.

    [0129] In one embodiment, the 5 UTR in the viral genome does not include a Kozak sequence.

    [0130] While not wishing to be bound by theory, wild-type 3 UTRs are known to have stretches of Adenosines and Uridines embedded therein. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al, 1995, the contents of which are herein incorporated by reference in its entirety): Class I AREs, such as, but not limited to, c-Myc and MyoD, contain several dispersed copies of an AUUUA motif within U-rich regions. Class II AREs, such as, but not limited to, GM-CSF and TNF-a, possess two or more overlapping UUAUUUA(U/A)(U/A) nonamers. Class III ARES, such as, but not limited to, c-Jun and Myogenin, are less well defined. These U rich regions do not contain an AUUUA motif. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3 UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo.

    [0131] Introduction, removal or modification of 3 UTR AU rich elements (AREs) can be used to modulate the stability of polynucleotides. When engineering specific polynucleotides, e.g., payload regions of viral genomes, one or more copies of an ARE can be introduced to make polynucleotides less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.

    [0132] In one embodiment, the 3 UTR of the viral genome may include an oligo(dT) sequence for tenrplated addition of a poly-A tail,

    [0133] In one embodiment, the viral genome may include at least one miRNA seed, binding site or full sequence. microRNAs (or miRNA or miR) are 19-25 nucleotide noncoding RNAs that bind to the sites of nucleic acid targets and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation. A microRNA sequence comprises a seed region, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which sequence has perfect Watson-Crick complementarity to the miRNA target sequence of the nucleic acid.

    [0134] In one embodiment, the viral genome may be engineered to include, alter or remove at least one miRNA binding site, sequence, or seed region.

    [0135] Any UTR from any gene known in the art may be incorporated into the viral genome of the AAV particle. These UTRs, or portions thereof, may be placed in the same orientation as in the gene from which they were selected or they may be altered in orientation or location. In one embodiment, the UTR used in the viral genome of the AAV particle may be inverted, shortened, lengthened, made with one or more other 5 UTRs or 3 UTRs known in the art. As used herein, the term altered as it relates to a UTR, means that the UTR has been changed in some way in relation to a reference sequence. For example, a 3 or 5 UTR may be altered relative to a wild type or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides.

    [0136] In one embodiment, the viral genome of the AAV particle comprises at least one artificial UTRs which is not a variant of a wild type UTR.

    [0137] In one embodiment, the viral genome of the AAV particle comprises UTRs which have been selected from a family of transcripts whose proteins share a common function, structure, feature or property.

    Viral Genome Component: Polyadenylation Sequence

    [0138] In one embodiment, the viral genome of the AAV particles of the present invention comprise at least one polyadenylation sequence. The viral genome of the AAV particle may comprise a polyadenylation sequence between the 3 end of the payload coding sequence and the 5 end of the 3ITR.

    [0139] In one embodiment, the polyadenylation sequence or polyA sequence may range from, absent to about 500 nucleotides in length. The polyadenylation sequence may be, but is not limited to, 1,2, 3, 4. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104. 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196. 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423. 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, and 500 nucleotides in length.

    [0140] In one embodiment the polyadenylation sequence is 50-100 nucleotides in length.

    [0141] In one embodiment, the polyadenylation sequence is 50-150 nucleotides in length.

    [0142] In one embodiment, the polyadenylation sequence is 50-160 nucleotides in length.

    [0143] In one embodiment, the polyadenylation sequence is 50-200 nucleotides in length.

    [0144] In one embodiment, the polyadenylation sequence is 60-100 nucleotides in length.

    [0145] In one embodiment, the polyadenylation sequence is 60-150 nucleotides in length.

    [0146] In one embodiment, the polyadenylation sequence is 60-160 nucleotides in length.

    [0147] In one embodiment, the polyadenylation sequence is 60-200 nucleotides in length.

    [0148] In one embodiment, the polyadenylation sequence is 70-100 nucleotides in length.

    [0149] In one embodiment, the polyadenylation sequence is 70-150 nucleotides in length.

    [0150] In one embodiment, the polyadenylation sequence is 70-1.60 nucleotides in length.

    [0151] In one embodiment, the polyadenylation sequence is 70-200 nucleotides in length.

    [0152] In one embodiment, the polyadenylation sequence is 80-100 nucleotides in length.

    [0153] In one embodiment, the polyadenylation sequence is 80-150 nucleotides in length.

    [0154] In one embodiment, the poiyadenyiation sequence is 80-160 nucleotides in length.

    [0155] In one embodiment, the poiyadenyiation sequence is 80-200 nucleotides in length,

    [0156] In one embodiment, the poiyadenyiation sequence is 90-100 nucleotides in length,

    [0157] In one embodiment, the poiyadenyiation sequence is 90-150 nucleotides in length.

    [0158] In one embodiment, the poiyadenyiation sequence is 90-160 nucleotides in length.

    [0159] In one embodiment, the poiyadenyiation sequence is 90-200 nucleotides in length.

    Viral Genome Component: Linkers

    [0160] Viral genomes of the invention may be engineered with one or more spacer or linker regions to separate coding or non-coding regions.

    [0161] In one embodiment, the payload region of the AAV particle may optionally encode one or more linker sequences. In some cases, the linker may be a peptide linker that may be used to connect the polypeptides encoded by the payload region (i.e., light and heavy antibody chains during expression). Some peptide linkers may be cleaved after expression to separate heavy and light chain domains, allowing assembly of mature antibodies or antibody fragments. Linker cleavage may be enzymatic. In some cases, linkers comprise an enzymatic cleavage site to facilitate intracellular or extracellular cleavage. Some payload regions encode linkers that interrupt polypeptide synthesis during translation of the linker sequence from a mRNA transcript. Such linkers may facilitate the translation of separate protein domains (e.g., heavy and light chain antibody domains) from a single transcript. In some cases, two or more linkers are encoded by a payload region of the viral genome. Non-limiting examples of linkers that may be encoded by the payload region of an AAV particle viral genome are given in Table 2.

    TABLE-US-00002 TABLE 2 Linkers Linker SEQ ID NO or No. Description SEQUENCE L1 Internal ribosome entry site (IRES) 899 L2 Foot and month disease virus 2A (F2A) 900 L3 Porcine teschovirus-1 virus 2A (P2A) 901 L4 Furin cleavage site (F) 902 L5 5xG4S (SEQ ID NO: 4321) 903 L6 1,4-alpha-glucan-branching enzyme CHP L7 1,4-alpha-glucan-branching enzyme 904 L8 1,4-beta-N-acetylmuramidase FKK L9 1,4-beta-N-acetylmuramidase 905 L10 1,4-beta-N-acetylmuramidase 906 L11 1,4-beta-N-acetylmuramidase 907 L12 1,4-beta-N-acetylmuramidase 908 L13 1,4-beta-N-acetylmuramidase 909 L14 1,4-beta-N-acetylmuramidase 910 L15 1,4-beta-N-acetylmuramidase 911 L16 1,4-beta-N-acetylmuramidase 912 L17 1,4-beta-N-acetylmuramidase 913 L18 1,4-beta-N-acetylmuramidase 914 L19 150aa long hypothetical transcriptional regulator 915 L20 150aa long hypothetical transcriptional regulator 916 L21 1-deoxy-D-xylulose 5-phosphate reductoisomerase 917 L22 1-deoxy-D-xylulose 5-phosphate reductoisomerase 918 L23 1-deoxy-D-xylulose 5-phosphate reductoisomerase 919 L24 1-deoxy-D-xylulose 5-phosphate reductoisomerase 920 L25 235aa long hypothetical biotin-[acetyl-CoA-carboxylase] ligase 921 L26 235aa long hypothetical biotin-[acetyl-CoA-carboxylase] ligase 922 L27 235aa long hypothetical biotin-[acetyl-CoA-carboxylase] ligase 923 L28 2-dehydropantoate 2-reductase 924 L29 2-dehydropantoate 2-reductase 925 L30 2-dehydropantoate 2-reductase 926 L31 2-dehydropantoate 2-reductase 927 L32 2-dehydropantoate 2-reductase 928 L33 2-dehydropantoate 2-reductase 929 L34 2-dehydropantoate 2-reductase, putative 930 L35 2-dehydropantoate 2-reductase, putative 931 L36 4-alpha-glucanotransferase 932 L37 4-alpha-glucanotransferase 933 L38 4-alpha-glucanotransferase 934 L39 4-diphosphocytidyl-2C-methyl-D-erythritol kinase HAA L40 4-diphosphocytidyl-2C-methyl-D-erythritol kinase 935 L41 4-diphosphocytidyl-2C-methyl-D-erythritol kinase 936 L42 4-diphosphocytidyl-2C-methyl-D-erythritol kinase 937 L43 4-diphosphocytidyl-2C-methyl-D-erythritol kinase 938 L44 4-hydroxyphenylpyruvate dioxygenase 939 L45 5-13 amino acids from the N termini of human Ck and CH1 domains linker 940 L46 5-13 amino acids from the N termini of human Ck and CH1 domains linker ERK L47 5-13 amino acids from the N termini of human Ck and CH1 domains linker 941 L48 5-13 amino acids from the N termini of human Ck and CH1 domains linker 942 L49 5-13 amino acids from the N termini of human Ck and CH1 domains linker 943 L50 5-13 amino acids from the N termini of human Ck and CH1 domains linker 944 L51 5-exonuclease 945 L52 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase ARL L53 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase 946 L54 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase 947 L55 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase 948 L56 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase 949 L57 5-nucleotidase 950 L58 5-nucleotidase 951 L59 5-nucleotidase 952 L60 5-nucleotidase 953 L61 704aa long hypothetical glycosyltransferase 954 L62 704aa long hypothetical glycosyltransferase 955 L63 80 kDa nuclear cap binding protein 956 L64 80 kDa nuclear cap binding protein 957 L65 80 kDa nuclear cap binding protein 958 L66 80 kDa nuclear cap binding protein 959 L67 Acetaldehyde dehydrogenase (acylating) 960 L68 Acetaldehyde dehydrogenase (acylating) 961 L69 Acetolactate synthase isozyme III small subunit 962 L70 Acetylcholine receptor protein, alpha chain 963 L71 Acetylcholine receptor protein, beta chain 964 L72 Aconitate hydratase 2 965 L73 Aconitate hydratase 2 966 L74 Aconitate hydratase 2 967 L75 Aconitate hydratase 2 968 L76 Aconitate hydratase 2 969 L77 Acriflavine resistance protein B DWY L78 Acriflavine resistance protein B GGS L79 Acriflavine resistance protein B IDQ L80 Acriflavine resistance protein B NKV L81 Acriflavine resistance protein B SEA L82 Acriflavine resistance protein B 970 L83 Acriflavine resistance protein B 971 L84 Acriflavine resistance protein B 972 L85 Acriflavine resistance protein B 973 L86 Acriflavine resistance protein B 974 L87 Acriflavine resistance protein B 975 L88 Acriflavine resistance protein B 976 L89 Acriflavine resistance protein B 977 L90 Acriflavine resistance protein B 978 L91 Acriflavine resistance protein B 979 L92 Acriflavine resistance protein B 980 L93 Acriflavine resistance protein B 981 L94 Acriflavine resistance protein B 982 L95 Acriflavine resistance protein B 983 L96 Acriflavine resistance protein B 984 L97 Acriflavine resistance protein B 985 L98 Acriflavine resistance protein B 986 L99 Acriflavine resistance protein B 987 L100 Acriflavine resistance protein B 988 L101 Acriflavine resistance protein B 989 L102 Acriflavine resistance protein B 990 L103 Acriflavine resistance protein B 991 L104 Acriflavine resistance protein B 992 L105 Acriflavine resistance protein B 993 L106 Acyl-CoA thioesterase II 994 L107 Acyl-CoA thioesterase II 995 L108 Acyl-CoA thioesterase II 996 L109 Acyl-CoA thioesterase II 997 L110 Acyl-CoA thioesterase II 998 L111 Acyl-coenzyme A thioesterase 4 999 L112 Acyl-coenzyme A thioesterase 4 1000 L113 Acyl-coenzyme A thioesterase 4 1001 L114 Acyl-coenzyme A thioesterase 4 1002 L115 Acyl-coenzyme A thioesterase 4 1003 L116 Adenine glycosylase 1004 L117 Adenylate cyclase 1005 L118 Aerolysin 1006 L119 Aerolysin 1007 L120 Agglutinin DWK L121 Agglutinin isolectin 1 1008 L122 Agglutinin isolectin 1 1009 L123 Aldehyde ferredoxin oxidoreductase 1010 L124 Aldehyde oxidoreductase 1011 L125 Aldehyde oxidoreductase 1012 L126 Aldehyde oxidoreductase 1013 L127 Aldehyde oxidoreductase 1014 L128 Aldehyde oxidoreductase 1015 L129 Alkyl hydroperoxide reductase subunit F 1016 L130 Alkyl hydroperoxide reductase subunit F 1017 L131 Alkyl hydroperoxide reductase subunit F 1018 L132 Alkyl hydroperoxide reductase subunit F 1019 L133 Alkyl hydroperoxide reductase subunit F 1020 L134 Alkyl hydroperoxide reductase subunit F 1021 L135 Alkyl hydroperoxide reductase subunit F 1022 L136 Alkyl hydroperoxide reductase subunit F 1023 L137 Alkyl hydroperoxide reductase subunit F 1024 L138 Alkyl hydroperoxide reductase subunit F 1025 L139 Allantoicase 1026 L140 Allantoicase 1027 L141 Alliin lyase 1 SAV L142 Alliin lyase 1 1028 L143 Alliin lyase 1 1029 L144 Alliin lyase 1 1030 L145 Alliin lyase 1 1031 L146 Alpha amylase 1032 L147 Alpha amylase 1033 L148 Alpha-actinin 1 1034 L149 Alpha-actinin 1 1035 L150 Alpha-adaptin C 1036 L151 Alpha-amylase 1037 L152 Alpha-glucuronidase LSD L153 Alpha-glucuronidase 1038 L154 Alpha-glucuronidase 1039 L155 Alpha-glucuronidase 1040 L156 Alpha-glucuronidase 1041 L157 Alpha-glucuronidase 1042 L158 Alpha-glucuronidase 1043 L159 Alpha-glucuronidase 1044 L160 Alpha-glucuronidase 1045 L161 Alpha-glucuronidase 1046 L162 Alpha-glucuronidase 1047 L163 Alpha-glucuronidase 1048 L164 Alpha-glucuronidase 1049 L165 Alpha-glucuronidase 1050 L166 Alpha-glucuronidase 1051 L167 Alpha-glucuronidase 1052 L168 Alpha-glucuronidase 1053 L169 Alpha-glucuronidase 1054 L170 Alpha-glucuronidase 1055 L171 Alpha-glucuronidase 1056 L172 Alpha-glucuronidase 1057 L173 Alpha-glucuronidase 1058 L174 Alpha-L-arabinofuranosidase B 1059 L175 Alpha-mannosidase 1060 L176 Alr2269 protein 1061 L177 AMP nucleosidase 1062 L178 AMP nucleosidase 1063 L179 AMP nucleosidase 1064 L180 Angiopoietin-1 receptor DAG L181 Angiopoietin-1 receptor NSG L182 Angiopoietin-1 receptor TSA L183 Angiopoietin-1 receptor VPR L184 Angiopoietin-1 receptor 1065 L185 Angiopoietin-1 receptor 1066 L186 Angiopoietin-1 receptor 1067 L187 Angiopoietin-1 receptor 1068 L188 Angiopoietin-1 receptor 1069 L189 Angiopoietin-1 receptor 1070 L190 Angiopoietin-1 receptor 1071 L191 Angiopoietin-1 receptor 1072 L192 Angiopoietin-1 receptor 1073 L193 Angiopoietin-1 receptor 1074 L194 Angiopoietin-1 receptor 1075 L195 Angiopoietin-1 receptor 1076 L196 Angiopoietin-1 receptor 1077 L197 Angiopoietin-1 receptor 1078 L198 Angiopoietin-1 receptor 1079 L199 Angiopoietin-1 receptor 1080 L200 Angiopoietin-1 receptor 1081 L201 Angiopoietin-1 receptor 1082 L202 Angiopoietin-1 receptor 1083 L203 Angiopoietin-1 receptor 1084 L204 Angiopoietin-1 receptor 1085 L205 Annexin A2 QNK L206 Annexin A2 1086 L207 Annexin A2 1087 L208 Anthranilate phosphoribosyltransferase 1088 L209 AP-2 complex subunit beta-2 1089 L210 Archaeosine tRNA-guanine transglycosylase LGI L211 Archaeosine tRNA-guanine transglycosylase 1090 L212 Archaeosine tRNA-guanine transglycosylase 1091 L213 Archaeosine tRNA-guanine transglycosylase 1092 L214 Archaeosine tRNA-guanine transglycosylase 1093 L215 Archaeosine tRNA-guanine transglycosylase 1094 L216 Archaeosine tRNA-guanine transglycosylase 1095 L217 Archaeosine tRNA-guanine transglycosylase 1096 L218 Archeal exosome RNA binding protein rrp4 1097 L219 Archeal exosome RNA binding protein rrp4 1098 L220 Archeal exosome RNA binding protein rrp4 1099 L221 Arginyl-tRNA synthetase IDY L222 Arginyl-tRNA synthetase 1100 L223 Arginyl-tRNA synthetase 1101 L224 Arginyl-tRNA synthetase 1102 L225 Arrestin 1103 L226 Arrestin 1104 L227 Arsenite oxidase 1105 L228 Artificial linker PGS L229 Artificial linker ATK L230 Artificial linker ASK L231 Artificial linker 1106 L232 Artificial linker 1107 L233 Artificial linker 1108 L234 Artificial linker 1109 L235 Artificial linker 1110 L236 Artificial linker 1111 L237 ATP phosphoribosyltransferase ANR L238 ATP-dependent DNA helicase YDP L239 ATP-dependent DNA helicase 1112 L240 ATP-dependent DNA helicase 1113 L241 ATP-dependent DNA helicase 1114 L242 ATP-dependent DNA helicase 1115 L243 ATP-dependent DNA helicase 1116 L244 ATP-dependent DNA helicase 1117 L245 ATP-dependent DNA helicase 1118 L246 ATP-dependent DNA helicase 1119 L247 AT-rich DNA-binding protein 1120 L248 AT-rich DNA-binding protein 1121 L249 Axonin-1 DEG L250 Axonin-1 ECF L251 Axonin-1 1122 L252 Axonin-1 1123 L253 Axonin-1 1124 L254 Axonin-1 1125 L255 Axonin-1 1126 L256 Axonin-1 1127 L257 Axonin-1 1128 L258 Bacilysin biosynthesis protein BacB 1129 L259 Bacilysin biosynthesis protein BacB 1130 L260 Bacilysin biosynthesis protein BacB 1131 L261 Bacilysin biosynthesis protein BacB 1132 L262 Bacilysin biosynthesis protein BacB 1133 L263 Bacteriophage Mu transposase 1134 L264 Bacteriophage Mu transposase 1135 L265 Benzoyl-CoA-dihydrodiol lyase 1136 L266 Benzoyl-CoA-dihydrodiol lyase 1137 L267 Benzoyl-CoA-dihydrodiol lyase 1138 L268 Benzoyl-CoA-dihydrodiol lyase 1139 L269 Benzoyl-CoA-dihydrodiol lyase 1140 L270 Benzoylformate decarboxylase 1141 L271 Benzoylformate decarboxylase 1142 L272 Benzoylformate decarboxylase 1143 L273 Beta-amylase 1144 L274 Beta-galactosidase AIS L275 Beta-galactosidase 1145 L276 Beta-galactosidase 1146 L277 Beta-galactosidase 1147 L278 Beta-galactosidase 1148 L279 Beta-galactosidase 1149 L280 Beta-galactosidase 1150 L281 Beta-galactosidase 1151 L282 Beta-galactosidase 1152 L283 Beta-galactosidase 1153 L284 Beta-galactosidase 1154 L285 Beta-galactosidase 1155 L286 Beta-galactosidase 1156 L287 Beta-galactosidase 1157 L288 Beta-galactosidase 1158 L289 Beta-galactosidase 1159 L290 Beta-galactosidase 1160 L291 Beta-galactosidase 1161 L292 Beta-galactosidase 1162 L293 Beta-galactosidase 1163 L294 Beta-galactosidase 1164 L295 Beta-galactosidase 1165 L296 Beta-galactosidase 1166 L297 Beta-N-acetylhexosaminidase QRE L298 Beta-N-acetylhexosaminidase 1167 L299 Beta-N-acetylhexosaminidase 1168 L300 Beta-N-acetylhexosaminidase 1169 L301 Bifunctional NMN adenylyltransferase/Nudix hydrolase 1170 L302 Bifunctional purine biosynthesis protein PURH 1171 L303 Biliverdin reductase A EHV L304 Biliverdin reductase A LME L305 Biliverdin reductase A 1172 L306 Biliverdin reductase A 1173 L307 Biodegradative arginine decarboxylase TVQ L308 Biodegradative arginine decarboxylase 1174 L309 Biodegradative arginine decarboxylase 1175 L310 Biodegradative arginine decarboxylase 1176 L311 Biodegradative arginine decarboxylase 1177 L312 Biodegradative arginine decarboxylase 1178 L313 Biodegradative arginine decarboxylase 1179 L314 Biodegradative arginine decarboxylase 1180 L315 Biodegradative arginine decarboxylase 1181 L316 Biodegradative arginine decarboxylase 1182 L317 Biodegradative arginine decarboxylase 1183 L318 Biodegradative arginine decarboxylase 1184 L319 Biodegradative arginine decarboxylase 1185 L320 Biotin carboxylase 1186 L321 Bowman-Birk trypsin inhibitor 1187 L322 Bpt4 gene 59 helicase assembly protein KQI L323 BRCA1-associated RING domain protein 1 1188 L324 BRCA1-associated RING domain protein 1 1189 L325 BRCA1-associated RING domain protein 1 1190 L326 Breast cancer 2 1191 L327 Breast cancer 2 1192 L328 Breast cancer 2 1193 L329 Breast cancer 2 1194 L330 Breast cancer 2 1195 L331 Breast cancer 2 1196 L332 Butyrate response factor 2 1197 L333 C4b-binding protein YKR L334 C4b-binding protein 1198 L335 C5a peptidase 1199 L336 C5a peptidase 1200 L337 C5a peptidase 1201 L338 C5a peptidase 1202 L339 C5a peptidase 1203 L340 C5a peptidase 1204 L341 C5a peptidase 1205 L342 C5a peptidase 1206 L343 C5a peptidase 1207 L344 C5a peptidase 1208 L345 C5a peptidase 1209 L346 C5a peptidase 1210 L347 C5a peptidase 1211 L348 Calcium-binding protein 1212 L349 CarA 1213 L350 CarA 1214 L351 Carbamoyl phosphate synthetase (small chain) 1215 L352 Carbamoyl phosphate synthetase (small chain) 1216 L353 Carbamoyl phosphate synthetase (small chain) 1217 L354 Carbamoyl phosphate synthetase (small chain) 1218 L355 Carbamoyl phosphate synthetase (small chain) 1219 L356 Carbon monoxide dehydrogenase/acetyl-CoA synthase subunitalpha 1220 L357 Carboxypeptidase Gp180 residues 503-882 HRG L358 Catabolite activation-like protein 1221 L359 Catabolite activation-like protein 1222 L360 Catechol 2,3-dioxygenase 1223 L361 Cation-independent mannose 6-phosphate receptor 1224 L362 CD3 epsilon and gamma ectodomain fragment complex 1225 L363 CD3 epsilon and gamma ectodomain fragment complex 1226 L364 Cell filamentation protein SNP L365 Cell filamentation protein 1227 L366 Cell filamentation protein 1228 L367 Cellular coagulation factor XIII zymogen DIT L368 Cellular coagulation factor XIII zymogen NSD L369 Cellular coagulation factor XIII zymogen TDT L370 Cellular coagulation factor XIII zymogen 1229 L371 Cellular coagulation factor XIII zymogen 1230 L372 Cellular coagulation factor XIII zymogen 1231 L373 Cellular coagulation factor XIII zymogen 1232 L374 Cellular coagulation factor XIII zymogen 1233 L375 Cellular coagulation factor XIII zymogen 1234 L376 Cellular coagulation factor XIII zymogen 1235 L377 Cellular coagulation factor XIII zymogen 1236 L378 Cellular coagulation factor XIII zymogen 1237 L379 Cellular coagulation factor XIII zymogen 1238 L380 Cellular coagulation factor XIII zymogen 1239 L381 Cellular coagulation factor XIII zymogen 1240 L382 Cellular coagulation factor XIII zymogen 1241 L383 Cellular coagulation factor XIII zymogen 1242 L384 Cellular coagulation factor XIII zymogen 1243 L385 Cellular coagulation factor XIII zymogen 1244 L386 Cellular coagulation factor XIII zymogen 1245 L387 Cellular coagulation factor XIII zymogen 1246 L388 Cellular coagulation factor XIII zymogen 1247 L389 Cellulase 1248 L390 Cellulase 1249 L391 Cellulase 1250 L392 Cellulase 1251 L393 Cellulase 1252 L394 Cellulase 1253 L395 Cellulase 1254 L396 Cellulase 1255 L397 Cellulase 1256 L398 Cellulase linker 1257 L399 Cellulase linker 1258 L400 Cellulase linker 1259 L401 Cellulase linker 1260 L402 Chaperone protein FimC KLR L403 Chaperone protein FimC QAA L404 Chaperone protein FimC 1261 L405 Chaperone protein FimC 1262 L406 Chaperone protein HscB RHP L407 Chaperone protein HscB 1263 L408 CheB methylesterase 1264 L409 CheB methylesterase 1265 L410 CheB methylesterase 1266 L411 Chelatase, putative 1267 L412 Chemotaxis receptor methyltransferase cheR 1268 L413 Chemotaxis receptor methyltransferase cheR 1269 L414 Chemotaxis receptor methyltransferase cheR 1270 L415 Cholesterol oxidase 1271 L416 Cholesterol oxidase 1272 L417 Cholesterol oxidase 1273 L418 Cholesterol oxidase 1274 L419 Cholesterol oxidase 1275 L420 Cholesterol oxidase 1276 L421 Cholesterol oxidase 1277 L422 Cholesterol oxidase 1278 L423 Cholesterol oxidase 1279 L424 Cholesterol oxidase 1280 L425 Cholesterol oxidase 1281 L426 Cholesterol oxidase 1282 L427 Chromatin structure-remodeling complex protein RSC4 KNL L428 Chromatin structure-remodeling complex protein RSC4 1283 L429 Chromatin structure-remodeling complex protein RSC4 1284 L430 Chromatin structure-remodeling complex protein RSC4 1285 L431 Chromodomain-helicase-DNA-binding protein 1 1286 L432 Chromodomain-helicase-DNA-binding protein 1 1287 L433 Cleavable disulfide 1288 L434 Cleavable disulfide 1289 L435 Cleavable disulfide 1290 L436 Cleavable disulfide 1291 L437 Cleavable disulfide 1292 L438 Cleavable disulfide 1293 L439 Cleavable disulfide 1294 L440 Cleavable disulfide 1295 L441 Cleavable disulfide 1296 L442 Cleavable disulfide 1297 L443 Cleavable disulfide 1298 L444 Colicin Ia 1299 L445 Collagen adhesin 1300 L446 Complement C3 beta chain 1301 L447 Complement C3 beta chain 1302 L448 Complement C3 beta chain 1303 L449 Complement C3 beta chain 1304 L450 Complement decay-accelerating factor EIY L451 Complement factor H KRP L452 Complement receptor type 2 1305 L453 Conserved hypothetical protein 1306 L454 Conserved hypothetical protein MTH1747 DIR L455 Conserved hypothetical protein MTH1747 1307 L456 Conserved hypothetical protein MTH1747 1308 L457 Conserved hypothetical protein MTH1747 1309 L458 Conserved hypothetical protein MTH1747 1310 L459 Conserved hypothetical protein MTH1747 1311 L460 Conserved hypothetical protein MTH1747 1312 L461 Conserved hypothetical protein MTH1747 1313 L462 Conserved protein (MTH177) 1314 L463 Creatine amidinohydrolase 1315 L464 Cruciferin 1316 L465 Cruciferin 1317 L466 Cruciferin 1318 L467 Cruciferin 1319 L468 Cruciferin 1320 L469 Cruciferin 1321 L470 Cruciferin 1322 L471 CSL3 1323 L472 CSL3 1324 L473 CTP synthase 1325 L474 CTP synthase 1326 L475 Cullin homolog HKN L476 Cullin homolog 1327 L477 Cullin homolog 1328 L478 Cullin homolog 1329 L479 Cullin homolog 1330 L480 Cullin homolog 1331 L481 Cyclin A2 1332 L482 Cysteine-rich secretory protein 1333 L483 Cytidine deaminase 1334 L484 Cytidine deaminase 1335 L485 Cytidine deaminase 1336 L486 Cytochrome b-c1 complex subunit Rieske, mitochondrial 1337 L487 Cytochrome c oxidase subunit 2 QAV L488 Cytochrome c oxidase subunit 2 1338 L489 Cytochrome c oxidase subunit 2 1339 L490 Cytochrome c oxidase subunit 2 1340 L491 Cytochrome c oxidase subunit 2 1341 L492 Cytochrome c4 GGK L493 Cytochrome c4 QGM L494 D-aminopeptidase 1342 L495 DDMC 1343 L496 DDMC 1344 L497 Deltex protein 1345 L498 Deoxyuridine 5-triphosphate nucleotidohydrolase 1346 L499 Diaminopimelate epimerase 1347 L500 Diaminopimelate epimerase 1348 L501 Diaminopimelate epimerase 1349 L502 Di-heme peroxidase SGC L503 Di-heme peroxidase 1350 L504 Dihydropyrimidine dehydrogenase 1351 L505 Dihydropyrimidine dehydrogenase 1352 L506 Dihydropyrimidine dehydrogenase 1353 L507 Dihydropyrimidine dehydrogenase 1354 L508 Dihydropyrimidine dehydrogenase 1355 L509 Dihydropyrimidine dehydrogenase 1356 L510 Dihydropyrimidine dehydrogenase 1357 L511 Dihydropyrimidine dehydrogenase 1358 L512 Dihydropyrimidine dehydrogenase 1359 L513 Dihydropyrimidine dehydrogenase 1360 L514 Dihydropyrimidine dehydrogenase 1361 L515 Dihydropyrimidine dehydrogenase 1362 L516 Dihydropyrimidine dehydrogenase 1363 L517 Dihydropyrimidine dehydrogenase 1364 L518 Dihydropyrimidine dehydrogenase 1365 L519 Dihydropyrimidine dehydrogenase 1366 L520 Dihydropyrimidine dehydrogenase 1367 L521 Dihydropyrimidine dehydrogenase 1368 L522 Dihydropyrimidine dehydrogenase 1369 L523 Dihydropyrimidine dehydrogenase 1370 L524 Dihydropyrimidine dehydrogenase 1371 L525 Dihydropyrimidine dehydrogenase 1372 L526 Dihydropyrimidine dehydrogenase 1373 L527 Dihydropyrimidine dehydrogenase 1374 L528 Dihydropyrimidine dehydrogenase 1375 L529 Dihydropyrimidine dehydrogenase 1376 L530 Dihydropyrimidine dehydrogenase 1377 L531 Dihydropyrimidine dehydrogenase 1378 L532 Dihydropyrimidine dehydrogenase 1379 L533 Dihydropyrimidine dehydrogenase 1380 L534 Dihydropyrimidine dehydrogenase 1381 L535 Discoidin-1 subunit A 1382 L536 Discoidin-1 subunit A 1383 L537 Discoidin-1 subunit A 1384 L538 Dissimilatory copper-containing nitritereductase 1385 L539 D-lactate dehydrogenase DTF L540 D-lactate dehydrogenase 1386 L541 D-lactate dehydrogenase 1387 L542 D-lactate dehydrogenase 1388 L543 D-lactate dehydrogenase 1389 L544 D-lactate dehydrogenase 1390 L545 D-lactate dehydrogenase 1391 L546 DNA damage-binding protein 1 LCA L547 DNA damage-binding protein 1 1392 L548 DNA damage-binding protein 1 1393 L549 DNA damage-binding protein 1 1394 L550 DNA damage-binding protein 1 1395 L551 DNA damage-binding protein 1 1396 L552 DNA damage-binding protein 1 1397 L553 DNA damage-binding protein 1 1398 L554 DNA damage-binding protein 1 1399 L555 DNA damage-binding protein 1 1400 L556 DNA damage-binding protein 1 1401 L557 DNA damage-binding protein 1 1402 L558 DNA damage-binding protein 1 1403 L559 DNA damage-binding protein 1 1404 L560 DNA damage-binding protein 1 1405 L561 DNA damage-binding protein 1 1406 L562 DNA damage-binding protein 1 1407 L563 DNA damage-binding protein 1 1408 L564 DNA damage-binding protein 1 1409 L565 DNA damage-binding protein 1 1410 L566 DNA damage-binding protein 1 1411 L567 DNA damage-binding protein 1 1412 L568 DNA damage-binding protein 1 1413 L569 DNA gyrase B ALS L570 DNA gyrase B 1414 L571 DNA gyrase B 1415 L572 DNA gyrase B 1416 L573 DNA gyrase B 1417 L574 DNA gyrase B 1418 L575 DNA gyrase B 1419 L576 DNA gyrase B 1420 L577 DNA gyrase B 1421 L578 DNA gyrase B 1422 L579 DNA gyrase B 1423 L580 DNA gyrase B 1424 L581 DNA ligase 1425 L582 DNA ligase 1426 L583 DNA ligase 1427 L584 DNA ligase 1428 L585 DNA ligase 1429 L586 DNA mismatch repair protein MutS MDA L587 DNA mismatch repair protein MutS SII L588 DNA mismatch repair protein MutS 1430 L589 DNA mismatch repair protein MutS 1431 L590 DNA mismatch repair protein MutS 1432 L591 DNA mismatch repair protein MutS 1433 L592 DNA mismatch repair protein MutS 1434 L593 DNA polymerase FSP L594 DNA polymerase RQF L595 DNA polymerase 1435 L596 DNA polymerase 1436 L597 DNA polymerase 1437 L598 DNA polymerase 1438 L599 DNA polymerase 1439 L600 DNA polymerase 1440 L601 DNA polymerase 1441 L602 DNA polymerase 1442 L603 DNA polymerase alpha subunit B 1443 L604 DNA polymerase alpha subunit B 1444 L605 DNA polymerase alpha subunit B 1445 L606 DNA polymerase alpha subunit B 1446 L607 DNA polymerase alpha subunit B 1447 L608 DNA polymerase alpha subunit B 1448 L609 DNA polymerase alpha subunit B 1449 L610 DNA polymerase alpha subunit B 1450 L611 DNA polymerase alpha subunit B 1451 L612 DNA polymerase alpha subunit B 1452 L613 DNA polymerase eta ALS L614 DNA polymerase eta 1453 L615 DNA polymerase eta 1454 L616 DNA polymerase eta 1455 L617 DNA polymerase eta 1456 L618 DNA polymerase eta 1457 L619 DNA polymerase I AGV L620 DNA polymerase I ELE L621 DNA polymerase I 1458 L622 DNA primase DHK L623 DNA primase 1459 L624 DNA primase 1460 L625 DNA primase 1461 L626 DNA primase 1462 L627 DNA primase 1463 L628 DNA primase 1464 L629 DNA primase 1465 L630 DNA primase/helicase AGY L631 DNA primase/helicase 1466 L632 DNA primase/helicase 1467 L633 DNA primase/helicase 1468 L634 DNA primase/helicase 1469 L635 DNA primase/helicase 1470 L636 DNA primase/helicase 1471 L637 DNA primase/helicase 1472 L638 DNA primase/helicase 1473 L639 DNA primase/helicase 1474 L640 DNA primase/helicase 1475 L641 DNA topoisomerase 2 EES L642 DNA topoisomerase 2 IPI L643 DNA topoisomerase 2 KEL L644 DNA topoisomerase 2 1476 L645 DNA topoisomerase 2 1477 L646 DNA topoisomerase 2 1478 L647 DNA topoisomerase 2 1479 L648 DNA topoisomerase 2 1480 L649 DNA topoisomerase 2 1481 L650 DNA topoisomerase 2 1482 L651 DNA topoisomerase 2 1483 L652 DNA topoisomerase 2 1484 L653 DNA topoisomerase I 1485 L654 DNA topoisomerase I 1486 L655 DNA topoisomerase I 1487 L656 DNA topoisomerase II, alpha isozyme PDL L657 DNA topoisomerase II, alpha isozyme 1488 L658 DNA topoisomerase II, alpha isozyme 1489 L659 DNA topoisomerase II, alpha isozyme 1490 L660 DNA topoisomerase II, alpha isozyme 1491 L661 DNA topoisomerase II, alpha isozyme 1492 L662 DNA topoisomerase II, alpha isozyme 1493 L663 DNA topoisomerase II, alpha isozyme 1494 L664 DNA topoisomerase II, alpha isozyme 1495 L665 DNA topoisomerase VI A subunit 1496 L666 DNA topoisomerase VI A subunit 1497 L667 DNA topoisomerase VI A subunit 1498 L668 DNA topoisomerase VI A subunit 1499 L669 DNA topoisomerase VI A subunit 1500 L670 DNA topoisomerase VI A subunit 1501 L671 DNA-3-methyladenine glycosylase 2 1502 L672 DNA-binding response regulator MtrA 1503 L673 DNA-directed RNA polymerase beta chain 1504 L674 DNA-directed RNA polymerase beta chain 1505 L675 DNA-directed RNA polymerase beta chain 1506 L676 DNA-directed RNA polymerase beta chain 1507 L677 DNA-directed RNA polymerase beta chain 1508 L678 DNA-directed RNA polymerase beta chain 1509 L679 DNA-directed RNA polymerase beta chain 1510 L680 DNA-directed RNA polymerase beta chain 1511 L681 DNA-directed RNA polymerase II 14.2 kDa polypeptide 1512 L682 DNA-directed RNA polymerase II 14.2 kDa polypeptide 1513 L683 DNA-directed RNA polymerase, subunit E (rpoe1) 1514 L684 DNA-directed RNA polymerase, subunit E (rpoe1) 1515 L685 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide ITP L686 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide 1516 L687 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide 1517 L688 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide 1518 L689 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide 1519 L690 Drosophila neuroglian 1520 L691 Dystroglycan 1521 L692 Dystrophin 1522 L693 Dystrophin 1523 L694 Dystrophin 1524 L695 Dystrophin 1525 L696 Dystrophin 1526 L697 Dystrophin 1527 L698 Dystrophin 1528 L699 E2A DNA-binding protein 1529 L700 E2A DNA-binding protein 1530 L701 E3 sumo-protein ligase SIZ1 1531 L702 E3 sumo-protein ligase SIZ1 1532 L703 E3 sumo-protein ligase SIZ1 1533 L704 Early switch protein xol-1 2.2k splice form 1534 L705 EGF-like module containing mucin-like hormonereceptor-like 2 precursor 1535 L706 EGF-like module containing mucin-like hormonereceptor-like 2 precursor 1536 L707 Elongation factor 1-gamma 1 1537 L708 Elongation factor 1-gamma 1 1538 L709 Elongation factor g 1539 L710 Elongation factor G 1540 L711 Elongation factor G 1541 L712 Elongation factor G 1542 L713 Elongation factor G 1543 L714 Elongation factor G 1544 L715 Elongation factor G 1545 L716 Elongation factor G 1546 L717 Elongation factor G 1547 L718 Elongation factor G 1548 L719 Elongation factor P 1549 L720 Elongation factor Ts 1550 L721 Elongation factor Ts 1551 L722 Elongation factor Ts 1552 L723 Elongation factor Tu (ef-Tu) 1553 L724 Endoglucanase 1554 L725 Endonuclease PI-SceI 1555 L726 Endonuclease PI-SceI 1556 L727 Endonuclease PI-SceI 1557 L728 Endonuclease PI-SceI 1558 L729 Endonuclease PI-SceI 1559 L730 Endonuclease PI-SceI 1560 L731 Endonuclease PI-SceI 1561 L732 Endonuclease PI-SceI 1562 L733 Endonuclease PI-SceI 1563 L734 Enterobactin synthetase component F 1564 L735 Enterobactin synthetase component F 1565 L736 Enterobactin synthetase component F 1566 L737 Enterobactin synthetase component F 1567 L738 Enterobactin synthetase component F 1568 L739 Enterobactin synthetase component F 1569 L740 Enterobactin synthetase component F 1570 L741 Enterobactin synthetase component F 1571 L742 Enterobactin synthetase component F 1572 L743 Enterochelin esterase 1573 L744 Epo receptor EVV L745 Epo receptor 1574 L746 Erythrocyte binding antigen region II 1575 L747 Erythrocyte binding antigen region II 1576 L748 Erythrocyte binding antigen region II 1577 L749 Erythrocyte binding antigen region II 1578 L750 Erythrocyte binding antigen region II 1579 L751 E-selectin 1580 L752 Esterase EstA SAP L753 Esterase EstA 1581 L754 Esterase EstA 1582 L755 Eukaryotic peptide chain release factor GTP-binding subunit 1583 L756 Exonuclease I RQP L757 Exonuclease I 1584 L758 FascIclIn I SDP L759 FascIclIn I 1585 L760 Fibrillin-1 1586 L761 Fibrillin-1 1587 L762 Fibrillin-1 1588 L763 Fibrillin-1 1589 L764 Fibrillin-1 1590 L765 Fibronectin 1591 L766 Fibronectin 1592 L767 Fibronectin 1593 L768 Flagellar hook protein FlgE 1594 L769 Flagellar hook protein FlgE 1595 L770 Flagellar hook protein FlgE 1596 L771 Flagellar hook protein FlgE 1597 L772 Flagellar hook protein FlgE 1598 L773 Flagellar hook protein FlgE 1599 L774 Flagellar hook protein FlgE 1600 L775 Flavohemoprotein 1601 L776 Flexible G/S rich linker G L777 Flexible G/S rich linker S L778 Flexible G/S rich linker GG L779 Flexible G/S rich linker GS L780 Flexible G/S rich linker GGS L781 Flexible G/S rich linker GGG L782 Flexible G/S rich linker 1602 L783 Flexible G/S rich linker 1603 L784 Flexible G/S rich linker 1604 L785 Flexible G/S rich linker 1605 L786 Flexible G/S rich linker 1606 L787 Flexible G/S rich linker 1607 L788 Flexible G/S rich linker 1608 L789 Flexible G/S rich linker 1609 L790 Flexible G/S rich linker 1610 L791 Flexible G/S rich linker 1611 L792 Flexible G/S rich linker 1612 L793 Flexible G/S rich linker 1613 L794 Flexible G/S rich linker 1614 L795 Flexible G/S rich linker 1615 L796 Focal adhesion kinase 1 1616 L797 FolC bifunctional protein 1617 L798 FolC bifunctional protein 1618 L799 FolC bifunctional protein 1619 L800 FolC bifunctional protein 1620 L801 FolC bifunctional protein 1621 L802 FolC bifunctional protein 1622 L803 FolC bifunctional protein 1623 L804 FolC bifunctional protein 1624 L805 Follistatin 1625 L806 Formate dehydrogenase (large subunit) YDK L807 Formate dehydrogenase (large subunit) 1626 L808 Formate dehydrogenase (large subunit) 1627 L809 Formate dehydrogenase (large subunit) 1628 L810 Formate dehydrogenase (large subunit) 1629 L811 Formate dehydrogenase (large subunit) 1630 L812 Formate dehydrogenase (large subunit) 1631 L813 Formate dehydrogenase (large subunit) 1632 L814 Formate dehydrogenase (large subunit) 1633 L815 Formate dehydrogenase (large subunit) 1634 L816 Formate dehydrogenase (large subunit) 1635 L817 Formate dehydrogenase (large subunit) 1636 L818 Formate dehydrogenase (large subunit) 1637 L819 Formate dehydrogenase, nitrate-inducible major subunit 1638 L820 Formate dehydrogenase, nitrate-inducible, major subunit 1639 L821 Formate dehydrogenase, nitrate-inducible, major subunit 1640 L822 Formate dehydrogenase, nitrate-inducible, major subunit 1641 L823 Formate dehydrogenase, nitrate-inducible, major subunit 1642 L824 Formate dehydrogenase, nitrate-inducible, major subunit 1643 L825 Formate dehydrogenase, nitrate-inducible, major subunit 1644 L826 Formate dehydrogenase, nitrate-inducible, major subunit 1645 L827 Formate dehydrogenase, nitrate-inducible, major subunit 1646 L828 Formate dehydrogenase, nitrate-inducible, major subunit 1647 L829 Formate dehydrogenase, nitrate-inducible, major subunit 1648 L830 Formate dehydrogenase, nitrate-inducible, major subunit 1649 L831 Formate dehydrogenase, nitrate-inducible, major subunit 1650 L832 Formate dehydrogenase, nitrate-inducible, major subunit 1651 L833 Fumarylacetoacetate hydrolase 1652 L834 Galactose oxidase GSV L835 Galactose oxidase GWK L836 Galactose oxidase IAE L837 Galactose oxidase KRQ L838 Galactose oxidase QDT L839 Galactose oxidase TPN L840 Galactose oxidase 1653 L841 Galactose oxidase 1654 L842 Galactose oxidase 1655 L843 Galactose oxidase 1656 L844 Galactose oxidase 1657 L845 Galactose oxidase 1658 L846 Galactose oxidase 1659 L847 Galactose oxidase 1660 L848 Galactose oxidase 1661 L849 Galactose oxidase 1662 L850 Galactose oxidase 1663 L851 Galactose oxidase 1664 L852 Galactose oxidase 1665 L853 Galactose oxidase 1666 L854 Galactose oxidase 1667 L855 Galactose oxidase 1668 L856 Galactose oxidase 1669 L857 Galactose oxidase 1670 L858 Galactose oxidase 1671 L859 Galactose oxidase 1672 L860 Galactose oxidase 1673 L861 Galactose oxidase 1674 L862 Galactose oxidase 1675 L863 Galactose oxidase 1676 L864 Gamma B-crystallin 1677 L865 Gamma-delta T-cell receptor 1678 L866 Gelation factor DSS L867 Gelation factor 1679 L868 Gelation factor 1680 L869 Gelation factor 1681 L870 Gene activator alpha 1682 L871 Gingipain R 1683 L872 Glucodextranase 1684 L873 Glucodextranase 1685 L874 Glucodextranase 1686 L875 Glucosamine-fructose-6-phosphate aminotransferase YEQ L876 Glucosamine-fructose-6-phosphate aminotransferase 1687 L877 Glucosamine-fructose-6-phosphate aminotransferase 1688 L878 Glucosamine-fructose-6-phosphate aminotransferase 1689 L879 Glucosamine-fructose-6-phosphate aminotransferase 1690 L880 Glucosamine-fructose-6-phosphate aminotransferase 1691 L881 Glucosamine-fructose-6-phosphate aminotransferase 1692 L882 Glucosamine-fructose-6-phosphate aminotransferase 1693 L883 Glucosamine-fructose-6-phosphate aminotransferase 1694 L884 Glucosamine-fructose-6-phosphate aminotransferase 1695 L885 Glucosamine-fructose-6-phosphate aminotransferase 1696 L886 Glucose-1-phosphate adenylyltransferase small subunit 1697 L887 Glucose-1-phosphate adenylyltransferase small subunit 1698 L888 Glucose-6-phosphate isomerase KNA L889 Glucose-6-phosphate isomerase VGF L890 Glucose-6-phosphate isomerase 1699 L891 Glucose-6-phosphate isomerase 1700 L892 Glucose-6-phosphate isomerase, conjectural 1701 L893 Glutamate dehydrogenase 1702 L894 Glutamate dehydrogenase 1703 L895 Glutamate receptor interacting protein 1704 L896 Glutamate synthase [NADPH] large chain 1705 L897 Glutamate synthase [NADPH] large chain 1706 L898 Glutamate synthase [NADPH] large chain 1707 L899 Glutamate synthase [NADPH] large chain 1708 L900 Glutamate synthase [NADPH] large chain 1709 L901 Glutamate synthase [NADPH] large chain 1710 L902 Glutamate synthase [NADPH] large chain 1711 L903 Glutamine synthetase 1712 L904 Glutamine synthetase 1713 L905 Glutamyl-tRNA synthetase 1714 L906 Glutamyl-tRNA synthetase 1715 L907 Glutamyl-tRNA synthetase 1716 L908 Glutamyl-tRNA synthetase 1717 L909 Glutamyl-tRNA synthetase 1718 L910 Glutamyl-tRNA synthetase 1719 L911 Glutamyl-tRNA synthetase 1720 L912 Glutamyl-tRNA synthetase 1721 L913 Glutaredoxin 2 1722 L914 Glutathione S-transferase 1723 L915 Glutathione S-transferase 1724 L916 Glutathione S-transferase 1725 L917 Glutathione S-transferase 1-6 1726 L918 Glutathione S-transferase A1 1727 L919 Glutathione S-transferase I NKP L920 Glutathione S-transferase I 1728 L921 Glutathione synthetase 1729 L922 Glutathione transferase GST1-4 1730 L923 Glutathione transferase GST1-4 1731 L924 Glutathione transferase sigma class 1732 L925 Glycerol-3-phosphate dehydrogenase [NAD(P)+] 1733 L926 Glycine cleavage system transcriptionalrepressor, putative 1734 L927 Glycolipid-anchored surface protein 2 1735 L928 Glycolipid-anchored surface protein 2 1736 L929 Glycyl-tRNA synthetase KFA L930 Glycyl-tRNA synthetase 1737 L931 Glycyl-tRNA synthetase 1738 L932 Glycyl-tRNA synthetase 1739 L933 Glycyl-tRNA synthetase 1740 L934 Glycyl-tRNA synthetase 1741 L935 Glycyl-tRNA synthetase 1742 L936 Glycyl-tRNA synthetase 1743 L937 Glycyl-tRNA synthetase 1744 L938 Glycyl-tRNA synthetase 1745 L939 Growth hormone receptor 1746 L940 Growth hormone receptor 1747 L941 Harmonin 1748 L942 HasR protein 1749 L943 HasR protein 1750 L944 Hemin transport protein HemS 1751 L945 Hemin transport protein HemS 1752 L946 Hemin transport protein HemS 1753 L947 Hemoglobin 1754 L948 Hemolytic lectin CEL-iii 1755 L949 Hepatocyte nuclear factor 6 1756 L950 Histidyl-tRNA synthetase 1757 L951 HNH homing endonuclease 1758 L952 HNH homing endonuclease 1759 L953 HNH homing endonuclease 1760 L954 Homoserine dehydrogenase 1761 L955 Homoserine kinase 1762 L956 Homosetine kinase 1763 L957 Homoserine kinase 1764 L958 Homoserine kinase 1765 L959 HTH-type transcriptional regulator MqsA (Ygit/B3021) 1766 L960 HTH-type transcriptional repressor YvoA 1767 L961 HTH-type transcriptional repressor YvoA 1768 L962 Human IgG1 middle hinge linker 1769 L963 Human IgG1 upper hinge linker 1770 L964 Human IgG3 middle hinge linker 1771 L965 Human IgG3m15 middle hinge linker 1772 L966 Human IgG4 lower hinge linker 1773 L967 Human IgG4 middle hinge linker 1774 L968 Human IgG4 upper hinge linker 1775 L969 Hybrid cluster protein 1776 L970 Hybrid cluster protein 1777 L971 Hybrid cluster protein 1778 L972 Hybrid cluster protein 1779 L973 Hybrid cluster protein 1780 L974 Hypothetical conserved protein, GK1056 1781 L975 Hypothetical membrane spanning protein 1782 L976 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1783 L977 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1784 L978 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1785 L979 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1786 L980 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1787 L981 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1788 L982 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1789 L983 Hypothetical protein AEP L984 Hypothetical protein 1790 L985 Hypothetical protein APE0525 PTL L986 Hypothetical protein APE0525 1791 L987 Hypothetical protein LOC449832 1792 L988 Hypothetical protein LOC449832 1793 L989 Hypothetical protein PA4388 1794 L990 Hypothetical protein PA5201 ASE L991 Hypothetical protein PA5201 QDP L992 Hypothetical protein PA5201 VKL L993 Hypothetical protein PA5201 1795 L994 Hypothetical protein PA5201 1796 L995 Hypothetical protein PA5201 1797 L996 Hypothetical protein PA5201 1798 L997 Hypothetical protein PA5201 1799 L998 Hypothetical protein PA5201 1800 L999 Hypothetical protein PA5201 1801 L1000 Hypothetical protein PA5201 1802 L1001 Hypothetical protein PA5201 1803 L1002 Hypothetical protein PA5201 1804 L1003 Hypothetical protein PA5201 1805 L1004 Hypothetical protein PA5201 1806 L1005 Hypothetical protein PA5201 1807 L1006 Hypothetical protein PA5201 1808 L1007 Hypothetical protein PA5201 1809 L1008 Hypothetical protein PA5201 1810 L1009 Hypothetical protein PA5201 1811 L1010 Hypothetical protein PA5201 1812 L1011 Hypothetical protein PA5201 1813 L1012 Hypothetical protein PA5201 1814 L1013 Hypothetical protein PH0495 ASN L1014 Hypothetical protein PH0495 1815 L1015 Hypothetical protein PH0495 1816 L1016 Hypothetical protein PH0495 1817 L1017 Hypothetical protein PH0495 1818 L1018 Hypothetical protein PH0510 1819 L1019 Hypothetical protein PH0510 1820 L1020 Hypothetical protein PH1313 1821 L1021 Hypothetical protein PH1313 1822 L1022 Hypothetical protein SLR0953 1823 L1023 Hypothetical protein SLR0953 1824 L1024 Hypothetical protein SLR0953 1825 L1025 Hypothetical protein SLR0953 1826 L1026 Hypothetical protein SLR0953 1827 L1027 Hypothetical protein YIGZ 1828 L1028 Hypothetical protein YIGZ 1829 L1029 Hypothetical protein YJIA 1830 L1030 Hypothetical protein YJIA 1831 L1031 Hypothetical protein YJIA 1832 L1032 Hypothetical protein YJIA 1833 L1033 Hypothetical protein YJIA 1834 L1034 Hypothetical tRNA/rRNA methyltransferase YJFH 1835 L1035 Hypothetical tRNA/rRNA methyltransferase YJFH 1836 L1036 IclR transcriptional regulator 1837 L1037 IclR transcriptional regulator 1838 L1038 IclR transcriptional regulator 1839 L1039 IclR transcriptional regulator 1840 L1040 Integrase 1841 L1041 Interferon, alpha-inducible protein (clone IFI-15k) 1842 L1042 Interleukin-1 receptor, type I AIF L1043 Interleukin-1 receptor, type I 1843 L1044 Interleukin-1 receptor, type I 1844 L1045 Interleukin-1 receptor, type I 1845 L1046 Interleukin-12 subunit p40 FFI L1047 Interleukin-12 subunit p40 1846 L1048 Interleukin-12 subunit p40 1847 L1049 Interleukin-12 subunit p40 1848 L1050 Interleukin-12 subunit p40 1849 L1051 Interleukin-12 subunit p40 1850 L1052 lnterleukin-12 subunit p40 1851 L1053 Interleukin-12 subunit p40 1852 L1054 Interleukin-2 receptor alpha chain 1853 L1055 Interleukin-2 receptor alpha chain 1854 L1056 Internalin B VTQ L1057 Internalin B 1855 L1058 Internalin B 1856 L1059 Internalin B 1857 L1060 Internalin B 1858 L1061 Internalin B 1859 L1062 Internalin B 1860 L1063 Internalin B 1861 L1064 Internalin B 1862 L1065 Internalin B 1863 L1066 Internalin B 1864 L1067 Internalin B 1865 L1068 Internalin B 1866 L1069 Intimin SLV L1070 Intimin 1867 L1071 Intimin 1868 L1072 Intimin 1869 L1073 Intron-encoded DNA endonuclease I-anil 1870 L1074 Intron-encoded DNA endonuclease I-anil 1871 L1075 Invasin KST L1076 Invasin 1872 L1077 Invasin 1873 L1078 Invasin 1874 L1079 Invasin 1875 L1080 Invasin 1876 L1081 Invasin 1877 L1082 Invasin 1878 L1083 Invasin 1879 L1084 Invasin 1880 L1085 Invasin 1881 L1086 Invasin 1882 L1087 Invasin 1883 L1088 Iron hydrogenase 1 GAE L1089 Iron hydrogenase 1 1884 L1090 Iron hydrogenase 1 1885 L1091 Iron hydrogenase 1 1886 L1092 Iron hydrogenase 1 1887 L1093 Iron hydrogenase 1 1888 L1094 Iron hydrogenase 1 1889 L1095 Iron hydrogenase 1 1890 L1096 Iron hydrogenase 1 1891 L1097 Iron hydrogenase 1 1892 L1098 Iron hydrogenase 1 1893 L1099 Iron hydrogenase 1 1894 L1100 Iron hydrogenase 1 1895 L1101 Iron hydrogenase 1 1896 L1102 Iron transport protein 1897 L1103 Isoflavanone 4-O-methyltransferase 1898 L1104 Isoflavanone 4-O-methyltransferase 1899 L1105 Junctional adhesion molecule 1 1900 L1106 Junctional adhesion molecule 1 1901 L1107 Junctional adhesion molecule 1 1902 L1108 Kanamycin nucleotidyltransferase 1903 L1109 Kanamycin nucleotidyltransferase 1904 L1110 Kanamycin nucleotidyltransferase 1905 L1111 Kanamycin nucleotidyltransferase 1906 L1112 Kelch-like protein 11 1907 L1113 Kexin ISE L1114 Kexin 1908 L1115 Kexin 1909 L1116 Kexin 1910 L1117 Kexin 1911 L1118 Kexin 1912 L1119 Kexin 1913 L1120 Kexin 1914 L1121 Ku70 1915 L1122 Ku70 1916 L1123 Ku70 1917 L1124 Ku70 1918 L1125 Ku80 1919 L1126 Laccase-1 1920 L1127 Laccase-1 1921 L1128 Laccase-1 1922 L1129 Laccase-1 1923 L1130 Laminin DKC L1131 L-aspartate dehydrogenase SAS L1132 L-aspartate dehydrogenase 1924 L1133 L-aspartate dehydrogenase 1925 L1134 Leucine dehydrogenase 1926 L1135 Leucine dehydrogenase 1927 L1136 Light chain of HyHel10 antibody fragment (fab) 1928 L1137 Lin2111 protein 1929 L1138 Lin2111 protein 1930 L1139 Lipopolysaccharide-responsive and beige-like anchor protein 1931 L1140 Lipopolysaccharide-responsive and beige-like anchor protein 1932 L1141 Lipovitellin (LV-1N, LV-1C) 1933 L1142 Lipovitellin (LV-1N, LV-1C) 1934 L1143 Lipovitellin (LV-1N, LV-1C) 1935 L1144 Lipovitellin (LV-1N, LV-1C) 1936 L1145 Lipovitellin (LV-1N, LV-1C) 1937 L1146 Lipoxygenase-1 1938 L1147 Lipoxygenase-1 1939 L1148 Low affinity immunoglobulin gamma Fc region receptor II-A 1940 L1149 Luciferase 1941 L1150 LysR-type regulatory protein 1942 L1151 Macrolide-specific efflux protein MacA ATE L1152 Macrolide-specific efflux protein MacA 1943 L1153 Macrolide-specific efflux protein MacA 1944 L1154 Magnesium transporter, putative 1945 L1155 Main hemagglutinin component 1946 L1156 Major centromere autoantigen B 1947 L1157 Major surface antigen p30 1948 L1158 Major surface antigen p30 1949 L1159 Major vault protein 1950 L1160 Major vault protein 1951 L1161 Maltose phosphorylase 1952 L1162 Maltose phosphorylase 1953 L1163 Maltose phosphorylase 1954 L1164 Maltose phosphorylase 1955 L1165 Maltose phosphorylase 1956 L1166 Manganese-dependent inorganic pyrophosphatase 1957 L1167 Manganese-dependent inorganic pyrophosphatase 1958 L1168 Mannan-binding lectin 1959 L1169 Mannan-binding lectin 1960 L1170 Mannan-binding lectin 1961 L1171 Mannitol dehydrogenase HNA L1172 Mannitol dehydrogenase 1962 L1173 Membrane cofactor protein RET L1174 Membrane cofactor protein 1963 L1175 Membrane-associated prostaglandin E synthase-2 1964 L1176 Membrane-associated prostaglandin E synthase-2 1965 L1177 Membrane-associated prostaglandin E synthase-2 1966 L1178 Membrane-associated prostaglandin E synthase-2 1967 L1179 Membrane-associated prostaglandin E synthase-2 1968 L1180 Membrane-bound lytic murein transglycosylase A 1969 L1181 Methionyl-tRNA synthetase 1970 L1182 Methyl-accepting chemotaxis protein VRP L1183 Methyl-accepting chemotaxis protein 1971 L1184 Methyl-accepting chemotaxis protein 1972 L1185 Methyl-accepting chemotaxis protein 1973 L1186 Methyl-coenzyme M reductase 1974 L1187 Methyl-coenzyme M reductase 1975 L1188 Methyl-coenzyme M reductase 1976 L1189 Methyl-coenzyme M reductase 1977 L1190 Methylene tetrahydromethanopterin dehydrogenase 1978 L1191 Methylene tetrahydromethanopterin dehydrogenase 1979 L1192 Mg2+ transporter MgtE 1980 L1193 Mg2+ transporter MgtE 1981 L1194 Mg2+ transporter MgtE 1982 L1195 Mitochondrial aconitase 1983 L1196 Mitochondrial aconitase 1984 L1197 Modification methylase TaqI EGK L1198 Modification methylase TaqI PAT L1199 Modification methylase TaqI 1985 L1200 Modification methylase TaqI 1986 L1201 Modification methylase TaqI 1987 L1202 Modification methylase TaqI 1988 L1203 Modification methylase TaqI 1989 L1204 Modification methylase TaqI 1990 L1205 Modification methylase TaqI 1991 L1206 Modification methylase TaqI 1992 L1207 Multidrug-efflux transporter 1 regulator 1993 L1208 Muramoyl-pentapeptide carboxypeptidase 1994 L1209 MutL 1995 L1210 MutL 1996 L1211 MutL 1997 L1212 MutL 1998 L1213 MutL 1999 L1214 MutL 2000 L1215 MutL 2001 L1216 MutL 2002 L1217 MutL 2003 L1218 MutM (Fpg) protein 2004 L1219 MutM (Fpg) protein 2005 L1220 MutM (Fpg) protein 2006 L1221 MutM (Fpg) protein 2007 L1222 Myotubularin-related protein 2 THW L1223 Myotubularin-related protein 2 2008 L1224 Myotubularin-related protein 2 2009 L1225 Myotubularin-related protein 2 2010 L1226 Myotubularin-related protein 2 2011 L1227 Myotubularin-related protein 2 2012 L1228 N utilization substance protein A EIP L1229 N utilization substance protein A 2013 L1230 N utilization substance protein A 2014 L1231 N utilization substance protein A 2015 L1232 N-acetylglucosamine kinase CAY L1233 N-acetylglucosamine kinase ISP L1234 N-acetylglucosamine kinase 2016 L1235 N-acyl-D-glutamate deacylase 2017 L1236 N-acyl-D-glutamate deacylase 2018 L1237 N-acyl-D-glutamate deacylase 2019 L1238 N-acyl-D-glutamate deacylase 2020 L1239 N-acyl-D-glutamate deacylase 2021 L1240 N-acyl-D-glutamate deacylase 2022 L1241 N-acyl-D-glutamate deacylase 2023 L1242 NAD-dependent malic enzyme 2024 L1243 NAD-dependent malic enzyme 2025 L1244 NADH peroxidase ADT L1245 NADH peroxidase AVG L1246 NADH peroxidase TLI L1247 NADH peroxidase 2026 L1248 NADH peroxidase 2027 L1249 NADH peroxidase 2028 L1250 NADH peroxidase 2029 L1251 NADH peroxidase 2030 L1252 NADH peroxidase 2031 L1253 NADH pyrophosphatase 2032 L1254 Naphthalene 1,2-dioxygenase alpha subunit 2033 L1255 Naphthalene 1,2-dioxygenase alpha subunit 2034 L1256 NEDD8-activating enzyme E1 catalytic subunit 2035 L1257 NEDD8-activating enzyme E1 regulatory subunit 2036 L1258 NEDD8-activating enzyme E1 regulatory subunit 2037 L1259 NEDD8-activating enzyme E1 regulatory subunit 2038 L1260 Nei endonuclease VIII-Like 1 2039 L1261 Nei endonuclease VIII-Like 1 2040 L1262 Nei endonuclease VIII-Like 1 2041 L1263 Nei endonuclease VIII-Like 1 2042 L1264 Neural cell adhesion molecule 2 2043 L1265 Neural cell adhesion molecule 2 2044 L1266 Neural cell adhesion molecule 2 2045 L1267 Neural cell adhesion molecule 2 2046 L1268 Neural cell adhesion molecule 2 2047 L1269 Neuroplastin 2048 L1270 Neuroplastin 2049 L1271 Neuroplastin 2050 L1272 Neutrophil cytosol factor 1 2051 L1273 Nickel responsive regulator 2052 L1274 NifU-like protein 2, chloroplast 2053 L1275 Nitric oxide reductase ILM L1276 Nitric oxide reductase 2054 L1277 Nitric oxide reductase 2055 L1278 Nitric oxide reductase 2056 L1279 Nitric oxide reductase 2057 L1280 Nitric oxide reductase 2058 L1281 NK receptor 2059 L1282 Nuclear factor of activated t-cells, cytoplasmic2 2060 L1283 Nucleolin RBD12 2061 L1284 O-GlcNAcase NagJ 2062 L1285 Orange carotenoid protein EGV L1286 Orange carotenoid protein 2063 L1287 Orange carotenoid protein 2064 L1288 Orn/Lys/Arg decarboxylase family protein LEL L1289 Orn/Lys/Arg decarboxylase family protein 2065 L1290 Orn/Lys/Arg decarboxylase family protein 2066 L1291 Orn/Lys/Arg decarboxylase family protein 2067 L1292 Orn/Lys/Arg decarboxylase family protein 2068 L1293 Orn/Lys/Arg decarboxylase family protein 2069 L1294 Orn/Lys/Arg decarboxylase family protein 2070 L1295 Orn/Lys/Arg decarboxylase family protein 2071 L1296 Osteoclast-stimulating factor 1 2072 L1297 Oxygen-independent coproporphyrinogen III oxidase 2073 L1298 Oxygen-independent coproporphyrinogen III oxidase 2074 L1299 Oxygen-independent coproporphyrinogen III oxidase 2075 L1300 Oxygen-independent coproporphyrinogen III oxidase 2076 L1301 Oxygen-independent coproporphyrinogen III oxidase 2077 L1302 Oxygen-independent coproporphyrinogen III oxidase 2078 L1303 Oxygen-independent coproporphyrinogen III oxidase 2079 L1304 Oxygen-independent coproporphyrinogen III oxidase 2080 L1305 Oxygen-independent coproporphyrinogen III oxidase 2081 L1306 Oxygen-independent coproporphyrinogen III oxidase 2082 L1307 Paraneoplastic encephalomyelitis antigen HuD 2083 L1308 Paraneoplastic encephalomyelitis antigen HuD 2084 L1309 Penicillin binding protein 4 2085 L1310 Penicillin binding protein 4 2086 L1311 Penicillin binding protein 4 2087 L1312 Penicillin binding protein 4 2088 L1313 Penicillin binding protein 4 2089 L1314 Penicillin binding protein 4 2090 L1315 Penicillin binding protein 4 2091 L1316 Peptide-N(4)-(N-acetyl-beta-D-glucosaminyl)asparagine amidase F DGV L1317 Peptide-N(4)-(N-acetyl-beta-D-glucosaminyl)asparagine amidase F 2092 L1318 Peptide-N(4)-(N-acetyl-beta-D-glucosaminyl)asparagine amidase F 2093 L1319 Peptide-N(4)-(N-acetyl-beta-D-glucosaminyl)asparagine amidase F 2094 L1320 Peroxisomal primary amine oxidase 2095 L1321 Peroxisomal primary amine oxidase 2096 L1322 Peroxisome biogenesis factor 1 2097 L1323 Pesticidial crystal protein Cry2Aa 2098 L1324 Pesticidial crystal protein Cry2Aa 2099 L1325 Pesticidial crystal protein Cry2Aa 2100 L1326 Phase 1 flagellin DLT L1327 Phase 1 flagellin 2101 L1328 Phase 1 flagellin 2102 L1329 Phase 1 flagellin 2103 L1330 Phase 1 flagellin 2104 L1331 Phase 1 flagellin 2105 L1332 Phase 1 flagellin 2106 L1333 Phase 1 flagellin 2107 L1334 Phase 1 flagellin 2108 L1335 Phase 1 flagellin 2109 L1336 Phase 1 flagellin 2110 L1337 Phase 1 flagellin 2111 L1338 Phase 1 flagellin 2112 L1339 Phenylalanyl-tRNA synthetase beta chain LGL L1340 Phenylalanyl-tRNA synthetase beta chain 2113 L1341 Phenylalanyl-tRNA synthetase beta chain 2114 L1342 Phenylalanyl-tRNA synthetase beta chain 2115 L1343 Phenylalanyl-tRNA synthetase beta chain 2116 L1344 Phenylalanyl-tRNA synthetase beta chain 2117 L1345 Phenylalanyl-tRNA synthetase beta chain 2118 L1346 Phenylalanyl-tRNA synthetase beta chain 2119 L1347 Phenylalanyl-tRNA synthetase beta chain 2120 L1348 Phenylalanyl-tRNA synthetase beta chain 2121 L1349 Phenylalanyl-tRNA synthetase beta chain 2122 L1350 Phenylalanyl-tRNA synthetase beta chain 2123 L1351 Phenylalanyl-tRNA synthetase beta chain 2124 L1352 Phenylalanyl-tRNA synthetase beta chain 2125 L1353 Phosphatase 2126 L1354 Phosphatase 2127 L1355 Phosphatase 2128 L1356 Phosphatidylinositol transfer protein Sec14p YGT L1357 Phosphatidylinositol transfer protein Sec14p 2129 L1358 Phosphatidylinositol transfer protein Sec14p 2130 L1359 Phosphatidylserine synthase 2131 L1360 Phosphatidylserine synthase 2132 L1361 Phosphatidylserine synthase 2133 L1362 Phosphoglycolate phosphatase 2134 L1363 Phosphoglycolate phosphatase 2135 L1364 Phosphoglycolate phosphatase 2136 L1365 Phosphoglycolate phosphatase 2137 L1366 Phospholipase D 2138 L1367 Phospholipase D 2139 L1368 Phospholipase D 2140 L1369 Phosphoribosylamine--glycine ligase 2141 L1370 Phosphoribosylamine--glycine ligase 2142 L1371 Phosphotransferase system, enzyme I 2143 L1372 Photosystem II d1 protease 2144 L1373 Photosystem II d1 protease 2145 L1374 Photosystem II d1 protease 2146 L1375 Photosystem II d1 protease 2147 L1376 Photosystem II d1 protease 2148 L1377 Phthalate dioxygenase reductase 2149 L1378 P-hydroxybenzoate hydroxylase DGL L1379 P-hydroxybenzoate hydroxylase IDL L1380 P-hydroxybenzoate hydroxylase RLK L1381 P-hydroxybenzoate hydroxylase 2150 L1382 P-hydroxybenzoate hydroxylase 2151 L1383 P-hydroxybenzoate hydroxylase 2152 L1384 P-hydroxybenzoate hydroxylase 2153 L1385 P-hydroxybenzoate hydroxylase 2154 L1386 P-hydroxybenzoate hydroxylase 2155 L1387 P-hydroxybenzoate hydroxylase 2156 L1388 P-hydroxybenzoate hydroxylase 2157 L1389 P-hydroxybenzoate hydroxylase 2158 L1390 P-hydroxybenzoate hydroxylase 2159 L1391 P-hydroxybenzoate hydroxylase 2160 L1392 P-hydroxybenzoate hydroxylase 2161 L1393 P-hydroxybenzoate hydroxylase 2162 L1394 P-hydroxybenzoate hydroxylase 2163 L1395 P-hydroxybenzoate hydroxylase 2164 L1396 P-hydroxybenzoate hydroxylase 2165 L1397 P-hydroxybenzoate hydroxylase 2166 L1398 Phytase LNF L1399 Phytase QSN L1400 Phytase 2167 L1401 Phytase 2168 L1402 Phytase 2169 L1403 Phytase 2170 L1404 Phytase 2171 L1405 Phytase 2172 L1406 Phytase 2173 L1407 Phytase 2174 L1408 Pirin LKS L1409 Pirin SGE L1410 Pirin 2175 L1411 Pirin 2176 L1412 Pirin 2177 L1413 Pirin 2178 L1414 Pirin 2179 L1415 Pirin 2180 L1416 Poly(A) polymerase 2181 L1417 Poly(A) polymerase 2182 L1418 Poly(A) polymerase 2183 L1419 Poly(A) polymerase 2184 L1420 Poly(A) polymerase 2185 L1421 Poly(A) polymerase 2186 L1422 Poly(A) polymerase 2187 L1423 Poly(A) polymerase 2188 L1424 Poly(A) polymerase 2189 L1425 Poly(A) polymerase 2190 L1426 Poly(A) polymerase 2191 L1427 Poly(A) polymerase 2192 L1428 Poly(rC)-binding protein 2 2193 L1429 Polymerase x 2194 L1430 Polymerase x 2195 L1431 Polypeptide N-acetylgalactosaminyltransferase 2 2196 L1432 Polypeptide N-acetylgalactosaminyltransferase 2 2197 L1433 Polyphosphate kinase 2198 L1434 Polyphosphate kinase 2199 L1435 Polyphosphate kinase 2200 L1436 Polypyrimidine tract-binding protein 2201 L1437 Porcine pancreatic spasmolytic polypeptide 2202 L1438 Possible 3-mercaptopyruvate sulfurtransferase LFR L1439 Possible 3-mercaptopyruvate sulfurtransferase YGM L1440 Possible 3-mercaptopyruvate sulfurtransferase 2203 L1441 Possible 3-mercaptopyruvate sulfurtransferase 2204 L1442 Possible 3-mercaptopyruvate sulfurtransferase 2205 L1443 Postsynaptic density protein 95 2206 L1444 Postsynaptic density protein 95 2207 L1445 Predicted sugar phosphatases of the HAD superfamily IAI L1446 Predicted sugar phosphatases of the HAD superfamily 2208 L1447 Predicted sugar phosphatases of the HAD superfamily 2209 L1448 Predicted sugar phosphatases of the HAD superfamily 2210 L1449 Predicted sugar phosphatases of the HAD superfamily 2211 L1450 Predicted sugar phosphatases of the HAD superfamily 2212 L1451 Predicted sugar phosphatases of the HAD superfamily 2213 L1452 Predicted sugar phosphatases of the HAD superfamily 2214 L1453 Predicted sugar phosphatases of the HAD superfamily 2215 L1454 Preprotein translocase SecA ITF L1455 Preprotein translocase SecA LID L1456 Preprotein translocase SecA 2216 L1457 Preprotein translocase SecA 2217 L1458 Preprotein translocase SecA 2218 L1459 Preprotein translocase SecA 2219 L1460 Preprotein translocase SecA 2220 L1461 Preprotein translocase SecA 2221 L1462 Preprotein translocase SecA 2222 L1463 Preprotein translocase SecA 2223 L1464 Preprotein translocase SecA 2224 L1465 Preprotein translocase SecA 2225 L1466 Preprotein translocase SecA 2226 L1467 Preprotein translocase SecA 2227 L1468 Preprotein translocase SecA 2228 L1469 Preprotein translocase SecA 2229 L1470 Preprotein translocase SecA 2230 L1471 Preprotein translocase SecA 2231 L1472 Preprotein translocase SecA 2232 L1473 PrfA ING L1474 Probable 16s rRNA-processing protein RimM 2233 L1475 Probable biphenyl-2,3-diol 1,2-dioxygenase BphC 2234 L1476 Probable chorismate mutase LLA L1477 Probable chorismate mutase 2235 L1478 Probable chorismate mutase 2236 L1479 Probable ferredoxin-dependent nitrite reductase NirA VPL L1480 Probable ferredoxin-dependent nitrite reductase NirA WGI L1481 Probable ferredoxin-dependent nitrite reductase NirA 2237 L1482 Probable ferredoxin-dependent nitrite reductase NirA 2238 L1483 Probable ferredoxin-dependent nitrite reductase NirA 2239 L1484 Probable ferredoxin-dependent nitrite reductase NirA 2240 L1485 Probable ferredoxin-dependent nitrite reductase NirA 2241 L1486 Probable ferredoxin-dependent nitrite reductase NirA 2242 L1487 Probable ferredoxin-dependent nitrite reductase NirA 2243 L1488 Probable ferredoxin-dependent nitrite reductase NirA 2244 L1489 Probable ferredoxin-dependent nitrite reductase NirA 2245 L1490 Probable ferredoxin-dependent nitrite reductase NirA 2246 L1491 Probable ferredoxin-dependent nitrite reductase NirA 2247 L1492 Probable ferredoxin-dependent nitrite reductase NirA 2248 L1493 Probable galactokinase 2249 L1494 Probable galactokinase 2250 L1495 Probable galactokinase 2251 L1496 Probable galactokinase 2252 L1497 Probable galactokinase 2253 L1498 Probable galactokinase 2254 L1499 Probable galactokinase 2255 L1500 Probable galactokinase 2256 L1501 Probable galactokinase 2257 L1502 Probable galactokinase 2258 L1503 Probable galactokinase 2259 L1504 Probable galactokinase 2260 L1505 Probable glutathione S-transferase 2261 L1506 Probable GST-related protein 2262 L1507 Probable HPr(Ser) kinase/phosphatase 2263 L1508 Probable thiosulfate sulfur transferase 2264 L1509 Probable thiosulfate sulfur transferase 2265 L1510 Probable thiosulfate sulfur transferase 2266 L1511 Probable thiosulfate sulfur transferase 2267 L1512 Probable thiosulfate sulfur transferase 2268 L1513 Probable thiosulfate sulfur transferase 2269 L1514 Probable thiosulfate sulfur transferase 2270 L1515 Probable thiosulfate sulfur transferase 2271 L1516 Probable tRNA pseudouridine synthase D 2272 L1517 Probable tRNA pseudouridine synthase D 2273 L1518 Probable tRNA pseudouridine synthase D 2274 L1519 Probable tRNA pseudouridine synthase D 2275 L1520 Probable tRNA pseudoundine synthase D 2276 L1521 Probable tRNA pseudouridine synthase D 2277 L1522 Programed cell death protein 8 SKE L1523 Programed cell death protein 8 TLQ L1524 Programed cell death protein 8 2278 L1525 Programed cell death protein 8 2279 L1526 Programed cell death protein 8 2280 L1527 Programed cell death protein 8 2281 L1528 Programed cell death protein 8 2282 L1529 Programed cell death protein 8 2283 L1530 Programed cell death protein 8 2284 L1531 Programed cell death protein 8 2285 L1532 Programed cell death protein 8 2286 L1533 Programed cell death protein 8 2287 L1534 Programed cell death protein 8 2288 L1535 Programed cell death protein 8 2289 L1536 Programed cell death protein 8 2290 L1537 Programed cell death protein 8 2291 L1538 Programed cell death protein 8 2292 L1539 Programed cell death protein 8 2293 L1540 Programed cell death protein 8 2294 L1541 Programed cell death protein 8 2295 L1542 Proline oxidase 2296 L1543 Prolyl-tRNA synthetase 2297 L1544 Prostaglandin G/H synthase 1 PEI L1545 Prostaglandin G/H synthase 1 2298 L1546 Protease 2299 L1547 Protease 2300 L1548 Protease 2301 L1549 Protease DegS 2302 L1550 Protease DegS 2303 L1551 Protease DegS 2304 L1552 Protease DegS 2305 L1553 Protease III NAR L1554 Protease III RNP L1555 Protease III 2306 L1556 Protease III 2307 L1557 Protease III 2308 L1558 Protease III 2309 L1559 Protease III 2310 L1560 Protease III 2311 L1561 Protease III 2312 L1562 Protease III 2313 L1563 Protease III 2314 L1564 Protease III 2315 L1565 Protease III 2316 L1566 Protease III 2317 L1567 Protease III 2318 L1568 Protease III 2319 L1569 Protease III 2320 L1570 Protease III 2321 L1571 Protease III 2322 L1572 Protease III 2323 L1573 Protease III 2324 L1574 Protease III 2325 L1575 Protection of telomeres 1 2326 L1576 Protection of telomeres 1 2327 L1577 Protein (CD58) 2328 L1578 Protein (CRP1) 2329 L1579 Protein (DNA polymerase) 2330 L1580 Protein (DNA polymerase) 2331 L1581 Protein (DNA polymerase) 2332 L1582 Protein (electron transfer flavoprotein) 2333 L1583 Protein (electron transfer flavoprotein) 2334 L1584 Protein (Ffh) 2335 L1585 Protein (Ffh) 2336 L1586 Protein (Ffh) 2337 L1587 Protein (Ffh) 2338 L1588 Protein (Ffh) 2339 L1589 Protein (FokI restriction endonuclease) 2340 L1590 Protein (FokI restriction endonuclease) 2341 L1591 Protein (FokI restriction endonuclease) 2342 L1592 Protein (FokI restriction endonuclease) 2343 L1593 Protein (FokI restriction endonuclease) 2344 L1594 Protein (FokI restriction endonuclease) 2345 L1595 Protein (FokI restriction endonuclease) 2346 L1596 Protein (FokI restriction endonuclease) 2347 L1597 Protein (FokI restriction endonuclease) 2348 L1598 Protein (neural cell adhesion molecule) 2349 L1599 Protein (neural cell adhesion molecule) 2350 L1600 Protein (neural cell adhesion molecule) 2351 L1601 Protein (nine-haem cytochrome c) FTH L1602 Protein (nine-haem cytochrome c) 2352 L1603 Protein (nine-haem cytochrome c) 2353 L1604 Protein (nine-haem cytochrome c) 2354 L1605 Protein (nine-haem cytochrome c) 2355 L1606 Protein (nine-haem cytochrome c) 2356 L1607 Protein (nine-haem cytochrome c) 2357 L1608 Protein (nine-haem cytochrome c) 2358 L1609 Protein (nine-haem cytochrome c) 2359 L1610 Protein (protease/helicase NS3) 2360 L1611 Protein (protease/helicase NS3) 2361 L1612 Protein (protease/helicase NS3) 2362 L1613 Protein (protease/helicase NS3) 2363 L1614 Protein disulfide oxidoreductase 2364 L1615 Protein disulfide oxidoreductase 2365 L1616 Protein disulfide-isomerase A4 2366 L1617 Protein kinase PKR 2367 L1618 Protein kinase PKR 2368 L1619 Protein TolB VNK L1620 Protein TolB 2369 L1621 Protein TolB 2370 L1622 Protein TolB 2371 L1623 Protein TolB 2372 L1624 Protein TolB 2373 L1625 Protein TolB 2374 L1626 Protein translation elongation factor 1A 2375 L1627 Protein transport protein Sec24 DRN L1628 Protein transport protein Sec24 2376 L1629 Protein transport protein Sec24 2377 L1630 Protein transport protein Sec24 2378 L1631 Protein transport protein Sec24 2379 L1632 Protein transport protein Sec24 2380 L1633 Protein transport protein Sec24 2381 L1634 Protein transport protein Sec24 2382 L1635 Protein transport protein Sec24 2383 L1636 Pseudouridine synthase CBF5 AIQ L1637 Pseudouridine synthase CBF5 2384 L1638 Pseudouridine synthase CBF5 2385 L1639 Putative acetylglutamate synthase 2386 L1640 Putative acetylglutamate synthase 2387 L1641 Putative acetylglutamate synthase 2388 L1642 Putative family 31 glucosidase Yicl 2389 L1643 Putative family 31 glucosidase Yicl 2390 L1644 Putative family 31 glucosidase Yicl 2391 L1645 Putative glutathione transferase 2392 L1646 Putative glutathione transferase 2393 L1647 Putative glutathione transferase 2394 L1648 Putative GNTR-family transcriptional regulator 2395 L1649 Putative GNTR-family transcriptional regulator 2396 L1650 Putative GNTR-family transcriptional regulator 2397 L1651 Putative HTH-type transcriptional regulator PH0061 2398 L1652 Putative HTH-type transcriptional regulator PH1519 2399 L1653 Putative HTH-type transcriptional regulator PH1519 2400 L1654 Putative metallopeptidase 2401 L1655 Putative N-acetylmannosamine kinase 2402 L1656 Putative N-acetylmannosamine kinase 2403 L1657 Putative N-acetylmannosamine kinase 2404 L1658 Putative NADP oxidoreductase BF3122 2405 L1659 Putative NADP oxidoreductase BF3122 2406 L1660 Putative NADP oxidoreductase BF3122 2407 L1661 Putative NADP oxidoreductase BF3122 2408 L1662 Putative oxidoreductase 2409 L1663 Putative secreted alpha-galactosidase PLP L1664 Putative secreted alpha-galactosidase TNG L1665 Putative secreted alpha-galactosidase 2410 L1666 Putative secreted alpha-galactosidase 2411 L1667 Putative secreted alpha-galactosidase 2412 L1668 Putative tagatose-6-phosphate ketose/aldose isomerase DKA L1669 Putative tagatose-6-phosphate ketose/aldose isomerase 2413 L1670 Putative tagatose-6-phosphate ketose/aldose isomerase 2414 L1671 Putative tagatose-6-phosphate ketose/aldose isomerase 2415 L1672 Putative transcriptional regulator GntR 2416 L1673 Putative transcriptional repressor (TetR/AcrR family) KFR L1674 Putative transcriptional repressor (TetR/AcrR family) 2417 L1675 Putative uncharacterized protein 2418 L1676 Putative uncharacterized protein 2419 L1677 Putative uncharacterized protein 2420 L1678 Putative uncharacterized protein 2421 L1679 Putative uncharacterized protein 2422 L1680 Putative uncharacterized protein 2423 L1681 Putative uncharacterized protein 2424 L1682 Putative uncharacterized protein 2425 L1683 Putative uncharacterized protein 2426 L1684 Pyruvate decarboxylase CAA L1685 Pyruvate decarboxylase 2427 L1686 Pyruvate decarboxylase 2428 L1687 Pyruvate decarboxylase 2429 L1688 Pyruvate decarboxylase 2430 L1689 Pyruvate decarboxylase 2431 L1690 Pyruvate dehydrogenase [lipoamide] kinase isozyme 2, mitochondrial YVP L1691 Pyruvate dehydrogenase [lipoamide] kinase isozyme 2, mitochondrial 2432 L1692 Pyruvate dehydrogenase [lipoamide] kinase isozyme 2, mitochondrial 2433 L1693 Pyruvate dehydrogenase E1 component subunit beta, mitochondrial 2434 L1694 Pyruvate dehydrogenase E1 component subunit beta, mitochondrial 2435 L1695 Pyruvate dehydrogenase E1 component subunit beta, mitochondrial 2436 L1696 Pyruvate phosphate dikinase FNP L1697 Pyruvate phosphate dikinase SAL L1698 Pyruvate phosphate dikinase 2437 L1699 Pyruvate phosphate dikinase 2438 L1700 Pyruvate phosphate dikinase 2439 L1701 Pyruvate phosphate dikinase 2440 L1702 Pyruvate phosphate dikinase 2441 L1703 Pyruvate phosphate dikinase 2442 L1704 Pyruvate phosphate dikinase 2443 L1705 Pyruvate phosphate dikinase 2444 L1706 Pyruvate phosphate dikinase 2445 L1707 Pyruvate phosphate dikinase 2446 L1708 Pyruvate-ferredoxin oxidoreductase VRL L1709 Pyruvate-ferredoxin oxidoreductase 2447 L1710 Pyruvate-ferredoxin oxidoreductase 2448 L1711 Pyruvate-ferredoxin oxidoreductase 2449 L1712 Pyruvate-ferredoxin oxidoreductase 2450 L1713 Pyruvate-ferredoxin oxidoreductase 2451 L1714 Pyruvate-ferredoxin oxidoreductase 2452 L1715 Pyruvate-ferredoxin oxidoreductase 2453 L1716 Pyruvate-ferredoxin oxidoreductase 2454 L1717 Pyruvate-ferredoxin oxidoreductase 2455 L1718 Pyruvate-ferredoxin oxidoreductase 2456 L1719 Pyruvate-ferredoxin oxidoreductase 2457 L1720 Pyruvate-ferredoxin oxidoreductase 2458 L1721 Pyruvate-ferredoxin oxidoreductase 2459 L1722 Pyruvate-ferredoxin oxidoreductase 2460 L1723 Pyruvate-ferredoxin oxidoreductase 2461 L1724 Pyruvate-ferredoxin oxidoreductase 2462 L1725 Pyruvate-ferredoxin oxidoreductase 2463 L1726 Pyruvate-ferredoxin oxidoreductase 2464 L1727 Pyruvate-ferredoxin oxidoreductase 2465 L1728 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2466 L1729 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2467 L1730 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2468 L1731 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2469 L1732 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2470 L1733 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2471 L1734 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2472 L1735 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2473 L1736 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2474 L1737 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2475 L1738 Rag1 2476 L1739 Rag1 2477 L1740 Receptor-type tyrosine-protein phosphatase Mu 2478 L1741 Receptor-type tyrosine-protein phosphatase Mu 2479 L1742 RecG 2480 L1743 RecG 2481 L1744 RecG 2482 L1745 RecG 2483 L1746 RecG 2484 L1747 RecG 2485 L1748 RecG 2486 L1749 RecG 2487 L1750 RecG 2488 L1751 RecG 2489 L1752 RecG 2490 L1753 RecG 2491 L1754 Recombination endonuclease VII 2492 L1755 Recombining binding protein suppressor of hairless 2493 L1756 Restriction endonuclease ERV L1757 Restriction endonuclease 2494 L1758 Restriction endonuclease 2495 L1759 Restriction endonuclease 2496 L1760 Retinaldehyde-binding protein 1 QYP L1761 Retinaldehyde-binding protein 1 2497 L1762 Retinaldehyde-binding protein 1 2498 L1763 Retinoblastoma pocket 2499 L1764 RfcS ITD L1765 RfcS LTE L1766 RfcS 2500 L1767 RfcS 2501 L1768 RfcS 2502 L1769 RfcS 2503 L1770 RfcS 2504 L1771 Rhamnogalacturonase B 2505 L1772 Rhamnogalacturonase B 2506 L1773 Rhamnogalacturonase B 2507 L1774 Rhamnogalacturonase B 2508 L1775 Rhamnogalacturonase B 2509 L1776 Rhodniin 2510 L1777 Rhodniin 2511 L1778 Riboflavin synthase 2512 L1779 Ribonuclease D 2513 L1780 Ribonuclease D 2514 L1781 Ribonuclease D 2515 L1782 Ribonuclease TTHA0252 2516 L1783 Ribonuclease TTHA0252 2517 L1784 Ribonuclease TTHA0252 2518 L1785 Ribonuclease TTHA0252 2519 L1786 Ribonuclease TTHA0252 2520 L1787 Ribonuclease TTHA0252 2521 L1788 Ribonucleotide reductase r1 protein 2522 L1789 Ribonucleotide reductase r1 protein 2523 L1790 Ribonucleotide reductase r1 protein 2524 L1791 Ribonucleotide reductase r1 protein 2525 L1792 Ribonucleotide reductase r1 protein 2526 L1793 Ribonucleotide reductase r1 protein 2527 L1794 Ribosome maturation factor RimM 2528 L1795 Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase RHA L1796 Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase 2529 L1797 Rigid extended P-rich 2530 L1798 Rigid extended P-rich 2531 L1799 Rigid extended P-rich 2532 L1800 Rigid extended P-rich 2533 L1801 Rigid extended P-rich 2534 L1802 Rigid extended P-rich 2535 L1803 Rigid extended P-rich 2536 L1804 Rigid extended P-rich 2537 L1805 Rigid extended P-rich 2538 L1806 Rigid extended P-rich 2539 L1807 Rigid extended P-rich 2540 L1808 Rigid extended P-rich 2541 L1809 Rigid extended P-rich 2542 L1810 Rigid extended P-rich 2543 L1811 Rigid extended P-rich 2544 L1812 Rigid helical 2545 L1813 Rigid helical 2546 L1814 Rigid helical 2547 L1815 Rigid helical 2548 L1816 Rigid helical 2549 L1817 Rigid helical 2550 L1818 Rigid helical 2551 L1819 Rigid helical 2552 L1820 RNA binding domain of rho transcription termination factor 2553 L1821 RNA binding protein ZFa 2554 L1822 Rob transcription factor 2555 L1823 Rob transcription factor 2556 L1824 RP2 lipase 2557 L1825 Rubrerythrin 2558 L1826 S-adenosylmethionine synthetase 2559 L1827 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 QFD L1828 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2560 L1829 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2561 L1830 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2562 L1831 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2563 L1832 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2564 L1833 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2565 L1834 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2566 L1835 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2567 L1836 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2568 L1837 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2569 L1838 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2570 L1839 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2571 L1840 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2572 L1841 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2573 L1842 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2574 L1843 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2575 L1844 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2576 L1845 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2577 L1846 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2578 L1847 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2579 L1848 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2580 L1849 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2581 L1850 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2582 L1851 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2583 L1852 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2584 L1853 Scavenger mRNA-decapping enzyme DcpS ETG L1854 Scavenger mRNA-decapping enzyme DcpS NIT L1855 Scavenger mRNA-decapping enzyme DcpS 2585 L1856 Scavenger mRNA-decapping enzyme DcpS 2586 L1857 Sec18p (residues 22-210) 2587 L1858 Sec18p (residues 22-210) 2588 L1859 Sensor protein 2589 L1860 Sensor protein 2590 L1861 Septum site-determining protein MinC 2591 L1862 Serine acetyltransferase 2592 L1863 Serine protease/NTPase/helicase NS3 2593 L1864 Serine protease/NTPase/helicase NS3 2594 L1865 Serine protease/NTPase/helicase NS3 2595 L1866 Serine rich linker 2596 L1867 Serine rich linker 2597 L1868 Serine rich linker 2598 L1869 Serine rich linker 2599 L1870 Serine rich linker 2600 L1871 Serine rich linker 2601 L1872 Serine rich linker 2602 L1873 Seryl-tRNA synthetase 2603 L1874 Sialidase 2604 L1875 Sialidase B SLT L1876 Sialidase B VRE L1877 Sialidase B 2605 L1878 Sialidase B 2606 L1879 Sialidase B 2607 L1880 Sialidase B 2608 L1881 Sialidase B 2609 L1882 Sialidase B 2610 L1883 SIgnal peptIdase I SRR L1884 SIgnal peptIdase I 2611 L1885 SIgnal peptIdase I 2612 L1886 SIgnal peptIdase I 2613 L1887 SIgnal peptIdase I 2614 L1888 SIgnal peptIdase I 2615 L1889 SIgnal peptIdase I 2616 L1890 SIgnal peptIdase I 2617 L1891 SIgnal peptIdase I 2618 L1892 SIgnal peptIdase I 2619 L1893 SIgnal peptIdase I 2620 L1894 Signal recognition particle protein 2621 L1895 Signal transducer and activator of transcription1-alpha/beta NDE L1896 Signal transducer and activator of transcription1-alpha/beta SSF L1897 Signal transducer and activator of transcription1-alpha/beta 2622 L1898 Signal transducer and activator of transcription1-alpha/beta 2623 L1899 Signal transducer and activator of transcription1-alpha/beta 2624 L1900 Signal transducer and activator of transcription1-alpha/beta 2625 L1901 Signal transduction protein CBL 2626 L1902 Signal transduction protein CBL 2627 L1903 Similar to RAD54-like AKP L1904 Similar to RAD54-like EYF L1905 Similar to RAD54-like RFE L1906 Similar to RAD54-like 2628 L1907 Similar to RAD54-like 2629 L1908 Similar to RAD54-like 2630 L1909 Similar to RAD54-like 2631 L1910 Similar to RAD54-like 2632 L1911 Similar to RAD54-like 2633 L1912 Similar to RAD54-like 2634 L1913 Similar to RAD54-like 2635 L1914 Similar to RAD54-like 2636 L1915 Similar to RAD54-like 2637 L1916 SKD1 protein LMQ L1917 SKD1 protein 2638 L1918 SKD1 protein 2639 L1919 SKD1 protein 2640 L1920 SKD1 protein 2641 L1921 SKD1 protein 2642 L1922 Sll1358 protein 2643 L1923 Sll1358 protein 2644 L1924 Sll1358 protein 2645 L1925 Sll1358 protein 2646 L1926 Soluble IFN alpha/beta receptor 2647 L1927 Soluble IFN alpha/beta receptor 2648 L1928 Sporozoite-specific SAG protein 2649 L1929 Staphylococcal accessory regulator a homologue 2650 L1930 Staphylococcal nuclease domain-containing protein 1 2651 L1931 Staphylococcal nuclease domain-containing protein 1 2652 L1932 Staphylococcal nuclease domain-containing protein 1 2653 L1933 Staphylococcal nuclease domain-containing protein 1 2654 L1934 Staphylococcal nuclease domain-containing protein 1 2655 L1935 Staphylococcal nuclease domain-containing protein 1 2656 L1936 Stat protein 2657 L1937 Stat protein 2658 L1938 Stat protein 2659 L1939 Stat protein 2660 L1940 Stat protein 2661 L1941 Stat protein 2662 L1942 Stat protein 2663 L1943 Stat protein 2664 L1944 Stat protein 2665 L1945 Stat protein 2666 L1946 Stat protein 2667 L1947 Stat protein 2668 L1948 Stat protein 2669 L1949 Stat protein 2670 L1950 Stat protein 2671 L1951 Subtilisin-like protease 2672 L1952 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2673 L1953 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2674 L1954 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2675 L1955 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2676 L1956 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2677 L1957 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2678 L1958 Succinyl-CoA synthetase beta chain ADG L1959 Succinyl-CoA synthetase beta chain RQP L1960 Succinyl-CoA synthetase beta chain 2679 L1961 Succinyl-CoA synthetase beta chain 2680 L1962 Succinyl-CoA synthetase beta chain 2681 L1963 Succinyl-CoA synthetase beta chain 2682 L1964 Succinyl-CoA synthetase beta chain 2683 L1965 Succinyl-CoA synthetase beta chain 2684 L1966 Succinyl-CoA:3-ketoacid-coenzyme A transferase 2685 L1967 Sulfurtransferase 2686 L1968 Superantigen SMEZ-2 2687 L1969 Superoxide dismutase 1 copper chaperone 2688 L1970 Surface layer protein 2689 L1971 Surface layer protein 2690 L1972 Surface layer protein 2691 L1973 Surface layer protein 2692 L1974 Surface layer protein 2693 L1975 Surface layer protein 2694 L1976 Surface layer protein 2695 L1977 Surface layer protein 2696 L1978 T lymphocyte activation antigen 2697 L1979 T lymphocyte activation antigen 2698 L1980 T-cell receptor alpha chain C region 2699 L1981 Terminal oxygenase component of carbazole 2700 L1982 Tetanus neurotoxin 2701 L1983 Tetracycline repressor protein class D 2702 L1984 The GTP-binding protein Obg 2703 L1985 The GTP-binding protein Obg 2704 L1986 The GTP-binding protein Obg 2705 L1987 The GTP-binding protein Obg 2706 L1988 Thioredoxin domain-containing protein 4 2707 L1989 Thioredoxin domain-containing protein 4 2708 L1990 Thiosulfate sulfurtransferase IDP L1991 Thiosulfate sulfurtransferase 2709 L1992 Thiosulfate sulfurtransferase 2710 L1993 Thiosulfate sulfurtransferase 2711 L1994 Thiosulfate sulfurtransferase 2712 L1995 Threonyl-tRNA synthetase 2713 L1996 Threonyl-tRNA synthetase 2714 L1997 Threonyl-tRNA synthetase 2715 L1998 Threonyl-tRNA synthetase 2716 L1999 Threonyl-tRNA synthetase 2717 L2000 Threonyl-tRNA synthetase 2718 L2001 Threonyl-tRNA synthetase 2719 L2002 Threonyl-tRNA synthetase 2720 L2003 Threonyl-tRNA synthetase 2721 L2004 Threonyl-tRNA synthetase 1 2722 L2005 Threonyl-tRNA synthetase 1 2723 L2006 Threonyl-tRNA synthetase 1 2724 L2007 Threonyl-tRNA synthetase 1 2725 L2008 Threonyl-tRNA synthetase 1 2726 L2009 Threonyl-tRNA synthetase 1 2727 L2010 Threonyl-tRNA synthetase 1 2728 L2011 Threonyl-tRNA synthetase 1 2729 L2012 Thrombospondin 1 2730 L2013 Tick-borne encephalitis virus glycoprotein 2731 L2014 Titin 2732 L2015 Titin 2733 L2016 TLR1789 protein 2734 L2017 TLR1789 protein 2735 L2018 Topoisomerase I 2736 L2019 Topoisomerase I 2737 L2020 Toxic shock syndrome toxin-1 2738 L2021 Toxic shock syndrome toxin-1 2739 L2022 Toxic shock syndrome toxin-1 2740 L2023 Toxic shock syndrome toxin-1 2741 L2024 T-plasminogen activator F1-G VPV L2025 T-plasminogen activator F1-G 2742 L2026 TpsB transporter FhaC 2743 L2027 TpsB transporter FhaC 2744 L2028 TpsB transporter FhaC 2745 L2029 Transcarbamylase 2746 L2030 Transcarbamylase 2747 L2031 Transcription antiterminator LicT 2748 L2032 Transcription elongation factor GreB 2749 L2033 Transcription initiation factor IIa gamma chain 2750 L2034 Transcription initiation factor IIb 2751 L2035 Transcription initiation factor IIb 2752 L2036 Transcriptional regulator (NtrC family) 2753 L2037 Transcriptional regulator AefR 2754 L2038 Transcriptional regulator AefR 2755 L2039 Transcriptional regulator AefR 2756 L2040 Transcriptional regulator AefR 2757 L2041 Transcriptional regulator AefR 2758 L2042 Transcriptional regulator, AsnC family 2759 L2043 Transcriptional regulator, AsnC family 2760 L2044 Transcriptional regulator, AsnC family 2761 L2045 Transcriptional regulator, biotin repressor family 2762 L2046 Transcriptional regulator, Crp/Fnr family 2763 L2047 Transcriptional regulator, GntR family 2764 L2048 Transcriptional regulator, HTH_3 family 2765 L2049 Transcriptional regulator, HTH_3 family 2766 L2050 Transcriptional regulator, HTH_3 family 2767 L2051 Transcriptional regulator, HTH_3 family 2768 L2052 Transcriptional regulator, HTH_3 family 2769 L2053 Transcriptional regulator, laci family 2770 L2054 Transcriptional regulatory protein ZraR 2771 L2055 Transcriptional regulatory protein ZraR 2772 L2056 Transcriptional regulatory protein ZraR 2773 L2057 Transcriptional regulatory protein ZraR 2774 L2058 Transcriptional regulatory protein ZraR 2775 L2059 Transcriptional regulatory protein ZraR 2776 L2060 Transcriptional regulatory protein ZraR 2777 L2061 Transferrin receptor protein VSN L2062 Transferrin receptor protein 2778 L2063 Transferrin receptor protein 2779 L2064 Transferrin receptor protein 2780 L2065 Transferrin receptor protein 2781 L2066 Translation initiation factor 5A 2782 L2067 Translation initiation factor 5A 2783 L2068 Translation initiation factor 5A 2784 L2069 Translation initiation factor IF2/eIF5b 2785 L2070 Translation initiation factor IF2/eIF5b 2786 L2071 Transposable element mariner, complete CDS 2787 L2072 Tricorn protease 2788 L2073 Tricorn protease 2789 L2074 Tricorn protease 2790 L2075 Trigger factor 2791 L2076 Trigger factor 2792 L2077 Trigger factor 2793 L2078 TRNA CCA-adding enzyme RRI L2079 TRNA CCA-adding enzyme 2794 L2080 TRNA CCA-adding enzyme 2795 L2081 TRNA CCA-adding enzyme 2796 L2082 TRNA CCA-adding enzyme 2797 L2083 TRNA nucleotidyltransferase 2798 L2084 TRNA-splicing endonuclease 2799 L2085 Tt1467 protein LEA L2086 Tt1467 protein 2800 L2087 Tumor suppressor p53-binding protein 1 2801 L2088 Tumor suppressor p53-binding protein 1 2802 L2089 Tumor suppressor p53-binding protein 1 2803 L2090 Tumor suppressor p53-binding protein 1 2804 L2091 Type A flavoprotein FprA 2805 L2092 Type A flavoprotein FprA 2806 L2093 Type A flavoprotein FprA 2807 L2094 Type A flavoprotein FprA 2808 L2095 Type A flavoprotein FprA 2809 L2096 Type I restriction enzyme specificity protein MG438 QMH L2097 Type I restriction enzyme specificity protein MG438 2810 L2098 Type I restriction enzyme specificity protein MG438 2811 L2099 Type I restriction-modification enzyme, S subunit 2812 L2100 Type I restriction-modification enzyme, S subunit 2813 L2101 Type I site-specific restriction-modification system, R (restriction) subunit 2814 L2102 Type I site-specific restriction-modification system, R (restriction) subunit 2815 L2103 Type I site-specific restriction-modification system, R (restriction) subunit 2816 L2104 Type II DNA topoisomerase VI subunit B 2817 L2105 Type II DNA topoisomerase VI subunit B 2818 L2106 Type II DNA topoisomerase VI subunit B 2819 L2107 Type II DNA topoisomerase VI subunit B 2820 L2108 Type II DNA topoisomerase VI subunit B 2821 L2109 Type II DNA topoisomerase VI subunit B 2822 L2110 Type II DNA topoisomerase VI subunit B 2823 L2111 Type II DNA topoisomerase VI subunit B 2824 L2112 Type II DNA topoisomerase VI subunit B 2825 L2113 Type II DNA topoisomerase VI subunit B 2826 L2114 Type II DNA topoisomerase VI subunit B 2827 L2115 Type VI secretion system component 2828 L2116 Type VI secretion system component 2829 L2117 Type VI secretion system component 2830 L2118 Tyrosine-protein kinase receptor UFO 2831 L2119 Tyrosine-protein kinase receptor UFO 2832 L2120 Tyrosine-protein kinase ZAP-70 2833 L2121 Tyrosine-protein kinase ZAP-70 2834 L2122 Tyrosyl-DNA phosphodiesterase 2835 L2123 Tyrosyl-DNA phosphodiesterase 2836 L2124 Ubiquitin carboxyl-terminal hydrolase 7 2837 L2125 UDP-galactopyranose mutase 2838 L2126 UDP-galactopyranose mutase 2839 L2127 UDP-galactopyranose mutase 2840 L2128 UDP-galactopyranose mutase 2841 L2129 UDP-galactopyranose mutase 2842 L2130 UDP-glucose dehydrogenase 2843 L2131 UDP-N-acetylmuramate-L-alanine ligase 2844 L2132 UDP-N-acetylmuramate-L-alanine ligase 2845 L2133 UDP-N-acetylmuramoylalanine--D-glutamate ligase 2846 L2134 UDP-N-acetylmuramoylalanine--D-glutamate ligase 2847 L2135 UDP-N-acetylmuramoylalanine-D-glutamyl-lysine-D-alanyl-D-alanine ligase, MurF 2848 protein L2136 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2849 L2137 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2850 L2138 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2851 L2139 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2852 L2140 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2853 L2141 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2854 L2142 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2855 L2143 Uncharacterized conserved protein 2856 L2144 Uncharacterized conserved protein 2857 L2145 Uncharacterized GST-like protein yfcF 2858 L2146 Uncharacterized GST-like proteinprotein 2859 L2147 Uncharacterized GST-like proteinprotein 2860 L2148 Uncharacterized GST-like proteinprotein 2861 L2149 Uncharacterized protein 2862 L2150 Uncharacterized protein 2863 L2151 Uncharacterized protein BT_1490 2864 L2152 Uncharacterized protein ypfl TLR L2153 Uncharacterized protein ypfl VHP L2154 Uncharacterized protein ypfl 2865 L2155 Uncharacterized protein ypfl 2866 L2156 Uncharacterized protein ypfl 2867 L2157 Uncharacterized protein ypfl 2868 L2158 Uncharacterized protein ypfl 2869 L2159 Uncharacterized protein ypfl 2870 L2160 Uncharacterized protein ypfl 2871 L2161 Uncharacterized protein ypfl 2872 L2162 Uncharacterized protein ypfl 2873 L2163 Uncharacterized protein ypfl 2874 L2164 Uncharacterized protein ypfl 2875 L2165 Uncharacterized protein ypfl 2876 L2166 Uncharacterized protein ypfl 2877 L2167 Uncharacterized protein ypfl 2878 L2168 Uncharacterized protein ypfl 2879 L2169 Unknown protein 2880 L2170 Unknown protein 2881 L2171 UPF0131 protein ykqA 2882 L2172 UPF0131 protein ykqA 2883 L2173 UPF0131 protein ykqA 2884 L2174 UPF0348 protein MJ0951 2885 L2175 UPF0348 protein MJ0951 2886 L2176 UPF0348 protein MJ0951 2887 L2177 UPF0348 protein MJ0951 2888 L2178 UPF0348 protein MJ0951 2889 L2179 UPF0348 protein MJ0951 2890 L2180 UPF0348 protein MJ0951 2891 L2181 UPF0348 protein MJ0951 2892 L2182 URE2 protein 2893 L2183 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase TAK L2184 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase 2894 L2185 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase 2895 L2186 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase 2896 L2187 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase 2897 L2188 Urokinase plasminogen activator surface receptor 2898 L2189 Urokinase plasminogen activator surface receptor 2899 L2190 Vascular cell adhesion molecule-1 2900 L2191 VCP-like ATPase 2901 L2192 VCP-like ATPase 2902 L2193 Viral CASP8 and FADD-like apoptosis regulator 2903 L2194 Vitamin K-dependent protein Z 2904 L2195 VP1 protein 2905 L2196 V-type ATP synthase alpha chain 2906 L2197 Xaa-Pro aminopeptidase 2907 L2198 Xaa-Pro aminopeptidase 2908 L2199 Xaa-Pro aminopeptidase 2909 L2200 Xaa-Pro aminopeptidase 2910 L2201 Xanthine dehydrogenase 2911 L2202 Xanthine dehydrogenase 2912 L2203 Xanthine dehydrogenase 2913 L2204 Xanthine dehydrogenase 2914 L2205 X-prolyl dipeptidyl aminopeptidase KSY L2206 X-prolyl dipeptidyl aminopeptidase LDG L2207 X-prolyl dipeptidyl aminopeptidase LLE L2208 X-prolyl dipeptidyl aminopeptidase TYS L2209 X-prolyl dipeptidyl aminopeptidase 2915 L2210 X-prolyl dipeptidyl aminopeptidase 2916 L2211 X-prolyl dipeptidyl aminopeptidase 2917 L2212 X-prolyl dipeptidyl aminopeptidase 2918 L2213 X-prolyl dipeptidyl aminopeptidase 2919 L2214 X-prolyl dipeptidyl aminopeptidase 2920 L2215 X-prolyl dipeptidyl aminopeptidase 2921 L2216 X-prolyl dipeptidyl aminopeptidase 2922 L2217 X-prolyl dipeptidyl aminopeptidase 2923 L2218 X-prolyl dipeptidyl aminopeptidase 2924 L2219 X-prolyl dipeptidyl aminopeptidase 2925 L2220 X-prolyl dipeptidyl aminopeptidase 2926 L2221 X-prolyl dipeptidyl aminopeptidase 2927 L2222 X-prolyl dipeptidyl aminopeptidase 2928 L2223 X-prolyl dipeptidyl aminopeptidase 2929 L2224 X-prolyl dipeptidyl aminopeptidase 2930 L2225 X-prolyl dipeptidyl aminopeptidase 2931 L2226 X-prolyl dipeptidyl aminopeptidase 2932 L2227 X-prolyl dipeptidyl aminopeptidase 2933 L2228 X-prolyl dipeptidyl aminopeptidase 2934 L2229 X-prolyl dipeptidyl aminopeptidase 2935 L2230 X-prolyl dipeptidyl aminopeptidase 2936 L2231 X-prolyl dipeptidyl aminopeptidase 2937 L2232 X-prolyl dipeptidyl aminopeptidase 2938 12233 Xylosidase/arabinosidase 2939 L2234 Xylosidase/arabinosidase 2940 L2235 Xylosidase/arabinosidase 2941 L2236 Xylosidase/arabinosidase 2942 L2237 Xylosidase/arabinosidase 2943 L2238 Xylosidase/arabinosidase 2944 L2239 Xylosidase/arabinosidase 2945 L2240 YkoF 2946 L2241 YkuI protein 2947

    [0162] Internal ribosomal entry site (IRES) is a nucleotide sequence (>500 nucleotides) that allows for initiation of translation in the middle of an mRNA sequence (Kim, J. H. et al., 2011. PLoS One 6(4): e18556; the contents of which are herein incorporated by reference in its entirely). Use of an IRES sequence ensures co-expression of genes before and after the IRES, though the sequence following the IRES may be transcribed and translated at lower levels than the sequence preceding the IRES sequence.

    [0163] 2A peptides are small self-cleaving peptides (18-22 amino acids) derived from viruses such as foot-and-mouth disease virus (F2A), porcine teschovirus-1 (P2A), Thoseaasigna virus (T2A), or equine rhinitis A virus (E2A). The 2A designation refers specifically to a region of picornavirus polvproteins that lead to a ribosomal skip at the glycyl-prolyl bond in the C-terminus of the 2A peptide (Kim, J. H. et al., 2011. PLoS One 6(4): e18556; the contents of which are herein incorporated by reference in its entirety). This skip results in a cleavage between the 2A peptide and its immediate downstream peptide. As opposed to IRES linkers, 2A peptides generate stoichiometric expression of proteins flanking the 2A peptide and their shorter length can be advantageous in generating viral expression vectors.

    [0164] Some payload regions encode linkers comprising furin cleavage sites. Furin is a calcium dependent serine endoprotease that cleaves proteins just downstream of a, basic amino acid target sequence (AxgX-(Arg/Lys)Arg) (Thomas. G., 2002. Nature Reviews Molecular Ceil Biology 3(10): 753-66; the contents of which are herein incorporated by reference in its entirety). Furin is enriched in the trans-golgi network where it is involved in processing cellular precursor proteins. Furin also plays a role in activating a number of pathogens. Tins activity can be taken advantage of for expression of polypeptides of the invention.

    [0165] In some embodiments, the payload region may encode one or more linkers comprising cathepsin, matrix metalloproteinases or legumain cleavage sites. Such linkers are described e.g. by Cizeau and Macdonald in International Publication No. WO2008052322, the contents of which are herein incorporated in their entirety. Cathepsins are a family of proteases with unique mechanisms to cleave specific proteins. Cathepsin B is a cysteine protease and cathepsin D is an aspartyl protease. Matrix metalloproteinases are a family of calcium-dependent and zinc-containing endopeptidases. Legumain is an enzyme catalyzing the hydrolysis of (-Asn-Xaa-) bonds of proteins and small molecule substrates.

    [0166] In some embodiments, payload regions may encode linkers that are not cleaved. Such linkers may include a simple amino acid sequence, such as a glycine rich sequence. In some cases, linkers may comprise flexible peptide linkers comprising glycine and serine residues. The linker may comprise flexible peptide linkers of different lengths, e.g. nxG4S, where n=1-10 (SEQ ID NO: 4322) and the length of the encoded linker varies between 5 and 50 amino acids. In a non-limiting example, the linker may be 5G4S (SEQ ID NO: 4321) encoded by SEQ ID NO: 903. These flexible linkers are small and without side chains so they tend not to influence secondary protein structure while providing a flexible linker between antibody segments (George, R.A., et al., 2002. Protein Engineering 15(11): 871-9; Huston, J. S. et al., 1988. PNAS 85:5879-83; and Shan, D. et al. 1999, Journal of Immunology. 162(11):6589-95; the contents of each of which are herein incorporated by reference in their entirety). Furthermore, the polarity of the serine residues improves solubility and prevents aggregation problems.

    [0167] In some embodiments, payload regions of the invention may encode small and unbranched serine-rich peptide linkers, such as those described by Huston et al. in U.S. Pat. No. 5,525,491, the contents of which are herein incorporated in their entirety. Polypeptides encoded by the payload region of the invention, linked by serine-rich linkers, have increased solubility,

    [0168] In some embodiments, payload regions of the invention may encode artificial linkers, such as those described by Whitlow and Filpula in U.S. Pat. No. 5,856,456 and Ladner et al. in U.S. Pat. No. 4,946,778, the contents of each of which are herein incorporated by their entirety.

    Viral Genome Component: Introns

    [0169] In one embodiment, the payload region comprises at least one element to enhance the expression such as one or more introns or portions thereof. Non-limiting examples of introns include, MVM (67-97 bps), F.IX truncated intron 1 (300 bps), -globin SD/immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor/immunoglobin splice acceptor (500 bps), SV40 late splice donor/splice acceptor (19S/16S) (180 bps) and hybrid adenovirus splice donor/IgG splice acceptor (230 bps).

    [0170] In one embodiment, the intron or intron portion may be 100-500 nucleotides in length. The intron may have a length of 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500. The intron may have a length between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400-500.

    Payloads of the Invention

    [0171] The AAV particles of the present disclosure comprise at least one payload region. As used herein, payload or payload region refers to one or more polynucleotides or polynucleotide regions encoded by or within a viral genome or an expression product of such polynucleotide or polynucleotide region, e.g., a transgene, a polynucleotide encoding a polypeptide or multi-polypeptide or a modulatory nucleic acid or regulatory nucleic acid. Payloads of the present invention typically encode polypeptides (e.g., antibodies or antibody-based compositions) or fragments or variants thereof.

    [0172] The payload region may be constructed in such a way as to reflect a region similar to or mirroring the natural organization of an mRNA.

    [0173] The payload region may comprise a combination of coding and non-coding nucleic acid sequences.

    [0174] In some embodiments, the AAV payload region may encode a coding or non-coding RNA.

    [0175] In one embodiment, the AAV particle comprises a viral genome with a payload region comprising nucleic acid sequences encoding more than one polypeptide of interest (e.g., an antibody). In such an embodiment, a viral genome encoding more than one polypeptide may be replicated and packaged into a viral particle. A target cell transduced with a viral particle comprising more than one polypeptide may express each of the polypeptides in a single cell.

    [0176] In one embodiment, as shown in FIG. 1, an AAV particle comprises a viral genome with a payload region comprising a nucleic acid sequence encoding a heavy chain and a light chain of an antibody. The heavy chain and light chain are expressed and assembled to form the antibody which is secreted.

    [0177] In one embodiment, the payload region may comprise the components as shown in FIG. 2. The payload region 110 is located within the viral genome 100. At the 5 and/or the 3 end of the payload region 110 there may be at least one inverted terminal repeat (ITR) 120. Within the payload region, there is a promoter region 130, an intron region 140 and a coding region 150. When the coding region 150 comprises a heavy chain region 151 and light cham region 152 of an antibody, the two chains may be separated by a linker region 155.

    [0178] In one embodiment, the coding region may comprise a heavy and light chain sequence and a linker. As shown in FIG. 3, the payload region may comprise a heavy chain and light chain sequence separated by a linker and/or a cleavage site. In one embodiment, the heavy and light chain sequence is separated by an IRES sequence (1 and 2). In one embodiment, the heavy and light chain sequence is separated by a foot and mouth virus sequence (3 and 4). In one embodiment the heavy and light chain sequence is separated by a foot and mouth virus sequence and a furin cleavage site (5 and 6). In one embodiment, the heavy and light chain sequence is separated by a porcine teschovirus-1 virus sequence (7 and 8). In one embodiment, the heavy and light chain sequence is separated by a porcine teschovirus-1 virus and a furin cleavage site (9 and 10), In one embodiment, the heavy and light chain sequence is separated by a 5G4S sequence (SEQ ID NO; 4321) (II).

    [0179] Where the AAV particle payload region encodes a polypeptide, the polypeptide may be a peptide or protein. A protein encoded by the AAV particle payload region may comprise an antibody, an antibody related composition, a secreted protein, an intracellular protein, an extracellular protein, and/or a membrane protein. The encoded proteins may be structural or functional. In addition to the antibodies or antibody-based composition, proteins encoded by the payload region may include, in combination, certain mammalian proteins involved in immune system regulation. The AAV viral genomes encoding polypeptides described herein may be useful in the fields of human disease, viruses, infections veterinary applications and a variety of in vivo and in vitro settings.

    [0180] In some embodiments, the AAV particles are useful in tire field of medicine for the treatment, prophylaxis, palliation, or amelioration of neurological diseases and/or disorders.

    Antibodies and Antibody-Based Compositions

    [0181] Payioad regions of the AAV particles of the invention may encode polypeptides that form one or more functional antibodies or antibody-based compositions. As used herein, the term antibody is referred to in the broadest sense and specifically covers various embodiments including, but not limited to monoclonal antibodies, polyclonal antibodies, multispeciric antibodies (e.g. bispecific antibodies formed from at least two intact antibodies), and antibody fragments (e.g., diabodies) so long as they exhibit a desired biological activity (e.g., functional). Antibodies are primarily amino-acid based molecules but may also comprise one or more modifications (including, but not limited to the addition of sugar moieties, fluorescent moieties, chemical tags, etc.).

    [0182] As used herein, antibody-based or antibody-derived compositions are monomeric or multi-meric polypeptides which comprise at least one amino-acid region derived from a known or parental antibody sequence and at least one amino acid region derived from a non-antibody sequence, e.g., mammalian protein.

    [0183] Payload regions may encode polypeptides that form or function as any antibody, including antibodies that are known in the art and/or antibodies that are commercially available. The encoded antibodies may be therapeutic, diagnostic, or for research purposes. Further, polypeptides of the invention may include fragments of such antibodies or antibodies that have been developed to comprise one or more of such fragments (e.g., variable domains or complementarity determining regions (CDRs)).

    [0184] In one embodiment, the viral genome of the AAV particles may comprise nucleic acids which have been engineered to enable expression of antibodies, antibody fragments, or components of any of those described, in U.S. Pat. No. 7,041,807 related, to YYX epitope; US20090175884, US20110305630, US20130330275 related to misfolded proteins in cancer; US20040175775related to PrP in eye fluid; US20030114360 related to copolymers and methods of treating prion-related diseases; WO2009121176 related to insulin-induced gene peptide compositions; US20030022243, WO2003000853 related to protein aggregation assays; WO200078344 related to prion protein peptides and uses thereof. Each of these publications are incorporated by reference in their entireties.

    Antibody Generation

    [0185] In some embodiments, viral genomes of the AAV particles of the invention may encode antibodies or antibody-based compositions produced using methods known in the art. Such methods may include, but are not limited to immunization and display technologies (e.g., phage display, yeast display, and ribosomal display). Antibodies may be developed, for example, using any naturally occurring or synthetic antigen. As used herein, an antigen is an entity which induces or evokes an immune response in an organism. An immune response is characterized by the reaction of the cells, tissues and/or organs of an organism to the presence of a foreign entity. Such an immune response typically leads to the production by the organism of one or more antibodies against the foreign entity, e.g., antigen or a portion of the antigen. As used herein, antigens also refer to binding partners for specific antibodies or binding agents in a display library.

    [0186] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be derived from antibodies produced using hybridoma technology. Host animals (e.g. mice, rabbits, goats, and llamas) may be immunized by an injection with an antigenic protein to elicit lymphocytes that specifically bind to the antigen. Lymphocytes may be collected and fused with immortalized cell lines to generate hybridomas which can be cultured in a suitable culture medium to promote growth. The antibodies produced by the cultured hybridomas may be subjected to analysis to determine binding specificity of the antibodies for the target antigen. Once antibodies with desirable characteristics are identified, corresponding hybridomas may be subcloned through limiting dilution procedures and grown by standard methods. The antibodies produced by these cells may be isolated and purified using standard immunoglobulin purification procedures.

    [0187] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be produced using heavy and light chain variable region cDNA sequences selected from hybridomas or from other sources. Sequences encoding antibody variable domains expressed by hybridomas may be determined by extracting RNA molecules from antibody-producing hybridoma cells and producing cDNA by reverse transcriptase polymerase chain reaction (PCR). PGR may be used to amplify cDNA using primers specific for heavy and light chain sequences. PCR products may then be subcloned into plasmids for sequence analysis. Antibodies may be produced by insertion of resulting variable domain sequences into expression vectors.

    [0188] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be generated using display technologies. Display technologies used to generate polypeptides of the invention may include any of the display techniques (e.g. display library screening techniques) disclosed in International Patent Application No. WO2014074532, the contents of which are herein incorporated by reference in their entirety. In some embodiments, synthetic antibodies may be designed, selected, or optimized by screening target antigens using display technologies (e.g. phage display technologies). Phage display libraries may comprise millions to billions of phage particles, each expressing unique antibody fragments on their viral coats. Such libraries may provide richly diverse resources that may be used to select potentially hundreds of antibody fragments with diverse levels of affinity for one or more antigens of interest (McCafferty, et al., 1990. Nature. 348:552-4, Edwards, B. M. et al., 2003. JMB. 334:103-18, Schofield, D. et al., 2007. Genome Biol. 8, R254 and Persbad, K. et al., 2010. Protein Engineering Design and Selection. 23:279-88; the contents of each of which are herein incorporated by reference in their entirety). Often, the antibody fragments present in such libraries comprise scFv antibody fragments, comprising a fusion protein of V.sub.K and V.sub.L antibody domains joined by a flexible linker. In some cases, scFvs may contain the same sequence with the exception of unique sequences encoding variable loops of the CDRs. In some cases, scFvs are expressed as fusion proteins, linked to viral coat proteins (e.g. the N-terminus of the viral pIII coat protein). V.sub.L chains may be expressed separately for assembly with V.sub.H chains in the periplasm prior to complex incorporation into viral coats. Precipitated library members may be sequenced from the bound phage to obtain cDNA encoding desired scFvs. Antibody variable domains or CDRs from such sequences may be directly incorporated into antibody sequences for recombinant antibody production, or mutated and utilized for further optimization through m vitro affinity maturation.

    [0189] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be produced using yeast surface display technology, wherein antibody variable domain sequences may be expressed on the cell surface of Saccharomyces cerevisiae. Recombinant antibodies may be developed by displaying the antibody fragment of interest as a fusion to e.g. Aga2p protein on the surface of the yeast, where the protein interacts with proteins and small molecules in a solution. scFvs with affinity toward desired receptors may-be isolated from the yeast surface using magnetic separation and flow cytometry. Several cycles of yeast surface display and isolation may be done to attain scFvs with desired properties through directed evolution.

    [0190] In one embodiment, the sequence of the polypeptides to be encoded in the viral genomes of the invention (e.g., antibodies) may be designed by VERSITOPE Antibody Generation and other methods used by BIOATLA and described in United States Patent Publication No. US20130281303, the contents of which are herein incorporated by reference in their entirety. In brief, recombinant monoclonal antibodies are derived from B-cells of a host immuno-challenged with one or more target antigens. These methods of antibody generation do not rely on immortalized cell lines, such as hybridorma, thereby avoiding some of the associated challenges i.e., genetic instability and low production capacity, producing high affinity and high diversity recombinant monoclonal antibodies. In one embodiment, the method is a natural diversity approach. In another embodiment, the method is a high diversity approach.

    [0191] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be generated using the BIOATLA natural diversity approach. In the natural diversity approach of generating recombinant monoclonal antibodies described in United States Patent Publication No. US20130281303, the original pairings of variable heavy (V.sub.H) and variable light (V.sub.L) domains are retained from the host, yielding recombinant monoclonal antibodies that are naturally paired. These may be advantageous due to a higher likelihood of functionality as compared to non-natural pairings of V.sub.H and V.sub.L. To produce the recombinant monoclonal antibodies, first a non-human host (i.e., rabbit, mouse, hamster, guinea pig, camel or goat) is immuno-challenged with an antigen of interest. In some embodiments, the host may be a previously challenged human patient. In other embodiments, the host may not have been immuno-challenged. B-cells are harvested from the host and screened by fluorescence activated cell sorting (FACS), or other method, to create a library of B-cells enriched in B-cells capable of binding the target antigen. The cDNA obtained, from the mRNA of a single B-cell is then amplified to generate an immunoglobulin library of V.sub.H and V.sub.L domains. This library of immunoglobulins is then cloned into expression vectors capable of expressing the V.sub.H and V.sub.L domains, wherein the V.sub.H and V.sub.L domains remain naturally paired. The library of expression vectors is then used in an expression system to express the V.sub.H and V.sub.L domains in order to create an antibody library. Screening of the antibody library yields antibodies able to bind the target antigen, and these antibodies can be further characterized. Characterization may include one or more of the following: isoelectric point, thermal stability, sedimentation rate, folding rate, neutralization or antigen activity, antagonist or agonistic activity, expression level, specific and non-specific binding, inhibition of enzymatic activity, rigidity/flexibility, shape, charge, stability across pH, in solvents, under UV radiation, in mechanical stress conditions, or in sonic conditions, half-life, and giycosylation.

    [0192] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be generated using the BIOATLA high diversity approach. In the high diversity approach of generating recombinant monoclonal antibodies described in United States Patent Publication No. US20130281303, additional pairings of variable heavy (V.sub.H) and variable light (V.sub.L) domains are attained. To produce the recombinant monoclonal antibodies, B-cells harvested from the host are screened by fluorescence activated cell sorting (FACS), panning, or other method, to create a library of B-cells enriched in B-cells capable of binding the target antigen. The cDNA obtained from the mRNA of the pooled B-cells is then amplified to generate an immunoglobulin library of V.sub.H and V.sub.L domains. This library of immunoglobulins is then used in a biological display system (mammalian, yeast or bacterial cell surface display systems) to generate a population of cells displaying antibodies, fragments or derivatives comprising the V.sub.H and V.sub.L domains wherein, the antibodies, fragments or derivatives comprise V.sub.H and V.sub.L domain combinations that were not present in the B-cells in vivo. Screening of the cell population by FACS, with the target antigen, yields a subset of cells capable of binding the target antigen and the antibodies displayed on these cells can be further characterized. In an alternate embodiment of the high diversity approach, the immunoglobulin library comprises only V.sub.H domains obtained from the B-cells of the immuno-challenged host, while the V.sub.L domain(s) are obtained from another source.

    [0193] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be evolved using BIOATLA comprehensive approaches. The methods of generating recombinant monoclonal antibodies as described in United States Patent Publication No. US20130281303, further comprises evolving the recombinant antibody by comprehensive positional evolution (CPE). CPE followed by comprehensive protein synthesis (CPS), PGR shuffling, or other method.

    [0194] In one embodiment, the sequence of the polypeptides to be encoded in the viral genomes of the invention (e.g., antibodies) may be derived from any of the BIOATLA protein evolution methods described in International Publication WO2012009026, the contents of which are herein incorporated by reference in their entirety. In this method, mutations are systematically performed throughout the polypeptide or molecule of interest, a map is created providing useful informatics to guide the subsequent evolutionary steps. Not wishing to be bound by theory, these evolutionary methods typically start with a template polypeptide and a mutant is derived therefrom, which has desirable properties or characteristics. Non-limiting examples of evolutionary techniques include polymerase chain reaction (PCR), error prone PCR, oligonucleotide-directed mutagenesis, cassette mutagenesis, shuffling, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis, in vitro mutagenesis, ligase chain reaction, oligonucleotide synthesis or any combination thereof.

    [0195] In one embodiment, the BIOATLA evolution method is Comprehensive Positional Evolution (CPE). In CPE, naturally occurring amino acid variants are generated for each of the codons of the template polypeptide, wherein 63 different codon options exist for each amino acid variant. A set of polypeptides with single amino acid mutations are generated and the mutations are then confirmed by sequencing or other method known in the art and each amino acid change screened for improved function, neutral mutations, inhibitory mutations, expression, and compatibility with the host system. An EvoMap is created that describes in detail the effects of each amino acid mutation on the properties and characteristics of that polypeptide. The data from the EvoMap may be utilized to produce polypeptides with more than one amino acid mutation, wherein the resultant multi-site mutant polypeptides can be screened for desirable characteristics.

    [0196] In one embodiment, the BIOATLA evolution method is Synergy Evolution, wherein an EvoMap is used to identify amino acid positions to introduce 2-20 mutations simultaneously to produce a combinatorial effect. The resulting multi-site mutant polypeptides may be screened on one or more pre-determined characteristics to identify uprautants wherein the function of the mutant is improved as compared to the parent polypeptide. In one embodiment, Synergy Evolution is used to enhance binding affinity of an antibody.

    [0197] In one embodiment, the BIOATLA evolution method is Flex Evolution, wherein an EvoMap is used to identify fully mutable sites within a polypeptide that may then be targeted, for alteration, such as introduction of glycosylation sites or chemical conjugation.

    [0198] In one embodiment, the BIOATLA) evolution method is Comprehensive Positional Insertion Evolution (CPI), wherein an amino acid is inserted after each amino acid of a template polypeptide to generate a set of lengthened polypeptides. CPI may be used to insert 1, 2, 3, 4, or 5 amino acids at each new position. The resultant lengthened polypeptides are sequenced and assayed for one or more pre-determined properties find evaluated in comparison to its template or parent molecule. In one embodiment, the binding affinity and immunogenicity of the resultant polypeptides are assayed. In one embodiment, the lengthened polypeptides are further mutated and mapped to identity polypeptides with desirable characteristics.

    [0199] In one embodiment, the BIOATLA evolution approach is Comprehensive Positional Deletion Evolution (CPD), wherein each amino acid of the template polypeptide is individually and systematically deleted one at a time. The resultant shortened polypeptides are then sequenced and evaluated by assay for at least one pre-determined feature. In one embodiment, the shortened polypeptides are further mutated and mapped, to identify polypeptides with desirable characteristics.

    [0200] In one embodiment, the BIOATLA evolution approach is Combinatorial Protein Synthesis (CPS), wherein mutants identified in CPE, CPI, CPD, or other evolutionary techniques are combined for polypeptide synthesis. These combined mutant polypeptides are then screened for enhanced properties and characteristics. In one embodiment CPS is combined with any of the aforementioned evolutionary or polypeptide synthesis methods.

    [0201] In one embodiment, the sequence of the polypeptides to be encoded in the viral genomes of the invention (e.g., antibodies) may be derived from the BIOATLA Comprehensive Integrated Antibody Optimization (CIAO!) described in U.S. Pat. No. 8,859,467, the contents of which are herein incorporated by reference in their entirety. The CIAO! method allows for simultaneous evolution of polypeptide performance and expression optimization, within a eukaryotic cell host (i.e., mammalian or yeast cell host). First, an antibody library is generated in a mammalian cell production host by antibody cell surface display, wherein the generated antibody library targets a particular antigen of interest. The antibody library is then screened by any method known in the art, for one or more properties or characteristics. One or more antibodies of the library, with desirable properties or characteristics are chosen for further polypeptide evolution by any of the methods known in the art, to produce a library of mutant antibodies by antibody cell surface display in a mammalian cell production host. The generated mutant antibodies are screened for one or more predetermined properties or characteristics, whereby an upmutant is selected, wherein the upmutant has enhanced or improved characteristics as compared to the parent template polypeptide.

    [0202] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be humanized by the methods of BIOATLA as described in United States Patent Publication US20130303 399, the contents of which are herein incorporated by reference in their entirety. In this method, for generating enhanced full length humanized antibodies in mammalian cells, no back-mutations are required to retain affinity to the antigen and no CDR grafting or phage-display is necessary. The generated humanized antibody has reduced immunogencity and equal or greater affinity for the target antigen as compared to the parent antibody. The variable regions or CDRs of the generated humanized antibody are derived from the parent or template, whereas the framework and constant regions are derived from one or more human antibodies. To start, the parent, or template antibody is selected, cloned and each CDR sequence identified and synthesized into a CDR fragment library. Double stranded DNA fragment libraries for V.sub.H and V.sub.L are synthesized from the CDR fragment encoding libraries, wherein at least one CDR fragment library is derived from the template antibody and framework (FW) fragment encoding libraries, wherein the FW fragment library is derived from a pool of human frameworks obtained from natively expressed and functional human antibodies. Stepwise liquid phase ligation of FW and CDR encoding fragments is then used to generate both V.sub.H and V.sub.L fragment libraries. The V.sub.H and V.sub.L fragment libraries are then cloned into expression vectors to create a humanization library, which is further transfected into cells for expression of full length humanized antibodies, and used to create a humanized antibody library. The humanized antibody library is then screened to determine expression level of the humanized antibodies, affinity or binding ability for the antigen, and additional improved or enhanced characteristics, as compared to the template or parent antibody. Non-limiting examples of characteristics that may be screened include equilibrium dissociation constant (K.sub.D), stability, melting temperature (T.sub.m), pI, solubility, expression level, reduced immunogemcity, and improved effector function.

    [0203] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be generated by the BIOATLA method for preparing conditionally active antibodies as described in International Publications WO2016033331 and WO2016036916, the contents of which are herein incorporated by reference in their entirety. As used herein, the term conditionally active refers to a molecule that is active at an aberrant condition. Further, the conditionally active molecule may be virtually inactive at normal physiological conditions. Aberrant conditions may result from changes in pH, temperature, osmotic pressure, osmolality, oxidative stress, electrolyte concentration, and/or chemical or proteolytic resistance, as non-limiting examples.

    [0204] The method of preparing a conditionally active antibody is described in International Publications WO2016033331 and WO2016036916 and summarized herein. Briefly, a wild-type polypeptide is selected and the DNA is evolved to create mutant DNAs. Non-limiting examples of evolutionary techniques that may be used to evolve the DNA include polymerase chain reaction (PCR), error prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PGR, sexual PCR mutagenesis, in vivo mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis, in vitro mutagenesis, ligase chain reaction, oligonucleotide synthesis or any combination thereof. Once mutant DNAs are created, they are expressed in a eukaryotic cell production host (i.e., fungal, insect, mammalian, adenoviral, plant), wherein a mutant polypeptide is produced. The mutant polypeptide and the corresponding wild-type polypeptide are then subjected to assays under both normal physiological conditions and aberrant conditions in order to identify mutants that exhibit a decrease in activity in the assay at normal physiological conditions as compared to the wild-type polypeptide and/or an increase in activity in the assay under aberrant conditions, as compared to the corresponding wild-type polypeptide. The desired conditionally active mutant may then be produced in the aforementioned eukaryotic cell production host.

    [0205] In one embodiment, the conditionally active antibody is a mirac protein as described by BIOATLA in U.S. Pat. No. 8,709,755, the contents of which are herein incorporated by reference in their entirety. As used herein mirac protein refers to a conditionally active antibody that is virtually inactive at body temperature but active at lower temperatures.

    [0206] In one embodiment, the sequence of the polypeptides to be encoded in the viral genomes of the invention (e.g., antibodies) may be derived based on any of the BIOATLA methods including, but not limited to, VERSITOPE Antibody Generation, natural diversity approaches, and high diversity approaches for generating monoclonal antibodies, methods for generation of conditionally active polypeptides, humanized antibodies, mirac proteins, multi-specific antibodies or cross-species active mutant polypeptides, Comprehensive Integrated Antibody Optimization (CIAO!), Comprehensive Positional Evolution (CPE), Synergy Evolution, Flex Evolution, Comprehensive Positional Insertion Evolution (CPI). Comprehensive Positional Deletion Evolution (CPD), Combinatorial Protein Synthesis (CPS), or any combination thereof. These methods are described in U.S. Pat. Nos. 8,859,467 and 8,709,755 and United States Publication Nos. US20130281303, US20130303399, US20150065690, US20150252119, US20150086562 and US20100138945, and International Publication Nos. WO2015105888, WO2012009026, WO2011109726, WO2016036916, and WO2016033331, the contents of each of which are herein incorporated by reference in their entirety.

    [0207] In one embodiment, antibodies of the present invention are generated by any of the aforementioned means to target one or more of the following epitopes of the tau protein; phosphorylated tau peptides, pS396, pS396-pS404, pS404, pS396-pS404-pS422, pS422, pS199, pS 199-pS202, pS202, pT181, pT231, cis-pT231, any of the following acetylated sites acK174, acK274, acK280, acK281 and/or any combination thereof.

    Antibody Fragments and Variants

    [0208] In some embodiments, antibody fragments encoded by payloads of the invention comprise antigen binding regions from, intact antibodies. Examples of antibody fragments may include, but are not limited to Fab, Fab, F(ab).sub.2, and Fv fragments; diabodies, linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antigen-binding fragments, called Fab fragments, each with a single antigen-binding site. Also produced is a residual Fc fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab).sub.2 fragment that has two antigen-binding sites and is still capable of cross-linking antigen. Compounds and/or compositions of the present invention may comprise one or more of these fragments. For the purposes herein, an antibody may comprise a heavy and light variable domain as well as an Fc region.

    [0209] In one embodiment, the Fc region may be a modified Fc region, as described in US Patent Publication US20150065690, wherein the Fc region may have a single amino acid substitution as compared to the corresponding sequence for the wild-type Fc region, wherein the single amino acid substitution yields an Fc region with preferred properties to those of the wild-type Fc region, Non-limiting examples of Fc properties that may be altered by the single amino acid substitution include bind properties or response to pH conditions.

    [0210] As used herein, the term native antibody refers to an usually heterotetrameric glycoprotein of about 150,000 Daitons, composed of two identical light (L) chains and two identical heavy (H) chains. Genes encoding antibody heavy and light chains are known and segments making up each have been well characterized and described (Matsuda, F. et al., 1998. The Journal of Experimental Medicine. 188(11); 2151-62 and Li, A. et al, 2004. Blood. 103(12:4602-9, the content of each of which are herein incorporated by reference in their entirety). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (V.sub.H) followed by a number of constant domains. Each light chain has a variable domain at one end (V.sub.L) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.

    [0211] As used herein, the term variable domain refers to specific antibody domains found on both the antibody heavy and light chains that differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. Variable domains comprise hypervariable regions. As used herein, the term hypervariable region refers to a region within a variable domain comprising amino acid residues responsible for antigen binding. The amino acids present within the hypervariable regions determine the structure of the complementarity determining regions (CDRs) that become part of the antigen-binding site of the antibody. As used herein, the term CDR refers to a region of an antibody comprising a structure that is complimentary to its target antigen or epitope. Other portions of the variable domain, not interacting with the antigen, are referred to as framework (FW) regions. The antigen-binding site (also known as the antigen combining site or paratope) comprises the amino acid residues necessary to interact with a particular antigen. The exact residues making up the antigen-binding site are typically elucidated by co-crystallography with bound antigen, however computational assessments can also be used based on comparisons with other antibodies (Strohl, W. R. Therapeutic Antibody Engineering, Woodhead Publishing. Philadelphia, Pa. 2012. Ch. 3. p47-54, the contents of which are herein incorporated by reference in their entirety). Determining residues making up CDRs may include the use of numbering schemes including, but not limited to, those taught by Kabat [Wu, T. T. et al., 1970, JEM, 132(2):211-50 and Johnson, G. et al., 2000, Nucleic Acids Res. 28(1): 214-8, the contents of each of which are herein incorporated by reference in their entirety], Chothia [Chothia and Lesk, J. Mol. Biol. 196, 901 (1987). Chothia et al., Nature 342, 877 (1989) and Al-Lazikam, B. et al., 1997, J. Mol. Biol. 273(4):927-48, the contents of each of which are herein incorporated by reference in their entirety], Lefranc (Lefranc. M. P. et al., 2005, Imniunome Res. 1:3) and Honegger (Honegger, A. and Pluckthun, A. 2001, J. Mol. Biol. 309(3):657-70, the contents of which are herein incorporated by reference in their entirety).

    [0212] V.sub.H and V.sub.L domains have three CDRs each. V.sub.L CDRs are referred to herein as CDR-L1, CDR-L2 and CDR-L3, in order of occurrence when moving from N- to C-terminus along the variable domain polypeptide. V.sub.H CDRs are referred to herein as CDR-H1, CDR-H2, and CDR-H3, in order of occurrence when moving from N- to C-terminus along the variable domain polypeptide. Each of CDRs have favored canonical structures with the exception of the CDR-H3, which comprises amino acid sequences that may be highly variable in sequence and length between antibodies resulting in a variety of three-dimensional structures in antigen-binding domains (Nikoloudis, D. et al., 2014. Peer J. 2:e456; the contents of which are herein incorporated by reference in their entirety). In some cases, CDR-H3s may be analyzed among a panel of related antibodies to assess antibody diversity. Various methods of determining CDR sequences are known in the art and may be applied to known antibody sequences (Strohl, W. R. Therapeutic Antibody Engineering, Woodhead Publishing, Philadelphia, Pa. 2012. Ch. 3, p47-54, the contents of which are herein incorporated by reference in their entirety).

    [0213] As used herein, the term Fv refers to an antibody fragment comprising the minimum fragment on an antibody needed to form a complete antigen-binding site. These regions consist of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent association. Fv fragments can be generated by proteolytic cleavage, but are largely unstable. Recombinant methods are known in the art for generating stable Fv fragments, typically through insertion of a flexible linker between the light chain variable domain and the heavy chain variable domain [to form a single chain Fv (scFv)] or through the introduction of a disulfide bridge between heavy and light drain variable domains (Strohl, W. R. Therapeutic Antibody Engineering, Woodhead Publishing, Philadelphia, Pa. 2012. Ch. 3, p46-47, the contents of which, are herein incorporated by reference in their entirety).

    [0214] As used herein, the term light chain refers to a component of an antibody from any vertebrate species assigned to one of two clearly distinct types, called kappa and lambda based on amino acid sequences of constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, antibodies can be assigned to different classes. There are five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2.

    [0215] As used herein, the term single chain Fv or scFv refers to a fusion protein of V.sub.H and V.sub.L antibody domains, wherein these domains are linked together into a single polypeptide chain by a flexible peptide linker. In some embodiments, the Fv polypeptide linker enables the scFv to form the desired structure for antigen binding. In some embodiments, scFvs are utilized in conjunction with phage display, yeast display or other display methods where they may be expressed in association with a surface member (e.g. phage coat protein) and used in the identification of high affinity peptides for a given antigen.

    [0216] As used herein, the term bispeciflc antibody refers to an antibody capable of binding two different antigens. Such antibodies typically comprise regions from at least two different antibodies. Bispeciflc antibodies may include any of those described in Riethmuller, G. 2012, Cancer Immunity. 12:12-18, Marvin, J. S. et al., 2005. Acta Pharmacologica Sinica. 26(6):649-58 and Schaefer, W. et al., 2011. PNAS. 108(27):11187-92, the contents of each of which are herein incorporated by reference in their entirety.

    [0217] As used herein, the term diabody refers to a small antibody fragment with two antigen-binding sites. Diabodies comprise a heavy chain variable domain V.sub.H connected to a light chain variable domain V.sub.L in the same polypeptide chain. By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies are described more fully in, for example, EP 404097; WO 9311161; and Hollinger et al. (Hoilinger, P. et al., Diabodies: Small bivalent and bispeciflc antibody fragments. PNAS. 1993. 90:6444-8) the contents of each of which are incorporated herein by reference in their entirety.

    [0218] The term intrabody refers to a form of antibody that is not secreted from, a cell in which it is produced, but instead targets one or more intracellular proteins. Intrabodies may be used to affect a multitude of cellular processes including, but not limited to intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling, and cell division. In some embodiments, methods of the present invention may include intrabody-based therapies. In some such embodiments, variable domain sequences and/or CDR sequences disclosed herein may be incorporated into one or more constructs for intrabody-based therapy.

    [0219] As used herein, the term monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous cells (or clones), i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variants that may arise during production of the monoclonal antibodies, such variants generally being present in minor amounts. In contrast to polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.

    [0220] The modifier monoclonal indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. The monoclonal antibodies herein include chimeric antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies.

    [0221] As used herein, the term humanized antibody refers to a chimeric antibody comprising a minimal portion from one or more non-human (e.g., murine) antibody source(s) with the remainder derived from one or more human immunoglobulin sources. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from the hypervariable region from an antibody of the recipient are replaced by residues from the hypervariable region from an antibody of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and/or capacity.

    [0222] In some embodiments, viral genomes of the present invention may encode antibody mimetics. As used herein, the term antibody mimetic refers to any molecule which mimics the function or effect of an antibody and which binds specifically and with high affinity to their molecular targets. In some embodiments, antibody mimetics may be monobodies, designed to incorporate the fibronectin type III domain (Fn3) as a protein scaffold (U.S. Pat. No. 6,673,901; U.S. Pat. No. 6,348,584). In some embodiments, antibody mimetics may be those known in the art including, but are not limited to affibody molecules, affilins, affitins, anticalms, avimers, Centyrins, DARPINS, fynomers, Kunitz domains, and domain peptides. In other embodiments, antibody mimetics may include one or more non-peptide regions.

    [0223] As used herein, the term antibody variant refers to a modified antibody (in relation to a native or starting antibody) or a biomolecule resembling a native or starting antibody in structure and/or function (e.g., an antibody mimetic). Antibody variants may be altered in their amino acid sequence, composition, or structure as compared to a native antibody. Antibody variants may include, but are not limited to, antibodies with altered isotypes (e.g., IgA, IgD, IgE, IgG1, IgG2, IgG3, IgG4, or IgM), humanized variants, optimized variants, muitispecific antibody variants (e.g., bispecific variants), and antibody fragments.

    [0224] The preparation of antibodies, whether monoclonal or polyclonal, is known in the art. Techniques for the production of antibodies are well known in the art and described, e.g. in Harlow and Lane Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1988; Harlow and Lane Using Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, 1999 and Therapeutic Antibody Engineering: Current and Future Advances Driving the Strongest Growth Area in the Pharmaceutical Industry Woodhead Publishing, 2012.

    Multispecific Antibodies

    [0225] In some embodiments, payloads of the invention may encode antibodies that bind more than one epitope. As used herein, the terms multibody or muitispecific antibody refer to an antibody wherein two or more variable regions bind to different epitopes. The epitopes may be on the same or different targets. In certain embodiments, a multi-specific antibody is a bispecific antibody, which recognizes two different epitopes on the same or different antigens.

    [0226] In one embodiment, multi-specific antibodies may be prepared by the methods used by BIOATLA and described in International Patent publication WO201109726, the contents of which are herein incorporated by reference in their entirety. First a library of homologous, naturally occurring antibodies is generated by any method known in the art (i.e., mammalian cell surface display), then screened by FACS Aria or another screening method, for multi-specific antibodies that specifically bind to two or more target antigens. In one embodiment, the identified multi-specific antibodies are further evolved by any method known in the art, to produce a set of modified multi-specific antibodies. These modified multi-specific antibodies are screened for binding to the target antigens. In one embodiment, the multi-specific antibody may be further optimized by screening the evolved modified multi-specific antibodies for optimized or desired characteristics.

    [0227] In one embodiment, multi-specific antibodies may be prepared by the methods used by BIOATLA and described in United States Publication No. US20150252119, the contents of which are herein incorporated by reference in their entirely. In one approach, the variable domains of two parent antibodies, wherein the parent antibodies are monoclonal antibodies are evolved using any method known in the art in a manner that allows a single light chain to functionally complement heavy chains of two different parent antibodies. Another approach requires evolving the heavy chain of a single parent antibody to recognize a second target antigen. A third approach involves evolving the light chain of a parent antibody so as to recognize a second target antigen. Methods for polypeptide evolution are described in International Publication WO2012009026, the contents of which are herein incorporated by reference in their entirety, and include as non-limiting examples, Comprehensive Positional Evolution (CPE), Combinatorial Protein Synthesis (CPS), Comprehensive Positional Insertion (CPI), Comprehensive Positional Deletion (CPD), or any combination thereof. The Fc region of the multi-specific antibodies described in United States Publication No. US20150252119 may be created using a knob-in-hole approach, or any other method that allows the Fc domain to form heterodimers. The resultant multi-specific antibodies may be further evolved for improved characteristics or properties such as binding affinity for the target antigen.

    Bispeciflc Antibodies

    [0228] In some embodiments, payloads of the invention may encode bispecific antibodies. Bispeciflc antibodies are capable of binding two different antigens. Such antibodies typically comprise antigen-binding regions from at least two different antibodies. For example, a bispecific monoclonal antibody (BsMAb, BsAb) is an artificial protein composed of fragments of two different monoclonal antibodies, thus allowing the BsAb to bind to two different types of antigen.

    [0229] In some cases, payloads encode bispecific antibodies comprising antigen-binding regions from two different anti-tau antibodies. For example, such bispecific antibodies may comprise binding regions from two different antibodies selected from Table 3.

    [0230] Bispecific antibody frameworks may include any of those described in Riethmuller, G., 2012. Cancer Immunity. 12:12-18; Marvin, J. S. et al., 2005. Acta Pharmacologica Sinica. 26(6):649-58; and Schaefer, W. et al., 2011. PNAS. 108(27);11187-92, the contents of each of which are herein incorporated by reference in their entirety.

    [0231] New generations of BsMAb, called trifunctional bispecific antibodies, have been developed. These consis t of two heavy and two light chains, one each from two different antibodies, where the two Fab regions (the arms) are directed against two antigens, and the Fc region (the foot) comprises the two heavy chains and forms the third binding site.

    [0232] Of the two paratopes that form the tops of the variable domains of a bispecific antibody, one can be directed against a target antigen and the other against a T-lymphocyie antigen like CD3. In the case of trifunctional antibodies, the Fc region may additionally bind to a cell that expresses Fc receptors, like a macrophage, a natural killer (NK) cell or a dendritic cell. In sum, the targeted cell is connected to one or two cells of the immune system, which subsequently destroy it.

    [0233] Other types of bispecific antibodies have been designed to overcome certain problems, such as short half-life, immunogenicity and side-effects caused by cytokine liberation. They include chemically linked Fabs, consisting only of the Fab regions, and vanous types of bivalent and trivalent single-chain variable fragments (scFvs), fusion proteins mimicking the variable domains of two antibodies. The furthest developed of these newer formats are the bi-specific T-cell engagers (BiTEs) and mAb2's, antibodies engineered to contain an Fcab antigen-binding fragment instead of the Fc constant region.

    [0234] Using molecular genetics, two scFvs can be engineered in tandem into a single polypeptide, separated by a linker domain, called a tandem scFv (tascFv). TascFvs have been found to be poorly soluble and require refolding when produced in bacteria, or they may be manufactured in mammalian cell culture systems, which avoids refolding requirements but may result in poor yields. Construction of a tascFv with genes for two different scFvs yields a bispecific single-chain variable fragments (bis-scFvs). Only two tascFvs have been developed clinically by commercial firms; both are bispecific agents in active early phase development by Micromet for oncologic indications, and are described as Bispecific T-cell Engagers (BiTE). Blinatumoniab is an anti-CD 19/anti-CD3 bispecific tascFv that potentiates T-cell responses to B-cell non-Hodgkin lymphoma in Phase 2. MT110 is an anti-EP-CAM/anti-CD3 bispecific tascFv that potentiates T-cell responses to solid tumors in Phase 1, Bispecific, tetravalent TandAbs are also being researched by Affimed (Nelson, A. L., MAbs.2010. Jan-Feb: 2(1);77-83).

    [0235] In some embodiments, pay loads may encode antibodies comprising a single antigen-binding domain. These molecules are extremely small, with molecular weights approximately one-tenth of those observed for full-sized mAbs. Further antibodies may include nanobodies derived from the antigen-binding variable heavy chain regions (V.sub.HHS) of heavy chain antibodies found in camels and llamas, which lack light chains (Nelson, A. L, MAbs.2010. Jan-Feb; 2(1):77-83).

    [0236] Disclosed and claimed in PCT Publication WO2014144573 to Memorial Sioan-Kettering Cancer Center are multimerization technologies for making dimeric multispecific binding agents (e.g., fusion proteins comprising antibody components) with improved properties over multispecific binding agents without the capability of dimerization.

    [0237] In some cases, payloads of the invention may encode tetravalent bispecific antibodies (TetBiAbs as disclosed and claimed in PCT Publication WO2014144357). TetBiAbs feature a second pair of Fab fragments with a. second antigen specificity attached to the C-terminus of an antibody, thus providing a molecule that is bivalent for each of the two antigen specificities. The tetravalent antibody is produced by genetic engineering methods, by linking an antibody heavy chain covalentiy to a Fab light chain, which associates with its cognate, co-expressed Fab heavy chain.

    [0238] In some aspects, pay loads of the invention may encode biosynthetic antibodies as described in U.S. Pat. No. 5,091,513, the contents of which are herein incorporated by reference in their entirety. Such antibody may include one or more sequences of amino acids constituting a region which behaves as a biosynthetic antibody binding site (BABS). The sites comprise 1) non-covalently associated or disulfide bonded synthetic V.sub.H and V.sub.L dimers, 2) V.sub.H-V.sub.L or V.sub.L-V.sub.H single chains wherein the V.sub.H and V.sub.L are attached by a polypeptide linker, or 3) individuals V.sub.H or V.sub.L domains. The binding domains comprise linked CDR and FR regions, which may be derived from separate immunoglobulins. The biosynthetic antibodies may also include other polypeptide sequences which function, e.g., as an enzyme, toxin, binding site, or site of attachment to an immobilization media or radioactive atom. Methods are disclosed, for producing the biosynthetic antibodies, for designing BABS having any specificity that can be elicited by in vivo generation of antibody, and for producing analogs thereof.

    [0239] In some embodiments, pay loads may encode antibodies with antibody acceptor frameworks taught in U.S. Pat. No. 8,399,625. Such antibody acceptor frameworks may be particularly well suited accepting CDRs from an antibody of interest. In some cases, CDRs from anti-tau antibodies known in the art or developed according to the methods presented herein may be used.

    Miniaturized Antibody

    [0240] In one embodiment, the antibody encoded by the payloads of the invention may be a miniaturized antibody. Among the best examples of mAb miniaturization are the small modular immunopharmaceuticals (SMIPs) from Trubion Pharmaceuticals. These molecules, which can be monovalent or bivalent, are recombinant single-chain molecules containing one V.sub.L, one V.sub.H antigen-binding domain, and one or two constant effector domains, all connected by linker domains. Presumably, such a molecule might offer the advantages of increased tissue or tumor penetration claimed by fragments while retaining the immune effector functions conferred by constant domains. At least three miniaturized SMIPs have entered clinical development. TRU-015, an anti-CD20 SMIP developed in collaboration with Wyeth, is the most advanced project, having progressed to Phase 2 for rheumatoid arthritis (RA). Earlier attempts in systemic lupus erythrematosus (SLE) and B cell lymphomas were ultimately discontinued. Trubion and Facet Biotechnology are collaborating in the development of TRU-016, an anti-CD37 SMTP, for the treatment of CLL and other lymphoid neoplasias, a project that has reached Phase 2. Wyeth has licensed the anti-CD20 SMIP SBI-087 for the treatment of autoimmune diseases, including RA, SLE, and possibly multiple sclerosis, although these projects remain in the earliest stages of clinical testing. (Nelson. A. L., MAbs.2010, Jan-Feb; 2(1 ):77-83).

    Diabodies

    [0241] In some embodiments, payloads of the invention may encode diabodies, Diabodies are functional bispecific single-chain antibodies (bscAb). These bivalent antigen-binding molecules are composed of non-covalent dimers of scFvs, and can be produced in mammalian cells using recombinant methods. (See, e.g., Mack et al, Proc. Natl. Acad. Sci., 92:7021-7025, 1995). Few diabodies have entered clinical development. An iodine-123-labeled. diabody version of the anti-CEA chimeric antibody cT84.66 has been evaluated for pre-surgical imniunosintigraphi.c detection of colorectal cancer in a study sponsored by the Beckman Research Institute of the City of Hope (Clinicaltnals.gov NCT00647153) (Nelson, A. L., MAbs., 2010. Jan-Feb; 2(1):77-83).

    Unibody

    [0242] In some embodiments, payloads may encode a unibody, in which the hinge region has been removed from IgG4 molecules. While IgG4 molecules are unstable and can exchange light-heavy chain heterodimers with one another, deletion of the hinge region prevents heavy chain-heavy chain pairing entirely, leaving highly specific monovalent light/heavy heterodimers, while retaining the Fc region to ensure stability and half-life in vivo. This configuration may minimize the risk of immune activation or oncogenic growth, as IgG4 interacts poorly with FcRs and monovalent unibodies fail to promote intracellular signaling complex formation. These contentions are, however, largely supported by laboratory, rather than clinical, evidence. Other antibodies may be miniaturized antibodies, which are compacted 100 kDa antibodies (see, e.g., Nelson, A. L., MAbs., 2010. Jan-Feb; 2(1):77-83).

    Intrabodies

    [0243] In some embodiments, payloads of the invention may encode intrabodies. Intrabodies are a form of antibody that is not secreted from a cell in which it is produced, but instead targets one or more intracellular proteins, Intrabodies are expressed and function intracellularly. and may be used to affect a multitude of cellular processes including, but not limited to intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling and cell division. In some embodiments, methods described herein include intrabody-based therapies. In some such embodiments, variable domain sequences and/or CDR sequences disclosed herein are incorporated into one or more constructs for intrabody-based therapy. For example, intrabodies may target one or more glycated intracellular proteins or may modulate the interaction between one or more glycated intracellular proteins and. an alternative protein.

    [0244] More than two decades ago, intracellular antibodies against intracellular targets were first described (Biocca, Neuberger and Cattaneo EMBO J. 9: 101-108, 1990). The intracellular expression of intrabodies in different compartments of mammalian cells allows blocking or modulation of the function of endogenous molecules (Biocca, et al., EMBO J. 9: 101-108. 1990, Colby et al., Proc. Natl. Acad. Sci. U.S.A. 1.01: 17616-21, 2004). Intrabodies can alter protein folding, protein-protein, protem-DNA, protein-RNA interactions and protein modification. They can induce a phenotypic knockout and work as neutralizing agents by direct binding to the target antigen, by diverting its intracellular trafficking or by inhibiting its association with binding partners. They have been largely employed as research tools and are emerging as therapeutic molecules for the treatment of human diseases such as viral pathologies, cancer and misfolding diseases. The fast-growing bio-market of recombinant antibodies provides intrabodies with enhanced binding specificity, stability, and solubility, together with lower immunogenicity, for their use in therapy (Biocca. abstract in Antibody Expression and Production Cell Engineering Volume 7, 2011, pp. 179-195).

    [0245] In some embodiments, intrabodies have advantages over interfering RNA (iRNA); for example, iRNA has been shown to exert multiple non-specific effects, whereas intrabodies have been shown to have high specificity and affinity to target antigens. Furthermore, as proteins, intrabodies possess a much longer active half-life than iRNA. Thus, when the active half-life of the intracellular target molecule is long, gene silencing through iRNA may be slow to yield an effect, whereas the effects of intrabody expression can be almost instantaneous. Lastly, it is possible to design intrabodies to block certain binding interactions of a particular target molecule, while sparing others.

    [0246] Intrabodies are often single chain variable fragments (scFvs) expressed from a recombinant nucleic acid molecule and engineered to be retained intracellularly (e.g., retained in the cytoplasm, endoplasmic reticulum, or periplasm). Intrabodies may be used, for example, to ablate the function of a protein to which the intrabody binds. The expression of intrabodies may also be regulated through the use of inducible promoters in the nucleic acid expression vector comprising the intrabody. Intrabodies may be produced for use in the viral genomes of the invention using methods known in the art, such as those disclosed and reviewed in: (Marasco et al., 1993 Proc. Natl. Acad. Sci. USA, 90: 7889-7893; Chen et al., 1994, Hum. Gem Ther. 5:595-601; Chen et al., 1994, Proc. Natl. Acad, Sci. USA, 91: 5932-5936; Maciejewski et al., 1995, Nature Med., 1: 667-673; Marasco, 1995, Immunotech, 1: 1-19; Mhashilkar, et al., 1995, EMBO J. 14: 1542-51, Chen et al., 1996, Hum. Gene Therap., 7: 1515-1525; Marasco. Gene Ther, 4: 11-15, 1997; Rondon and Marasco, 1997, Annu. Rev. Microbiol 51: 257-283; Cohen, et al., 1998, Oncogene 17:2445-56; Proba et al, 1998, J. Mol Biol 275:245-253; Cohen etal, 1998, Oncogene 17:2445-2456; Hassanzadeh, et al., 1998, FEBS Lett. 437:81-6; Richardson et al., 1998, Gene Ther. 5:635-44; Ohage and Steipe, 1999, J. Mol Biol 291:1119-1128; Ohage et al., 1999, J. Mol. Biol. 291:1129-1134; Wirtz and Steipe, 1999, Protein Sci. 8:2245-2250; Zhu et al., 1999, J. Immunol. Methods 231:207-222; Arafat et al., 2000, Cancer Gene Ther. 7:1250-6; der Maur et al., 2002, J. Biol. Chem. 277:45075-85; Mhashilkar et al., 2002, Gene Ther. 9:307-19; and Wheeler et al., 2003, FASEB J. 17: 1733-5; and references cited therein). In particular, a CCR5 intrabody has been produced by Steinberger el al., 2000, Proc. Natl Acad. Sci. USA 97:80-810). See generally Marasco, Wash., 1998, Intrabodies: Basic Research and Clinical Gene Therapy Applications Springer: New York; and for a review of scFvs, see Pluckthun in The Pharmacology of Monoclonal Antibodies, 1994, vol. 113, Rosenburg and Moore eds. Springer-Verlag, N.Y., pp. 269-315.

    [0247] Sequences from donor antibodies may be used to develop intrabodies, Intrabodies are often recombinantly expressed as single domain fragments such as isolated V.sub.H and V.sub.L domains or as a single chain variable fragment (scFv) antibody within the cell. For example, intrabodies are often expressed as a single polypeptide to form a single chain antibody comprising the variable domains of the heavy and light chains joined by a flexible linker polypeptide. Intrabodies typically lack disulfide bonds and are capable of modulating the expression or activity of target genes through their specific binding activity. Single chain antibodies can also be expressed as a single chain variable region fragment joined to the light chain constant region.

    [0248] As is known in the art, an intrabody can be engineered into recombinant polynucleotide vectors to encode sub-cellular trafficking signals at its N or C terminus to allow expression at high concentrations in the sub-cellular compartments where a target protein is located. For example, intrabodies targeted to the endoplasmic reticulum (ER) are engineered to incorporate a leader peptide and, optionally, a C-terminal ER retention signal, such as the KDEL amino acid motif (SEQ ID NO: 4323). Intrabodies intended to exert activity in the nucleus are engineered to include a nuclear localization signal. Lipid moieties are joined to intrabodies in order to tether the intrabody to the cytosolic side of the plasma membrane. Intrabodies can also be targeted to exert function in the cytosol. For example, cytosolic intrabodies are used to sequester factors within the cytosol, thereby preventing them from being transported to their natural cellular destination.

    [0249] There are certain technical challenges with intrabody expression. In particular, protein conformational folding and structural stability of the newly-synthesized intrabody within the cell is affected by reducing conditions of the intracellular environment.

    [0250] Intrabodies of the invention may be promising therapeutic agents for the treatment of misfoldmg diseases, including Tauopathies, prion diseases, Alzheimer's, Parkinson's, and Huntington's, because of their virtually infinite ability to specifically recognize the different conformations of a protein, including pathological isoforms, and because they can be targeted to the potential sites of aggregation (both intra- and extracellular sites). These molecules can work as neutralizing agents against amyloidogenic proteins by preventing their aggregation, and/or as molecular shunters of intracellular traffic by rerouting the protein from its potential aggregation site (Cardmale, and Biocca. Curr. Mol. Med. 2008, 8:2-11).

    Maxihodies

    [0251] In one embodiment, the payloads of the invention encode a maxibody (bivalent scFV fused to the amino terminus of the Fc (CH2-CH3 domains) of IgG.

    Chimeric Antigen Receptors

    [0252] In some embodiments, the polypeptides encoded by the viral genomes of the invention (e.g., antibodies) may be used to generate chimeric antigen receptors (CARs) as described by BIOATLA in International Publications WO2016033331 and WO2016036916, the contents of which are herein incorporated by reference in their entirety. As used herein, a chimeric antigen receptor (CAR) refers to an artificial chimeric protein comprising at least one antigen specific targeting region (ASTR), wherein the antigen specific targeting region comprises a full-length antibody or a fragment thereof that specifically binds to a target antigen. The ASTR may comprise any of the following: a full length heavy or light chain, an Fab fragment, a single chain Fv fragment, a divalent single chain antibody, or a diabody. As a non-limiting example the ASTR of a CAR may be any of the antibodies listed in Table 3, antibody-based compositions or fragments thereof. Any molecule that is capable of binding a target antigen with high affinity can be used in the ASTR of a CAR. In one embodiment, the CAR may have more than one ASTR. These ASTRs may target two or more antigens or two or more epitopes of the same antigen. In one embodiment, the CAR is conditionally active. In one embodiment, the CAR is used to produce a genetically engineered cytotoxic cell earning the CAR and capable of targeting the antigen bound by the ASTR.

    [0253] Chimeric antigen receptors (CARs) are particularly useful in the treatment of cancers, though also therapeutically effective in treatment of a wide variety of other diseases and disorders. Non-limiting examples of disease categories that may be treated with CARs or CAR-based therapeutics include autoimmune disorders, B-cell mediated diseases, inflammatory diseases, neuronal disorders, cardiovascular disease and circulatory disorders, or infectious diseases. Not wishing to be bound by theory, CARs traditionally work by targeting antigens presented on the surface of or on the inside of cells to be destroyed e.g., cancer tumor cells, by the cytotoxic cell of the CAR.

    Senescent Cell Surface Protein Antibodies

    [0254] In some embodiments, the AAV particles may comprise nucleic acids which have been engineered to express of antibodies that selectively bind to surface marker proteins of senescent cells. For example, the antibodies may selectively bind to proteins that are in misfolded conformation. The binding antibodies may reduce the number of senescent cells and be used to treat age-related conditions, such as, but not limited to, Alzheimer's disease, cardiovascular disease, emphysema, sarcopenia, and tumorigenesis as well as conditions more cosmetic in nature such as signs of skin aging including wrinkling, sagging, discoloration, age-related tissue dysfunction, tumor formation, and other age-related conditions.

    [0255] In one embodiment, the expressed antibodies binding to epitopes of senescent cell surface proteins may be, but are not limited to, such as prion epitopes presented by SEQ ID NO: 1-14 of International Publication No. WO2014186878; CD44 epitopes presented by SEQ ID NO: 47-51 of International Publication No. WO2014186878, TNFR epitopes presented by SEQ ID NO: 52-56 of International Publication No. WO2014186878; NOTCH1 epitope presented by SEQ ID NO: 57-61 of International Publication No. WO2014186878; FasR epitopes presented by SEQ ID NO: 62-66 of International Publication No. WO2014186878; epidermal growth factor epitopes presented by SEQ ID NO: 67-81 of International Publication No, WO2014186878; CD38 epitopes presented by SEQ ID NO: 82-86 of International Publication No. WO2014186878, the contents of each of which are herein incorporated by reference in their entirety.

    [0256] In one embodiment, the expressed antibodies may comprise peptides binding to senescent cell surface prion proteins, such as, but not limited to, those presented by SEQ ID NO: 15-36 of International Publication No. WO2014186878, the contents of which are herein incorporated by reference in their entirety.

    [0257] In one embodiment, the expressed antibody may be AMF-3a-118 or AMF 3d-19 (SEQ ID NO: 89-92 and 103-106 of International publication WO2014186878, respectively, the contents of which are herein incorporated by reference in their entirety) targeting senescent cell surface protein FasR. In one embodiment, the expressed antibody may be Ab c-120 (SEQ ID NO: 37-40 of International publication WO2014186878, the contents of which are herein incorporated by reference in their entirety) targeting senescent cell surface protein PrP.

    Payload Antibodies of the Invention

    [0258] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the payload antibody polypeptides listed in Table 3.

    [0259] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences listed in Table 3 or Table 4.

    [0260] In some embodiments, the payload region of the AAV particle comprises a nucleic acid sequence encoding a payload antibody with at least 50% identity to one or more payload antibody polypeptides listed in Tables 3 or 4. The encoded antibody polypeptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%. 57%, 58%, 59%, 60%, 61%, 62%, 63%. 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more of the pavload antibody polypeptides listed in Tables 3 or 4.

    [0261] In one embodiment, the full sequence of the encoded antibody polypeptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%), 99%, or 100% identity to one or more of the payload antibody polypeptides listed in Tables 3 or 4.

    [0262] In one embodiment, the variable region sequence(s) of the encoded antibody polypeptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more of the payload antibody polypeptides listed in Tables 3 or 4.

    [0263] In one embodiment, the heavy chain of the encoded antibody polypeptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%. 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more of the payload heavy chain antibody polypeptides listed in Tables 3 or 4.

    [0264] In one embodiment, the light chain of the encoded antibody polypeptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%. 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%. 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more of the payload light chain antibody polypeptides listed in Tables 3 or 4.

    [0265] In one embodiment, the CDR region of the encoded antibody polypeptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the CDRs of one or more of the payload antibody polypeptides listed in Tables 3 or 4.

    [0266] In one embodiment, the payload antibody has 90% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0267] In one embodiment, the payload antibody has 91 % identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0268] In one embodiment, the payload antibody has 92% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0269] In one embodiment, the payload antibody has 93% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0270] In one embodiment, the payload antibody has 94% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0271] In one embodiment, the payload antibody has 95% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0272] In one embodiment, the payload antibody has 96% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0273] In one embodiment, the payload antibody has 97% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0274] In one embodiment, the payload antibody has 98% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0275] In one embodiment, the payload antibody has 99% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0276] In one embodiment, the payload antibody has 100% identity to one or more of the antibody polypeptides listed in Tables 3 or 4.

    [0277] In some embodiments, the payload region of the AAV particle comprises a nucleic acid sequence with at least 50% identity to one or more nucleic acid sequences listed in Tables 3 or 4. The payload nucleic acid sequence may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more nucleic acid sequences listed in Tables 3 or 4.

    [0278] In one embodiment, the payload nucleic acid sequence has 90% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0279] In one embodiment, the payload nucleic acid sequence has 91% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0280] In one embodiment, the payload nucleic acid sequence has 92% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0281] In one embodiment, the payload nucleic acid sequence has 93% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0282] In one embodiment, the payload nucleic acid sequence has 94% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0283] In one embodiment, the payload nucleic acid sequence has 95% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0284] In one embodiment, the payload nucleic acid sequence has 96% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0285] In one embodiment, the payload nucleic acid sequence has 97% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0286] In one embodiment, the payload nucleic acid sequence has 98% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0287] In one embodiment, the payload nucleic acid sequence has 99% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4.

    [0288] In one embodiment, the payload nucleic acid sequence has 100% identity to one or more of the nucleic acid sequences listed in Tables 3 or 4,

    TABLE-US-00003 TABLE 3 Tau Associated Disease Antibodies Antibody No. Target Description Antibody Name Reference SEQ ID NO TAU1 tau Heavy chain MC-1 2948 TAU2 tau Heavy chain PHF-1 2949 TAU3 tau Heavy chain IPN002 2950 TAU4 amyloids Heavy chain #118 WO2010012004 SEQ ID NO: 11 2951 TAU5 amyloids Heavy chain #121 WO2010012004 SEQ ID NO: 13 2952 TAU6 amyloids Heavy chain #204 WO2010012004 SEQ ID NO: 17 2953 TAU7 amyloids Heavy chain #205 WO2010012004 SEQ ID NO: 19 2954 TAU8 NOGO Heavy chain H6L13 FL US20140147435 SEQ ID NO: 27 2955 TAU9 NOGO Heavy chain H16L16 FL, US20140147435 SEQ ID NO: 31 2956 H16L18 FL TAU10 NOGO Heavy chain H18L16 FL US20140147435 SEQ ID NO: 33 2957 TAU11 NOGO Heavy chain H19L13 FL, US20140147435 SEQ ID NO: 92 2958 H19L16 FL, H19L18 FL TAU12 NOGO Heavy chain H20L13 FL, US20140147435 SEQ ID NO: 93 2959 H20L16 FL, H20L18 FL TAU13 NOGO Heavy chain H21L13 FL, US20140147435 SEQ ID NO: 94 2960 H21L16 FL, H21L18 FL TAU14 NOGO Heavy chain H25L13 FL, US20140147435 SEQ ID NO: 98 2961 H25L16 FL, H25L18 FL TAU15 Nogo receptor-1 Heavy chain 5B10 US20090215691 SEQ ID NO: 16 2962 TAU16 Nogo receptor-1 Heavy chain 5B10 US20090215691 SEQ ID NO: 18 2963 TAU17 PrP Heavy chain Ab c-120 WO2014186878 SEQ ID NO: 38 2964 TAU18 PrPC and/or Heavy chain US20150166668 SEQ ID NO: 10 2965 PrPSc TAU19 PrPC and/or Heavy chain U.S. Pat. No. 8,852,587 SEQ ID NO: 4 2966 PrPSc TAU20 tau Heavy chain VH antibody US20150252102 SEQ ID NO: 93 2967 TAU21 tau Heavy chain hACl-36-3A8 WO2013151762 SEQ ID NO: 24 2968 Ab1 TAU22 tau Heavy chain hACl-36-3B8 WO2013151762 SEQ ID NO: 25 2969 Ab1 TAU23 tau Heavy chain hACl-36-3A8 WO2013151762 SEQ ID NO: 26 2970 Ab1.v2 TAU24 tau Heavy chain hACl-36-3A8 WO2013151762 SEQ ID NO: 27 2971 Ab1.v3 TAU25 tau Heavy chain hACl-36-3A8 WO2013151762 SEQ ID NO: 28 2972 Ab1.v4 TAU26 tau Heavy chain hACl-36-3B8 WO2013151762 SEQ ID NO: 29 2973 Ab1.v2 TAU27 tau Heavy chain hACl-36-3B8 WO2013151762 SEQ ID NO: 30 2974 Ab1.v3 TAU28 tau Heavy chain hACl-36-3B8 WO2013151762 SEQ ID NO: 31 2975 Ab1.v4 TAU29 tau Heavy chain IPN001 U.S. Pat. No. 8,980,271 SEQ ID NO: 14 2976 TAU30 tau Heavy chain IPN002 U.S. Pat. No. 8,980,271 SEQ ID NO: 16 2977 TAU31 tau Heavy chain ACl-36-3A8- US20150175682 SEQ ID NO: 16 2978 Ab1 and hACl- 36-2B6-Ab1 TAU32 tau Heavy chain hACl-36-3A8- US20150175682 SEQ ID NO: 17 2979 Ab1 and hACl- 36-2B6-Ab1 TAU33 tau Heavy chain hACl-36-2B6- US20150175682 SEQ ID NO: 25 2980 Ab1 (IgG4) TAU34 tau Heavy chain hACl-36-3A8- US20150175682 SEQ ID NO: 26 2981 Ab1.v2 (IgG4) TAU35 tau Heavy chain hACl-36-3A8- US20150175682 SEQ ID NO: 27 2982 Ab1.v3 (IgG1) TAU36 tau Heavy chain hACl-36-3A8- US20150175682 SEQ ID NO: 28 2983 Ab1.v4 (IgG1 N297G) TAU37 tau Heavy chain hACl-36-2B6- US20150175682 SEQ ID NO: 29 2984 Ab1.v2 (IgG4) TAU38 tau Heavy chain hACl-36-2B6- US20150175682 SEQ ID NO: 30 2985 Ab1.v3 (IgG1) TAU39 tau Heavy chain hACl-36-2B6- US20150175682 SEQ ID NO: 31 2986 Ab1.v4 (IgG1 N297G) TAU40 trk-C Heavy chain 2250 U.S. Pat. No. 7,615,383 SEQ ID NO: 42 2987 TAU41 trk-C Heavy chain 2253 U.S. Pat. No. 7,615,383 SEQ ID NO: 43 2988 TAU42 trk-C Heavy chain 2256 U.S. Pat. No. 7,615,383 SEQ ID NO: 44 2989 TAU43 trk-C Heavy chain 6.1.2 U.S. Pat. No. 7,615,383 SEQ ID NO: 45 2990 TAU44 trk-C Heavy chain 6.4.1 U.S. Pat. No. 7,615,383 SEQ ID NO: 46 2991 TAU45 trk-C Heavy chain 2345 U.S. Pat. No. 7,615,383 SEQ ID NO: 47 2992 TAU46 trk-C Heavy chain 2349 U.S. Pat. No. 7,615,383 SEQ ID NO: 48 2993 TAU47 tau Heavy chain hACl-36-3A8- US20150175682 SEQ ID NO: 14 2994 constant Ab1 and hACl- region 36-2B6-Ab1 TAU48 many Heavy chain U.S. Pat. No. 8,053,569 SEQ ID NO: 25 2995 fusion protein TAU49 many Heavy chain U.S. Pat. No. 8,053,569 SEQ ID NO: 28 2996 fusion protein TAU50 many Heavy chain U.S. Pat. No. 8,053,569 SEQ ID NO: 34 2997 fusion protein TAU51 many - growth Heavy chain U.S. Pat. No. 8,053,569 SEQ ID NO: 24 2998 factors (to fusion protein increase transport across BBB) TAU52 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 79 2999 humanized construct H1 TAU53 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 29 3000 humanized construct H14 TAU54 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 30 3001 humanized construct H15 TAU55 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 31 3002 humanized construct H16 TAU56 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 32 3003 humanized construct H17 TAU57 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 33 3004 humanized construct H18 TAU58 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 92 3005 humanized construct H19 TAU59 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 93 3006 humanized construct H20 TAU60 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 94 3007 humanized construct H21 TAU61 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 95 3008 humanized construct H22 TAU62 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 96 3009 humanized construct H23 TAU63 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 97 3010 humanized construct H24 TAU64 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 98 3011 humanized construct H25 TAU65 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 26 3012 humanized construct H5 TAU66 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 27 3013 humanized construct H6 TAU67 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 28 3014 humanized construct H700 TAU68 RTN4 Heavy chain Atinumab U.S. Pat. No. 8,163,285 SEQ ID NO: 24 3015 (NOGO) IgG4, immunomodulator TAU69 tau Heavy chain ch4E4 US20150252102 SEQ ID NO: 20 3016 mature TAU70 tau Heavy chain ch4E4(N30Q) US20150252102 SEQ ID NO: 22 3017 mature TAU71 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 77 3018 variable humanized construct H1 TAU72 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 14 3019 variable humanized construct H14 TAU73 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 15 3020 variable humanized construct H15 TAU74 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 16 3021 variable humanized construct H16 TAU75 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 17 3022 variable humanized construct H17 TAU76 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 18 3023 variable humanized construct H18 TAU77 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 85 3024 variable humanized construct H19 TAU78 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 86 3025 variable humanized construct H20 TAU79 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 87 3026 variable humanized construct H21 TAU80 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 88 3027 variable humanized construct H22 TAU81 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 89 3028 variable humanized construct H23 TAU82 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 90 3029 variable humanized construct H24 TAU83 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 91 3030 variable humanized construct H25 TAU84 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 11 3031 variable humanized construct H5 TAU85 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 12 3032 variable humanized construct H6 TAU86 NOGO Heavy chain 2A10 construct WO2007003421 SEQ ID NO: 13 3033 variable humanized construct H700 TAU87 amyloid Heavy chain F11G3 U.S. Pat. No. 9,125,846 SEQ ID NO: 11 3034 oligomers variable region TAU88 LPG(lysophosphatidylglucoside) Heavy chain #7 U.S. Pat. No. 8,591,902 SEQ ID NO: 18 3035 variable region TAU89 LPG(lysophosphatidylglucoside) Heavy chain #15 U.S. Pat. No. 8,591,902 SEQ ID NO: 8 3036 variable region TAU90 MAG Heavy chain U.S. Pat. No. 8,071,731 SEQ ID NO: 13 3037 variable region TAU91 MAG Heavy chain U.S. Pat. No. 8,071,731 SEQ ID NO: 14 3038 variable region TAU92 MAG Heavy chain U.S. Pat. No. 8,071,731 SEQ ID NO: 15 3039 variable region TAU93 MAI (myelin Heavy chain WO2013158748 SEQ ID NO: 1 3040 associated variable inhibitor) region TAU94 MAI (myelin Heavy chain WO2013158748 SEQ ID NO: 17 3041 associated variable inhibitor) region TAU95 NMDA Heavy chain EP2805972 SEQ ID NO: 43 3042 variable region TAU96 NOGO Heavy chain H5L13, H5L16, US20140147435 SEQ ID NO: 11 3043 variable H5L18, H5L14, region H5L15, H5L17, H5L6, H5L11 TAU97 NOGO Heavy chain H6L13, H6L16, US20140147435 SEQ ID NO: 12 3044 variable H6L18, H6L14, region H6L15, H6L17, H6L6 TAU98 NOGO Heavy chain H700L13, US20140147435 SEQ ID NO: 13 3045 variable H700L16, region H700L18, H700L14, H700L15, H700L17, H700L6, H700L11 TAU99 NOGO Heavy chain H14L13, US20140147435 SEQ ID NO: 14 3046 variable H14L16, region H14L18, H14L14, H14L15, H14L17, H14L6, H14L11 TAU100 NOGO Heavy chain H15L13, US20140147435 SEQ ID NO: 15 3047 variable H15L16, region H15L18, H15L14, H15L15, H15L17, H15L6, H15L11 TAU101 NOGO Heavy chain H16L13, US20140147435 SEQ ID NO: 16 3048 variable H16L16, region H16L18, H16L14, H16L15, H16L17, H16L6, H16L11 TAU102 NOGO Heavy chain H17L13, US20140147435 SEQ ID NO: 17 3049 variable H17L16, region H17L18, H17L14, H17L15, H17L17, H17L6, H17L11 TAU103 NOGO Heavy chain H18L13, US20140147435 SEQ ID NO: 18 3050 variable H18L16, region H18L18, H18L14, H18L15, H18L17, H18L6, H18L11 TAU104 NOGO Heavy chain H1L13, H1L16, US20140147435 SEQ ID NO: 77 3051 variable H1L18, H1L14, region H1L15, H1L17, H1L6 TAU105 NOGO Heavy chain H19L13, US20140147435 SEQ ID NO: 85 3052 variable H19L16, region H19L18, H19L14, H19L15, H19L17, H19L6, H19L11 TAU106 NOGO Heavy chain H20L13, US20140147435 SEQ ID NO: 86 3053 variable H20L16, region H20L18, H20L14, H20L15, H20L17, H20L6, H20L11 TAU107 NOGO Heavy chain H21L13, US20140147435 SEQ ID NO: 87 3054 variable H21L16, region H21L18, H21L14, H21L15, H21L17, H21L6, H21L11 TAU108 NOGO Heavy chain H22L13, US20140147435 SEQ ID NO: 88 3055 variable H22L16, region H22L18, H22L14, H22L15, H22L17, H22L6, H22L11 TAU109 NOGO Heavy chain H23L13, US20140147435 SEQ ID NO: 89 3056 variable H23L16, region H23L18, H23L14, H23L15, H23L17, H23L6, H23L11 TAU110 NOGO Heavy chain H24L13, US20140147435 SEQ ID NO: 90 3057 variable H24L16, region H24L18, H24L14, H24L15, H24L17, H24L6, H24L11 TAU111 NOGO Heavy chain H25L13, US20140147435 SEQ ID NO: 91 3058 variable H25L16, region H25L18, H25L14, H25L15, H25L17, H25L6, H25L11 TAU112 NOGO Heavy chain 2A10 U.S. Pat. No. 7,988,964 SEQ ID NO: 37 3059 variable region TAU113 NOGO Heavy chain 2C4 U.S. Pat. No. 7,988,964 SEQ ID NO: 38 3060 variable region TAU114 NOGO Heavy chain 15C3 U.S. Pat. No. 7,988,964 SEQ ID NO: 39 3061 variable region TAU115 Nogo-66 Heavy chain Antibody clone US20140065155 SEQ ID NO: 3 3062 variable 50 region TAU116 Nogo-66 Heavy chain Antibody clone US20140065155 SEQ ID NO: 5 3063 variable 51 region TAU117 NogoA/NiG Heavy chain 6A3-Ig4 WO2009056509 SEQ ID NO: 24 3064 variable region TAU118 NogoA/NiG Heavy chain 6A3-IgG1 WO2009056509 SEQ ID NO: 4 3065 variable region TAU119 PrP Heavy chain ICSM18VH US20140294844 SEQ ID NO: 4 3066 variable region TAU120 PrP Heavy chain Ab c-120 WO2014186878 SEQ ID NO: 40 3067 variable region TAU121 PEPC and/or Heavy chain US20150166668 SEQ ID NO: 8 3068 PrPSc variable region TAU122 RGM A Heavy chain 5F9.1-GL US20150183871 SEQ ID NO: 35 3069 variable region TAU123 RGM A Heavy chain 5F9.2-GL US20150183871 SEQ ID NO: 36 3070 variable region TAU124 RGM A Heavy chain 5F9.3-GL US20150183871 SEQ ID NO: 37 3071 variable region TAU125 RGM A Heavy chain 5F9.4-GL US20150183871 SEQ ID NO: 38 3072 variable region TAU126 RGM A Heavy chain 5F9.5-GL US20150183871 SEQ ID NO: 39 3073 variable region TAU127 RGM A Heavy chain 5F9.6-GL US20150183871 SEQ ID NO: 40 3074 variable region TAU128 RGM A Heavy chain 5F9.7-GL US20150183871 SEQ ID NO: 41 3075 variable region TAU129 RGM A Heavy chain 5F9.8-GL US20150183871 SEQ ID NO: 42 3076 variable region TAU130 RGM A Heavy chain 5F9.9-GL US20150183871 SEQ ID NO: 43 3077 variable region TAU131 RGM A Heavy chain h5F9.1, h5F9.1, US20150183871 SEQ ID NO: 47 3078 variable h5F9.1, h5F9.1, region h5F9.1, h5F9.2, h5F9.3 TAU132 RGM A Heavy chain h5F9.3, h5F9.9, US20150183871 SEQ ID NO: 53 3079 variable h5F9.25 region TAU133 RGM A Heavy chain h5F9.4, h5F9.10, US20150183871 SEQ ID NO: 54 3080 variable h5F9.26 region TAU134 RGMa Heavy chain AE12-1 US20140023659 SEQ ID NO: 1 3081 variable region TAU135 RGMa Heavy chain AE12-20 US20140023659 SEQ ID NO: 107 3082 variable region TAU136 RGMa Heavy chain AE12-21 US20140023659 SEQ ID NO: 115 3083 variable region TAU137 RGMa Heavy chain AE12-23 US20140023659 SEQ ID NO: 123 3084 variable region TAU138 RGMa Heavy chain AE12-24 US20140023659 SEQ ID NO: 131 3085 variable region TAU139 RGMa Heavy chain AE12-3 US20140023659 SEQ ID NO: 17 3086 variable region TAU140 RGMa Heavy chain AE12-4 US20140023659 SEQ ID NO: 25 3087 variable region TAU141 RGMa Heavy chain AE12-5 US20140023659 SEQ ID NO: 33 3088 variable rrgion TAU142 RGMa Heavy chain AE12-6 US20140023659 SEQ ID NO: 41 3089 variable region TAU143 RGMa Heavy chain AE12-7 US20140023659 SEQ ID NO: 49 3090 variable region TAU144 RGMa Heavy chain AE12-8 US20140023659 SEQ ID NO: 57 3091 variable region TAU145 RGMa Heavy chain AE12-2 US20140023659 SEQ ID NO: 9 3092 variable region TAU146 RGMa Heavy chain AE12-13 US20140023659 SEQ ID NO: 91 3093 variable region TAU147 RGMa Heavy chain AE12-15 US20140023659 SEQ ID NO: 99 3094 variable region TAU148 tau Heavy chain WO2014100600 SEQ ID NO: 45 3095 variable region TAU149 tau Heavy chain NI-105.24B2 US20150252102 SEQ ID NO: 13 3096 variable region TAU150 tau Heavy chain NI-105.4A3 US20150252102 SEQ ID NO: 17 3097 variable region TAU151 tau Heavy chain NI-105.4E4 US20150252102 SEQ ID NO: 9 3098 variable region TAU152 tau Heavy chain WO2013041962 SEQ ID NO: 138 3099 variable region TAU153 tau Heavy chain WO2013041962 SEQ ID NO: 139 3100 variable region TAU154 tau Heavy chain WO2013041962 SEQ ID NO: 140 3101 variable region TAU155 tau Heavy chain WO2013041962 SEQ ID NO: 145 3102 variable region TAU156 tau Heavy chain WO2013041962 SEQ ID NO: 147 3103 variable region TAU157 tau Heavy chain WO2013041962 SEQ ID NO: 148 3104 variable region TAU158 tau Heavy chain WO2014100600 SEQ ID NO: 220 3105 variable region TAU159 tau Heavy chain NI-105.17C1 WO2014100600 SEQ ID NO: 44 3106 variable region TAU160 tau Heavy chain WO2014100600 SEQ ID NO: 47 3107 variable region TAU161 tau Heavy chain NI-105.6C5 WO2014100600 SEQ ID NO: 48 3108 variable region TAU162 tau Heavy chain NI-105.29G10 WO2014100600 SEQ ID NO: 50 3109 variable region TAU163 tau Heavy chain NI-105.6L9 WO2014100600 SEQ ID NO: 52 3110 variable region TAU164 tau Heavy chain NI-105.40E8 WO2014100600 SEQ ID NO: 54 3111 variable region TAU165 tau Heavy chain NI-105.48E5 WO2014100600 SEQ ID NO: 56 3112 variable region TAU166 tau Heavy chain NI-105.6E3 WO2014100600 SEQ ID NO: 58 3113 variable region TAU167 tau Heavy chain NI-105.22E1 WO2014100600 SEQ ID NO: 60 3114 variable region TAU168 tau Heavy chain NI-105.26B12 WO2014100600 SEQ ID NO: 62 3115 variable region TAU169 tau Heavy chain NI-105.12E12 WO2014100600 SEQ ID NO: 65 3116 variable region TAU170 tau Heavy chain NI-105.60E7 WO2014100600 SEQ ID NO: 67 3117 variable region TAU171 tau Heavy chain NI-105.14E2 WO2014100600 SEQ ID NO: 69 3118 variable region TAU172 tau Heavy chain NI-105.39E2 WO2014100600 SEQ ID NO: 71 3119 variable region TAU173 tau Heavy chain NI-105.19C6 WO2014100600 SEQ ID NO: 73 3120 variable region TAU174 tau Heavy chain WO2014100600 SEQ ID NO: 75 3121 variable region TAU175 tau Heavy chain NI-105.9C4 WO2014100600 SEQ ID NO: 76 3122 variable region TAU176 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 1 3123 variable region TAU177 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 2 3124 variable region TAU178 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 3 3125 variable region TAU179 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 4 3126 variable region TAU180 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 5 3127 variable region TAU181 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 68 3128 variable region TAU182 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 76 3129 variable region TAU183 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 88 3130 variable region TAU184 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 96 3131 variable region TAU185 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ ID NO: 104 3132 variable region TAU186 tau Heavy chain hACl-36-3A8- US20150175682 SEQ ID NO: 7 3133 variable Ab1 and hACl- reegion 36-2B6-Ab1 TAU187 tau Heavy chain hACl-36-3A8- US20150175682 SEQ ID NO: 20 3134 variable Ab1.v2 region TAU188 tau Heavy chain hACl-36-2B6- US20150175682 SEQ ID NO: 21 3135 variable Ab1.v2 region TAU189 tau Heavy chain ADx210 US20140161875 SEQ ID NO: 15 3136 variable region TAU190 tau Heavy chain ADx210 subpart US20140161875 SEQ ID NO: 17 3137 variable region TAU191 tau Heavy chain ADx215 US20140161875 SEQ ID NO: 25 3138 variable region TAU192 tau Heavy chain IPN002 variant 1 U.S. Pat. No. 8,926,974 SEQ ID NO: 36 3139 variable region TAU193 tau Heavy chain IPN002 variant 2 U.S. Pat. No. 8,926,974 SEQ ID NO: 37 3140 variable region TAU194 tau Heavy chain IPN002 variant 3 U.S. Pat. No. 8,926,974 SEQ ID NO: 38 3141 variable region TAU195 tau Heavy chain IPN002 variant 4 U.S. Pat. No. 8,926,974 SEQ ID NO: 39 3142 variable region TAU196 tau Heavy chain PT1 US20150307600 SEQ ID NO: 35 3143 variable region TAU197 tau Heavy chain PT3 US20150307600 SEQ ID NO: 37 3144 variable region TAU198 tau antigen Heavy chain ADx202 WO2015004163 SEQ ID NO: 14 3145 variable region TAU199 tau pS422 Heavy chain antibody US20110059093 SEQ ID NO: 2 3146 variable Mab2.10.3 region TAU200 tau pS422 Heavy chain Mab 005 US20110059093 SEQ ID NO: 22 3147 variable region TAU201 tau pS422 Heavy chain Mab 019 US20110059093 SEQ ID NO: 30 3148 variable region TAU202 tau pS422 Heavy chain Mab 020 US20110059093 SEQ ID NO: 38 3149 variable region TAU203 tau pS422 Heavy chain Mab 085 US20110059093 SEQ ID NO: 46 3150 variable region TAU204 tau pS422 Heavy chain Mab 086 US20110059093 SEQ ID NO: 54 3151 variable region TAU205 tau pS422 Heavy chain Mab 097 US20110059093 SEQ ID NO: 62 3152 variable region TAU206 tau Light chain MC-1 3153 TAU207 tau Light chain PHF-1 3154 TAU208 tau Light chain IPN002 3155 TAU209 amyloids Light chain #118 WO2010012004 SEQ ID NO: 12 3156 TAU210 amyloids Light chain #121 WO2010012004 SEQ ID NO: 14 3157 TAU211 amyloids Light chain #201 WO2010012004 SEQ ID NO: 15 3158 TAU212 amyloids Light chain #204 WO2010012004 SEQ ID NO: 16 3159 TAU213 amyloids Light chain #205 WO2010012004 SEQ ID NO: 18 3160 TAU214 NOGO Light chain H6L13 FL, US20140147435 SEQ ID NO: 35 3161 H19L13 FL, H20L13 FL, H21L13 FL, H25L13 FL TAU215 NOGO Light chain H16L16 FL, US20140147435 SEQ ID NO: 38 3162 H19L16 FL, H20L16 FL, H21L16 FL, H25L16 FL, H18L16 FL TAU216 NOGO Light chain H16L18 FL, US20140147435 SEQ ID NO: 40 3163 H19L18 FL, H20L18 FL, H21L18 FL, H25L18 FL TAU217 Nogo receptor-1 Light chain 7.00E+11 US20090215691 SEQ ID NO: 15 3164 TAU218 Nogo receptor-1 Light chain 7.00E+11 US20090215691 SEQ ID NO: 17 3165 TAU219 PrP Light chain Ab c-120 WO2014186878 SEQ ID NO: 37 3166 TAU220 PrPC and/or Light chain US20150166668 SEQ ID NO: 9 3167 PrPSc TAU221 PrPC and/or Light chain U.S. Pat. No. 8,852,587 SEQ ID NO: 5 3168 PrPSc TAU222 tau Light chain hACl-36-3A8 WO2013151762 SEQ ID NO: 22 3169 Ab1, hACl-36- 3A8 Ab1.v2, hACl-36-3A8 Ab1.v3, hACl- 36-3A8 Ab1.v4 TAU223 tau Light chain hACl-36-3B8 WO2013151762 SEQ ID NO: 23 3170 Ab1, hACl-36- 3B8 Ab1.v2, hACl-36-3B8 Ab1.v3, hACl- 36-3B8 Ab1.v4 TAU224 tau Light chain IPN001 U.S. Pat. No. 8,980,271 SEQ ID NO: 13 3171 TAU225 tau Light chain IPN002 U.S. Pat. No. 8,980,271 SEQ ID NO: 15 3172 TAU226 tau Light chain hACl-36-3A8- US20150175682 SEQ ID NO: 18 3173 Ab1 and hACl- 36-2B6-Ab1 TAU227 tau Light chain hACl-36-3A8- US20150175682 SEQ ID NO: 22 3174 Ab1 (IgG4), hACl-36-3A8- Ab1.v2 (IgG4), hACl-36-3A8- Ab1.v3 (IgG1), and hACl-36- 3A8-Ab1.v4 (IgG1 N297G) TAU228 tau Light chain hACl-36-2B6- US20150175682 SEQ ID NO: 23 3175 Ab1 (IgG4), hACl-36-2B6- Ab1.v2 (IgG4), hACl-36-2B6- Ab1.v3 (IgG1), and hACl-36- 2B6-Ab1.v4 (IgG1 N297G) TAU229 tau Light chain hACl-36-3A8- US20150175682 SEQ ID NO: 24 3176 Ab1 (IgG4) TAU230 trk-C Light chain 2250 U.S. Pat. No. 7,615,383 SEQ ID NO: 49 3177 TAU231 trk-C Light chain 2253 U.S. Pat. No. 7,615,383 SEQ ID NO: 50 3178 TAU232 trk-C Light chain 2256 U.S. Pat. No. 7,615,383 SEQ ID NO: 51 3179 TAU233 trk-C Light chain 6.1.2 U.S. Pat. No. 7,615,383 SEQ ID NO: 52 3180 TAU234 trk-C Light chain 6.4.1 U.S. Pat. No. 7,615,383 SEQ ID NO: 53 3181 TAU235 trk-C Light chain 2345 U.S. Pat. No. 7,615,383 SEQ ID NO: 54 3182 TAU236 trk-C Light chain 2349 U.S. Pat. No. 7,615,383 SEQ ID NO: 55 3183 TAU237 many Light chain U.S. Pat. No. 8,053,569 SEQ ID NO: 31 3184 fusion protein TAU238 many Light chain U.S. Pat. No. 8,053,569 SEQ ID NO: 36 3185 fusion protein TAU239 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 80 3186 humanized construct L11 TAU240 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 35 3187 humanized construct L13 TAU241 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 36 3188 humanized construct L14 TAU242 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 37 3189 humanized construct L15 TAU243 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 38 3190 humanized construct L16 TAU244 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 39 3191 humanized construct L17 TAU245 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 40 3192 humanized construct L18 TAU246 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 34 3193 humanized construct L6 TAU247 RTN4 Light chain Atinumab U.S. Pat. No. 8,163,285 SEQ ID NO: 25 3194 IgG4, immunomodulator TAU248 tau Light chain ch4E4 US20150252102 SEQ ID NO: 21 3195 mature TAU249 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 78 3196 variable humanized construct L11 TAU250 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 20 3197 variable humanized construct L13 TAU251 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 21 3198 variable humanized construct L14 TAU252 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 22 3199 variable humanized construct L15 TAU253 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 23 3200 variable humanized construct L16 TAU254 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 24 3201 variable humanized construct L17 TAU255 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 25 3202 variable humanized construct L18 TAU256 NOGO Light chain 2A10 construct WO2007003421 SEQ ID NO: 19 3203 variable humanized construct L6 TAU257 amyloid Light chain F11G3 U.S. Pat. No. 9,125,846 SEQ ID NO: 12 3204 oligomers variable region TAU258 LPG(lysophosphatidylglucoside) Light chain #7 U.S. Pat. No. 8,591,902 SEQ ID NO: 17 3205 variable region TAU259 LPG(lysophosphatidylglucoside) Light chain #15 U.S. Pat. No. 8,591,902 SEQ ID NO: 7 3206 variable region TAU260 MAG Light chain U.S. Pat. No. 8,071,731 SEQ ID NO: 16 3207 variable region TAU261 MAG Light chain U.S. Pat. No. 8,071,731 SEQ ID NO: 17 3208 variable region TAU262 MAG Light chain U.S. Pat. No. 8,071,731 SEQ ID NO: 18 3209 variable region TAU263 MAG Light chain U.S. Pat. No. 8,071,731 SEQ ID NO: 19 3210 variable region TAU264 MAI (myelin Light chain WO2013158748 SEQ ID NO: 11 3211 associated variable inhibitor) region TAU265 MAI (myelin Light chain WO2013158748 SEQ ID NO: 27 3212 associated variable inhibitor) region TAU266 NMDA Light chain EP2805972 SEQ ID NO: 44 3213 variable region TAU267 NOGO Light chain H1L6, H5L6, US20140147435 SEQ ID NO: 19 3214 variable H6L6, H14L6, region H15L6, H16L6, H17L6, H18L6, H19L6, H20L6, H21L6, H22L6, H23L6, H24L6, H25L6, H700L6 TAU268 NOGO Light chain H1L13, H5L13, US20140147435 SEQ ID NO: 20 3215 variable H6L13, H14L13, region H15L13, H16L13, H17L13, H18L13, H19L13, H20L13, H21L13, H22L13, H23L13, H24L13, H25L13, H700L13 TAU269 NOGO Light chain H1L14, H5L14, US20140147435 SEQ ID NO: 21 3216 variable H6L14, H14L14, region H15L14, H16L14, H17L14, H18L14, H19L14, H20L14, H21L14, H22L14, H23L14, H24L14, H25L14, H700L14 TAU270 NOGO Light chain H1L15, H5L15, US20140147435 SEQ ID NO: 22 3217 variable H6L15, H14L15, region H15L15, H16L15, H17L15, H18L15, H19L15, H20L15, H21L15, H22L15, H23L15, H24L15, H25L15, H700L15 TAU271 NOGO Light chain H1L16, H5L16, US20140147435 SEQ ID NO: 23 3218 variable H6L16, H14L16, region H15L16, H16L16, H17L16, H18L16, H19L16, H20L16, H21L16, H22L16, H23L16, H24L16, H25L16, H700L16 TAU272 NOGO Light chain H1L17, H5L17, US20140147435 SEQ ID NO: 24 3219 variable H6L17, H14L17, region H15L17, H16L17, H17L17, H18L17, H19L17, H20L17, H21L17, H22L17, H23L17, H24L17, H25L17, H700L17 TAU273 NOGO Light chain H1L18, H5L18, US20140147435 SEQ ID NO: 25 3220 variable H6L18, H14L18, region H15L18, H16L18, H17L18, H18L18, H19L18, H20L18, H21L18, H22L18, H23L18, H24L18, H25L18, H700L18 TAU274 NOGO Light chain H5L11, H6L11, US20140147435 SEQ ID NO: 78 3221 variable H14L11, region H15L11, H16L11, H17L11, H18L11, H19L11, H20L11, H21L11, H22L11, H23L11, H24L11, H25L11, H700L11 TAU275 NOGO Light chain 2A10 U.S. Pat. No. 7,988,964 SEQ ID NO: 40 3222 variable region TAU276 NOGO Light chain 2C4 U.S. Pat. No. 7,988,964 SEQ ID NO: 41 3223 variable region TAU277 Nogo-66 Light chain Antibody clone US20140065155 SEQ ID NO: 4 3224 variable 50 region TAU278 Nogo-66 Light chain Antibody clone US20140065155 SEQ ID NO: 6 3225 variable 51 region TAU279 NogoA/NiG Light chain 6A3-Ig4 WO2009056509 SEQ ID NO: 25 3226 variable region TAU280 NogoA/NiG Light chain 6A3-IgG1 WO2009056509 SEQ ID NO: 5 3227 variable region TAU281 PrP Light chain Ab c-120 WO2014186878 SEQ ID NO: 39 3228 variable region TAU282 PrPC and/or Light chain US20150166668 SEQ ID NO: 7 3229 PrPSc variable region TAU283 RGM A Light chain 5F9.1-GL, US20150183871 SEQ ID NO: 44 3230 variable 5F9.1-GL, region 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, h5F9.4, h5F9.11, h5F9.12 TAU284 RGM A Light chain 5F9.2-GL, US20150183871 SEQ ID NO: 45 3231 variable 5F9.2-GL, region 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, h5F9.5, h5F9.19, h5F9.20 TAU285 RGM A Light chain 5F9.3-GL, US20150183871 SEQ ID NO: 46 3232 variable 5F9.3-GL, region 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, h5F9.6, h5F9.21, h5F9.22 TAU286 RGM A Light chain h5F9.5, h5F9.6, US20150183871 SEQ ID NO: 48 3233 variable h5F9.7, h5F9.8, region h5F9.9, h5F9.10 TAU287 RGM A Light chain h5F9.11, US20150183871 SEQ ID NO: 49 3234 variable h5F9.19, h5F9.21 region TAU288 RGM A Light chain h5F9.12, US20150183871 SEQ ID NO: 50 3235 variable h5F9.20, region h5F9.22, h5F9.23, h5F9.25, h5F9.25, h5F9.26 TAU289 RGM A Light chain h5F9.1, h5F9.7, US20150183871 SEQ ID NO: 51 3236 variable h5F9.23 region TAU290 RGM A Light chain h5F9.2, h5F9.8, US20150183871 SEQ ID NO: 52 3237 variable h5F9.25 region TAU291 RGMa Light chain AE12-15 US20140023659 SEQ ID NO: 103 3238 variable region TAU292 RGMa Light chain AE12-20 US20140023659 SEQ ID NO: 111 3239 variable region TAU293 RGMa Light chain AE12-21 US20140023659 SEQ ID NO: 119 3240 variable region TAU294 RGMa Light chain AE12-23 US20140023659 SEQ ID NO: 127 3241 variable region TAU295 RGMa Light chain AE12-2 US20140023659 SEQ ID NO: 13 3242 variable region TAU296 RGMa Light chain AE12-24 US20140023659 SEQ ID NO: 135 3243 variable region TAU297 RGMa Light chain AE12-3 US20140023659 SEQ ID NO: 21 3244 variable region TAU298 RGMa Light chain AE12-4 US20140023659 SEQ ID NO: 29 3245 variable region TAU299 RGMa Light chain AE12-5 US20140023659 SEQ ID NO: 37 3246 variable region TAU300 RGMa Light chain AE12-6 US20140023659 SEQ ID NO: 45 3247 variable region TAU301 RGMa Light chain AE12-1 US20140023659 SEQ ID NO: 5 3248 variable region TAU302 RGMa Light chain AE12-7 US20140023659 SEQ ID NO: 53 3249 variable region TAU303 RGMa Light chain AE12-8 US20140023659 SEQ ID NO: 61 3250 variable region TAU304 RGMa Light chain AE12-13 US20140023659 SEQ ID NO: 95 3251 variable region TAU305 tau Light chain NI-105.4E4 US20150252102 SEQ ID NO: 11 3252 variable region TAU306 tau Light chain NI-105.24B2 US20150252102 SEQ ID NO: 15 3253 variable region TAU307 tau Light chain NI-105.4A3 US20150252102 SEQ ID NO: 19 3254 variable region TAU308 tau Light chain WO2013041962 SEQ ID NO: 141 3255 variable region TAU309 tau Light chain WO2013041962 SEQ ID NO: 142 3256 variable region TAU310 tau Light chain WO2013041962 SEQ ID NO: 143 3257 variable region TAU311 tau Light chain WO2013041962 SEQ ID NO: 150 3258 variable region TAU312 tau Light chain WO2013041962 SEQ ID NO: 152 3259 variable region TAU313 tau Light chain WO2013041962 SEQ ID NO: 153 3260 variable region TAU314 tau Light chain WO2014100600 SEQ ID NO: 221 3261 variable region TAU315 tau Light chain WO2014100600 SEQ ID NO: 222 3262 variable region TAU316 tau Light chain NI-105.17C1 WO2014100600 SEQ ID NO: 46 3263 variable region TAU317 tau Light chain NI-105.6C5 WO2014100600 SEQ ID NO: 49 3264 variable region TAU318 tau Light chain NI-105.29G10 WO2014100600 SEQ ID NO: 51 3265 variable region TAU319 tau Light chain NI-105.6L9 WO2014100600 SEQ ID NO: 53 3266 variable region TAU320 tau Light chain NI-105.40E8 WO2014100600 SEQ ID NO: 55 3267 variable region TAU321 tau Light chain NI-105.48E5 WO2014100600 SEQ ID NO: 57 3268 variable region TAU322 tau Light chain NI-105.6E3 WO2014100600 SEQ ID NO: 59 3269 variable region TAU323 tau Light chain NI-105.22E1 WO2014100600 SEQ ID NO: 61 3270 variable region TAU324 tau Light chain WO2014100600 SEQ ID NO: 63 3271 variable region TAU325 tau Light chain NI-105.26B12 WO2014100600 SEQ ID NO: 64 3272 variable region TAU326 tau Light chain NI-105.12E12 WO2014100600 SEQ ID NO: 66 3273 variable region TAU327 tau Light chain NI-105.60E7 WO2014100600 SEQ ID NO: 68 3274 variable region TAU328 tau Light chain NI-105.14E2 WO2014100600 SEQ ID NO: 70 3275 variable region TAU329 tau Light chain NI-105.39E2 WO2014100600 SEQ ID NO: 72 3276 variable region TAU330 tau Light chain NI-105.19C6 WO2014100600 SEQ ID NO: 74 3277 variable region TAU331 tau Light chain WO2014100600 SEQ ID NO: 77 3278 variable region TAU332 tau Light chain NI-105.9C4 WO2014100600 SEQ ID NO: 78 3279 variable region TAU333 tau Light chain IPN002 variant 1 U.S. Pat. No. 8,926,974 SEQ ID NO: 40 3280 variable region TAU334 tau Light chain IPN002 variant 2 U.S. Pat. No. 8,926,974 SEQ ID NO: 41 3281 variable region TAU335 tau Light chain IPN002 variant 3 U.S. Pat. No. 8,926,974 SEQ ID NO: 42 3282 variable region TAU336 tau Light chain IPN002 variant 4 U.S. Pat. No. 8,926,974 SEQ ID NO: 43 3283 variable region TAU337 tau Light chain PT1 US20150307600 SEQ ID NO: 36 3284 variable region TAU338 tau Light chain PT3 US20150307600 SEQ ID NO: 38 3285 variable region TAU339 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 6 3286 variable region TAU340 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 7 3287 variable region TAU341 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 8 3288 variable region TAU342 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 9 3289 variable region TAU343 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 10 3290 variable region TAU344 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 11 3291 variable region TAU345 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 69 3292 variable region TAU346 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 77 3293 variable region TAU347 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 92 3294 variable region TAU348 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 97 3295 variable region TAU349 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 105 3296 variable region TAU350 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 116 3297 variable region TAU351 tau Light chain U.S. Pat. No. 9,304,138 SEQ ID NO: 118 3298 variable region TAU352 tau Light chain hAC1-36-3A8- US20150175682 SEQ ID NO: 8 3299 variable Ab1 region TAU353 tau Light chain hAC1-36-2B6- US20150175682 SEQ ID NO: 9 3300 variable Ab1 region TAU354 tau Light chain ADx210 US20140161875 SEQ ID NO: 16 3301 variable region TAU355 tau Light chain ADx210 isoform US20140161875 SEQ ID NO: 18 3302 variable region TAU356 tau Light chain ADx215 US20140161875 SEQ ID NO: 26 3303 variable region TAU357 tau antigen Light chain ADx202 WO2015004163 SEQ ID NO: 9 3304 variable region TAU358 tau pS422 Light chain antibody US20110059093 SEQ ID NO: 1 3305 variable Mab2.10.3 region TAU359 tau pS422 Light chain Mab 005 US20110059093 SEQ ID NO: 26 3306 variable region TAU360 tau pS422 Light chain Mab 019 US20110059093 SEQ ID NO: 34 3307 variable region TAU361 tau pS422 Light chain Mab 020 US20110059093 SEQ ID NO: 42 3308 variable region TAU362 tau pS422 Light chain Mab 085 US20110059093 SEQ ID NO: 50 3309 variable region TAU363 tau pS422 Light chain Mab 086 US20110059093 SEQ ID NO: 58 3310 variable region TAU364 tau pS422 Light chain Mab 097 US20110059093 SEQ ID NO: 66 3311 variable region TAU365 PrPC and/or scFv U.S. Pat. No. 8,852,587 SEQ ID NO: 6 3312 PrPSc TAU366 amyloid M13 g3p US20150376239 SEQ ID NO: 1 3313 proteins TAU367 amyloid Construct 5 US20150376139 SEQ ID NO: 11 3314 proteins TAU368 amyloid Construct 6 US20150376239 SEQ ID NO: 13 3315 proteins TAU369 amyloid fd N2 US20150376239 SEQ ID NO: 14 3316 proteins TAU370 amyloid f1 N2 US20150376239 SEQ ID NO: 15 3317 proteins TAU371 amyloid M13 N2 US20150376239 SEQ ID NO: 16 3318 proteins TAU372 amyloid Ike N2 US20150376239 SEQ ID NO: 17 3319 proteins TAU373 amyloid 12-2 N2 US20150376239 SEQ ID NO: 18 3320 proteins TAU374 amyloid If1 N2 US20150376239 SEQ ID NO: 19 3321 proteins TAU375 amyloid fd g3p US20150376239 SEQ ID NO: 2 3322 proteins TAU376 amyloid Construct 3 US20150376239 SEQ ID NO: 20 3323 proteins TAU377 amyloid Construct 3m US20150376239 SEQ ID NO: 24 3324 proteins g3p portion TAU378 amyloid If1 g3p US20150376239 SEQ ID NO: 29 3325 proteins TAU379 amyloid f1 g3p US20150376239 SEQ ID NO: 3 3326 proteins TAU380 amyloid fd g3p US20150376239 SEQ ID NO: 30 3327 proteins TAU381 amyloid Construct 8, rs- US20150376239 SEQ ID NO: 31 3328 proteins g3p (If1-N1N2)- hIgG1-Fc TAU382 amyloid consensus US20150376239 SEQ ID NO: 4 3329 proteins sequence of M13 g3p, fd g3p, f1 g3p TAU383 amyloid I2-2 g3p US20150376239 SEQ ID NO: 5 3330 proteins TAU384 amyloid Ike g3p US20150376239 SEQ ID NO: 6 3331 proteins TAU385 amyloid consensus US20150376239 SEQ ID NO: 7 3332 proteins sequence of I2-2 g3p, Ike g3p TAU386 amyloid If1 g3p US20150376239 SEQ ID NO: 8 3333 proteins TAU387 amyloid Construct 4 US20150376239 SEQ ID NO: 9 3334 proteins TAU388 PrP ICSM181c US20140294844 SEQ ID NO: 6 3335 TAU389 PrPC and/or U.S. Pat. No. 8,852,587 SEQ ID NO: 3 3336 PrPSc TAU390 tau US20140302046 SEQ ID NO: 103 3337 TAU391 B-amyloid Heavy chain 1B 1-40 US20100323905 SEQ ID NO: 92 3338 variable region antibody TAU392 B-amyloid Heavy chain 3A 1-42 US20100323905 SEQ ID NO: 94 3339 variable region antibody TAU393 B-amyloid Heavy chain FC5 US20100323905 SEQ ID NO: 96 3340 variable region antibody TAU394 Tau Chain A, Cehlar, O. et al., Structure Of Tau 3341 Structure Of Peptide In Complex With Tau5 Tau Peptide Antib Fragment, unpublished, In Complex 4TQE_A With Tau5 Antibody Fab Fragment TAU395 Tau Chain A and Shih, H. H., et al., An ultra-specific 3342 B, Structure avian antibody to phosphorylated Of The Anti- tau protein reveals a unique ptau Fab mechanism for phosphoepitope (pt231/ps235_1) recognition, J. Biol. Chem. 287 In (53), 44425-44434 (2012), Complex Accession number 4GLR_A and With 4GLR_B Phosphoepitope Pt231/ps235 TAU396 Tau Chain P, At8 Fab Malia, T. J. et al, Epitope mapping 3343 Anti-tau At8 and structural basis for the Fab With recognition of phosphorylated tau Doubly by the anti-tau antibody AT8, Phosphorylated Proteins 84 (4), 427-434 (2016), Tau Accession number 5E2V_P Peptide TAU397 Tau Chain P, At8 Fab Malia, T. J. et al, Epitope mapping 3344 Anti-tau At8 and structural basis for the Fab With recognition of phosphorylated tau Triply by the anti-tau antibody AT8, Phosphorylated Proteins 84 (4), 427-434 (2016), Tau Accession number 5E2W_P Peptide TAU398 Tau Chain P, X- Rb86 Bujotzek, A. et al, VH-VL 3345 ray Structure orientation prediction for antibody Of The Fab humanization candidate selection: A Fragment Of case study, MAbs 8 (2), 288-305 The Anti Tau (2016), Accession number Antibody 5DMG_P, 5DMG_X, 5DMG_Z Rb86 In Complex With The Phosphorylated Tau Peptide (416-430) TAU399 Tau Heavy chain cDC8E8 VH WO2016079597 SEQ ID NO: 9; 3346 US20150050215 SEQ ID NO: 138 TAU400 Tau Heavy chain RHA-IgG1 WO2016079597 SEQ ID NO: 28 3347 TAU401 Tau Heavy chain RHB-IgG1 WO2016079597 SEQ ID NO: 29 3348 TAU402 Tau Heavy chain RHC-IgG1 WO2016079597 SEQ ID NO: 30 3349 TAU403 Tau Heavy chain RHD-IgG1 WO2016079597 SEQ ID NO: 31 3350 TAU404 Tau Heavy chain RHE-IgG1 WO2016079597 SEQ ID NO: 32 3351 TAU405 Tau Heavy chain RHF-IgG1 WO2016079597 SEQ ID NO: 33 3352 TAU406 Tau Heavy chain RHG-IgG1 WO2016079597 SEQ ID NO: 34 3353 TAU407 Tau Heavy chain RHH-IgG1 WO2016079597 SEQ ID NO: 35 3354 TAU408 Tau Heavy chain RHI-IgG1 WO2016079597 SEQ ID NO: 36 3355 TAU409 Tau Heavy chain RHJ-IgG1 WO2016079597 SEQ ID NO: 37 3356 TAU410 Tau Heavy chain RHK-IgG1 WO2016079597 SEQ ID NO: 38 3357 TAU411 Tau Heavy chain RHL-IgG1 WO2016079597 SEQ ID NO: 39 3358 TAU412 Tau Heavy chain RHM-IgG1 WO2016079597 SEQ ID NO: 40 3359 TAU413 Tau Heavy chain cDC8E8-IgG1 WO2016079597 SEQ ID NO: 41 3360 TAU414 Tau Heavy chain mouse DC8E8- WO2016079597 SEQ ID NO: 42 3361 IgG1 TAU415 Tau Heavy chain RHA-IgG4 WO2016079597 SEQ ID NO: 43 3362 TAU416 Tau Heavy chain RHB-IgG4 WO2016079597 SEQ ID NO: 44 3363 TAU417 Tau Heavy chain RHC-IgG4 WO2016079597 SEQ ID NO: 45 3364 TAU418 Tau Heavy chain RHD-IgG4 WO2016079597 SEQ ID NO: 46 3365 TAU419 Tau Heavy chain RHE-IgG4 WO2016079597 SEQ ID NO: 47 3366 TAU420 Tau Heavy chain RHF-IgG4 WO2016079597 SEQ ID NO: 48 3367 TAU421 Tau Heavy chain RHG-IgG4 WO2016079597 SEQ ID NO: 49 3368 TAU422 Tau Heavy chain RHH-IgG4 WO2016079597 SEQ ID NO: 50 3369 TAU423 Tau Heavy chain RHI-IgG4 WO2016079597 SEQ ID NO: 51 3370 TAU424 Tau Heavy chain RHJ-IgG4 WO2016079597 SEQ ID NO: 52 3371 TAU425 Tau Heavy chain RHK-IgG4 WO2016079597 SEQ ID NO: 53 3372 TAU426 Tau Heavy chain RHL-IgG4 WO2016079597 SEQ ID NO: 54 3373 TAU427 Tau Heavy chain RHM-IgG4 WO2016079597 SEQ ID NO: 55 3374 TAU428 Tau Heavy chain cDC8E8-IgG4 WO2016079597 SEQ ID NO: 56 3375 TAU429 Tau Heavy chain DC8E8 WO2016079597 SEQ ID NO: 90 3376 TAU430 Tau Heavy chain cDC8E8 WO2016079597 SEQ ID NO: 92 3377 TAU431 Tau Heavy chain OptiDC8E8 WO2016079597 SEQ ID NO: 94 3378 TAU432 Tau Heavy chain RHA WO2016079597 SEQ ID NO: 96 3379 TAU433 Tau Heavy chain RHB WO2016079597 SEQ ID NO: 97 3380 TAU434 Tau Heavy chain RHC WO2016079597 SEQ ID NO: 98 3381 TAU435 Tau Heavy chain RHD WO2016079597 SEQ ID NO: 99 3382 TAU436 Tau Heavy chain RHE WO2016079597 SEQ ID NO: 100 3383 TAU437 Tau Heavy chain RHF WO2016079597 SEQ ID NO: 101 3384 TAU438 Tau Heavy chain RHG WO2016079597 SEQ ID NO: 102 3385 TAU439 Tau Heavy chain RHH WO2016079597 SEQ ID NO: 103 3386 TAU440 Tau Heavy chain RHI WO2016079597 SEQ ID NO: 104 3387 TAU441 Tau Heavy chain RHJ WO2016079597 SEQ ID NO: 105 3388 TAU442 Tau Heavy chain RHK WO2016079597 SEQ ID NO: 106 3389 TAU443 Tau Heavy chain RHL WO2016079597 SEQ ID NO: 107 3390 TAU444 Tau Heavy chain RHM WO2016079597 SEQ ID NO: 108 3391 TAU445 Tau Heavy chain RHA-IgG1 WO2016079597 SEQ ID NO: 111 3392 TAU446 Tau Heavy chain RHB-IgG1 WO2016079597 SEQ ID NO: 112 3393 TAU447 Tau Heavy chain RHC-IgG1 WO2016079597 SEQ ID NO: 113 3394 TAU448 Tau Heavy chain RHD-IgG1 WO2016079597 SEQ ID NO: 114 3395 TAU449 Tau Heavy chain RHE-IgG1 WO2016079597 SEQ ID NO: 115 3396 TAU450 Tau Heavy chain RHF-IgG1 WO2016079597 SEQ ID NO: 116 3397 TAU451 Tau Heavy chain RHG-IgG1 WO2016079597 SEQ ID NO: 117 3398 TAU452 Tau Heavy chain RHH-IgG1 WO2016079597 SEQ ID NO: 118 3399 TAU453 Tau Heavy chain RHI-IgG1 WO2016079597 SEQ ID NO: 119 3400 TAU454 Tau Heavy chain RHJ-IgG1 WO2016079597 SEQ ID NO: 120 3401 TAU455 Tau Heavy chain RHK-IgG1 WO2016079597 SEQ ID NO: 121 3402 TAU456 Tau Heavy chain RHL-IgG1 WO2016079597 SEQ ID NO: 122 3403 TAU457 Tau Heavy chain RHM-IgG1 WO2016079597 SEQ ID NO: 123 3404 TAU458 Tau Heavy chain cDC8E8-IgG1 WO2016079597 SEQ ID NO: 124 3405 TAU459 Tau Heavy chain mouse DC8E8- WO2016079597 SEQ ID NO: 125 3406 IgG1 TAU-460 Tau Heavy chain codon opt mouse WO2016079597 SEQ ID NO: 126 3407 DC8E8 TAU461 Tau Heavy chain RHA-IgG4 WO2016079597 SEQ ID NO: 127 3408 TAU462 Tau Heavy chain RHB-IgG4 WO2016079597 SEQ ID NO: 128 3409 TAU463 Tau Heavy chain RHC-IgG4 WO2016079597 SEQ ID NO: 129 3410 TAU464 Tau Heavy chain RHD-IgG4 WO2016079597 SEQ ID NO: 130 3411 TAU465 Tau Heavy chain RHE-IgG4 WO2016079597 SEQ ID NO: 131 3412 TAU466 Tau Heavy chain RHF-IgG4 WO2016079597 SEQ ID NO: 132 3413 TAU467 Tau Heavy chain RHG-IgG4 WO2016079597 SEQ ID NO: 133 3414 TAU468 Tau Heavy chain RHH-IgG4 WO2016079597 SEQ ID NO: 134 3415 TAU469 Tau Heavy chain RHI-IgG4 WO2016079597 SEQ ID NO: 135 3416 TAU470 Tau Heavy chain RHJ-IgG4 WO2016079597 SEQ ID NO: 136 3417 TAU471 Tau Heavy chain RHK-IgG4 WO2016079597 SEQ ID NO: 137 3418 TAU472 Tau Heavy chain RHL-IgG4 WO2016079597 SEQ ID NO: 138 3419 TAU473 Tau Heavy chain RHM-IgG4 WO2016079597 SEQ ID NO: 139 3420 TAU474 Tau Heavy chain cDC8E8-IgG4 WO2016079597 SEQ ID NO: 140 3421 TAU475 Tau Heavy chain U.S. Pat. No. 8,697,076 SEQ ID NO: 12 3422 TAU476 Tau Heavy chain 5202.4 US20160024193 SEQ ID NO: 63 3423 TAU477 Tau Heavy chain US20160031977 SEQ ID NO: 22 3424 TAU478 Tau Heavy chain US20160031977 SEQ ID NO: 24 3425 TAU479 Tau Heavy chain US20160031977 SEQ ID NO: 26 3426 TAU480 Tau heavy chain ch4A3-mIgG1- US20150344553 SEQ ID NO: 213 3427 Agly TAU481 Tau heavy chain ch4E4(N30Q)- US20150344553 SEQ ID NO: 214 3428 mIgG1-Agly TAU482 Tau heavy chain ch6C5-mIgG1- US20150344553 SEQ ID NO: 215 3429 Agly TAU483 Tau heavy chain ch17C1-mIgG1- US20150344553 SEQ ID NO: 216 3430 Agly TAU484 Tau Heavy chain human NI- US20150344553 SEQ ID NO: 218 3431 105.40E8(R104W)- hIgG1 TAU485 Tau Heavy chain NI- US20150344553 SEQ ID NO: 43; 3432 105.4E4(N30Q) U.S. Pat. No. 8,940,272 SEQ ID NO: 93 TAU486 Tau Heavy chain US20150050215 SEQ ID NO: 140 3433 TAU487 Tau Heavy chain US20150050215 SEQ ID NO: 142 3434 TAU488 Tau Heavy chain pT231/pS235 WO2014016737 SEQ ID NO: 70 3435 TAU489 Tau heavy chain ch40E8(R104W) US20150344553 SEQ ID NO: 208 3436 (mouse IgG2a) TAU490 Tau heavy chain ch17C1 US20150344553 SEQ ID NO: 203 3437 (mouse IgG2a) TAU491 Tau heavy chain ch6C5 US20150344553 SEQ ID NO: 205 3438 (mouse IgG2a) TAU492 Tau heavy chain ch40E8 US20150344553 SEQ ID NO: 207 3439 (mouse IgG2a) TAU493 Tau heavy chain ch6E3 US20150344553 SEQ ID NO: 210 3440 (mouse IgG2a) TAU494 Tau heavy chain WO2016079597 SEQ ID NO: 172 3441 constant region TAU495 Tau heavy chain WO2016079597 SEQ ID NO: 173 3442 constant region TAU496 Tau Heavy chain WO2015197823 SEQ ID NO: 83 3443 constant region, IgGI TAU497 Tau Heavy chain ch4E4(N30Q) U.S. Pat. No. 8,940,272 SEQ ID NO: 22 3444 mature (mouse IgG2a) TAU498 Tau Heavy chain ch4E4 U.S. Pat. No. 8,940,272 SEQ ID NO: 20 3445 mature (mouse IgG2a) TAU499 Tau Heavy chain ch4E4 US20150344553 SEQ ID NO: 20 3446 mature (mouse IgG2a) TAU500 Tau Heavy chain ch4E4(N30Q) US20150344553 SEQ ID NO: 22 3447 mature (mouse IgG2a) TAU501 Tau Heavy chain NI-105.4A3-VH US20150344553 SEQ ID NO: 17; 3448 variable U.S. Pat. No. 8,940,272 SEQ ID NO: 17 TAU502 Tau Heavy chain NI-105.24B2- US20150344553 SEQ ID NO: 13; 3449 variable VH U.S. Pat. No. 8,940,272 SEQ ID NO: 13 TAU503 Tau Heavy chain NI-105.4E4-VH US20150344553 SEQ ID NO: 9; 3450 variable U.S. Pat. No. 8,940,272 SEQ ID NO: 9 TAU504 Tau Heavy chain US20150307600 SEQ ID NO: 35 3451 variable TAU505 Tau Heavy chain US20150307600 SEQ ID NO: 37 3452 variable TAU506 Tau Heavy chain RHA WO2016079597 SEQ ID NO: 13 3453 variable region TAU507 Tau Heavy chain RHB WO2016079597 SEQ ID NO: 14 3454 variable region TAU508 Tau Heavy chain RHC WO2016079597 SEQ ID NO: 15 3455 variable region TAU509 Tau Heavy chain RHD WO2016079597 SEQ ID NO: 16 3456 variable region TAU510 Tau Heavy chain RHE WO2016079597 SEQ ID NO: 17 3457 variable region TAU511 Tau Heavy chain RHF WO2016079597 SEQ ID NO: 18 3458 variable region TAU512 Tau Heavy chain RHG WO2016079597 SEQ ID NO: 19 3459 variable region TAU513 Tau Heavy chain RHH WO2016079597 SEQ ID NO: 20 3460 variable region TAU514 Tau Heavy chain RHI WO2016079597 SEQ ID NO: 21 3461 variable region TAU515 Tau Heavy chain RHJ WO2016079597 SEQ ID NO: 22 3462 variable region TAU516 Tau Heavy chain RHK WO2016079597 SEQ ID NO: 23 3463 variable region TAU517 Tau Heavy chain RHL WO2016079597 SEQ ID NO: 24 3464 variable region TAU518 Tau Heavy chain RHM WO2016079597 SEQ ID NO: 25 3465 variable region TAU519 Tau Heavy chain U.S. Pat. No. 8,697,076 SEQ ID NO: 7 3466 variable region TAU520 Tau Heavy chain US20160024193 SEQ ID NO: 58 3467 variable and 62 region TAU521 Tau Heavy chain 16B5 US20160031976 SEQ ID NO: 10 3468 variable region TAU522 Tau Heavy chain NI-105.17C1 US20150344553 SEQ ID NO: 45 3469 variable region TAU523 Tau Heavy chain NI-105.6C5 US20150344553 SEQ ID NO: 48 3470 variable region TAU524 Tau Heavy chain NI-105.29G10 US20150344553 SEQ ID NO: 50 3471 variable region TAU525 Tau Heavy chain NI-105.6L9 US20150344553 SEQ ID NO: 52 3472 variable region TAU526 Tau Heavy chain NI-105.40E8 US20150344553 SEQ ID NO: 54 3473 variable region TAU527 Tau Heavy chain NI-105.40E8 US20150344553 SEQ ID NO: 220 3474 variable R104W region TAU528 Tau Heavy chain NI-105.48E5 US20150344553 SEQ ID NO: 56 3475 variable region TAU529 Tau Heavy chain NI-105.6E3 US20150344553 SEQ ID NO: 58 3476 variable region TAU530 Tau Heavy chain NI-105.22E1 US20150344553 SEQ ID NO: 60 3477 variable region TAU531 Tau Heavy chain NI-105.26B12 US20150344553 SEQ ID NO: 62 3478 variable region TAU532 Tau Heavy chain NI-105.12E12 US20150344553 SEQ ID NO: 65 3479 variable region TAU533 Tau Heavy chain NI-105.60E7 US20150344553 SEQ ID NO: 67 3480 variable region TAU534 Tau Heavy chain NI-105.14E2 US20150344553 SEQ ID NO: 69 3481 variable region TAU535 Tau Heavy chain NI-105.39E2 US20150344553 SEQ ID NO: 71 3482 variable region TAU536 Tau Heavy chain NI-105.19C6 US20150344553 SEQ ID NO: 73 3483 variable region TAU537 Tau Heavy chain NI-105.9C4 US20150344553 SEQ ID NO: 76 3484 variable region TAU538 Tau Heavy chain 19.3 US20150320860 SEQ ID NO: 7 3485 variable region TAU539 Tau Heavy chain 3-66 US20150320860 SEQ ID NO: 8 3486 variable region TAU540 Tau Heavy chain US20150253341 SEQ ID NO: 37 3487 variable region TAU541 Tau Heavy chain NI-101.10 US20150147343 SEQ ID NO: 4 3488 variable region TAU542 Tau Heavy chain NI-101.11 US20150147343 SEQ ID NO: 6 3489 variable region TAU543 Tau Heavy chain NI-101.12 US20150147343 SEQ ID NO: 10 3490 variable region TAU544 Tau Heavy chain NI-101.13; NI- US20150147343 SEQ ID NO: 14, 3491 variable 101.13A; NI- 42, 43 region 101.13B TAU545 Tau Heavy chain NI-101.12F6A US20150147343 SEQ ID NO: 39 3492 variable region TAU546 Tau Heavy chain Ta1501 US20150183854 SEQ ID NO: 18 3493 variable region TAU547 Tau Heavy chain Ta1502 US20150183854 SEQ ID NO: 19 3494 variable region TAU548 Tau Heavy chain Ta1505 US20150183854 SEQ ID NO: 20 3495 variable region TAU549 Tau Heavy chain Ta1506 US20150183854 SEQ ID NO: 21 3496 variable region TAU550 Tau Heavy chain Ta1507 US20150183854 SEQ ID NO: 22 3497 variable region TAU551 Tau Heavy chain Ta1508 US20150183854 SEQ ID NO: 23 3498 variable region TAU552 Tau Heavy chain Ta1509 US20150183854 SEQ ID NO: 24 3499 variable region TAU553 Tau Heavy chain US20150050215 SEQ ID NO: 145 3500 variable region TAU554 Tau Heavy chain US20150050215 SEQ ID NO: 147 3501 variable region TAU555 Tau Heavy chain US20150050215 SEQ ID NO: 148 3502 variable region TAU556 Tau Heavy chain U.S. Pat. No. 8,980,270 SEQ ID NO: 14 3503 variable region TAU557 Tau Heavy chain U.S. Pat. No. 8,980,270 SEQ ID NO: 16 3504 variable region TAU558 Tau Heavy chain US20150183855 SEQ ID NO: 15; 3505 variable WO2016126993 SEQ ID NO: 15 region TAU559 Tau Heavy chain CBTAU-7.1 WO2015197823 SEQ ID NO: 87 3506 variable region TAU560 Tau Heavy chain CBTAU-8.1 WO2015197823 SEQ ID NO: 91 3507 variable region TAU561 Tau Heavy chain CBTAU-16.1 WO2015197823 SEQ ID NO: 95 3508 variable region TAU562 Tau Heavy chain CBTAU-18.1 WO2015197823 SEQ ID NO: 99 3509 variable region TAU563 Tau Heavy chain CBTAU-20.1 WO2015197823 SEQ ID NO: 103 3510 variable region TAU564 Tau Heavy chain CBTAU-22.1 WO2015197823 SEQ ID NO: 107 3511 variable region TAU565 Tau Heavy chain CBTAU-24.1 WO2015197823 SEQ ID NO: 111 3512 variable region TAU566 Tau Heavy chain CBTAU-27.1 WO2015197823 SEQ ID NO: 115 3513 variable region TAU567 Tau Heavy chain CBTAU 28.1 WO2015197823 SEQ ID NO: 119 3514 variable region TAU568 Tau Heavy chain CBTAU-41.1 WO2015197823 SEQ ID NO: 123 3515 variable region TAU569 Tau Heavy chain CBTAU-41.2 WO2015197823 SEQ ID NO: 127 3516 variable region TAU570 Tau Heavy chain CBTAU-42.1 WO2015197823 SEQ ID NO: 131 3517 variable region TAU571 Tau Heavy chain CBTAU 43.1 WO2015197823 SEQ ID NO: 135 3518 variable region TAU572 Tau Heavy chain CBTAU 44.1 WO2015197823 SEQ ID NO: 139 3519 variable region TAU573 Tau Heavy chain CBTAU 45.1 WO2015197823 SEQ ID NO: 143 3520 variable region TAU574 Tau Heavy chain CBTAU 46.1 WO2015197823 SEQ ID NO: 147 3521 variable region TAU575 Tau Heavy chain CBTAU 47.1 WO2015197823 SEQ ID NO: 151 3522 variable region TAU576 Tau Heavy chain CBTAU 47.2 WO2015197823 SEQ ID NO: 155 3523 variable region TAU577 Tau Heavy chain CBTAU 49.1 WO2015197823 SEQ ID NO: 159 3524 variable region TAU578 Tau Heavy chain Native 7.1 WO2015197823 SEQ ID NO: 257 3525 variable region TAU579 Tau Heavy chain Native 8.1 WO2015197823 SEQ ID NO: 261 3526 variable region TAU580 Tau Heavy chain Native 16.1 WO2015197823 SEQ ID NO: 265 3527 variable region TAU581 Tau Heavy chain Native 18.1 WO2015197823 SEQ ID NO: 269 3528 variable region TAU582 Tau Heavy chain Native 20.1 WO2015197823 SEQ ID NO: 272 3529 variable region TAU583 Tau Heavy chain Native 22.1 WO2015197823 SEQ ID NO: 275 3530 variable region TAU584 Tau Heavy chain Native 24.1 WO2015197823 SEQ ID NO: 279 3531 variable region TAU585 Tau Heavy chain Native 27.1 WO2015197823 SEQ ID NO: 282 3532 variable region TAU586 Tau Heavy chain Native 28.1 WO2015197823 SEQ ID NO: 284 3533 variable region TAU587 Tau Heavy chain Native 41.1; WO2015197823 SEQ ID NO: 287, 3534 variable Native 41.2 289 region TAU588 Tau Heavy chain Native 42.1 WO2015197823 SEQ ID NO: 292 3535 variable region TAU589 Tau Heavy chain Native 43.1 WO2015197823 SEQ ID NO: 295 3536 variable region TAU590 Tau Heavy chain Native 44.1 WO2015197823 SEQ ID NO: 298 3537 variable region TAU591 Tau Heavy chain Native 45.1 WO2015197823 SEQ ID NO: 302 3538 variable region TAU592 Tau Heavy chain Native 46.1 WO2015197823 SEQ ID NO: 306 3539 variable region TAU593 Tau Heavy chain Native 47.1 WO2015197823 SEQ ID NO: 309 3540 variable region TAU594 Tau Heavy chain Native 47.2 WO2015197823 SEQ ID NO: 311 3541 variable region TAU595 Tau Heavy chain Native 49.1 WO2015197823 SEQ ID NO: 313 3542 variable region TAU596 Tau Heavy chain 6B2G12; WO2016007414 SEQ ID NO: 9 and 3543 variable scFv235 11 region TAU597 Tau Heavy chain WO2015120364 SEQ ID NO: 30 3544 variable region TAU 598 Tau Heavy chain WO2015120364 SEQ ID NO: 42 3545 variable region TAU599 Tau Heavy chain pT231/pS235_1; WO2014016737 SEQ ID NO: 15 3546 variable pT231/pS235_2 and 17 region TAU600 Tau Heavy chain pT212/pS214_1 WO2014016737 SEQ ID NO: 19 3547 variable region TAU601 Tau Heavy chain pT212/pS214_2 WO2014016737 SEQ ID NO: 21 3548 variable region TAU602 Tau Heavy chain pS396/pS404_1 WO2014016737 SEQ ID NO: 23 3549 variable region TAU603 Tau Heavy chain pS396/pS404_2 WO2014016737 SEQ ID NO: 25 3550 variable region TAU604 Tau Heavy chain 2H9 WO2014096321 SEQ ID NO: 11 3551 variable region TAU605 Tau Heavy chain WO2015122922 SEQ ID NO: 16 3552 variable and 24 region TAU606 Tau Heavy chain WO2015122922 SEQ ID NO: 32 3553 variable region TAU607 Tau Heavy chain WO2015122922 SEQ ID NO: 40 3554 variable region TAU608 Tau Heavy chain WO2015122922 SEQ ID NO: 48 3555 variable region TAU609 Tau Heavy chain WO2015122922 SEQ ID NO: 56 3556 variable region TAU610 Tau Heavy chain WO2015122922 SEQ ID NO: 64 3557 variable region TAU611 Tau Heavy chain WO2015122922 SEQ ID NO: 72 3558 variable region TAU612 Tau Heavy chain US20150320860 SEQ ID NO: 34 3559 variable region fused with a human IgG2 heavy chain constant region TAU613 Tau Heavy chain NI-105.17C1 US20150344553 SEQ ID NO: 44 3560 variable region, before germlining TAU614 Tau Heavy chain NI-105.6C5 US20150344553 SEQ ID NO: 47 3561 variable region, before germlining TAU615 Tau Heavy chain NI-105.26B12 US20150344553 SEQ ID NO: 63 3562 variable region, before germlining TAU616 Tau Heavy chain NI-105.9C4 US20150344553 SEQ ID NO: 75 3563 variable region, before germlining TAU617 Tau Heavy chain variant 1-VH32 US20150175685 SEQ ID NO: 19; 3564 variable WO2015197735 SEQ ID NO: 19 region, humanized TAU618 Tau Heavy chain variant 2-VH20 US20150175685 SEQ ID NO: 20; 3565 variable WO2015197735 SEQ ID NO: 20 region, humanized TAU619 Tau Heavy chain IPN002 VH U.S. Pat. No. 8,980,270 SEQ ID NO: 36 3566 variable variant 1 region, humanized TAU1620 Tau Heavy chain IPN002 VH U.S. Pat. No. 8,980,270 SEQ ID NO: 37 3567 variable variant 2 region, humanized TAU621 Tau Heavy chain IPN002 VH U.S. Pat. No. 8,980,270 SEQ ID NO: 38 3568 variable variant 3 region, humanized TAU622 Tau Heavy chain IPN002 VH U.S. Pat. No. 8,980,270 SEQ ID NO: 39 3569 variable variant 4 region, humanized TAU623 Tau Heavy chain, BACO2002. 1 US20160031976 SEQ ID NO: 14 3570 human Ig TAU624 Tau Heavy chain, US20160031976 SEQ ID NO: 29 3571 human IgG1 constant region TAU625 Tau Heavy chain, TAM_1, US20160024193 SEQ ID NO: 87 3572 IgG1 TAM_2, TAM_3, TAM_4, TAM_5, TAM_6, TAM_7, TAM_8, TAM_9, TAM_10, TAM_11, TAM_12, TAM_13, TAM_14, TAM_15, TAM_16, TAM_17, TAM_18, TAM_19, TAM_20, TAM_21, TAM_22, TAM_23 TAU626 Tau Heavy chain, TAM_1, US20160024193 SEQ ID NO: 88 3573 IgG1 N297G TAM_2, TAM_3, TAM_4, TAM_5, TAM_6, TAM_7, TAM_8, TAM_9, TAM_10, TAM_11, TAM_12, TAM_13, TAM_14, TAM_15, TAM_16, TAM_17, TAM_18, TAM_19, TAM_20, TAM_21, TAM_22, TAM_23 TAU627 Tau Heavy chain, TAM_1, US20160024193 SEQ ID NO: 86 3574 IgG4 isotypes TAM_2, TAM_3, TAM_4, TAM_5, TAM_6, TAM_7, TAM_8, TAM_9, TAM_10, TAM_11, TAM_12, TAM_13, TAM_14, TAM_15, TAM_16, TAM_17, TAM_18, TAM_19, TAM_20, TAM_21, TAM_22, TAM_23 TAU628 Tau Heavy chain, US20160031976 SEQ ID NO: 15 3575 mature TAU629 Tau heavy-chain Tau-A2-SH WO2015114538 SEQ ID NO: 14 3576 antibody; camelid TAU630 Tau heavy-chain TauA2var-SH WO2015114538 SEQ ID NO: 17 3577 antibody; Camelid TAU631 Tau heavy-chain Tau-A2 variant WO2015114538 SEQ ID NO: 15 3578 antibody; Camelid TAU632 Tau heavy-chain Tau-A2 variant WO2015114538 SEQ ID NO: 16 3579 antibody; Camelid TAU633 Tau Light chain cDC8E8 VK US20150050215 SEQ ID NO: 141; 3580 WO2016079597 SEQ ID NO: 10 TAU634 Tau Light chain RKA WO2016079597 SEQ ID NO: 57 3581 TAU635 Tau Light chain cDC8E8 WO2016079597 SEQ ID NO: 59 3582 TAU636 Tau Light chain OptiDC8E8 WO2016079597 SEQ ID NO: 95 3583 TAU637 Tau Light chain RKA WO2016079597 SEQ ID NO: 109 3584 TAU638 Tau Light chain RKB WO2016079597 SEQ ID NO: 110 3585 TAU639 Tau Light chain RKA WO2016079597 SEQ ID NO: 141 3586 TAU640 Tau Light chain RKB WO2016079597 SEQ ID NO: 142 3587 TAU641 Tau Light chain cDC8E8 WO2016079597 SEQ ID NO: 143 3588 TAU642 Tau Light chain U.S. Pat. No. 8,697,076 SEQ ID NO: 14 3589 TAU643 Tau Light chain 5202.4 US20160024193 SEQ ID NO: 61 3590 TAU644 Tau Light chain TAM_1 US20160024193 SEQ ID NO: 64 3591 TAU645 Tau Light chain TAM_2 US20160024193 SEQ ID NO: 65 3592 TAU646 Tau Light chain TAM_3 US20160024193 SEQ ID NO: 66 3593 TAU647 Tau Light chain TAM_4 US20160024193 SEQ ID NO: 67 3594 TAU648 Tau Light chain TAM_5 US20160024193 SEQ ID NO: 68 3595 TAU649 Tau Light chain TAM_6 US20160024193 SEQ ID NO: 69 3596 TAU650 Tau Light chain TAM_7 US20160024193 SEQ ID NO: 70 3597 TAU651 Tau Light chain TAM_8 US20160024193 SEQ ID NO: 71 3598 TAU652 Tau Light chain TAM_9 US20160024193 SEQ ID NO: 72 3599 TAU653 Tau Light chain TAM_10 US20160024193 SEQ ID NO: 73 3600 TAU654 Tau Light chain TAM_11 US20160024193 SEQ ID NO: 74 3601 TAU655 Tau Light chain TAM_12 US20160024193 SEQ ID NO: 75 3602 TAU656 Tau Light chain TAM_13 US20160024193 SEQ ID NO: 76 3603 TAU657 Tau Light chain TAM_14 US20160024193 SEQ ID NO: 77 3604 TAU658 Tau Light chain TAM_15 US20160024193 SEQ ID NO: 78 3605 TAU659 Tau Light chain TAM_16 US20160024193 SEQ ID NO: 79 3606 TAU660 Tau Light chain TAM_17 US20160024193 SEQ ID NO: 80 3607 TAU661 Tau Light chain TAM_18 US20160024193 SEQ ID NO: 81 3608 TAU662 Tau Light chain TAM_19 US20160024193 SEQ ID NO: 82 3609 TAU663 Tau Light chain TAM_20; US20160024193 SEQ ID NO: 83 3610 TAM_22 and 85 TAU664 Tau Light chain TAM_21 US20160024193 SEQ ID NO: 84 3611 TAU665 Tau Light chain US20160031977 SEQ ID NO: 23 3612 TAU666 Tau Light chain US20160031977 SEQ ID NO: 25 3613 TAU667 Tau Light chain US20160031977 SEQ ID NO: 27 3614 TAU668 Tau Light chain US20160031977 SEQ ID NO: 28 3615 TAU669 Tau Light chain US20150050215 SEQ ID NO: 139 3616 TAU670 Tau Light chain US20150050215 SEQ ID NO: 143 3617 TAU671 Tau Light Chain pT231/pS235 WO2014016737 SEQ ID NO: 71 3618 TAU672 Tau Light chain RKB WO2016079597 SEQ ID NO: 58 3619 TAU673 Tau Light chain cDC8E8 WO2016079597 SEQ ID NO: 93 3620 TAU674 Tau light chain ch40E8 US20150344553 SEQ ID NO: 209 3621 (lambda) TAU675 Tau light chain ch6E3 US20150344553 SEQ ID NO: 211 3622 (mouse kappa) TAU676 Tau light chain ch17C1 US20150344553 SEQ ID NO: 204 3623 (mouse lambda) TAU677 Tau light chain ch6C5 US20150344553 SEQ ID NO: 206 3624 (mouse lambda) TAU678 Tau light chain ch17C1(N31Q) US20150344553 SEQ ID NO: 212 3625 (mouse lambda) TAU679 Tau light chain WO2016079597 SEQ ID NO: 170; 3626 constant WO2015197823 SEQ ID NO: 84; region US20150320860 SEQ ID NO: 36; WO2015197735 SEQ ID NO: 59; U.S. Pat. No. 9,290,567 SEQ ID NO: 11 TAU680 Tau light chain WO2016079597 SEQ ID NO: 171; 3627 constant US20160031976 SEQ ID NO: 32 region TAU681 Tau Light chain human NI- US20150344553 SEQ ID NO: 219 3628 lambda 105.40E8 light chain TAU682 Tau Light chain ch17C1(N31Q, US20150344553 SEQ ID NO: 217 3629 lambda I48V) mouse TAU683 Tau Light chain ch4E4 US20150344553 SEQ ID NO: 21; 3630 mature U.S. Pat. No. 8,940,272 SEQ ID NO: 21 (mouse lambda) TAU684 Tau Light chain NI-105.4A3-VL US20150344553 SEQ ID NO: 19; 3631 variable U.S. Pat. No. 8,940,272 SEQ ID NO: 19 TAU685 Tau Light chain US20150344553 SEQ ID NO: 15 3632 variable TAU686 Tau Light chain NI-105.4E4-VL; US20150344553 SEQ ID NO: 11, 3633 variable NI-105.24B2-VL 15 TAU687 Tau Light chain US20150307600 SEQ ID NO: 36 3634 variable TAU688 Tau Light chain US20150307600 SEQ ID NO: 38 3635 variable TAU689 Tau Light chain RKA WO2016079597 SEQ ID NO: 26 3636 variable region TAU690 Tau Light chain RKB WO2016079597 SEQ ID NO: 27 3637 variable region TAU691 Tau Light chain DC8E8 WO2016079597 SEQ ID NO: 91 3638 variable region TAU692 Tau Light chain U.S. Pat. No. 8,940,272 SEQ ID NO: 15 3639 variable region TAU693 Tau Light chain U.S. Pat. No. 8,697,076 SEQ ID NO: 8 3640 variable region TAU694 Tau Light chain US20160024193 SEQ ID NO: 36 3641 variable region TAU695 Tau Light chain US20160024193 SEQ ID NO: 37 3642 variable region TAU696 Tau Light chain US20160024193 SEQ ID NO: 38 3643 variable region TAU697 Tau Light chain US20160024193 SEQ ID NO: 39 3644 variable region TAU698 Tau Light chain US20160024193 SEQ ID NO: 40 3645 variable region TAU699 Tau Light chain US20160024193 SEQ ID NO: 41 3646 variable region TAU700 Tau Light chain US20160024193 SEQ ID NO: 42 3647 variable region TAU701 Tau Light chain US20160024193 SEQ ID NO: 43 3648 variable region TAU702 Tau Light chain US20160024193 SEQ ID NO: 44 3649 variable region TAU703 Tau Light chain US20160024193 SEQ ID NO: 45 3650 variable region TAU704 Tau Light chain US20160024193 SEQ ID NO: 46 3651 variable region TAU705 Tau Light chain US20160024193 SEQ ID NO: 47 3652 variable region TAU706 Tau Light chain US20160024193 SEQ ID NO: 48 3653 variable region TAU707 Tau Light chain US20160024193 SEQ ID NO: 49 3654 variable region TAU708 Tau Light chain US20160024193 SEQ ID NO: 50 3655 variable region TAU709 Tau Light chain US20160024193 SEQ ID NO: 51 3656 variable region TAU710 Tau Light chain US20160024193 SEQ ID NO: 52 3657 variable region TAU711 Tau Light chain US20160024193 SEQ ID NO: 53 3658 variable region TAU712 Tau Light chain US20160024193 SEQ ID NO: 54 3659 variable region TAU713 Tau Light chain US20160024193 SEQ ID NO: 55 3660 variable and 57 region TAU714 Tau Light chain US20160024193 SEQ ID NO: 56 3661 variable region TAU715 Tau Light chain 5202.4 US20160024193 SEQ ID NO: 60 3662 variable region TAU716 Tau Light chain NI-105.17C1 US20150344553 SEQ ID NO: 46 3663 variable region TAU717 Tau Light chain NI-105.17C1 US20150344553 SEQ ID NO: 221 3664 variable N31Q region TAU718 Tau Light chain NI-105.17C1 US20150344553 SEQ ID NO: 222 3665 variable N31Q, I48V region TAU719 Tau Light chain NI-105.6C5 US20150344553 SEQ ID NO: 49 3666 variable region TAU720 Tau Light chain M-105.29G10 US20150344553 SEQ ID NO: 51 3667 variable region TAU721 Tau Light chain NI-105.6L9 US20150344553 SEQ ID NO: 53 3668 variable region TAU722 Tau Light chain NI-105.40E8 US20150344553 SEQ ID NO: 55 3669 variable region TAU723 Tau Light chain NI-105.48E5 US20150344553 SEQ ID NO: 57 3670 variable region TAU724 Tau Light chain NI-105.6E3 US20150344553 SEQ ID NO: 59 3671 variable region TAU725 Tau Light chain NI-105.22E1 US20150344553 SEQ ID NO: 61 3672 variable region TAU726 Tau Light chain NI-105.26B13 US20150344553 SEQ ID NO: 64 3673 variable region TAU727 Tau Light chain NI-105.12E12 US20150344553 SEQ ID NO: 66 3674 variable region TAU728 Tau Light chain NI-105.60E7 US20150344553 SEQ ID NO: 68 3675 variable region TAU729 Tau Light chain NI-105.14E2 US20150344553 SEQ ID NO: 70 3676 variable region TAU730 Tau Light chain NI-105.39E2 US20150344553 SEQ ID NO: 72 3677 variable region TAU731 Tau Light chain NI-105.19C6 US20150344553 SEQ ID NO: 74 3678 variable region TAU732 Tau Light chain NI-105.9C4 US20150344553 SEQ ID NO: 78 3679 variable region TAU733 Tau Light chain 19.3 US20150320860 SEQ ID NO: 9 3680 variable region TAU734 Tau Light chain 3-66 US20150320860 SEQ ID NO: 10 3681 variable region TAU735 Tau Light chain h3B3 US20150320860 SEQ ID NO: 25 3682 variable region TAU736 Tau Light chain 19.3 US20150320860 SEQ ID NO: 26 3683 variable region TAU737 Tau Light chain 17.1 US20150320860 SEQ ID NO: 27 3684 variable region TAU738 Tau Light chain 14.2 US20150320860 SEQ ID NO: 28 3685 variable region TAU739 Tau Light chain 13.1 US20150320860 SEQ ID NO: 29 3686 variable region TAU740 Tau Light chain 7.2 US20150320860 SEQ ID NO: 30 3687 variable region TAU741 Tau Light chain 9.2 US20150320860 SEQ ID NO: 31 3688 variable region TAU742 Tau Light chain 11.4 US20150320860 SEQ ID NO: 32 3689 variable region TAU743 Tau Light chain US20150253341 SEQ ID NO: 39 3690 variable region TAU744 Tau Light chain NI-101.10; NI- US20150147343 SEQ ID NO: 8 3691 variable 101.11 region TAU745 Tau Light chain NI-101.12 US20150147343 SEQ ID NO: 12 3692 variable region TAU746 Tau Light chain NI-101.13 US20150147343 SEQ ID NO: 16 3693 variable region TAU747 Tau Light chain NI-101.12F6A US20150147343 SEQ ID NO: 41 3694 variable region TAU748 Tau Light chain NI-101.13A US20150147343 SEQ ID NO: 44 3695 variable region TAU749 Tau Light chain NI-101.13B US20150147343 SEQ ID NO: 45 3696 variable region TAU750 Tau Light chain Ta1501 US20150183854 SEQ ID NO: 25 3697 variable region TAU751 Tau Light chain Ta1502; Ta1505 US20150183854 SEQ ID NO: 26 3698 variable region TAU752 Tau Light chain Ta1506 US20150183854 SEQ ID NO: 27 3699 variable region TAU753 Tau Light chain Ta1507 US20150183854 SEQ ID NO: 28 3700 variable region TAU754 Tau Light chain Ta1508 US20150183854 SEQ ID NO: 29 3701 variable region TAU755 Tau Light chain Ta1509 US20150183854 SEQ ID NO: 30 3702 variable region TAU756 Tau Light chain US20150050215 SEQ ID NO: 150 3703 variable region TAU757 Tau Light chain US20150050215 SEQ ID NO: 152 3704 variable region TAU758 Tau Light chain US20150050215 SEQ ID NO: 153 3705 variable region TAU759 Tau Light chain U.S. Pat. No. 8,980,270 SEQ ID NO: 13 3706 variable region TAU760 Tau Light chain U.S. Pat. No. 8,980,270 SEQ ID NO: 15 3707 variable region TAU761 Tau Light chain CBTAU-7.1 WO2015197823 SEQ ID NO: 88 3708 variable region TAU762 Tau Light chain CBTAU-8.1 WO2015197823 SEQ ID NO: 92 3709 variable region TAU763 Tau Light chain CBTAU-16.1 WO2015197823 SEQ ID NO: 96 3710 variable region TAU764 Tau Light chain CBTAU-18.1 WO2015197823 SEQ ID NO: 100 3711 variable region TAU765 Tau Light chain CBTAU-20.1 WO2015197823 SEQ ID NO: 104 3712 variable region TAU766 Tau Light chain CBTAU-22.1 WO2015197823 SEQ ID NO: 108 3713 variable region TAU767 Tau Light chain CBTAU-24.1 WO2015197823 SEQ ID NO: 112 3714 variable region TAU768 Tau Light chain CBTAU-27.1 WO2015197823 SEQ ID NO: 116 3715 variable region TAU769 Tau Light chain CBTAU 28.1 WO2015197823 SEQ ID NO: 120 3716 variable region TAU770 Tau Light chain CBTAU-41.1 WO2015197823 SEQ ID NO: 124 3717 variable region TAU771 Tau Light chain CBTAU-41.2 WO2015197823 SEQ ID NO: 128 3718 variable region TAU772 Tau Light chain CBTAU-42.1 WO2015197823 SEQ ID NO: 132 3719 variable region TAU773 Tau Light chain CBTAU 43.1 WO2015197823 SEQ ID NO: 136 3720 variable region TAU774 Tau Light chain CBTAU 44.1 WO2015197823 SEQ ID NO: 140 3721 variable region TAU775 Tau Light chain CBTAU 45.1 WO2015197823 SEQ ID NO: 144 3722 variable region TAU776 Tau Light chain CBTAU 46.1 WO2015197823 SEQ ID NO: 148 3723 variable region TAU777 Tau Light chain CBTAU 47.1 WO2015197823 SEQ ID NO: 152 3724 variable region TAU778 Tau Light chain CBTAU 47.2 WO2015197823 SEQ ID NO: 156 3725 variable region TAU779 Tau Light chain CBTAU 49.1 WO2015197823 SEQ ID NO: 160 3726 variable region TAU780 Tau Light chain Native 7.1 WO2015197823 SEQ ID NO: 259 3727 variable region TAU781 Tau Light chain Native 8.1 WO2015197823 SEQ ID NO: 263 3728 variable region TAU782 Tau Light chain Native 16.1 WO2015197823 SEQ ID NO: 267 3729 variable region TAU783 Tau Light chain Native 18.1 WO2015197823 SEQ ID NO: 270 3730 variable region TAU784 Tau Light chain Native 20.1 WO2015197823 SEQ ID NO: 273 3731 variable region TAU785 Tau Light chain Native 22.1 WO2015197823 SEQ ID NO: 277 3732 variable region TAU786 Tau Light chain Native 24.1 WO2015197823 SEQ ID NO: 280 3733 variable region TAU787 Tau Light chain Native 27.1 WO2015197823 SEQ ID NO: 283 3734 variable region TAU788 Tau Light chain Native 28.1 WO2015197823 SEQ ID NO: 285 3735 variable region TAU789 Tau Light chain Native 41.1 WO2015197823 SEQ ID NO: 288 3736 variable region TAU790 Tau Light chain Native 41.2; WO2015197823 SEQ ID NO: 290; 3737 variable Native 42.1 WO2015197823 SEQ ID NO: 293 region TAU791 Tau Light chain Native 43.1 WO2015197823 SEQ ID NO: 296 3738 variable region TAU792 Tau Light chain Native 44.1 WO2015197823 SEQ ID NO: 300 3739 variable region TAU793 Tau Light chain Native 45.1 WO2015197823 SEQ ID NO: 304 3740 variable region TAU794 Tau Light chain Native 46.1 WO2015197823 SEQ ID NO: 307 3741 variable region TAU795 Tau Light chain Native 47.1 WO2015197823 SEQ ID NO: 310 3742 variable region TAU796 Tau Light chain Native 47.2 WO2015197823 SEQ ID NO: 312 3743 variable region TAU797 Tau Light chain Native 49.1 WO2015197823 SEQ ID NO: 314 3744 variable region TAU798 Tau Light chain 6B2G12 WO2016007414 SEQ ID NO: 8 3745 variable region TAU799 Tau Light chain scFv235 WO2016007414 SEQ ID NO: 10 3746 variable region TAU800 Tau Light chain WO2015120364 SEQ ID NO: 24 3747 variable region TAU801 Tau Light chain WO2015120364 SEQ ID NO: 36 3748 variable region TAU802 Tau Light chain pT231/pS235_1 WO2014016737 SEQ ID NO: 14 3749 variable region TAU803 Tau Light chain pT231/pS235_2 WO2014016737 SEQ ID NO: 16 3750 variable region TAU804 Tau Light chain pT212/pS214_1 WO2014016737 SEQ ID NO: 18 3751 variable region TAU805 Tau Light chain pT212/pS214_2 WO2014016737 SEQ ID NO: 20 3752 variable region TAU806 Tau Light chain pS396/pS404_1 WO2014016737 SEQ ID NO: 22 3753 variable region TAU807 Tau Light chain pS396/pS404_2 WO2014016737 SEQ ID NO: 24 3754 variable region TAU808 Tau Light chain 2H9 WO2014096321 SEQ ID NO: 15 3755 variable region TAU809 Tau Light chain WO2015122922 SEQ ID NO: 15 3756 variable and 23 region TAU810 Tau Light chain WO2015122922 SEQ ID NO: 31 3757 variable and 39 region TAU811 Tau Light chain WO2015122922 SEQ ID NO: 47 3758 variable region TAU812 Tau Light chain WO2015122922 SEQ ID NO: 55 3759 variable region TAU813 Tau Light chain WO2015122922 SEQ ID NO: 63 3760 variable region TAU814 Tau Light chain WO2015122922 SEQ ID NO: 71 3761 variable region TAU815 Tau light chain 16B5 US20160031976 SEQ ID NO: 16 3762 variable region kappa TAU816 Tau light chain US20160031976 SEQ ID NO: 20 3763 variable region kappa TAU817 Tau Light chain NI-105.9C4 US20150344553 SEQ ID NO: 77 3764 variable region, before germlining TAU818 Tau Light chain variant 1-VL21 US20150175685 SEQ ID NO: 16; 3765 variable WO2015197735 SEQ ID NO: 16 region, humanized TAU819 Tau Light chain variant 2-VL22 US20150175685 SEQ ID NO: 17; 3766 variable WO2015197735 SEQ ID NO: 17 region, humanized TAU820 Tau Light chain variant 4-VL01 US20150175685 SEQ ID NO: 32 3767 variable region, humanized TAU821 Tau Light chain variant 5-VL09 US20150175685 SEQ ID NO: 33 3768 variable region, humanized TAU822 Tau Light chain variant 6-VL12 US20150175685 SEQ ID NO: 34 3769 variable region, humanized TAU823 Tau Light chain variant 7-VL15 US20150175685 SEQ ID NO: 35 3770 variable region, humanized TAU824 Tau Light chain variant 8-VL16 US20150175685 SEQ ID NO: 36 3771 variable region, humanized TAU825 Tau Light chain variant 9-VL17 US20150175685 SEQ ID NO: 37 3772 variable region, humanized TAU826 Tau Light chain variant 10-VL19 US20150175685 SEQ ID NO: 38 3773 variable region humanized TAU827 Tau Light chain variant 11-VL28 US20150175685 SEQ ID NO: 39 3774 variable region, humanized TAU828 Tau (pS422) Light chain variant 12-VL33 US20150175685 SEQ ID NO: 40 3775 variable region, humanized TAU829 Tau Light chain variant 13-VL35 US20150175685 SEQ ID NO: 41 3776 variable region, humanized TAU830 Tau Light chain variant 14-VL39 US20150175685 SEQ ID NO: 42 3777 variable region, humanized TAU831 Tau Light chain variant 15-VL40 US20150175685 SEQ ID NO: 43 3778 variable region, humanized TAU832 Tau Light chain variant 16-VL41 US20150175685 SEQ ID NO: 44 3779 variable region, humanized TAU833 Tau Light chain variant 17-VL42 US20150175685 SEQ ID NO: 45 3780 variable region, humanized TAU834 Tau Light chain variant 4-VH01 US20150175685 SEQ ID NO: 46 3781 variable region, humanized TAU835 Tau Light chain variant 5-VH02 US20150175685 SEQ ID NO: 47 3782 variable region, humanized TAU836 Tau Light chain variant 6-VH03 US20150175685 SEQ ID NO: 48 3783 variable region, humanized TAU837 Tau Light chain variant 7-VH04 US20150175685 SEQ ID NO: 49 3784 variable region, humanized TAU838 Tau Light chain variant 8-VH14 US20150175685 SEQ ID NO: 50 3785 variable region, humanized TAU839 Tau Light chain variant 9-VH15 US20150175685 SEQ ID NO: 51 3786 variable region, humanized TAU840 Tau Light chain variant 10-VH18 US20150175685 SEQ ID NO: 52 3787 variable region, humanized TAU841 Tau Light chain variant 11-VH19 US20150175685 SEQ ID NO: 53 3788 variable region, humanized TAU842 Tau Light chain variant 12-VH22 US20150175685 SEQ ID NO: 54 3789 variable region, humanized TAU843 Tau Light chain variant 13-VH23 US20150175685 SEQ ID NO: 55 3790 variable region, humanized TAU844 Tau Light chain variant 14-VH24 US20150175685 SEQ ID NO: 56 3791 variable region, humanized TAU845 Tau Light chain variant 15-VH31 US20150175685 SEQ ID NO: 57 3792 variable region, humanized TAU846 Tau Light chain IPN002 Vk U.S. Pat. No. 8,980,270 SEQ ID NO: 40 3793 variable variant 1 region, humanized TAU847 Tau Light chain IPN002 Vk U.S. Pat. No. 8,980,270 SEQ ID NO: 41 3794 variable variant 2 region, humanized TAU848 Tau Light chain IPN002 Vk U.S. Pat. No. 8,980,270 SEQ ID NO: 42 3795 variable variant 3 region, humanized TAU849 Tau Light chain IPN002 Vk U.S. Pat. No. 8,980,270 SEQ ID NO: 43 3796 variable variant 4 region, humanized TAU850 Tau Light chain US20160031976 SEQ ID NO: 21 3797 variable region, mature TAU851 Tau Light chain US20160031976 SEQ ID NO: 22 3798 variable region, mature TAU852 Tau Light chain US20160031976 SEQ ID NO: 23 3799 variable region, mature TAU853 Tau ScFv scFv235 WO2016007414 SEQ ID NO: 18 3800 TAU854 Tau scFv235 WO2016007414 SEQ ID NO: 22 3801 Fusion Protein TAU855 Tau scFv235 WO2016007414 SEQ ID NO: 23 3802 Fusion Protein TAU856 Tau scFv235 WO2016007414 SEQ ID NO: 24 3803 Fusion Protein TAU857 Tau scFv235 WO2016007414 SEQ ID NO: 25 3804 Fusion Protein TAU858 Tau scFv235 WO2016007414 SEQ ID NO: 26 3805 Fusion Protein TAU859 Tau Y15982 Igkv8- WO2016079597 SEQ ID NO: 60 3806 21*01 TAU860 Tau L17135 Igkv8- WO2016079597 SEQ ID NO: 61 3807 28*02 TAU861 Tau Y15980 IGKV8- WO2016079597 SEQ ID NO: 62 3808 19*01 TAU862 Tau AJ235948 WO2016079597 SEQ ID NO: 63 3809 IGKV8-30*01 TAU863 Tau AJ235947 WO2016079597 SEQ ID NO: 64 3810 IGKV8-28*01 TAU864 Tau X72449 WO2016079597 SEQ ID NO: 65 3811 TAU865 Tau AC160990 WO2016079597 SEQ ID NO: 66 3812 Musmus IGHV1- 81*01 TAU866 Tau AC160473 WO2016079597 SEQ ID NO: 67 3813 Musmus IGHV1- 83*01 TAU867 Tau AC160990 WO2016079597 SEQ ID NO: 68 3814 Musmus IGHV1- 83*01 TAU868 Tau AC160473 WO2016079597 SEQ ID NO: 69 3815 Musmus IGHV1- 75*01 TAU869 Tau X02064 Musmus WO2016079597 SEQ ID NO: 70 3816 IGHV1-54*02 TAU870 Tau M65092 WO2016079597 SEQ ID NO: 71 3817 TAU871 Tau US20150320860 SEQ ID NO: 56 3818 TAU872 Tau US20150320860 SEQ ID NO: 57 3819 TAU873 Tau US20150320860 SEQ ID NO: 58 3820 TAU874 Tau US20150320860 SEQ ID NO: 59 3821 TAU875 Tau Light chain US20150183855 SEQ ID NO: 14; 3822 variable WO2016126993 SEQ ID NO: 14 region TAU876 Tau (O- Heavy chain WO2014159244 SEQ ID NO: 1 3823 GlcNAc) variable region TAU877 Tau (O- Light chain WO2014159244 SEQ ID NO: 2 3824 GlcNAc) variable region TAU878 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 58 3825 constant region TAU879 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 139 3826 HC anti-TfR2 antibody conjugated to scFv anti- biotin antibody fragment TAU880 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 138 3827 HC anti-TfR2 antibody conjugated to scFv anti- digoxigenin antibody fragment TAU881 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 135 3828 HC anti-TfR1 antibody conjugated to scFv anti- digoxigenin antibody fragment TAU882 Tau (pS422) Heavy chain VH00 WO2015197735 SEQ ID NO: 11; 3829 variable U.S. Pat. No. 9,290,567 SEQ ID NO: 54 region TAU883 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 68 3830 variable region TAU884 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 76 3831 variable region TAU885 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 84 3832 variable region TAU886 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 92 3833 variable region TAU887 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 100 3834 variable region TAU888 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 108 3835 variable region TAU889 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 116 3836 variable region TAU890 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 129 3837 variable region TAU891 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 131 3838 variable region TAU892 Tau (pS422) Heavy chain WO2015197735 SEQ ID NO: 148 3839 variable region of the anti-HeliCar motif TAU893 Tau (pS422) Heavy WO2015197735 SEQ ID NO: 136 3840 chainHC anti- TfR1 antibody conjugated to scFv anti- biotin antibody fragment TAU894 Tau (pS422) Helicar motif WO2015197735 SEQ ID NO: 152 3841 amino acid sequence cystein variant 1 fused to pseudomonas exotoxin LR8M with a GGG- peptidic linker and the C-terminal K deleted TAU895 Tau (pS422) human Ig- WO2015197735 SEQ ID NO: 60 3842 lambda constant region TAU896 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 137 3843 LC anti-TfR2 antibody TAU897 Tau (pS422) Light chain LC anti-TfR1 WO2015197735 SEQ ID NO: 134 3844 LC anti-TfR1 antibody antibody TAU898 Tau (pS422) Light chain VL00 WO2015197735 SEQ ID NO: 7 3845 variable region TAU899 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 72 3846 variable region TAU900 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 80 3847 variable region TAU901 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 88 3848 variable region TAU902 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 96 3849 variable region TAU903 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 104 3850 variable region TAU904 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 112 3851 variable region TAU905 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 120 3852 variable region TAU906 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 130 3853 variable region TAU907 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 132 3854 variable region TAU908 Tau (pS422) Light cliain WO2015197735 SEQ ID NO: 151 3855 variable region N51C variant of the anti-HeliCar motif TAU909 Tau (pS422) Light cliain WO2015197735 SEQ ID NO: 150 3856 variable region N55C variant of the anti-HeliCar motif TAU910 Tau (pS422) Light chain WO2015197735 SEQ ID NO: 149 3857 variable region of the anti-HeliCar motif TAU911 Tau pS422 Heavy chain U.S. Pat. No. 9,290,567 SEQ ID NO: 13 3858 constant region TAU912 Tau pS422 Heavy cliain U.S. Pat. No. 9,290,567 SEQ ID NO: 14 3859 constant region TAU913 Tau pS422 Heavy chain U.S. Pat. No. 9,290,567 SEQ ID NO: 15 3860 constant region TAU914 Tau pS422 Heavy chain U.S. Pat. No. 9,290,567 SEQ ID NO: 16 3861 constant region TAU915 Tau pS422 Heavy chain Mab2.10.3 U.S. Pat. No. 9,290,567 SEQ ID NO: 2 3862 variable region TAU916 Tau pS422 Heavy chain Mab 005 U.S. Pat. No. 9,290,567 SEQ ID NO: 22 3863 variable region TAU917 Tau pS422 Heavy chain Mab 019 U.S. Pat. No. 9,290,567 SEQ ID NO: 30 3864 variable region TAU918 Tau pS422 Heavy cliain Mab 020 U.S. Pat. No. 9,290,567 SEQ ID NO: 38 3865 variable region TAU919 Tau pS422 Heavy chain Mab 085 U.S. Pat. No. 9,290,567 SEQ ID NO: 46 3866 variable region TAU920 Tau pS422 Heavy chain Mab 097 U.S. Pat. No. 9,290,567 SEQ ID NO: 62 3867 variable region TAU921 Tau pS422 Light chain Mab2.10.3 U.S. Pat. No. 9,290,567 SEQ ID NO: 1 3868 variable region TAU922 Tau pS422 Light chain Mab 005 U.S. Pat. No. 9,290,567 SEQ ID NO: 26 3869 variable region TAU923 Tau pS422 Light chain Mab 019 U.S. Pat. No. 9,290,567 SEQ ID NO: 34 3870 variable region TAU924 Tau pS422 Light chain Mab 020 U.S. Pat. No. 9,290,567 SEQ ID NO: 42 3871 variable region TAU925 Tau pS422 Light chain Mab 085 U.S. Pat. No. 9,290,567 SEQ ID NO: 50 3872 variable region TAU926 Tau pS422 Light chain Mab 086 U.S. Pat. No. 9,290,567 SEQ ID NO: 58 3873 variable region TAU927 Tau pS422 Light chain Mab 097 U.S. Pat. No. 9,290,567 SEQ ID NO: 66 3874 variable region TAU928 Tau/Amyloid Heavy chain 3.F5 US20100323905 SEQ ID NO: 13 3875 beta/Alpha variable and 119 synuclein region antibody TAU929 Tau/Amyloid Heavy chain 3.A9 US20100323905 SEQ ID NO: 14 3876 beta/Alpha variable and 120 synuclein region antibody TAU930 Tau/Amyloid Heavy chain 3.00E+09 US20100323905 SEQ ID NO: 15, 3877 beta/Alpha variable 110 synuclein region antibody TAU931 Tau/Amyloid Heavy chain #08 US20100323905 SEQ ID NO: 16 3878 beta/Alpha variable and 111 synuclein region antibody TAU932 Tau/Amyloid Heavy chain VHH29 US20100323905 SEQ ID NO: 18, 3879 beta/Alpha variable 118 synuclein region antibody TAU933 Tau/Amyloid Heavy chain VHH07 US20100323905 SEQ ID NO: 97, 3880 beta/Alpha variable 98 synuclein region antibody TAU934 Tau/Amyloid Heavy chain VHH15 US20100323905 SEQ ID NO: 99-101 3881 beta/Alpha variable synuclein region antibody TAU935 Tau/Amyloid Heavy chain VHH01 US20100323905 SEQ ID NO: 102 3882 beta/Alpha variable synuclein region antibody TAU936 Tau/Amyloid Heavy chain VHH04 US20100323905 SEQ ID NO: 103 3883 beta/Alpha variable synuclein region antibody TAU937 Tau/Amyloid Heavy chain VHH19 US20100323905 SEQ ID NO: 104 3884 beta/Alpha variable synuclein region antibody TAU938 Tau/Amyloid Heavy chain VHH21 US20100323905 SEQ ID NO: 105 3885 beta/Alpha variable synuclein region antibody TAU939 Tau/Amyloid Heavy chain VHH05 US20100323905 SEQ ID NO: 106 3886 beta/Alpha variable synuclein region antibody TAU940 Tau/Amyloid Heavy chain VHH23 US20100323905 SEQ ID NO: 107 3887 beta/Alpha variable synuclein region antibody TAU941 Tau/Amyloid Heavy chain VHH34 US20100323905 SEQ ID NO: 108 3888 beta/Alpha variable synuclein region antibody TAU942 Tau/Amyloid Heavy chain VHH26 US20100323905 SEQ ID NO: 109 3889 beta/Alpha variable synuclein region antibody TAU943 Tau/Amyloid Heavy chain VHH18 US20100323905 SEQ ID NO: 17 3890 beta/Alpha variable and 112 synuclein region antibody TAU944 Tau/Amyloid Heavy chain VHH09 US20100323905 SEQ ID NO: 113 3891 beta/Alpha variable synuclein region antibody TAU945 Tau/Amyloid Heavy chain VHH20 US20100323905 SEQ ID NO: 114 3892 beta/Alpha variable synuclein region antibody TAU946 Tau/Amyloid Heavy chain VHH32 US20100323905 SEQ ID NO: 115 3893 beta/Alpha variable synuclein region antibody TAU947 Tau/Amyloid Heavy chain VHH30 US20100323905 SEQ ID NO: 116 3894 beta/Alpha variable synuclein region antibody TAU948 Tau/Amyloid Heavy chain VHH28 US20100323905 SEQ ID NO: 117 3895 beta/Alpha variable synuclein region antibody TAU949 Tau/Amyloid Heavy chain VHH14 US20100323905 SEQ ID NO: 121 3896 beta/Alpha variable synuclein region antibody TAU950 Tau/Amyloid Heavy chain VHH12 US20100323905 SEQ ID NO: 122 3897 beta/Alpha variable synuclein region antibody TAU951 Tau/Amyloid Heavy chain 1B US20100323905 SEQ ID NO: 52 3898 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU952 Tau/Amyloid Heavy chain 1D US20100323905 SEQ ID NO: 53 3899 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU953 Tau/Amyloid Heavy chain 2A US20100323905 SEQ ID NO: 54 3900 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU954 Tau/Amyloid Heavy chain 2B US20100323905 SEQ ID NO: 55 3901 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU955 Tau/Amyloid Heavy chain 2F US20100323905 SEQ ID NO: 56 3902 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU956 Tau/Amyloid Heavy chain 3A US20100323905 SEQ ID NO: 57 3903 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU957 Tau/Amyloid Heavy chain 3H US20100323905 SEQ ID NO: 58 3904 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU958 Tau/Amyloid Heavy chain 4C US20100323905 SEQ ID NO: 59 3905 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU959 Tau/Amyloid Heavy chain 8F US20100323905 SEQ ID NO: 60 3906 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU960 Tau/Amyloid Heavy chain 11D US20100323905 SEQ ID NO: 61 3907 beta/Alpha variable synuclein region antibody, amyloid 42 VHH TAU961 Tau/Amyloid Heavy chain EME7E US20100323905 SEQ ID NO: 62 3908 beta/Alpha variable synuclein region antibody, VHH for emerin TAU962 Tau/Amyloid Heavy chain EME1C US20100323905 SEQ ID NO: 63 3909 beta/Alpha variable synuclein region antibody, VHH for emerin TAU963 Tau/Amyloid Heavy chain VHH01 US20100323905 SEQ ID NO: 64 3910 beta/Alpha variable synuclein region antibody, VHH for emerin TAU964 Tau/Amyloid Heavy chain VHH03/ US20100323905 SEQ ID NO: 65 3911 beta/Alpha variable VHH23 synuclein region antibody, VHH for emerin TAU965 Tau/Amyloid Heavy chain EME3H US20100323905 SEQ ID NO: 66 3912 beta/Alpha variable synuclein region antibody, VHH for emerin TAU966 Tau/Amyloid Heavy chain VHH09 US20100323905 SEQ ID NO: 67 3913 beta/Alpha variable synuclein region antibody, VHH for emerin TAU967 Tau/Amyloid Heavy chain VHH12 US20100323905 SEQ ID NO: 68 3914 beta/Alpha variable synuclein region antibody, VHH for emerin TAU968 Tau/Amyloid Heavy chain VHH05 US20100323905 SEQ ID NO: 69 3915 beta/Alpha variable synuclein region antibody, VHH for emerin TAU969 Tau/Amyloid Heavy chain VHH11 US20100323905 SEQ ID NO: 70 3916 beta/Alpha variable synuclein region antibody, VHH for emerin TAU970 Tau/Amyloid Heavy chain EME8A US20100323905 SEQ ID NO: 71 3917 beta/Alpha variable synuclein region antibody, VHH for emerin TAU971 Tau/Amyloid Heavy chain VHH02 US20100323905 SEQ ID NO: 72 3918 beta/Alpha variable synuclein region antibody, VHH for emerin TAU972 Tau/Amyloid Heavy chain VHH15 US20100323905 SEQ ID NO: 73 3919 beta/Alpha variable synuclein region antibody, VHH for emerin TAU973 Tau/Amyloid Heavy chain VHH10 US20100323905 SEQ ID NO: 74 3920 beta/Alpha variable synuclein region antibody, VHH for emerin TAU974 Tau/Amyloid Heavy chain EME4B US20100323905 SEQ ID NO: 75 3921 beta/Alpha variable synuclein region antibody, VHH for emerin TAU975 Tau/Amyloid Heavy chain VHH13 US20100323905 SEQ ID NO: 76 3922 beta/Alpha variable synuclein region antibody, VHH for emerin TAU976 Tau/Amyloid Heavy chain EME7F US20100323905 SEQ ID NO: 77 3923 beta/Alpha variable synuclein region antibody, VHH for emerin TAU977 Tau/Amyloid Heavy chain VHH14 US20100323905 SEQ ID NO: 78 3924 beta/Alpha variable synuclein region antibody, VHH for emerin TAU978 Tau/Amyloid Heavy chain EME2G US20100323905 SEQ ID NO: 79 3925 beta/Alpha variable synuclein region antibody, VHH for emerin TAU979 Tau/Amyloid Heavy chain EME8D US20100323905 SEQ ID NO: 80 3926 beta/Alpha variable synuclein region antibody, VHH for emerin TAU980 Tau/Amyloid Heavy chain VHH04 US20100323905 SEQ ID NO: 81 3927 beta/Alpha variable synuclein region antibody, VHH for emerin TAU981 Tau/Amyloid Heavy chain VHH07/ US20100323905 SEQ ID NO: 82 3928 beta/Alpha variable VHH08 synuclein region antibody, VHH for emerin TAU982 Tau/Amyloid Heavy chain VHH16 US20100323905 SEQ ID NO: 83 3929 beta/Alpha variable synuclein region antibody, VHH for emerin TAU983 Tau/Amyloid Heavy chain 3.6B US20100323905 SEQ ID NO: 84 3930 beta/Alpha variable synuclein region antibody, VHH for emerin TAU984 Tau/Amyloid Heavy chain 3.8B US20100323905 SEQ ID NO: 85 3931 beta/Alpha variable synuclein region antibody, VHH for emerin TAU985 Tau/Amyloid Heavy chain VHH24 US20100323905 SEQ ID NO: 86 3932 beta/Alpha variable synuclein region antibody, VHH for emerin TAU986 Tau/Amyloid Heavy chain VHH21 US20100323905 SEQ ID NO: 87 3933 beta/Alpha variable synuclein region antibody, VHH for emerin TAU987 Tau/Amyloid Heavy chain 3.8E US20100323905 SEQ ID NO: 88 3934 beta/Alpha variable synuclein region antibody, VHH for emerin TAU988 Tau/Amyloid Heavy chain US20100323905 SEQ ID NO: 89 3935 beta/Alpha variable synuclein region antibody, VHH which can translocate via blood brain barrier TAU989 Tau/Amyloid Heavy chain US20100323905 SEQ ID NO: 90 3936 beta/Alpha variable synuclein region antibody, VHH which can translocate via blood brain barrier TAU990 Tau/A US20110002945 SEQ ID NO: 2 3937 peptides TAU991 Tau/A US20110002945 SEQ ID NO: 3 3938 peptides TAU992 Tau CDR WO2016137811 SEQ ID NO: 3 3939 TAU993 Tau CDR WO2016137811 SEQ ID NO: 4 3940 TAU994 Tau CDR WO2016137811 SEQ ID NO: 5 3941 TAU995 Tau CDR WO2016137811 SEQ ID NO: 6 3942 TAU996 Tau CDR WO2016137811 SEQ ID NO: 7 3943 TAU997 Tau CDR WO2016137811 SEQ ID NO: 8 3944 TAU998 Tau CDR WO2015122922 SEQ ID NO: 41 3945 TAU999 Tau CDR WO2015122922 SEQ ID NO: 49 3946 and 57 TAU1000 Tau CDR WO2016126993 SEQ ID NO: 16 3947 TAU1001 Tau CDR WO2016126993 SEQ ID NO: 17 3948 TAU1002 Tau CDR WO2016126993 SEQ ID NO: 18 3949 TAU1003 Tau CDR WO2016126993 SEQ ID NO: 19 3950 TAU1004 Tau CDR WO2016126993 SEQ ID NO: 20 3951 TAU1005 Tau CDR WO2016126993 SEQ ID NO: 21 3952 TAU1006 Tau dimeric DH-Tau15 WO2016055941 SEQ ID NO: 20 3953 antibody TAU1007 Tau Fc Fc-Tau15 WO2016055941 SEQ ID NO: 23 3954 TAU1008 Tau full antibody MC-1 Furin 2A WO2015035190 SEQ ID NO: 2 3955 TAU1009 Tau full antibody MC-1 Furin 2A WO2015035190 SEQ ID NO: 4 3956 TAU1010 Tau full antibody MC-1 optimized WO2015035190 SEQ ID NO: 6 3957 seq TAU1011 Tau full antibody PHF-1 Furin 2A WO2015035190 SEQ ID NO: 1 3958 TAU1012 Tau full antibody PHF-1 Furin 2A WO2015035190 SEQ ID NO: 3 3959 TAU1013 Tau full antibody PHF-1 optimized WO2015035190 SEQ ID NO: 5 3960 seq TAU1014 Tau Heavy chain 1 A6 WO2016137950 SEQ ID NO: 46 3961 TAU1015 Tau heavy chain 113F5-F7 WO2016196726 SEQ ID NO: 90 3962 TAU1016 Tau heavy chain 111E10-B8 WO2016196726 SEQ ID NO: 30 3963 TAU1017 Tau heavy chain 123E9-A1 WO2016196726 SEQ ID NO: 140 3964 TAU1018 Tau heavy chain 125B11-H3 WO2016196726 SEQ ID NO: 80 3965 TAU1019 Tau heavy chain 126F11-G11 WO2016196726 SEQ ID NO: 180 3966 TAU1020 Tau heavy chain 12A10-E8 WO2016196726 SEQ ID NO: 250 3967 TAU1021 Tau heavy chain 14F5-D9 WO2016196726 SEQ ID NO: 210 3968 TAU1022 Tau heavy chain 15C6-A7 WO2016196726 SEQ ID NO: 150 3969 TAU1023 Tau Heavy chain 17H3.2 WO2016112078 SEQ ID NO: 20 3970 TAU1024 Tau heavy chain 19F8-B1 WO2016196726 SEQ ID NO: 160 3971 TAU1025 Tau heavy chain 19H6-F7 WO2016196726 SEQ ID NO: 60 3972 TAU1026 Tau heavy chain 22G7-C9 WO2016196726 SEQ ID NO: 230 3973 TAU1027 Tau heavy chain 24A11-D5 WO2016196726 SEQ ID NO: 170 3974 TAU1028 Tau heavy chain 26C1-B11 and WO2016196726 SEQ ID NO: 100 3975 26C1-C8 and 110 TAU1029 Tau Heavy chain 29H2.10 WO2016112078 SEQ ID NO: 22 3976 TAU1030 Tau Heavy chain 29H2.10N31S WO2016112078 SEQ ID NO: 23 3977 (Mutant) TAU1031 Tau heavy chain 30G1-B2 WO2016196726 SEQ ID NO: 120 3978 TAU1032 Tau heavy chain 37D3-H9 and WO2016196726 SEQ ID NO: 10 3979 37D3-H9b and 20 TAU1033 Tau heavy chain 3A4-H4 WO2016196726 SEQ ID NO: 50 3980 TAU1034 Tau Heavy chain 4G11 WO2016137950 SEQ ID NO: 42 3981 TAU1035 Tau heavy chain 52F6-H11 WO2016196726 SEQ ID NO: 270 3982 TAU1036 Tau heavy chain 54C1-H11 and WO2016196726 SEQ ID NO: 40 3983 61E7-C4 TAU1037 Tau heavy chain 55E7-F11 WO2016196726 SEQ ID NO: 260 3984 TAU1038 Tau heavy chain 66F5-A1 WO2016196726 SEQ ID NO: 130 3985 TAU1039 Tau heavy chain 73H6-B8 WO2016196726 SEQ ID NO: 220 3986 TAU1040 Tau heavy chain 7A11-C12 WO2016196726 SEQ ID NO: 240 3987 TAU1041 Tau heavy chain 89F4-A1 WO2016196726 SEQ ID NO: 190 3988 TAU1042 Tau heavy chain 93A8-D2 WO2016196726 SEQ ID NO: 200 3989 TAU1043 Tau heavy chain 94B2-C1 WO2016196726 SEQ ID NO: 70 3990 TAU1044 Tau ps409 heavy chain hAC1-36-3A8- US20150175682 SEQ ID NO: 11 3991 Ab1 TAU1045 Tau heavy chain hu125B11.v17 WO2016196726 SEQ ID NO: 310 3992 and hu125B11- and 448 H3.HC3 TAU1046 Tau heavy chain hu125B11.v17 WO2016196726 SEQ ID NO: 311 3993 TAU1047 Tau heavy chain hu125B11.v26 WO2016196726 SEQ ID NO: 320 3994 TAU1048 Tau heavy chain hu125B11.v26 WO2016196726 SEQ ID NO: 321 3995 TAU1049 Tau heavy chain hu125B11.v28 WO2016196726 SEQ ID NO: 330 3996 TAU1050 Tau heavy chain hu125B11.v28 WO2016196726 SEQ ID NO: 331 3997 TAU1051 Tau heavy chain hu125B11- WO2016196726 SEQ ID NO: 446 3998 H3.HC1 TAU1052 Tau heavy chain hu125B11- WO2016196726 SEQ ID NO: 447 3999 H3.HC2 TAU1053 Tau heavy chain hu125B11- WO2016196726 SEQ ID NO: 449 4000 H3.HC4 TAU1054 Tau heavy chain hu125B11- WO2016196726 SEQ ID NO: 450 4001 H3.HC5 TAU1055 Tau heavy chain hu125B11- WO2016196726 SEQ ID NO: 451 4002 H3.HC6 TAU1056 Tau heavy chain Hu37D3.v39 WO2016196726 SEQ ID NO: 560, 4003 570, 580 TAU1057 Tau heavy chain Hu37D3-H9.v1 WO2016196726 SEQ ID NO: 280 4004 TAU1058 Tau heavy chain Hu37D3- WO2016196726 SEQ ID NO: 340 4005 H9.v28.A4 TAU1059 Tau heavy chain Hu37D3- WO2016196726 SEQ ID NO: 348 4006 H9.v28.A4 IgG4- S228P.YTE TAU1060 Tau heavy chain Hu37D3- WO2016196726 SEQ ID NO: 602 4007 H9.v28.A4 IgG4- S228P.YTE des-K TAU1061 Tau heavy chain Hu37D3-H9.v5 WO2016196726 SEQ ID NO: 290 4008 TAU1062 Tau heavy chain Hu94B2.HC1 WO2016196726 SEQ ID NO: 452 4009 TAU1063 Tau heavy chain Hu94B2.HC2 WO2016196726 SEQ ID NO: 453 4010 TAU1064 Tau heavy chain Hu94B2.HC3 WO2016196726 SEQ ID NO: 454 4011 TAU1065 Tau heavy chain Hu94B2.HC4 WO2016196726 SEQ ID NO: 455 4012 TAU1066 Tau heavy chain Hu94B2.HC5 WO2016196726 SEQ ID NO: 456 4013 TAU1067 Tau heavy chain Hu94B2.HC6 WO2016196726 SEQ ID NO: 457 4014 TAU1068 Tau heavy chain Hu94B2.HC7 WO2016196726 SEQ ID NO: 458 4015 TAU1069 Tau heavy chain Hu94B2.HC8 WO2016196726 SEQ ID NO: 459 4016 TAU1070 Tau heavy chain Hu94B2.v105 WO2016196726 SEQ ID NO: 300 4017 TAU1071 Tau(pS422) heavy chain MAb086 WO2015197735 SEQ ID NO: 11 4018 TAU1072 Tau heavy chain WO2016137811 SEQ ID NO: 2 4019 TAU1073 Tau heavy chain WO2016137811 SEQ ID NO: 12 4020 TAU1074 Tau (pS422) heavy chain WO2015197735 SEQ ID NO: 58 4021 constant regions TAU1075 Tau heavy chain DC8E8 WO2016079597 SEQ ID NO: 7 4022 variable domain TAU1076 Tau(pS422) heavy chain WO2015197735 SEQ ID NO: 21 4023 variable domain TAU1077 Tau heavy chain WO2016137811 SEQ ID NO: 10 4024 variable domain TAU1078 Tau & intrabody A2 WO2014193632 SEQ ID NO: 2 4025 huntingtin TAU1079 Tau & intrabody E10 WO2014193632 SEQ ID NO: 3 4026 huntingtin TAU1080 Tau & intrabody H8 WO2014193632 SEQ ID NO: 4 4027 huntingtin TAU1081 Tau & intrabody NT41 WO2014193632 SEQ ID NO: 1 4028 huntingtin TAU1082 Tau & intrabody WO2014193632 SEQ ID NO: 5 4029 huntingtin TAU1083 Tau(pS422) Ig-kappa light WO2015197735 SEQ ID NO: 59 4030 chain constant region TAU1084 Tau(pS422) Ig-kappa light WO2015197735 SEQ ID NO: 60 4031 chain constant region TAU1085 Tau light chain 1 A6 WO2016137950 SEQ ID NO: 48 4032 TAU1086 Tau light chain 113F5-F7 WO2016196726 SEQ ID NO: 91 4033 TAU1087 Tau light chain 11E10-B8 WO2016196726 SEQ ID NO: 31 4034 TAU1088 Tau light chain 123E9-A1 WO2016196726 SEQ ID NO: 141 4035 TAU1089 Tau light chain 125B11-H3 WO2016196726 SEQ ID NO: 81 4036 TAU1090 Tau light chain 126F11-G11 WO2016196726 SEQ ID NO: 181 4037 TAU1091 Tau light chain 12A10-E8 WO2016196726 SEQ ID NO: 251 4038 TAU1092 Tau light chain 14F5-D9 WO2016196726 SEQ ID NO: 211 4039 TAU1093 Tau light chain 15C6-A7 WO2016196726 SEQ ID NO: 151 4040 TAU1094 Tau light chain 17H3.2 WO2016112078 SEQ ID NO: 21 4041 TAU1095 Tau light chain 19F8-B1 WO2016196726 SEQ ID NO: 161 4042 TAU1096 Tau light chain 19H6-F7 WO2016196726 SEQ ID NO: 61 4043 TAU1097 Tau light chain 22G7-C9 WO2016196726 SEQ ID NO: 231 4044 TAU1098 Tau light chain 24A11-D5 WO2016196726 SEQ ID NO: 171 4045 TAU1099 Tau light chain 26C1-B11 WO2016196726 SEQ ID NO: 101 4046 TAU1100 Tau light chain 26C1-C8 WO2016196726 SEQ ID NO: 111 4047 TAU1101 Tau Light chain 29H2.10 WO2016112078 SEQ ID NO: 24 4048 TAU1102 Tau light chain 30G1-B2 WO2016196726 SEQ ID NO: 121 4049 TAU1103 Tau light chain 37D3-H9 WO2016196726 SEQ ID NO: 11 4050 TAU1104 Tau light chain 37D3-H9b WO2016196726 SEQ ID NO: 21 4051 TAU1105 Tau light chain 3A4-H4 WO2016196726 SEQ ID NO: 51 4052 TAU1106 Tau Light chain 4G11 WO2016137950 SEQ ID NO: 44 4053 TAU1107 Tau light chain 52F6-F11 WO2016196726 SEQ ID NO: 271 4054 TAU1108 Tau light chain 54C1-H11 and WO2016196726 SEQ ID NO: 41 4055 61E7-C4 TAU1109 Tau light chain 55E7-F11 WO2016196726 SEQ ID NO: 261 4056 TAU1110 Tau light chain 66F5-A1 WO2016196726 SEQ ID NO: 131 4057 TAU1111 Tau light chain 73H6-B8 WO2016196726 SEQ ID NO: 221 4058 TAU1112 Tau light chain 7A11-C12 WO2016196726 SEQ ID NO: 241 4059 TAU1113 Tau light chain 89F4-A1 WO2016196726 SEQ ID NO: 191 4060 TAU1114 Tau light chain 93A8-D2 WO2016196726 SEQ ID NO: 201 4061 TAU1115 Tau light chain 94B2-C1 WO2016196726 SEQ ID NO: 71 4062 TAU1116 Tau ps410 light chain hAC1-36-3A8- US20150175682 SEQ ID NO: 12 4063 Ab1 TAU1117 Tau light chain hu125B11- WO2016196726 SEQ ID NO: 442 4064 H3.LC1 TAU1118 Tau light chain hu125B11- WO2016196726 SEQ ID NO: 443 4065 H3.LC2 TAU1119 Tau light chain hu125B11- WO2016196726 SEQ ID NO: 444 4066 H3.LC3 TAU1120 Tau light chain hu125B11- WO2016196726 SEQ ID NO: 445 4067 H3.LC4 TAU1121 Tau light chain Hu37D3.v39 WO2016196726 SEQ ID NO: 561 4068 TAU1122 Tau light chain Hu37D3.v40 WO2016196726 SEQ ID NO: 571 4069 TAU1123 Tau light chain Hu37D3.v41 WO2016196726 SEQ ID NO: 581 4070 TAU1124 Tau light chain Hu37D3-H9.v1 WO2016196726 SEQ ID NO: 281 4071 TAU1125 Tau light chain Hu37D3- WO2016196726 SEQ ID NO: 341 4072 H9.v28.A4 TAU1126 Tau light chain Hu37D3- WO2016196726 SEQ ID NO: 349 4073 H9.v28.A4 IgG4- S228P.YTE TAU1127 Tau light chain Hu37D3-H9.v5 WO2016196726 SEQ ID NO: 291 4074 TAU1128 Tau light chain Hu94B2.LC10 WO2016196726 SEQ ID NO: 461 4075 TAU1129 Tau light chain Hu94B2.LC11 WO2016196726 SEQ ID NO: 462 4076 TAU1130 Tau light chain Hu94B2.LC12 WO2016196726 SEQ ID NO: 463 4077 TAU1131 Tau light chain Hu94B2.LC13 WO2016196726 SEQ ID NO: 464 4078 TAU1132 Tau light chain Hu94B2.LC14 WO2016196726 SEQ ID NO: 465 4079 TAU1133 Tau light chain Hu94B2.LC15 WO2016196726 SEQ ID NO: 466 4080 TAU1134 Tau light chain Hu94B2.LC16 WO2016196726 SEQ ID NO: 467 4081 TAU1135 Tau light chain Hu94B2.LC9 WO2016196726 SEQ ID NO: 460 4082 TAU1136 Tau light chain Hu94B2.v105 WO2016196726 SEQ ID NO: 301 4083 TAU1137 Tau(pS422) light chain MAb086 WO2015197735 SEQ ID NO: 07 4084 TAU1138 Tau light chain WO2016137811 SEQ ID NO: 1 4085 TAU1139 Tau light chain WO2016137811 SEQ ID NO: 11 4086 TAU1140 Tau light chain U.S. Pat. No. 8,940,272B2 SEQ ID NO: 11 4087 TAU1141 Tau ps411 light chain hAC1-36-2B6- US20150175682 SEQ ID NO: 13 4088 Ab1 TAU1142 Tau light chain DC8E8 WO2016079597 SEQ ID NO: 8 4089 variable domain TAU1143 Tau light chain WO2016137811 SEQ ID NO: 9 4090 variable domain TAU1144 Tau single domain Tau15 WO2016055941 SEQ ID NO: 7 4091 antibody TAU1145 Tau single domain Tau81 WO2016055941 SEQ ID NO: 8 4092 antibody TAU1146 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 8 4093 (pS198/pS199/ pS202/pT205) TAU1147 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 10 4094 (pS198/pS199/ pS202/pT205) TAU1148 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 14 4095 (pS198/pS199/ pS202/pT205) TAU1149 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 15 4096 (pS198/pS199/ pS202/pT205) TAU1150 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 16 4097 (pS198/pS199/ pS202/pT205) TAU1151 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 20 4098 (pS198/pS199/ pS202/pT205) TAU1152 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 21 4099 (pS198/pS199/ pS202/pT205) TAU1153 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 22 4100 (pS198/pS199/ pS202/pT205) TAU1154 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 23 4101 (pS198/pS199/ pS202/pT205) TAU1155 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 24 4102 (pS198/pS199/ pS202/pT205) TAU1156 pTau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 25 4103 (pS198/pS199/ pS202/pT205) TAU1157 Tau Heavy chain AB1 WO2017005732A1 SEQ ID NO: 27 4104 TAU1158 pTAU (pS396) Heavy Chain C10.2 US20170015738A1 SEQ ID NO: 16 4105 TAU1159 Tau heavy chain C2N-8E12 WO2016201434A2 SEQ ID NO: 14 4106 TAU1160 pTAU (pS396) Heavy Chain C5.2 US20170015738A1 SEQ ID NO: 24 4107 TAU1161 pTAU (pS396) Heavy Chain C8.3 US20170015738A1 SEQ ID NO: 32 4108 TAU1162 pTAU (pS396) Heavy Chain D1.2 US20170015738A1 SEQ ID NO: 8 4109 TAU1163 pTAU (pS396) Heavy Chain humanized C10.2 US20170015738A1 SEQ ID NO: 35 4110 TAU1164 Tau Heavy chain mFab AB 1 WO2017005734A1 SEQ ID NO: 20 4111 TAU1165 Tau Heavy chain mFab AB1 WO2017005734A1 SEQ ID NO: 8 4112 TAU1166 Tau Heavy chain WO2017005734A1 SEQ ID NO: 10 4113 TAU1167 Tau Heavy chain WO2017005734A1 SEQ ID NO: 11 4114 TAU1168 Tau Heavy chain WO2017005734A1 SEQ ID NO: 12 4115 TAU1169 Tau Heavy chain WO2017005734A1 SEQ ID NO: 13 4116 TAU1170 Tau Heavy chain WO2017005734A1 SEQ ID NO: 22 4117 TAU1171 Tau Heavy chain WO2017005734A1 SEQ ID NO: 23 4118 TAU1172 Tau Heavy chain WO2017005734A1 SEQ ID NO: 54 4119 TAU1173 Tau Heavy chain WO2017005734A1 SEQ ID NO: 55 4120 TAU1174 Tau Heavy chain WO2017005734A1 SEQ ID NO: 15 4121 TAU1175 Tau Heavy chain WO2017005734A1 SEQ ID NO: 16 4122 TAU1176 Tau Heavy chain WO2017005734A1 SEQ ID NO: 17 4123 TAU1177 Tau Heavy chain WO2017005734A1 SEQ ID NO: 18 4124 TAU1178 Tau Heavy chain C2N-8E12 WO2016201434A2 SEQ ID NO: 15 4125 (VH1) TAU1179 Tau Heavy chain C2N-8E12 WO2016201434A2 SEQ ID NO: 16 4126 (VH2) TAU1180 Tau Heavy chain C2N-8E12 WO2016201434A2 SEQ ID NO: 17 4127 (VH3) TAU1181 Tau Heavy chain C2N-8E12 WO2016201434A2 SEQ ID NO: 18 4128 (VH4) TAU1182 Tau (421) Heavy chain 1G10D2 WO2017027685A2 SEQ ID NO: 12 4129 variable domain TAU1183 Tau (421) Heavy chain 1G11A10 WO2017027685A2 SEQ ID NO: 20 4130 variable domain TAU1184 Tau pS404 Heavy chain 4E6G7 WO2017027691A1 SEQ ID NO: 13 4131 variable domain TAU1185 Tau (421) Heavy chain 5G2A3 WO2017027685A2 SEQ ID NO: 40 4132 variable domain TAU1186 Tau Heavy chain IPN001 VH U.S. Pat. No. 9,567,395 SEQ ID NO: 18 4133 variable region TAI1187 Tau Heavy chain IPN002 VH U.S. Pat. No. 9,567,395 SEQ ID NO: 20 4134 variable region TAU1188 Tau Heavy chain ACI-35-ID2- U.S. Pat. No. 9,540,434 SEQ ID NO: 86 4135 variable Ab1 region (VH) TAU1189 Tau Heavy chain ACI-35-2A1- U.S. Pat. No. 9,540,434 SEQ ID NO: 109 4136 variable Ab1, ACI-35- region (VH) 2A1-Ab2, and ACI-35-4A6- Ab2 TAU1190 Tau Heavy chain ACI-35-2G5- U.S. Pat. No. 9,540,434 SEQ ID NO: 111 4137 variable AB1 region (VH) TAU1191 Tau Heavy chain ACI-35-2G5- U.S. Pat. No. 9,540,434 SEQ ID NO: 113 4138 variable AB2 and ACI- region (VH) 35-2G5-AB3 TAU1192 Tau Heavy chain ACI-35-4A6- U.S. Pat. No. 9,540,434 SEQ ID NO: 84 4139 variable Ab1 region (VH) TAU1193 Tau Heavy chain IPN002 VH U.S. Pat. No. 9,567,395 SEQ ID NO: 28 4140 variable variant 1 region, humanized TAU1194 Tau Heavy chain IPN002 VH U.S. Pat. No. 9,567,395 SEQ ID NO: 29 4141 variable variant 2 region, humanized TAU1195 Tau Heavy chain IPN002 VH U.S. Pat. No. 9,567,395 SEQ ID NO: 30 4142 variable variant 3 region, humanized TAU1196 Tau Heavy chain IPN002 VH U.S. Pat. No. 9,567,395 SEQ ID NO: 31 4143 variable variant 4 region, humanized TAU1197 Tau (pS422) Heavy chain VH35H5 US20160376352A1 SEQ ID NO: 65 4144 variant 16 TAU1198 Tau Heavy chain C2N-8E12 WO2016201434A2 SEQ ID NO: 1 4145 variant gVH1 TAU1199 Tau Heavy chain C2N-8E12 WO2016201434A2 SEQ ID NO: 2 4146 variant gVH2 TAU1200 Tau Heavy chain C2N-8E12 WO2016201434A2 SEQ ID NO: 3 4147 variant gVH3 TAU1201 Tau Heavy chain C2N-8E12 WO2016201434A2 SEQ ID NO: 4 4148 variant gVH4 TAU1202 Tau (421) Heavy Chain 5B3C11 WO2017027685A2 SEQ ID NO: 32 4149 VL2 Variable Domain TAU1203 Tau Heavy chain; WO2017005734A1 SEQ ID NO: 25 4150 humanized TAU1204 Tau Heavy chain; WO2017005734A1 SEQ ID NO: 26 4151 humanized TAU1205 Tau Heavy chain; WO2017005734A1 SEQ ID NO: 56 4152 humanized TAU1206 Tau Heavy chain; WO2017005734A1 SEQ ID NO: 57 4153 humanized TAU1207 Tau Heavy chain; WO2017005732A1 SEQ ID NO: 32 4154 humanized TAU1208 Tau Heavy chain; WO2017005732A1 SEQ ID NO: 33 4155 humanized TAU1209 Tau Heavy chain; WO2017005732A1 SEQ ID NO: 36 4156 humanized TAU1210 Tau Heavy chain; WO2017005732A1 SEQ ID NO: 37 4157 humanized TAU1211 Tau Heavy chain; WO2017005732A1 SEQ ID NO: 38 4158 humanized TAU1212 Tau Heavy chain; WO2017005732A1 SEQ ID NO: 39 4159 humanized TAU1213 pTau Light chain AB1 WO2017005732A1 SEQ ID NO: 7 4160 (pS198/pS199/ pS202/pT205) TAU1214 pTau Light chain AB1 WO2017005732A1 SEQ ID NO: 9 4161 (pS198/pS199/ pS202/pT205) TAU1215 pTau Light chain AB1 WO2017005732A1 SEQ ID NO: 11 4162 (pS198/pS199/ pS202/pT205) TAU1216 pTau Light chain AB1 WO2017005732A1 SEQ ID NO: 12 4163 (pS198/pS199/ pS202/pT205) TAU1217 pTau Light chain AB1 WO2017005732A1 SEQ ID NO: 13 4164 (pS198/pS199/ pS202/pT205) TAU1218 pTau Light chain AB1 WO2017005732A1 SEQ ID NO: 17 4165 (pS198/pS199/ pS202/pT205) TAU1219 pTau Light chain AB1 WO2017005732A1 SEQ ID NO: 18 4166 (pS198/pS199/ pS202/pT205) TAU1220 pTau Light chain AB1 WO2017005732A1 SEQ ID NO: 19 4167 (pS198/pS199/ pS202/pT205) TAU1221 Tau Light chain AB1 WO2017005732A1 SEQ ID NO: 26 4168 TAU1222 pTAU (pS396) Light Chain C10.2 US20170015738A1 SEQ ID NO: 15 4169 TAU1223 Tau light chain C2N-8E12 WO2016201434A2 SEQ ID NO: 9 4170 TAU1224 pTAU (pS396) Light Chain C5.2 US20170015738A1 SEQ ID NO: 23 4171 TAU1225 pTAU (pS396) Light Chain C8.3 US20170015738A1 SEQ ID NO: 31 4172 TAU1226 pTAU (pS396) Light Chain D1.2 US20170015738A1 SEQ ID NO: 7 4173 TAU1227 pTAU (pS396) Light Chain D1.2* US20170015738A1 SEQ ID NO: 34 4174 TAU1228 pTAU (pS396) Light Chain humanized C10.2 US20170015738A1 SEQ ID NO: 36 4175 TAU1229 Tau Light chain mFab AB 1 WO2017005734A1 SEQ ID NO: 19 4176 TAU1230 Tau Light chain mFab AB1 WO2017005734A1 SEQ ID NO: 7 4177 TAU1231 Tau Light chain WO2017005734A1 SEQ ID NO: 9 4178 TAU1232 Tau Light chain WO2017005734A1 SEQ ID NO: 14 4179 TAU1233 Tau Light chain WO2017005734A1 SEQ ID NO: 21 4180 TAU1234 Tau Light chain C2N-8E12 WO2016201434A2 SEQ ID NO: 10 4181 (VK1) TAU1235 Tau Light chain C2N-8E12 WO2016201434A2 SEQ ID NO: 11 4182 (VK2) TAU1236 Tau Light chain C2N-8E12 WO2016201434A2 SEQ ID NO: 12 4183 (VK3) TAU1237 Tau Light chain C2N-8E12 WO2016201434A2 SEQ ID NO: 13 4184 (VK4) TAU1238 Tau (421) Light Chain 1G10D2 WO2017027685A2 SEQ ID NO: 8 4185 Variable Domain TAU1239 Tau (421) Light Chain 1G11A10 WO2017027685A2 SEQ ID NO: 16 4186 Variable Domain TAU1240 Tau pS404 Light chain 4E6G7 WO2017027691A1 SEQ ID NO: 9 4187 variable domain TAU1241 Tau (421) Light Chain 5G2A3 WO2017027685A2 SEQ ID NO: 36 4188 Variable Domain TAU1242 Tau Light chain IPN001 VL U.S. Pat. No. 9,567,395 SEQ ID NO: 17 4189 variable region TAU1243 Tau Light chain IPN002 VL U.S. Pat. No. 9,567,395 SEQ ID NO: 19 4190 variable region TAU1244 Tau Light chain ACI-35-1D2- U.S. Pat. No. 9,540,434 SEQ ID NO: 87 4191 variable Ab1 region (VK) TAU1245 Tau Light chain ACI-35-2A1- U.S. Pat. No. 9,540,434 SEQ ID NO: 117 4192 variable Ab1 region (VK) TAU1246 Tau Light chain ACI-35-2A1- U.S. Pat. No. 9,540,434 SEQ ID NO: 110 4193 variable Ab2 region (VK) TAU1247 Tau Light chain ACI-35-2G5- U.S. Pat. No. 9,540,434 SEQ ID NO: 112 4194 variable AB1 region (VK) TAU1248 Tau Light chain ACI-35-2G5- U.S. Pat. No. 9,540,434 SEQ ID NO: 114 4195 variable AB2 and ACI- region (VK) 35-2G5-AB3 TAU1249 Tau Light chain ACI-35-4A6- U.S. Pat. No. 9,540,434 SEQ ID NO: 85 4196 variable Ab1 region (VK) TAU1250 Tau Light chain AC-35-4A6- U.S. Pat. No. 9,540,434 SEQ ID NO: 119 4197 variable Ab2 region (VK) TAU1251 Tau Light chain IPN002 Vk U.S. Pat. No. 9,567,395 SEQ ID NO: 32 4198 variable variant 1 region, humanized TAU1252 Tau Light chain IPN002 Vk U.S. Pat. No. 9,567,395 SEQ ID NO: 33 4199 variable variant 2 region, humanized TAU1253 Tau Light chain IPN002 Vk U.S. Pat. No. 9,567,395 SEQ ID NO: 34 4200 variable variant 3 region, humanized TAU1254 Tau Light chain IPN002 Vk U.S. Pat. No. 9,567,395 SEQ ID NO: 35 4201 variable variant 4 region, humanized TAU1255 Tau (pS422) Light chain VL31A1 US20160376352A1 SEQ ID NO: 66 4202 variant 18 TAU1256 Tau (pS422) Light chain VL49G1 US20160376352A1 SEQ ID NO: 67 4203 variant 19 TAU1257 Tau (pS422) Light chain VL35F2 US20160376352A1 SEQ ID NO: 68 4204 variant 20 TAU1258 Tau (pS422) Light chain VL53A2 US20160376352A1 SEQ ID NO: 69 4205 variant 21 TAU1259 Tau (pS422) Light chain VL35G4 US20160376352A1 SEQ ID NO: 78 4206 variant 22 TAU1260 Tau (pS422) Light chain VL4G1 US20160376352A1 SEQ ID NO: 86 4207 variant 24 TAU1261 Tau Light chain C2N-8E12 WO2016201434A2 SEQ ID NO: 5 4208 variant gVL1 TAU1262 Tau Light chain C2N-8E12 WO2016201434A2 SEQ ID NO: 6 4209 variant gVL2 TAU1263 Tau Light chain C2N-8E12 WO2016201434A2 SEQ ID NO: 7 4210 variant gVL3 TAU1264 Tau Light chain C2N-8E12 WO2016201434A2 SEQ ID NO: 8 4211 variant gVL4 TAU1265 Tau (421) Light chain 5B3C11 WO2017027685A2 SEQ ID NO: 24 4212 VL1 variable domain TAU1266 Tau (421) Light chain 5B3C11 WO2017027685A2 SEQ ID NO: 28 4213 VL2 variable domain TAU1267 Tau Light chain; WO2017005734A1 SEQ ID NO: 24 4214 humanized TAU1268 Tau Light chain; WO2017005732A1 SEQ ID NO: 30 4215 humanized TAU1269 Tau Light chain; WO2017005732A1 SEQ ID NO: 31 4216 humanized TAU1270 Tau Light chain; WO2017005732A1 SEQ ID NO: 34 4217 humanized TAU1271 Tau Light chain; WO2017005732A1 SEQ ID NO: 35 421.8 humanized TAU1272 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 47 4219 TAU1273 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 48 4220 TAU1274 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 49 4221 TAU1275 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 50 4222 TAU1276 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 51 4223 TAU1277 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 52 4224 TAU1278 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 53 4225 TAU1279 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 54 4226 TAU1280 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 55 4227 TAU1281 Tau (421) scFv 1G10D2 WO2017027685A2 SEQ ID NO: 56 4228 TAU1282 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 57 4229 TAU1283 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 58 4230 TAU1284 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 59 4231 TAU1285 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 60 4232 TAU1286 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 61 4233 TAU1287 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 62 4234 TAU1288 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 63 4235 TAU1289 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 64 4236 TAU1290 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 65 4237 TAU1291 Tau (421) scFv 1G11A10 WO2017027685A2 SEQ ID NO: 66 4238 TAU1292 Tau pS404 scFv 4E607 WO2017027691A1 SEQ ID NO: 17 4239 TAU1293 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 67 4240 TAU1294 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 68 4241 TAU1295 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 69 4242 TAU1296 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 70 4243 TAU1297 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 71 4244 TAU1298 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 72 4245 TAU1299 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 73 4246 TAU1300 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 74 4247 TAU1301 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 75 4248 TAU1302 Tau (421) scFv 5B3C11 (VL1) WO2017027685A2 SEQ ID NO: 76 4249 TAU1303 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 77 4250 TAU1304 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 78 4251 TAU1305 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 79 4252 TAU1306 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 80 4253 TAU1307 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 81 4254 TAU1308 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 82 4255 TAU1309 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 83 4256 TAU1310 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 84 4257 TAU1311 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 85 4258 TAU1312 Tau (421) scFv 5B3C11 (VL2) WO2017027685A2 SEQ ID NO: 86 4259 TAU1313 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 87 4260 TAU1314 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 88 4261 TAU1315 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 89 4262 TAU1316 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 90 4263 TAU1317 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 91 4264 TAU1318 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 92 4265 TAU1319 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 93 4266 TAU1320 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 94 4267 TAU1321 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 95 4268 TAU1322 Tau (421) scFv 5G2A3 WO2017027685A2 SEQ ID NO: 96 4269

    [0289] In one embodiment, the payload region of the AAV particle comprises a nucleic acid sequence encoding a polypeptide which is an antibody, an antibody-based composition, or a fragment thereof. As a non-limiting example, the antibody may be one or more of the polypeptides listed in Table 3. As another non-limiting example, the antibody may be one or more of the heavy chain sequences listed in Table 3. As a non-limiting example, the antibody may be one or more of the light chain sequences listed in Table 3.

    [0290] In one embodiment, the payload region of the AAV particle comprises a nucleic acid sequence encoding a polypeptide comprising a heavy chain and a light chain sequence listed in Table 3. The payload region may also comprise a linker between the heavy and light chain sequences. The linker may be a sequence known in the art or described in Table 2.

    [0291] In one embodiment, the payload region of the AAV particle comprises a nucleic acid sequence encoding a polypeptide comprising a heavy chain and a light chain sequence listed in Table 3, where the heavy chain sequence is from a different antibody than the light chain sequence. The payload region may also comprise a linker between the heavy and light chain sequences. The linker may be a sequence known in the art or described in Table 2.

    [0292] In one embodiment, the payload region comprises, in the 5 to 3 direction, an antibody light chain sequence, a linker and a heavy chain sequence.

    [0293] In one embodiment, the payload region comprises a nucleic acid sequence encoding, in the 5 to 3 direction, an antibody light chain sequence from Table 3, a linker from Table 2 and a heavy chain sequence from Table 3. Non-limiting examples are included in Table 4.

    [0294] In one embodiment, the payload region comprises, in the 5 to 3 direction, an antibody heavy chain sequence, a linker and a light chain sequence.

    [0295] In one embodiment the payload region comprises a nucleic acid sequence encoding, in the 5 to 3 direction, an antibody heavy chain sequence from Table 3, a linker from Table 2, and a. light chain sequence from Table 3. Non-limiting examples are included in Table 4.

    [0296] In one embodiment, the payload region comprises a nucleic acid sequence encoding a single heavy chain. As a non-limiting example, the heavy chain is an amino acid sequence or fragment thereof described in Table 3.

    [0297] Shown in Table 3 are a listing of antibodies and their polynucleotides and/or polypeptides sequences. These sequences may be encoded by or included in the AAV particles of the present invention. Variants or fragments of the antibody sequences described in Table 3 may be utilized in the AAV particles of the present invention,

    [0298] In some embodiments, the AAV particles may comprise eodon-optimized versions of the nucleic acids encoding the polypeptides listed in Table 3. In some cases, the payload region of the AAV particles of the invention may encode one or more isoforms or variants of these heavy and light chain antibody domains. Such variants may be humanized or optimized antibody domains composing one or more complementarity determining regions (CDRs) from the heavy and light chains listed in Table 3, CDRs of the antibodies encoded by the viral genomes of the present invention may be 50%, 60%, 70%, 80%, 90%, 95% identical to CDRs listed in or incorporated in the sequences of Table 3. Methods of determining CDRs are well known in the art and are described herein. Payioad regions may encode antibody variants with one or more heavy chain variable domain (V.sub.H) or light chain variable domain (V.sub.L) derived from the antibody sequences in Table 3. In some cases, such variants may include bispecific antibodies. Bispecific antibodies encoded by payload regions of the invention may comprise variable domain pairs from two different antibodies.

    [0299] In one embodiment, the AAV particles may comprise a heavy and a light chain of an antibody described herein and two promoters. As a non-limiting example, the AAV particles may comprise a nucleic acid sequence of a genome as described in FIG. 1 or FIG. 2 of US Patent Publication No. US20030219733, the contents of which are herein incorporated by reference in its entirety. As another non-limiting example, the AAV particles may be a dual-promoter AAV for antibody expression as described by Lewis et al. (J. of. Virology, Sept 2002, Vol. 76(17), p8769-8775; the contents of which are herein incorporated by reference in its entirety).

    [0300] Payioad regions of the viral genomes of the invention may encode any anti-tau antibodies, or tau-associated antibodies, not limited to those described in Table 3, including antibodies that are known in the art and/or antibodies that are commercially available. This may include fragments of such antibodies or antibodies that have been developed to comprise one or more of such fragments [e.g., variable domains or complementarity determining regions (CDRs)]. Anti-tau antibodies that may be encoded by payloads of the invention include, but are not limited to, AT8 (pSer.sup.202/pThr.sup.202; ThermoFisher. Waltham, Mass.; described in International Publication No. WO1995017429, the contents of which are herein incorporated in their entirety). AT100 (pSef.sup.212/pSer.sup.214; ThermoFisher, Waltham, Mass.; described in U.S. Pat. No. 6,121,003, the contents of which are herein incorporated in their entirety), AT180 (pTh.sup.231, ThermoFisher, Waltham, Mass.; described in International Publication No. WO1995017429, the contents of which are herein incorporated by reference in their entirety ), MC-1 (Tau.sup.2-18/312-342 conformational antibody; as described in International Publication WO 199620218, the contents of which are herein incorporated by reference in their entirety ), MC-6 (pSer.sup.235; described in U.S. Pat. No. 5,811,310, the contents of which are herein incorporated in their entirety), TG-3 (pThr.sup.231; described in Jicha, G A et al., 1997 J Neurochem 69(5):2087-95, the contents of which are herein incorporated by reference in their entirety), CP13 (pSer.sup.202), CP27 (human Tan.sup.130-150), Tau12 (human Tan.sup.9-18: Abeam, Cambridge, Mass.), TG5 (Tau.sup.220-242; described in U.S. Pat. No. 5,811,310), DA9 (Tau.sup.102-140; described in U.S. Pat. No. 5,811,310), PHF-1 (pSer.sup.396/pSer.sup.404; described in International Publication WO199620218), Alz50 (Tau.sup.7-9 and Tau.sup.312-342 conformational epitope; described in U.S. Pat. No. 5,811,310 and Carmel, G et al 1996 J Biol Chem 271(51):32780-32795 and Jicha, GaA et al, 1997 J Neurosci Res 48(2): 128-132, the contents of each of which are herein incorporated by reference in their entirety), Tau-1 (de-phosphorylated Ser.sup.195/Ser.sup.198/Ser.sup.199/Ser.sup.202; ThermoFisher, Waltham, Mass.), Tau46 (Tau.sup.404-441; Abcam, Cambridge, Mass.), pSI99 (ThermoFisher, Waltham, Mass.), pT205, pS396 (ThermoFisher, Waltham, Mass.; described in U.S. Pat. No. 8,647,631, the contents of which are herein incorporated by reference in their entirety ), pS404(ThermoFisher, Waltham, Mass.; described in U.S. Pat. No. 8,647,631, the contents of which are herein incorporated by reference in their entirety), pS422 (ThermoFisher, Waltham, Mass.), A0024 (hTau.sup.243-441; Dako, Glostrup, Denmark), HT7 (hTau.sup.159-363; ThermoFisher, Waltham, Mass.), Tau2 (hTau.sup.52-68; Abeam, Cambridge, Mass.), AD2 (pSer.sup.396/pSer.sup.404; Bio-Rad Laboratories, Hercules, Calif.), ATI 20 (hTau.sup.216-224; described in U.S. Pat. No. 5,843,779, the contents of which are herein incorporated by reference in their entirety), AT270 (pThr.sup.181; ThermoFisher, Waltham, Mass.), 12E8 (pSer.sup.262 and/or Ser.sup.356), K.9JA (hTau.sup.243-443; Dako, Caprinteria, Calif.), TauC3 (hTau Asp441; Santa Cruz Biotechnology, Dallas, Tex.; described in U.S. Patent Publication US20120244174 and Gamblin, T C et al 2003 PNAS 100(17): 10032-7, the contents of each of which are herein incorporated by reference in their entirety), 4E6G7 (pSer.sup.396/pSer.sup.404; described in U.S. Patent Publication No. US2010316564 and Congdon, E. E. et al., 2016. Molecular Neurodegeneration Aug 30;11(1) :62, the contents of which are herein incorporated by reference in their entirety), 6B2 and variants thereof described in International Patent Publication WO2016007414, the contents of which are herein incorporated by reference in their entire RZ3 (pThr.sup.231), PG5 (pSer.sup.409), BT2 (pS.sup.199/202), DAS 31 (Tau.sup.150-190), CP9 (pThr.sup.231) Ta1505 (phospho site between Tau.sup.410-421, particularly pSer.sup.413 as described in U.S. Patent Publication US20150183854 and Umeda, T. et al., 2015. Ann Clin Trans Neurol 2(3): 241-255, the contents of each of which are herein incorporated by reference in their entirety), PHF-6 (pThr.sup.231, as described in Hoffman R et al., 1997, Biochemistry 36:8114-8124, the contents of which are herein incorporated by reference in their entirety), PHF-13 (pSer.sup.396, as described in Hoffman R et al., 1997. Biochemisty 36:8114-8124), 16B5 (Tau.sup.25-46, as described in United States Publication US20160031976, the contents of which are herein incorporated by reference in their entirety), DC8E8 (as described in United States Patent Publication US20150050215, the contents of which are herein incorporated by reference in their entirety), PT1 or PT3 (as described in U.S. Pat. No. 9,371,376, the contents of which are herein incorporated by reference in their entirety), 4G11 (Tau.sup.57-64, as described in International Publication WO2016137950, the contents of which are herein incorporated by reference in their entirety), 1A6 (Tau.sup.7-17 and Tau.sup.215-220, as described in International Publication WO2016137950), Tau15 or Tau81 (as described in International Publication WO2016055941, the contents of which, are herein incorporated, by reference in their entirely), TOC-1 (dimerized or aggregated tau, as described in International Publication WO2012149365, the contents of which are herein incorporated by reference in their entirety), pS4041gG2a/k (Neotope Biosciences, South San Francisco, Calif.; as described in Ittner et al., 201.5. Neurochemistry 132:135-145, the contents of which are herein incorporated by reference in their entirety), TOMA (tau oligomer monoclonal antibody; as described in U.S. Pat. Nos. 8,778,343 and 9,125,846, International Publications WO2012051498 and WO2011026031, or United States Publication Nos. US20150004169 and US20150322143, and Castfflo-Cananza, DL et al, 2014 J Neurosci 34(12)4260-72, the contents of each of which are herein incorporated by reference in their entirety), TT099 (oligomeric tau), BMS-986168 (as described in U.S. Patent Publication US2014294831, International Publication WO2015081085 and U.S. Pat. 898027 L the contents of which are herein incorporated by reference in their entirety), 3H3 (pan-amyloid epitope; described in Levites, Y et al 2015 J Neurosci 35(16)6265-76, the contents of which are herein incorporated by reference in their entirety), cis-pT231(described in International Publications WO2012149334 and WO2011056561, the contents of which are herein incorporated by reference in their entirety), CP-3 (pSer.sup.214; described in Jicha et al 1999 J Neurosci 19(17):7486-94, the contents of which are herein incorporated by reference in their entirety), TNT1 (Tau.sup.2-18, as described in United States Patent Publication 20160031978, the contents of which are herein incorporated by reference in their entirety ), Tau-nY29 (nTyr.sup.29; described in Reynolds M R, et al., 2006 J Neurosci 26(42):10636-45, the contents of which are herein incorporated by reference in their entirety), Tau-nY197 (nTyr197; described in Reyes, J F et al., 2012 Acta Neuropath ol 123(1):119-32, the contents of which are herein incorporated by reference in their entirety), Tau-nY394 (nTyr.sup.394; described in Reyes, J F et al 2012), 4E4 (Tau.sup.337-343 Tau.sup.387-397; described in International Publication WO2012049570 and United States Patent Publication US20150252102, the contents of each of which are herein incorporated by reference in their entirety), ADx210 (described in United States Patent Publication US20140161875, the contents of which are herein incorporated by reference in their entirety), ADx215 (described in U.S. Patent Publication US20140161875), ADx202 (as described in International Publication WO2015004163, the contents of which are herein incorporated by reference in their entirety), AP422 (pSer.sup.422: described in Hasegawa, M et al 1996 FEBS Lett 384:25-30, the contents of which are herein incorporated by reference in their entirety), Tau5 (Tau.sup.210-241), RTA2(Tau.sup.275-283), RTAC (Tan.sup.426-441), RTA1 (Tau.sup.257-274), T46 (Tau.sup.395-432), T49, MIGT4, O.BG.15, 525. 3-39, 4FL MapTau (Tau.sup.95-108; SMI Covance), T1, HYB33801 (Tau.sup.5-52), Tau13 (Tau.sup.2-18), B11E8, 5J20 (14-3-3 tau), DC25 (Tau.sup.347-353), DC39N1 (Tai.sup.45-73), DC-11 (Tau.sup.321-391; described in U.S. Pat. No. 7,746,180, the contents of which are herein incorporated by reference in their entirety), DC39 (Tau.sup.401-411), DC4R, n847 (nitrated tau), SPM452, T14, 1E1/A6 (Tau.sup.275-291), 5E2, 8E6/C11 (Tau.sup.209-224), 2E12 (pT231), NFT200, 248E5 (Tau.sup.3-214), IG2 (Thr.sup.175, Thr.sup.181, Thr.sup.233; as described in International Publication WO2016041553, the contents of which are herein incorporated by reference in their entirety), YP3 (as described in WO2007019273, the contents of which are herein incorporated by reference in their entirety), YP4 (as described in WO2007019273) and 14-3-3 Tau (pSer 14-3-3 binding motif: Abeam, Cambridge, Mass.). Further, anti-tau antibodies may be any of those listed in the antibody section of Alzforum.org or at the Antibody Resource Page.com, the contents of each of which are herein incorporated by reference in their entirety. Further, anti-tau antibodies may be any commercially available anti-tau antibody. Additional antibodies may include any of those taught in Petty, F. R. et al., 2014. PLoS One 9(5): e94251, the contents of which are herein incorporated by reference in their entirety. In one example, such antibodies may include any of those described in Jicha, G. A. et al., 1997. Journal ofNeuroscience Research 48:128-132, the contents of which are herein incorporated by reference in their entirety. One such antibody, MC-1, recognizes distinct conformations of tau that are associated with neurological disease,

    [0301] In some embodiments, payloads may encode anti-tau antibodies (or fragments thereof) taught in United States Publication No. US2014294831, the contents of which are herein incorporated by reference in their entirety. Such antibodies may include IPN001 and/or IPN002antibodies or fragments of such antibodies. In some cases, variable domains of IPN002 as presented in FIGS. 2A and 2B of US2014294831 may be used (e.g., incorporated into another antibody). In some cases, CDR regions of IPN002 as underlined in FIGS. 2A and 2B may be used (e.g., incorporated into another antibody or used to prepare humanized versions of IPN002), In some cases, anti-tau antibodies may include any of the IPN001or IPN002 antibody variants taught in US2014294831 (e.g., in FIGS. 9-16 of that publication). In one embodiment, this antibody is also referred to as RMS-986168.

    [0302] In some cases, payloads may encode anti-tau antibodies (or fragments thereof) taught in Otvos, L. et al., 1994. J Neurosci. Res 39(6:669-73, the contents of which are herein incorporated by reference in their entirety. Such antibodies may include monoclonal antibody PHF-1 or fragments thereof. The PHF-1 antibody binds to tau paired helical filaments, a pa thological conformation of tau, found in certain neurological disorders, including Alzheimer's disease. Further, antibody affinity is increased when either serine 396 or serine 404 of tau is phosphorylated and even further increased when both are phosphorylated.

    [0303] In some embodiments, payloads may encode anti-tau antibodies (or fragments thereof) taught in U.S. Pat. No. 5,811,310, the contents of which are herein incorporated by reference in their entirety. Such embodiments may include monoclonal antibodies PHF-1 or MC-1 or fragments thereof. MC-1 is a conformational antibody binding to the epitopes presented in Jicha, G. A., et al., 1997. J Neurosci Res 48(128-132).

    [0304] In some embodiments, payloads may encode anti-tau antibodies (or fragments thereof) taught in International Publication Number WO2015035190, the contents of which are herein incorporated by reference in their entirety. Such embodiments may include, but are not limited to, antibodies PHF-1 or MC-1 or fragments thereof. Viral genomes of the AAV particles of the present invention may comprise or encode any of SEQ ID NO: 1-6 of WO2015035190.

    [0305] Anti-tau antibodies (or fragments thereof) encoded by viral genomes of the invention may include antibodies that bind to one or more of the epitopes presented in Otvos, L. et al., 1994, J Neurosci. Res 39(6:669-73 (e.g., any of those presented in Table 1 of that publication).

    [0306] In some embodiments, payloads may encode anti-tau antibodies (or fragments thereof) taught in U.S. Pat. No. 7,746,180, the contents of which are herein incorporated by reference in their entirety. Such embodiments may include antibody DC-1.1 or fragments thereof.

    [0307] In some embodiments, the antibodies encoded by the viral genomes of the present invention may target any of the antigenic regions or epitopes described in United States Patent Publication No US2008050383 or US20100316564, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the antibody targets pS396/pS404. Such embodiments may include antibody 4E6 and/or variants or fragments thereof. The affinity of antibody 4E6 for soluble PFIF and its ability to reduce soluble phospho tau has been described in Congdon, E. E. et al., 2016. Molecular Neurodegeneration Aug 30;11(1):62, the contents of which are herein incorporated by reference in their entirety.

    [0308] In some embodiments, the antibodies encoded by the viral genomes of the present invention may target any of the antigenic regions or epitopes described in International Patent Publication WO1998022120, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the antibody may be PHF-6 (pT231), or fragments or variants thereof. In another embodiment, the antibody may be PHF-13 (pS396). or a fragment of variant thereof. These antibodies are further described in Hoffman et al., 1997. Biochemistry 36: 8114-8124, the contents of which are herein incorporated by reference in their entirety.

    [0309] In some embodiments, the antibodies encoded by the viral genomes of the present invention may target any of the antigenic regions or epitopes described in International Publication WO2016126993, the contents of which are herein incorporated by reference in their entirely. The antibodies may be derived from any of the tau epitopes described, in Table A of WO2016126993. In one embodiment, the antibody of the present invention may comprise any of the sequences listed in Table B or Table 1 of WO2016126993.

    [0310] In some embodiments, the antibodies encoded by the viral genomes of the present invention may target any of the antigenic regions or epitopes described in United States Patent Publication US20120244174, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the antibody may bind to caspase-cleaved tau. In one embodiment, the epitope for antibodies targeting caspa.se cleaved tau is aspartic acid 421. In another embodiment, the epitope for antibodies targeting caspase cleaved tau may be the C-terminus after glutamic residue Glu391. In yet another embodiment, the epitope for antibodies targeting caspase cleaved tau may be at the N-terrminus at aspartic acid residue 13. In another embodiment, the antibody may be TauC3.

    [0311] In some embodiments, the antibodies encoded by the viral genomes of the present invention may target any of the antigenic regions or epitopes described in U.S. Patent Publication US20160031978, the contents of which are herein incorporated by reference in their entirely. In one embodiment, the antibody may bind to tau Nterminal residues associated with the PP1/GSK3 signaling cascade. In one embodiment, the antibody may be TNT1.

    [0312] In some embodiments, the antibodies encoded by the viral genomes of the present invention may be any of those described in d'Abrarao, C et al., 2015. PLOS One 10(8):e0135774, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the antibody may be CP13 (pS202), or a fragment or variant thereof. In another embodiment, the antibody may be RZ3 (pT231), or a fragment or variant thereof. In another embodiment, the antibody may be PG5 (pS409), or a fragment or variant thereof.

    [0313] Anti-tau antibodies or fragments thereof encoded by the viral genomes of the present invention may target tau in any antigenic form. As non-limiting examples, antigenic tau may be an unphosphorylated or unmodified, tau protein, a phosphorylated or otherwise post-translationally modified tau protein (O-GlnAcylated, or nitrosylated), an oligomeric species of tau protein, a soluble species of tau protein, an insoluble species of tau protein, a conformationally abnormal species of tau protein, a neuropathological form of tau protein and/or a neurofibrillary tangle or a precursor thereof.

    [0314] Anti-tau antibodies or fragments thereof encoded by the viral genomes of the invention, may target any antigenic region or epitope along the full length of any of the six human tau protein isoforms. As non-limiting examples, the targeted antigenic peptides of the tau protein may be any of the following phosphorylated sites pT50, pS396, pS396pS404, pS404, pS396-pS404-pS422, pS409, pS413, pS422, pS198, pS199, pS199-pS202, pS202, pT205, pT212, pS214, pT212-pS214, pT181, pT231, cis-pT231, pS235, pS238, pT245, pS262, pY310, pY394, pS324, pS356, pTau.sup.177-187, pY18, pS610, pS622. nitrosvlated tau (nY18, nY29), methylated tau (di-meK28L dimeK311), O-GlnAcylated tau at S400, any of the following acetylated sites acK174, acK274, acK280, acK281 and/or any combination thereof. Acetylated tau proteins and associated antigenic peptides are described in Min et al, 2010, Neuron., 67, 953-966, Min et al., 2015, Nature Medicine., 10, 1154-1162, Cohen et al., 2011, Nature Communications., 2, 252, Gorsky et al, 2016, Scientific Report., 6, 22685, Tracy et al., 2016, Neuron., 90, 245-260, the contents of each of which are herein incorporated by reference in their entirety. Phosphorylated tau proteins and associated antigenic peptides are described in Asuni et al., 2007, J Neuroscl. 27, 9115-9129, Boutajangout et al., 2010, J Neuroses., 30, 16559-16566, Boutajangout et al., 2011, J Neurochem, 118, 658-667, Chai et al., 2011, J Biol Chem, 286, 34457-34467, Gu et al., 2011, J Biol Chem, 288, 33081-33095, Sankaranarayanan et al., 2015, PloS One, 10, e0125614, Ittner et al., 2015, J Neurochem., 132, 135-145, D'Abramo et al., 2016, Neurobiol Aging., 37, 58-65, Collin et al., 2014, Brain., 137, 2834-2846, Kondo et al., 2015, Nature., 523, 431-436, the contents of each of which are herein incorporated by reference in their entirety.

    [0315] In one embodiment, the antibody encoded by the viral genomes of the present invention may be a pS409 targeting antibody as described in Lee et al., 2016, Cell Reports, 16, 1690-1700, or International Patent Publication WO2013151762, the contents of each of which are herein incorporated by reference in their entirety. In some embodiments, this antibody may be RG6100 or R071057 or variants or fragments thereof.

    [0316] In one embodiment, the antibody encoded by the viral genomes of the present invention may be a pS413 targeting antibody as described in Umeda et al, 2015, Ann Clin Trans Neurol., 2(3), 241-255 or International Patent Publication WO2013180238, the contents of each of which are herein incorporated by reference in their entirety. In one embodiment, the antibody is Ta1505 or variants or fragments thereof.

    [0317] In one embodiment, the antibody encoded by the viral genomes of the present invention may target a tau epitope with amino acid residues 210-275, more specifically pS238 and/or pT245, as described in International Publication WO2011053565, the contents of which are herein incorporated by reference in their entirety.

    [0318] In one embodiment, the CDRs of an antibody encoded by the viral genomes of the present invention may be any of those listed in or incorporated in the antibody sequences of Table 3. In one embodiment, the CDRs may be any of those described in International Publication WO2015122922, the contents of which are herein incorporated by reference in their entirety. In one embodiment, a CDR may be any of those chosen from the group of SEQ ID NO: 41, 49, or 57 of WO2015122922. Further a CDR of an antibody encoded by the viral genomes of the present invention may have 50%, 60%, 70%, 80%, 90%, or 95% identity to SEQ ID NO: 41, 49, or 57 of WO2015122922.

    [0319] In one embodiment, the antibodies encoded by the viral genomes of the present invention may be any of those described in international Publication WO2016097315, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the antibody may have an amino acid sequence as shown by SEQ ID NO: 2, 11, 20, 29, 38, 47, 56, 65, 74, 83, 92, 101, 110, 119, 128, 137, 146, 155, 164, 173, 182, 191, 209, 218, 226, or 227 of WO2016097315.

    [0320] In one embodiment, the antibodies encoded by the viral genomes of the present invention may be a muitispecific blood brain barrier receptor antibody that also targets tau, as described, in International Publication WO2016094566, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the antibody may have a sequence as shown by SEQ ID NO: 1, 2, 17, 18, 33, 34, 49, 50, 65, 66, 81, 82, 9-16, 25-32, 41-48, 57-64, 73-80, 89-96 of WO2016094566.

    [0321] In some embodiments, the antibodies (or fragments thereof) encoded by the viral genomes of the present invention may be any of those taught in U.S. Pat. No. 8,778,343 and U.S. Pat. No. 9,125,846, International Publications WG2012051498 and WO2011026031, or United States Publication Nos. US20150004169 and US20150322143, the contents of each of which are herein incorporated by reference in their entirety. Such antibodies may include those that bind to oligoraeric species of tau. Further, such an antibody may be referred to as TOMA (tau oligomer monoclonal antibody), as described in Castillo-Carranza et at (Castillo-Carranza, DL et al., 2014 J Neurosci 34(12)4260-72) the contents of which are herein incorporated by reference in their entirety. In one embodiment, the antibody that binds oligomeric tau may be TTC-99.

    [0322] In some embodiments, the antibodies (or fragments thereof) encoded by the viral genomes of the present invention may be any of those taught in International Publications WO2014059442, the contents of which are herein incorporated by reference in their entirety. Such antibodies may include those that bind to oligomeric species of tau.

    [0323] In some embodiments, the antibodies (or fragments thereof) encoded by the viral genomes of the present invention may be any of those taught in the International Publications WO2014008404 and WO2016126993, United States Patent Publication US20150183855, Yanamandra, K et al., 2013 Neuron 80(2):402-14 and Yanamandra, K et al 2015 Ann Clin Transl Neurol 2(3):278-88, the contents of each of which are herein incorporated by reference in their entirety. Such antibodies may block tau seeding. Non-limiting examples of antibodies described in these publications include HJ8.1.1, HJ8.1.2, HJ8.2, HJ8.3, HJ8.4, HJ8.5, HJ8.7, HJ8.8, HJ9.1, HJ9.2, HJ9.3, HJ9.4, HJ9.5, and variants thereof. Non-limiting examples of targeted epitopes of tau may include amino acids 22-34, 385-391, 405-411, 3-6, 118-122, 386-401, 7-13, and/or 272-281 of human tau.

    [0324] In some embodiments, the antibodies (or fragments thereof) encoded by the viral genomes of the present invention may be any of those taught in the International Publications WO200206285.1, the contents of which are herein incorporated by reference in their entirety.

    [0325] In some embodiments, the antibodies (or fragments thereof) encoded by the viral genomes of the present invention may be as described in Bright, J et al., 2015 Neurobiol of Aging 36:693-709; Pedersen, J T and Sigurdsson E M, 2015 Trends Mol Med 21(6):394-402; Levites. Y et al. 2015 J Neurosci 35(16)6265-76; Jicha et al 1999 J Neuroses 19(17): 7486-94; Reyes J F et al., 2012 Acta Neuropathol 123(1):119-32; Reynolds M R, et al., 2006 J Neurosci 26(42):10637-45; Gamblin, TcC et al 2003 PNAS 1.00(17):10032-7; Castfflo-Cananza, D L et al., 2014 J Neuroses 34(12)4260-72; Walls, K C et al., 2014 Neuroses Lett 575:96-100; Yanamandra. K et al., 2013 Neuron 80(2):402-14; Yanamandra, K et al 2015 Ann Clin Transl Neurol 2(3):278-88; Allen B. et al., 2002 J Neurosci 22(21):9340-51; Gotz, J et al, 2010 Biochem Biophys Acta 1802(10:860-71; Hasegawa, M et al 1996 FEES Lett 384:25-30; Carmel, G et al 1996 J Biol Chem 271 (51 ):32780-32795; Jicha, G A et al, 1997 J Neurosci Res 48(2):1.28-132; Jicha, G A et al., 1997 j Neurochem 69(5):2087-95; the contents of each of which are herein incorporated by reference in their entirety.

    [0326] Anti-tau antibodies or fragments thereof encoded by the viral genomes of the present invention may be any commercially available anti-tau antibody known in the art or developed by a person with skill in the art. Non-limiting examples of commercially available anti-tau antibodies include EPR2396(2) (pThr.sup.50; Abcam, Cambridge, Mass.), 5H911 (pThr.sup.181; ThermoFisher, Waltham, Mass.), M7004D06 (pThr.sup.181; BioLegend, San Diego, Calif), 1E7 (pThr.sup.181, EMD Miliipore, Billerica, Mass.), EPR2400 (pSsr398; Abcam, Cambridge, Mass.), EPR2401Y (pSer.sup.199; Abcam, Cambridge, Mass.), 2H23L4 (pSer.sup.199; ThermoFisher, Waltham, Mass.), EPR2402 (pSer.sup.202; Abcam, Cambridge, Mass.), 10F8 (pSer202; Abcam, Cambridge, Mass.), EPR2403(2) (pThr.sup.205; Abcam, Cambridge, Mass.), EPR1884(2) (pSer.sup.214; Abcam, Cambridge, Mass.), EPR2488 (pThr.sup.231; Abcam, Cambridge, Mass.), 1H6L6 (pThr231; ThermoFisher, Waltham, Mass.), 3G3 (pThr.sup.231, pSer.sup.235; Abcam, Cambridge, Mass.), EPR2452 (pSer.sup.235; Abcam, Cambridge, Mass.), 12G10 (pSer238; Abcam, Cambridge, Mass.), EPR2454 (pSer.sup.262; Abcam, Cambridge, Mass.), EPR2457(2) (pSer.sup.324; Abcam, Cambridge, Mass.), EPR2603 (pSer.sup.356; Abcam, Cambridge, Mass.), EPR2731 (pSer.sup.396; Abcam, Cambridge, Mass.), EPR2605 (pSer.sup.404; Abcam, Cambridge, Mass.), EPR2866 (pSer.sup.422; Abcam, Cambridge, Mass), 1A4 (pTau.sup.177-187; Origene, Roekville, Md.), 7G9 (pTau.sup.177-187; Origene, Rockville, Md.), 9B4 (pTau.sup.177-187, Origene, Rockville, Md.), 2A4 (pTau.sup.177-187; Origene, Roekville, Md.), 9G3 (pTyr.sup.18; NovusBio, Littleton, Colo.), EPR2455(2) (pSer.sup.610; Abcam, Cambridge, Mass.), EP2456Y (pSer622; Abcam, Cambridge, Mass.; EMD Miliipore, Biilerica, Mass.), SMI 51 (PHF Tan.sup.95-108; BioLegend, San Diego, Calif.), TOMA-1 (Oligomeric Tau, EMD Miliipore, Billerica, Mass.), Tau-nY18 (nTyr.sup.18, Origene, Rockville, Md.; BioLegend, San Diego, Calif.; EMD Miliipore, Billerica, Mass.), Tau-nY29 (nTyr.sup.29; BioLegend, San Diego, Calif.; EMD Miliipore, Billerica, Mass.; Abcam, Cambridge, Mass.), 1C9.G6 (di-methyl-Lys.sup.281; BioLegend, San Diego, Calif.), 7G5.F4 (di-methyl-Lys.sup.311; BioLegend, San Diego, Calif.), TNT-1 (Tau.sup.2-18; EMD Miliipore, Billerica, Mass.), TNT-2 (Tau.sup.2-58; EMD Miliipore, Billerica, Mass.), 7B8 (Tau.sup.5-12; Abcam, Cambridge, Mass.), Tau-13 (Tau.sup.20-35; BioLegend, San Diego, Calif.), 1-100 (Tau.sup.1-100; BioLegend, San Diego, Calif.), 2G9.F10 (Tau.sup.157-168, BioLegend, San Diego, Calif., Origene, Rockville, Md.), 39E10 (Tau.sup.189-195; BioLegend, San Diego, Calif., Origene, Rockville, Md.), 77E9 (Tau.sup.185-195; BioLegend, San Diego, Calif.; Origene, Rockville, Md.), ATS (pSer.sup.202, pSer.sup.205; ThermoFisher, Waltham, Mass.), AT100 (pSer.sup.212, pSer.sup.214; ThermoFisher, Waltham, Mass.), PHF-6 (pThr.sup.231; NovusBio, Littleton, Colo.; EMD Miliipore, Billerica, Mass.; BioLegend, San Diego, Calif.; ThermoFisher, Waltham, Mass.), AT180 (pThr.sup.231; ThermoFisher, Waltham, Mass.), AT270 (pThr.sup.181; ThermoFisher, Waltham, Mass.), PHF-13 (pSer.sup.396; ThermoFisher, Waltham, Mass.; BioLegend, San Diego, Calif.), TauC3 (Asp.sup.421; BioLegend, San Diego, Calif.; EMD Miliipore, Billerica, Mass.; ThermoFisher, Waltham, Mass.), Taul2 (Tau.sup.6-18; BioLegend, San Diego, Calif.; EMD Miliipore, Billerica, Mass.), Tau5 (Tau210-241; BioLegend, San Diego, Calif.; EMD Millipore, Billerica, Mass.; Abcam, Cambridge Mass.; ThermoFisher, Waltham, Mass.), HT7 (Tau.sup.159-163; ThermoFisher, Waltham, Mass.), 77G7 (Tau.sup.316-355; BioLegend, San Diego, Calif.), Tau46 (Tau.sup.404-441; BioLegend, San Diego, Calif.; NovusBio, Littleton, Colo.; Abcam, Cambridge, Mass.), UMAB239 (Tau.sup.623-758, Origene, Rockville. Md.), OTI6G3 (Tau.sup.623-758; Origene, Rockville, Md.), OTI13E11 (Tau.sup.623-758, Origene, Rockville, Md.), OTI13B5 (Tau.sup.623-758; Origene, Rockville, Md.), E178 (Tau.sup.700-800; Abcam, Cambridge, Mass.), SP70 (N-terminal Tau; Origene, Rockville, Md.; NovusBio, Littleton, Colo.; ThermoFisher, Waltham, Mass.; Abcam, Cambridge, Mass.), C45 (N-terminal Tau; Origene, Rockville, MD), Tau7 (C-terminal Tau; EMD Millipore, Billerica, Mass.), S. 125.0 (C-terminal Tau; ThermoFisher, Waltham, Mass.), 8E6/C11 (Three-repeat Tau.sup.209-224; EMD Millipore, Billerica, Mass.), 1E1/A6 (Four-repeat Tau.sup.275-291; EMD Millipore, Billerica, Mass.), 7D12.1 (Four-repeat Tau.sup.275-291; EMD Millipore, Billerica, Mass.), 5C7 (Four-repeat Tau.sup.267-278; BioLegend, San Diego, Calif.; Origene, Rockville, Md.), 5F9 (Four-repeat Tau.sup.275-291; BioLegend, San Diego, Calif.: Origene, Rockville, Md.), 3H6.H7 (0N Tau.sup.39-50; BioLegend, San Diego, Calif.; Origene, Rockville, Md.), 4H5.B9 (1N Tau.sup.68-79: BioLegend, San Diego, Calif.; Origene, Rockville, Md.), 71C11 (2N Tau; BioLegend, San Diego, Calif.), PC1C6 (unphosphorylated tau; EMD Millipore, Billerica, Mass.), Tau2 (BioLegend, San Diego, Calif.; Origene, Rockville, Md.; EMD Millipore, Billerica, Mass.), 2E9 (Origene, Rockville, Md.; NovusBio, Littleton, Colo.), 4F1 (Origene, Rockville, Md., NovusBio, Littleton, Colo.), 5B10 (NovusBio, Littleton, Colo.); 5E2 (EMD Millipore, Billerica, Mass.), Tau-93 (Origene, Rockville, Md.), T14 (ThermoFisher, Waltham, Mass.), T46 (ThermoFisher, Waltham, Mass.), BT2 (ThermoFisher, Waltham, Mass.) and/or variants or derivates thereof.

    [0327] In one embodiment, the antibodies encoded by the viral genomes of the present invention may be multispecific antibodies for transferrin receptor and a brain antigen, wherein the brain antigen may be tau, as described in International Publication WO2016081643, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the antibody may have a sequence as given by SEQ ID NO: 160 or 161 of WO2016081643.

    [0328] In one embodiment, the antibodies encoded by the viral genomes of the present invention are any of those described in U.S. Pat. Nos. 8,871,447, 8,420,613, International Publication No. WO2014193935, WO2010011999, or in United States Publication Nos. US20110250217, US20110020237, US20100316590, or US20120225864, the contents of each of which are herein incorporated by reference in their entirety. In one embodiment, the antibody recognizes an amyloidogenic or aggregating protein.

    Disease Specific Epitopes, Innate Defense Regulator Peptides, Cyclic Peptides

    [0329] In one embodiment, the viral genomes of the AAV particles may comprise nucleic acids which have been engineered to enable expression of antibodies binding to disease-specific epitopes of proteins. Such antibodies may be used to diagnose, prevent, and/or treat the corresponding medical conditions by targeting epitopes of the protein presented by or accessible on native or non-native forms (e.g., misfolded forms of native proteins) of the target. Such epitopes may be specific to diseases involved with misfolding of a protein due to pathologic condition and resulting in misfolded aggregates. The disease-specific proteins are considered to be toxic to neurons and to have a role in neuronal cell death and dysfunction in neurodegenerative diseases including, but not limited to, Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), Parkinson's disease, dementia by Lewy body (DLB), and prion diseases, e.g. Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussier-Scheinker syndrome (GSS), kuru, and fatal familial insomnia (FFI).

    [0330] In one embodiment, the encoded disease-specific epitopes may include epitopes on SOD1 that are revealed, as SOD1 (Superoxide dismutase [CuZn]) dissociates from its homodimeric, normal state. The SOD epitopes may be selectively presented or accessible in non-native SOD1 forms including misfolded SOD1 monomer, misfolded SOD1 dimer, and the epitopes selectively presented or accessible in SOD1 aggregates. Such epitopes may be specific to neurodegenerative diseases including, but not limited to, amyotrophic lateral sclerosis (ALS), Alzheimer's (AD), Parkinson's (PD), and Lewy body diseases (LBD).

    [0331] In one embodiment, the expressed antibodies may bind to epitopes presented by or accessible on non-native forms of SOD1, such as those presented by SED ID NO: 2, 3, 5, 6, and 7 of U.S. Pat No.7,977,314 (the contents of which are herein incorporated by reference in its entirety), or presented by or accessible on monomeric forms of SOD1, such as those presented by SEQ ID NO: 1 and 4 of U.S. Pat. No. 7,977,314, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the expressed antibodies may comprise isolated peptides corresponding to such epitopes, such as those presented in SEQ ID NO: 1-8 or SEQ ID NO: 8-16, or epitopes presented by SEQ ID NO: 34-63, 65-79 of U.S. Pat. No. 7,977,314, the contents of which are herein incorporated by reference in their entirety.

    [0332] In one embodiment, the encoded disease-specific epitopes may be specific to diseases associated with prion protein (PrP); familial amyloid polyneuropathy or senile systemic amyloidosis or a disease related by the presence of misfolded transthyretins (TTR), renal accumulation of 2 microglobulin amyloid deposits or a disease related by the presence of misfolded 2 microglobulin, amyotrophic lateral sclerosis (ALS) or a disease related by the presence of misfolded SOD1, leukemias or myelomas or a disease related by the presence of misfolded cluster of differentiation 38 (CD38); colon cancer metastasis and or a disease related by the presence of misfolded cluster of differentiation (CD44); tumors associated with tumor necrosis factor receptor (TNFR); cancers including cervical, head and neck, endometrial, lung and breast carcinomas, pleural mesotheliomas, malignant melanomas, Hodgkin lymphomas, anaplastic large cell non-Hodgkin lymphomas, or a disease related by the presence of misfolded Notch homolog 1 (NOTCH1) e.g. acute myeloid leukemias and B-cell chronic lymphoid leukemias; cancer in which Fas receptor (FasR) is implicated; cancers and related disorders in which misfolded epidermal growth factor (EGFR) is implicated; aid/or other related diseases, disorders and conditions.

    [0333] In one embodiment, the encoded disease specific epitopes may include epitopes that are revealed as the proteins misfold. In one embodiment, the expressed antibodies may bind to predicted epitopes of human PrP, such as those presented by SEQ ID NO: 1-10 of US Patent Publication No. US20100233176; bovine PrP, such as those presented by SEQ ID NO: 11-15 of US Patent Publication No. 11820100233176, TTR, such as those presented by SEQ ID NO: 16-22 of US Patent Publication No. US20100233176; beta-2 microglobulin, such as those presented by SEQ ID NO: 23-26 of US Patent Publication No. US20.100233176; SOD1, such as those presented by SEQ ID NO; 27-40 of US Patent Publication No. US20100233176; CD38, such as those presented by SEQ ID NO: 41-45 of US Patent Publication No. US20100233176; CD44, such as those presented by 46-50 of US Patent Publication No. US20100233176; TNFR, such as those presented by 51-55 of US Patent Publication No. US20100233176, notch protein, such as those presented in SEQ ID NO: 56-60 of US Patent Publication No. US20100233176; FasR, such as those presented by SEQ ID NO: 61-65 of US Patent Publication No. US20100233176; and EGFR, such as those presented by SEQ ID NO: 66-80 of US Patent Publication No. US 20100233176; the contents of which are herein incorporated by reference in their entirety.

    [0334] In one embodiment, the expressed antibodies may comprise peptides corresponding to such epitopes. In one embodiment, the expressed antibodies may comprise prion-specific peptides, such as those presented by SEQ ID NO: 81-88 of US Patent Publication No. US20100233176, the contents of which are herein incorporated by reference in their entirety, and variations thereof.

    [0335] In one embodiment, the encoded disease-specific epitopes may be specific to prion diseases, including transmissible spongiform encephalopathies (TSEs) or other prion diseases. In one embodiment, the expressed antibodies may bind to predicted epitopes of PrP, such as those presented by SEQ ID NO: 24, 26, 28, 30, 32, 34, 36, 39-43, of US Patent Publication No. US20150004185, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the expressed antibodies may comprise prion-specific peptides or peptide fusions, such as those presented by SEQ ID NO: 12-23, 25, 27, 29, 31, 33, 35, 37, 38, 43, and 44-48 of US Patent Publication No. US20150004185, the contents of which are herein incorporated by reference in their entirety.

    [0336] In one embodiment, the expressed antibodies may comprise prion peptides binding to prion specific abnormal isoform of the prion protein, such as those presented by SEQ ID NO: 2-10 of US Patent Publication No. US20040072236, the contents of which are herein incorporated by reference in their entirety.

    [0337] In one embodiment, the viral genomes of the AAV particles may comprise nucleic acids which have been engineered to express innate defense regulator (IDR) peptides. IDRs are imniunomodulatory peptides that act directly on cells to affect an innate immune response. Such IDRs may be used to treat neurodegenerative diseases associated with neuroinflammation, e.g. amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease, spinal muscular atrophy, and multiple sclerosis (MS) and other neurodegenerative diseases. In one embodiment, IDRs may be those presented by SEQ IDNO: 1-969, find 973-1264 of International Publication No. WO2013034982, the contents of which are herein incorporated by reference in their entirety, or analogs, derivatives, amidated variations and conservative variations thereof.

    [0338] In one embodiment, the viral genomes of the AAV particles may comprise nucleic acids which have been engineered to express antibodies binding to an epitope of the Tropomyosin receptor kinase (TrkC) receptor. Such antibodies may comprise a peptide, such, as one presented by SEQ ID NO: 1 of U.S. Pat. No.9,200,080, the contents of which are herein incorporated by reference in their entirety.

    [0339] In some embodiments, the viral genomes of the AAV particles may comprise nucleic acids which have been engineered to express cyclic peptides with an amino acid, sequence SNK. Non-limiting examples of other cyclic peptides include SEQ ID NO: 1-7 of U.S. Pat. No. 9,216,217, the contents of which are herein incorporated by reference in their entirety. The method of preparing the antibodies may include hyperimmune preparation method, as described, in U.S. Pat. No. 9,216,217, the contents of which are herein incorporated by reference in their entirety.

    Prions

    [0340] In one embodiment, the viral genomes of the AAV particles may comprise a nucleic acid sequence encoding antibodies comprising prion peptides comprising prion epitopes, and fusions and repeats thereof, such as those presented by SEQ ID NO: 8-32, 35, and 36 of U.S. Pat.9,056,918, the contents of which are herein incorporated by reference in their entirety.

    [0341] In one embodiment, the viral genomes of the AAV particles may comprise a nucleic acid sequence encoding prion binding proteins (PrPBP). In one embodiment, the PrPBPs are cadherins, such as those presented by SEQ ID NO. 1 and 2 of International Publication WO1997/045746, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the PrPBPs are cadherins, such as those presented by SEQ ID NO: 2 and 7-9 of International Publication No. WO200100023 5, the contents of which are herein incorporated by reference in their entirety.

    The Nature of the Polypeptides and Variants

    [0342] Antibodies encoded by payload regions of the viral genomes of the invention may be translated as a whole polypeptide, a plurality of polypeptides or fragments of polypeptides, which independently may be encoded by one or more nucleic acids, fragments of nucleic acids or variants of any of the aforementioned. As used herein, polypeptide means a polymer of amino acid residues (natural or unnatural) linked together most often by peptide bonds. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. In some instances, the polypeptide encoded is smaller than about 50 amino acids and the polypeptide is then termed a peptide. If the polypeptide is a peptide, it will be at least about 2, 3, 4, or at least 5 amino acid residues long. Thus, polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide may be a single molecule or may be a multi-molecular complex such as a dimer, trimer or tetramer. They may also comprise single chain or multichain polypeptides and may be associated or linked. The term polypeptide may also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.

    [0343] The term polypeptide variant refers to molecules which differ in their amino acid sequence from a native or reference sequence. The amino acid sequence variants may possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence, as compared to a native or reference sequence. Ordinarily, variants will possess at least about 50% identity (homology) to a native or reference sequence, and preferably, they will be at least about 80%, more preferably at least about 90% identical (homologous) to a native or reference sequence.

    [0344] In some embodiments variant mimics are provided. As used herein, the term variant mimic is one which contains one or more amino acids which would mimic an activated sequence. For example, glutamate may serve as a mimic for phosphoro-threonine and/or phosphoro-serine. Alternatively, variant mimics may result in deactivation or in an inactivated product containing the mimic, e.g., phenylalanine may act as an inactivating substitution for tyrosine; or alanine may act as an inactivating substitution for serine.

    [0345] The term amino acid sequence variant refers to molecules with some differences in their amino acid sequences as compared to a native or starting sequence. The amino acid sequence variants may possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence. Native or starting sequence should not be confused with a wild type sequence. As used herein, a native or starting sequence is a relative term referring to an original molecule against which a comparison may be made. Nativeor starting sequences or molecules may represent the wild-type (that sequence found in nature) but do not have to be the wild-type sequence.

    [0346] Ordinarily, variants will possess at least about 70% homology to a native sequence, and preferably, they will be at least about 80%, more preferably at least about 90% homologous to a native sequence. Homology as it applies to amino acid sequences is defined as the percentage of residues in the candidate amino acid sequence that are identical with the residues in the amino acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology. Methods and computer programs for the alignment are well known in the art. It is understood that homology depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation.

    [0347] By homologs as it applies to amino acid sequences is meant the corresponding sequence of other species having substantial identity to a second sequence of a second species.

    [0348] Analogs is meant to include polypeptide variants which differ by one or more amino acid alterations, e.g., substitutions, additions, or deletions of amino acid residues that still maintain the properties of the parent poly peptide.

    [0349] Sequence tags or amino acids, such as one or more lysines, can be added to the peptide sequences of the invention (e.g., at the N-terminal or C-terminal ends). Sequence tags can be used for peptide purification or localization. Lysines can be used to increase peptide solubility or to allow for biotinylation. Alternatively, amino acid residues located at the carboxy and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted providing for truncated, sequences. Certain amino acids (e.g., C-terminal or N-terminal residues) may alternatively be deleted depending on the use of the sequence, as for example, expression of the sequence as part of a larger sequence which is soluble, or linked to a solid support.

    [0350] Substitutional variants when referring to proteins are those that have at least one amino acid residue in a native or starting sequence removed and a different amino acid inserted in its place at the same position. The substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.

    [0351] As used herein the term conservative amino acid substitution refers to the substitution of an amino acid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the substitution of a non-polar (hydropholic) residue such as isoleucine, valine, and leucine for another non-polar residue. Likewise, examples of conservative substitutions include the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamme and asparagine, and between glycine and serine. Additionally, the substitution of a basic residue such as lysine, arginine, or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic residue are additional examples of conservative substitutions. Examples of non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue such as isoleucine, valine, leucine, alanine, methionine for a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid or lysine and/or a polar residue for a non-polar residue.

    [0352] Insertional variants when referring to proteins are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native or starting sequence. Immediately adjacent to an amino acid means connected to either the alpha-carboxy or alpha-amino functional group of the amino acid.

    [0353] Deletional variants when referring to proteins, are those with one or more amino acids in the native or starting amino acid, sequence removed. Ordinarily, deletional variants will have one or more amino acids deleted in a particular region of the molecule.

    [0354] As used herein, the term derivative is used synonymously with the term variant and refers to a molecule that has been modified or changed in any way relative to a reference molecule or starting molecule. In some embodiments, derivatives include native or starting proteins that have been modified with an organic proteinaceous or non-proteinaceous derivatizing agent, and post-translational modifications. Covalent modifications are traditionally introduced by reacting targeted amino acid residues of the protein with an organic derivatizing agent that is capable of reacting with selected side-chains or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. The resultant covalent derivatives are useful in programs directed at identifying residues important for biological activity, for immunoassays, or for the preparation of anti-protein antibodies for immunoaffinity purification of the recombinant glycoprotein. Such modifications are within the ordinary skill in the art and are performed without undue experimentation.

    [0355] Certain posi-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues may be present in the proteins used in accordance with the present invention.

    [0356] Other post-txanslational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the alpha-amino groups of lysine, arginine, and histidine side chains (T. E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, pp. 79-86 (1983)).

    [0357] Features when referring to proteins are defined as distinct amino acid sequence-based components of a molecule. Features of the proteins of the present invention include surface manifestations, local conformational shape, folds, loops, half-loops, domains, half-domains, sites, termini or any combination thereof.

    [0358] As used herein when referring to proteins the term surface manifestation refers to a polypeptide based component of a protein appearing on an outermost surface.

    [0359] As used herein when referring to proteins the term local conformational shape means a polypeptide based structural manifestation of a protein which is located within a definable space of the protein.

    [0360] As used herein when referring to proteins the term fold means the resultant conformation of an amino acid sequence upon energy minimization. A fold may occur at the secondary or tertiary level of the folding process. Examples of secondary level folds include beta sheets and alpha helices. Examples of tertiary folds include domains and regions formed due to aggregation or separation of energetic forces. Regions formed in this way include hydrophobic and hydrophilic pockets, and the like.

    [0361] As used herein the term turn as it relates to protein conformation means a bend which alters the direction of the backbone of a peptide or polypeptide and may involve one, two, three or more amino acid residues.

    [0362] As used, herein when referring to proteins the term loop refers to a structural feature of a peptide or polypeptide which reverses the direction of the backbone of a peptide or polypeptide and comprises four or more amino acid residues. Oliva et al. have identified at least 5 classes of protein loops (J. Mol Biol 266 (4): 814-830; 1997).

    [0363] As used herein when referring to proteins the term half-loop refers to a portion of an identified loop having at least half the number of amino acid residues as the loop from which it is derived. It is understood that, loops may not always contain an even number of amino acid residues. Therefore, in those cases where a loop contains or is identified to comprise an odd number of amino acids, a half-loop of the odd-numbered loop will comprise the whole number portion or next whole number portion of the loop (number of amino acids of the loop/2+/0.5 amino acids). For example, a loop identified as a 7-animo acid loop could produce half-loops of 3 amino acids or 4 amino acids (7/2=3.5+/0.5 being 3 or 4).

    [0364] As used, herein when referring to proteins the term domain refers to a motif of a polypeptide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions).

    [0365] As used herein when referring to proteins the term half-domain means portion of an identified domain having at least half the number of amino acid residues as the domain from which it is derived. It is understood that domains may not always contain an even number of amino acid residues. Therefore, in those cases where a domain contains or is identified to comprise an odd number of amino acids, a half-domain of the odd-numbered domain will comprise the whole number portion or next whole number portion of the domain (number of amino acids of the domain/2+/0.5 amino acids). For example, a domain identified as a 7-amino acid domain could produce half-domains of 3 amino acids or 4 amino acids (7/2=3.5+/0.5 being 3 or 4). It is also understood that sub-domains may be identified within domains or half-domains, these subdomains possessing less than all of the structural or functional properties identified in the domains or half domains from which they were derived. It is also understood that the amino acids that comprise any of the domain types herein need not be contiguous along the backbone of the polypeptide (i.e., nonadjacent amino acids may fold structurally to produce a domain, half-domain or subdomam).

    [0366] As used herein when referring to proteins the terms site as it pertains to amino acid based embodiments is used synonymous with amino acid residue and amino acid side chain. A site represents a position within a peptide or poly peptide that may be modified, manipulated, altered, derivatized or varied within the polypeptide based molecules of the present invention.

    [0367] As used herein the terms termini or terminus when referring to proteins refers to an extremity of a peptide or polypeptide. Such extremity is not limited only to the first or final site of the peptide or polypeptide but may include additional amino acids in the terminal regions. The polypeptide based molecules of the present invention may be characterized as having both an N-terminus (terminated by an amino acid, with a free amino group (NH2)) and a C-terminus (terminated by an amino acid with a free carboxyl group (COOH)). Proteins of the invention are in some cases made up of multiple polypeptide chains brought together by disulfide bonds or by non-covalent forces (multimers, oligomers). These sorts of proteins will have multiple N- and C-termini. Alternatively, the termini of the polypeptides may be modified such that they begin or end, as the case may be, with a non-poly peptide based moiety such as an organic conjugate.

    [0368] Once any of the features have been identified or defined as a component of a molecule of the invention, any of several manipulations and/or modifications of these features may be performed by moving, swapping, inverting, deleting, randomizing, or duplicating. Furthermore, it is understood that manipulation of features may result in the same outcome as a modification to the molecules of the invention. For example, a manipulation which involves deleting a domain would result in the alteration of the length of a molecule just as modification of a nucleic acid to encode less than a full-length molecule would.

    [0369] Modifications and manipulations can be accomplished by methods known in the art such as site directed mutagenesis. The resulting modified molecules may then be tested for activity using in vitro or in vivo assays such as those described herein or any other suitable screening assay known in the art.

    AAV Production

    [0370] The present invention provides methods for the generation of parvoviral particles, e.g. AAV particles, by viral genome replication in a viral replication cell.

    [0371] In accordance with the invention, the viral genome comprising a payload region encoding an antibody, an antibody-based composition or fragment thereof, will be incorporated into the AAV particle produced in the viral replication cell. Methods of making AAV particles are well known in the art and are described in e.g., U.S. Pat. Nos. 6,204,059, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508, 5,064,764, 6,194,191, 6,566,118, 8,137,948, or International Publication Nos. WO 1996039530, WO 1998010088, WO1999014354, WO1999015685, WO 1999047691, WO2000055342, WO2000075353, and WO2001023597; Methods In Molecular Biology, ed. Richard, Humana Press, N.J. (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir.63:3822-8 (1989); Kajigaya et al., Proc Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir., 219:37-44 (1996); Zhao et al., Vir.272:382-93 (2000); the contents of each of which are herein incorporated by reference in their entirety. In one embodiment, the AAV particles are made using the methods described in WO2015191508, the contents of which are herein incorporated by reference in their entirety.

    [0372] Viral replication cells commonly used for production of recombinant AAV viral vectors include but are not limited to 293 cells, COS cells, HeLa cells, KB cells, and other mammalian cell lines as described in U.S. Pat. Nos. 6,156,303, 5,387,484, 5,741,683, 5, 691,176, and 5,688,676, U.S. patent publication No. 2002/0081721, and International Patent Publication Nos. WO 00/47757, WO 00/24916, and WO 96/17947, the contents of each of which are herein incorporated by reference in their entireties.

    [0373] In some embodiments, the present invention provides a method for producing an AAV particle having enhanced (increased, improved) transduction efficiency comprising the steps of: 1) co-transfecting competent bacterial cells with a bacmid vector and either a viral construct vector and/or AAV payload construct vector, 2) isolating the resultant viral construct expression vector and AAV payload construct expression vector and separately transfectmg viral replication cells, 3) isolating and purifying resultant payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, 4) co-infecting a viral replication cell with both the AAV payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, and 5) harvesting and purifying the AAV particle comprising a viral genome.

    [0374] In some embodiments, the present invention provides a method for producing an AAV particle comprising the steps of 1) simultaneously co-transfecting mammalian cells, such as, but not limited to HEK293 cells, with a payload region, a construct expressing rep and cap genes and a helper construct, and 2) harvesting and purifying the AAV particle comprising a viral genome.

    [0375] In some embodiments, the viral genome of the AAV particle of the invention optionally encodes a, selectable marker. The selectable marker may comprise a cell-surface marker, such as any protein expressed on the surface of the cell including, but not limited to receptors, CD markers, lectins, integrins, or truncated versions thereof.

    [0376] In some embodiments, selectable marker reporter genes are selected from those described in International Application No. WO 96/23810; Heim et al., Current Biology 2:178-182 (1996); Heim et al., Proc. Natl. Acad. Sci. USA (1995); or Heim et al., Science 373:663-664 (1995 ), WO 96/30540, the contents of each of which are incorporated herein by reference in their entireties).

    II. FORMULATION AND DELIVERY

    Pharmaceutical Compositions

    [0377] According to the present invention the AAV particles may be prepared as pharmaceutical compositions. It will be understood, that such compositions necessarily comprise one or more active ingredients and, most often, a pharmaceutically acceptable excipient.

    [0378] Relative amounts of the active ingredient (e.g. AAV particle), a pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1% and 99% (w/w) of the active ingredient. By way of example, the composition may comprise between 0.1% and 100%, e.g., between 0.5 and 50%, between 1-30%), between 5-80%, at least 80% (w/w) active ingredient.

    [0379] In some embodiments, the AAV particle pharmaceutical compositions described herein may comprise at least one payload. As a non-limiting example, the pharmaceutical compositions may contain an AAV particle with 1, 2, 3, 4 or 5 payloads. In one embodiment, the pharmaceutical composition may contain a nucleic acid encoding a payload construct encoding proteins selected from antibodies and/or antibody-based compositions.

    [0380] Although the descriptions of pharmaceutical compositions provided herem are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, rats, birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and/or turkeys.

    [0381] In some embodiments, compositions are administered to humans, human patients, or subjects.

    Formulations

    [0382] The AAV particles of the invention can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfeetion or transduction; (3) permit the sustained or delayed expression of the payload; (4) alter the biodistribution (e.g., target the viral particle to specific tissues or cell types); (5) increase the translation of encoded protein; (6) alter the release profile of encoded protein; and/or (7) allow for regulatable expression of the payload.

    [0383] Formulations of the present invention can include, without limitation, saline, liposomes, lipid nanoparticles, polymers, peptides, proteins, cells transfected with viral vectors (e.g., for transfer or transplantation into a subject) and combinations thereof.

    [0384] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. As used herein the term pharmaceutical composition refers to compositions comprising at least one active ingredient and optionally one or more pharmaceutieally acceptable excipients.

    [0385] In general, such preparatory methods include the step of associating the active ingredient with an excipient and/or one or more other accessory ingredients. As used herein, the phrase active ingredient generally refers either to an AAV particle carrying a payload region encoding the polypeptides of the invention or to the antibody or antibody-based composition encoded by a viral genome of by an AAV particle as described herein.

    [0386] Formulations of the AAV particles and pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single-or multi-dose unit.

    [0387] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and/or sold, in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a unit dose refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

    [0388] In one embodiment, the AAV particles of the invention may be formulated in PBS with 0.001% of pluronic acid (F-68) at a pH of about 7.0.

    [0389] Relative amounts of the active ingredient (e.g. AAV particle), the pharmaceutieally acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1% and 99% (w/w) of the active ingredient. By way of example, the composition may comprise between 0.1% and 1.00%, e.g., between 0.5 and 50%, between 1-30%, between 5-80%, or at least 80% (w/w) active ingredient.

    [0390] In some embodiments, the AAV formulations described herein may contain sufficient AAV particles for expression of at least one expressed functional antibody or antibody-based composition. As anon-limiting example, the AAV particles may contain viral genomes encoding 1, 2, 3, 4, or 5 functional antibodies.

    [0391] According to the present invention AAV particles may be formulated for CNS delivery. Agents that cross the brain blood barrier may be used. For example, some cell penetrating peptides that can target molecules to the brain blood barrier endothelium may be used for formulation (e.g., Mathupala, Expert Opin Ther Pat., 2009, 19, 137-140; the content of which is incorporated herein by reference in its entirety).

    Excipients and Diluents

    [0392] The AAV particles of the invention can be formulated using one or more excipients or diluents to (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release; (4) alter the biodistribution (e.g., target the viral particle to specific tissues or cell types); (5) increase the translation of encoded protein in vivo; (6) alter the release profile of encoded protein in vivo; and/or (7) allow for regulatable expression of the polypeptides of the invention.

    [0393] In some embodiments, a pharmaceutically acceptable excipient may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, an excipient is approved for use for humans and for veterinary use. In some embodiments, an excipient may be approved by United States Food and Drug Administration. In some embodiments, an excipient may be of pharmaceutical grade. In some embodiments, an excipient may meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and/or the International Pharmacopoeia.

    [0394] Excipients, as used herein, include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, Md. 2006; incorporated herein by reference in its entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.

    [0395] Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystallme cellulose, kaolin, manntol sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, etc., and/or combinations thereof.

    Inactive Ingredients

    [0396] In some embodiments, AAV particle formulations may comprise at least one inactive ingredient. As used herein, the term inactive ingredient refers to one or more agents that do not contribute to the activity of the active ingredient of the pharmaceutical composition included in formulations. In some embodiments, all, none or some of the inactive ingredients which may be used in the formulations of the present invention may be approved by the US Food and Drug Administration (FDA).

    [0397] In one embodiment, the AAV particle pharmaceutical compositions comprise at least one inactive ingredient such as, but not limited to, 1,2,6-Hexanetnol, 1,2-Dimynstoyl-Sn-Glycero-3-(Phospho-S-(1-Glycerol)); 1,2-Dimyristoyl-Sn-Glycero-3-PhosphochoIine; 1,2-Dioleoyl-Sn-Giycero-3-Phosphocholine: 1,2-Dipalmitoyl-Sn-Glycero3-(Phospho-Rac-(1-Glycerol)); 1,2-Distearoyl-Sn-Glycero-3-(Phospho-Rac-(1-Glycerol)); 1,2-Distearoyl-Sn-Glycero-3-Phosphocholine; 1-O-Tolylbiguanide; 2-Ethyl-1,6-Hexanediol; Acetic Acid; Acetic Acid, Glacial; Acetic Anhydride; Acetone; Acetone Sodium Bisulfite; Acetylated Lanolin Alcohols; Acetylated Monoglycerides; Acetylcysteine; Acetyltryptophan, DL-; Acrylates Copolymer; Acrylic Acid-Isoctyl Acrylate Copolymer; Acrylic Adhesive 788; Activated Charcoal; Adcote 72A103; Adhesive Tape; Adipic Acid; Aerotex Resin 3730; Alanine; Albumin Aggregated; Albumin Colloidal; Albumin Human; Alcohol; Alcohol, Dehydrated; Alcohol, Denatured; Alcohol, Diluted; Alfadex, Alginic Acid; Alkyl Ammonium Sulfonic Acid Betaine; Alkyl Aryl Sodium Sulfonate; Allantoin; Allyl. Alpha.-Ionone; Almond Oil; Alpha-Terpineol; Alpha-Tocopherol; Alpha-Tocopherol Acetate, D1-; Alpha-Tocopherol, D1-; Aluminum Acetate; Aluminum Chlorhydroxy Allantoinate; Aluminum Hydroxide; Aluminum Hydroxide-Sucrose, Hydrated; Aluminum Hydroxide Gel; Aluminum Hydroxide Gel F 500; Aluminum Hydroxide Gel F 5000; Aluminum Monostearate, Aluminum Oxide; Aluminum Polyester; Aluminum Silicate; Aluminum Starch Octenylsuccinate; Aluminum Stearate; Aluminum Subacetate; Aluminum Sulfate Anhydrous, Amerchol C; Amerchol-Cab; Aminomethylpropanol; Ammonia; Ammonia Solution; Ammonia Solution, Strong; Ammonium Acetate; Ammonium Hydroxide; Ammonium Laurvl Sulfate; Ammonium Nonoxynol-4 Sulfate; Ammonium Salt Of C-12-C-15 Linear Primary Alcohol Ethoxylate; Ammonium Sulfate; Ammonyx; Amphoteric-2; Amphoteric-9; Anethole; Anhydrous Citric Acid; Anhydrous Dextrose, Anhydrous Lactose, Anhydrous Trisodium Citrate, Aniseed Oil; Anoxid Sbn; Antifoam; Antipyrine; Apaflurane; Apricot Kernel Oil Peg-6 Esters; Aquaphor; Arginine; Arlacel; Ascorbic Acid; Ascorbyl Palmitate; Aspartic Acid; Balsam Peru; Barium Sulfate; Beeswax, Beeswax, Synthetic; Beheneth-10; Bentonite; Benzalkonium Chloride; Benzenesulfonic Acid; Benzethonium Chloride; Benzododecinium Bromide; Benzoic Acid; Benzyl Alcohol; Benzyl Benzoate; Benzyl Chloride, Betadex; Bibapcitide; Bismuth Subgallate; Boric Acid, Brocrinat; Butane, Butyl Alcohol; Butyl Ester Of Vinyl Methyl Ether/Maleic Anhydride Copolymer (125000 Mw); Butyl Stearate; Butylated Hydroxyanisole; Butylated Hydroxytoluene; Butylene Glycol; Butylparaben; Butyric Acid; C20-40 Pareth-24; Caffeine, Calcium; Calcium Carbonate; Calcium Chloride; Calcium Gluceptate; Calcium Hydroxide; Calcium Lactate; Calcobutrol; Caldiamide Sodium, Caloxetate Trisodium; Calteridol Calcium; Canada Balsam; Caprylic/Capric Triglyceride; Caprylic/Capric/Stearic Triglyceride; Captan; Captisol; Caramel; Carbomer 1342; Carbomer 1382, Carbomer 934, Carbomer 934p, Carbomer 940; Carbomer 941; Carbomer 980; Carbomer 981; Carbomer Homopolymer Type B (Allyl Pentaerythritol Crosslinked); Carbomer Homopolymer Type C (Allyl Pentaerythritol Crosslinked); Carbon Dioxide; Carboxy Vinyl (Copolymer; CarboxymethylcelIulose; Carboxymethylcellulose Sodium; Carboxypolymethylene; Carrageenan; Carrageenan Salt; Castor Oil; Cedar Leaf Oil; Cellulose; Cellulose, Microcrystalline; Cerasynt-Se; Ceresin; Ceteareth-12; Ceteareth-L5; Ceteareth-30; Cetearyl Alcohol/Ceteareth-20; Cetearyl Ethylhexanoate; Ceteth-10; Ceteth-2; Ceteth-20; Ceteth-23; Cetostearyl Alcohol; Cetrimonium Chloride, Cetyl Alcohol; Cetyl Esters Wax; Cetyl Palmitate; Cetylpyridinium Chloride; Chlorobutanol; Chlorobutanol Hemihydrate; Chlorobutanol, Anhydrous; Chlorocresol; Chloroxylenol; Cholesterol; Choleth; Choleth-24; Citrate; Citric Acid; Citric Acid Monohydrate; Citric Acid, Hydrous, Cocamide Ether Sulfate; Cocamine Oxide, Coco Betaine; Coco Diethanolamide; Coco Monoethanolamide, Cocoa Butter; Coco-Glvcerides; Coconut Oil; Coconut Oil, Hydrogenated; Coconut Oil/Palm Kernel Oil Glycerides, Hydrogenated; Cocoyl Capiylocaprate; Cola Nitida Seed Extract; Collagen; Coloring Suspension, Com Oil; Cottonseed Oil; Cream Base; Creatine; Creatinine; Cresol; Croscarmellose Sodium; Crospovidone; Cupric Sulfate, Cupric Sulfate Anhydrous; Cyclomethicone; Cyclomethicone/Dimethicone Copolyol; Cysteine; Cysteine Hydrochloride; Cysteine Hydrochloride Anhydrous; Cysteine, D1-; D&C Red No. 28; D&C Red No. 33; D&C Red No. 36; D&C Red No. 39, D&C Yellow No. 10; Daltampridine; Daubert 1-5 Pestr (Matte) 164z; Decyl Methyl Sulfoxide; Dehydag Wax Sx; Dehydroacetic Acid; Dehymuls E; Denatonium Benzoate; Deoxycholic Acid; Dextran; Dextran 40; Dextrin; Dextrose; Dextrose Monohydrate, Dextrose Solution; Diatrizoic Acid; Diazolidinyl Urea; Dichlorohenzyl Alcohol; Dichlorodifluoromethane; Dichlorotetrafluoroethane; Diethanolamine; Diethyl Pyrocarbonate; Diethyl Sebacate; Diethylene Glycol Monoethyl Ether; Diethylhexyl Phthalate, Dihydroxyaluminum Aminoacetate; Diisopropanolamine; Diisopropyl Adipate; Diisopropyl Dilinoleate; Dimethicone 350; Dimethicone Copoiyol; Dimethicone Mdx4-4210; Dimethicone Medical Fluid 360; Dimethyl Isosorbide: Dimethyl Sulfoxide; Dimethylaminoethyl Methacrylate-Butyl Methacrylate-Methyl Methacrylate Copolymer; Dimethyidioctadecylammonium Bentonite; Dimethylsiloxane/Methylvinylsiloxane Copolymer; Dinoseb Ammonium Salt: Dipalnitoylphosphatidylglycerol, D1-; Dipropylene Glycol; Disodium Cocoamphodiacetate; Disodium Laureth Sulfosuccinate; Disodium Lauryl Sulfosuccinate; Disodium Sulfosalicylate; Disofenin; Divinylbenzene Styrene Copolymer; Dindm Hydantoin; Docosanol; Docusate Sodium; Duro-Tak 280-2516; Duro-Tak 387-2516; Duro-Tak 80-1196; Duro-Tak 87-2070; Duro-Tak 87-2194; Duro-Tak 87-2287; Duro-Tak 87-2296; Duro-Tak 87-2888; Duro-Tak 87-2979, Edetate Calcium Disodium, Edetate Disodium; Edetate Disodium Anhydrous; Edetate Sodium; Edetic Acid; Egg Phospholipids; Entsufon; Entsufon Sodium: Epilactose; Epitetracycline Hydrochloride: Essence Bouquet 9200; Ethanolamine Hydrochloride; Ethyl Acetate; Ethyl Oleate; Ethylcelluloses; Ethylene Glycol; Ethylene Vinyl Acetate Copolymer; Ethylenediamine; Ethylenediamine Dihydrochloride; Ethylene-Propylene Copolymer; Ethylene-Vinyl Acetate Copolymer (28% Vinyl Acetate); Ethylene-Vinyl Acetate Copolymer (9% Vinylacetate); Ethylhexyl Hydroxystearate; Ethylparaben; Eucalyptol; Exametazime; Fat, Edible; Fat, Hard, Fatty Acid Esters, Fatty Acid Pentaerythriol Ester; Fatty Acids; Fatty Alcohol Citrate; Fatty Alcohols; Fd&C Blue No. 1; Fd&C Green No. 3; Fd&C Red No. 4; Fd&C Red No. 40; Fd&C Yellow No. 10 (Delisted); Fd&C Yellow No. 5; Fd&C Yellow No. 6; Ferric Chloride; Ferric Oxide; Flavor 89-186; Flavor 89-259; Flavor Df-119; Flavor Df-1530; Flavor Enhancer; Flavor Fig 827118; Flavor Raspberry Pfc-8407; Flavor Rhodia Pharmaceutical No. Rf 451; Fluorochlorohydrocarbons; Formaldehyde; Formaldehyde Solution; Fractionated Coconut Oil; Fragrance 3949-5; Fragrance 520a; Fragrance 6.007; Fragrance 91-122; Fragrance 9128-Y; Fragrance 93498g; Fragrance Balsam Pine No. 5124; Fragrance Bouquet 10328; Fragrance Chemoderm 6401-B; Fragrance Chentoderm 6411, Fragrance Cream No. 7345 7, Fragrance Cs-28197; Fragrance Felton 066m; Fragrance Firmenich 47373; Fragrance Givaudan Ess 9090/1c; Fragrance H-6540; Fragrance Herbal 10396, Fragrance Nj-1085; Fragrance P O F1-147, Fragrance Pa 52805; Fragrance Pera Derm D; Fragrance Rbd-9819; Fragrance Shaw Mudge U-7776; Fragrance Tf 044078; Fragrance Ungerer Honeysuckle K. 2771; Fragrance Ungerer N5195; Fructose; Gadolinium Oxide; Galactose: Gamma Cyclodextrin; Gelatin; Gelatin, Crosslinked; Gelfoam Sponge: Gellan Gum (Low Acyl): Gelva 737; Gentisic Acid; Gentisic Acid Ethanolamide, Gluceptate Sodium; Gluceptate Sodium Dihydrate; Gluconolactone, Glucuronic Acid: Glutamic Acid, D1-; Glutathione; Glycerin; Glycerol Ester Of Hydrogenated Rosin; Glyceryl Citrate; Glyceryl Isostearate; Glyceryl Laurate; Glyceryl Monostearate; Glyceryl Oleate; Glyceryl Oleate/Propylene Glycol: Glyceryl Palmitate; Glyceryl Ricinoleate; Glyceryl Stearate; Glyceryl Stearate-Laureth-23; Glyceryl Stearate/Peg Stearate; Glyceryl Stearate/Peg-100 Stearate; Glyceryl Stearate/Peg-40 Stearate; Glyceryl Stearate-Stearamidoethyl Diethylamine; Glyceryl Trioleate; Glycine; Glycine Hydrochloride; Glycol Distearate; Glycol Stearate; Guanidine Hydrochloride; Guar Gum; Hair Conditioner (18n95-1m); Heptane; Hetastarch, Hexylene Glycol; High Density Polyethylene, Histidine; Human Albumin Microspheres; Hyaluronate Sodium: Hydrocarbon, Hydrocarbon Gel, Plasticized; Hydrochloric Acid; Hydrochloric Acid, Diluted; Hydrocortisone; Hydrogel Polymer: Hydrogen Peroxide; Hydrogenated Castor Oil; Hydrogenated Palm Oil; Hydrogenated Palm/Palm Kernel Oil Peg-6 Esters; Hydrogenated Polybutene 635-690; Hydroxide Son; Hydroxyethyl Cellulose; Hydroxyethylpiperazine Ethane Sulfonic Acid; Hydroxymethyl Cellulose; Hydroxyoctacosanyl Hydroxystearate; Hydroxypropyl Cellulose; Hydroxypropyl Methylcellulose 2906; Hydroxypropyl-Beta-cyclodextrin; Hypromellose 2208 (15000 Mp.Math.S); Hypromellose 2910 (15000 Mpa.Math.S); Hypromelloses; Imidurea; Iodine; Todoxamic Acid; Iofetamine Hydrochloride; Irish Moss Extract; Isobutane; Isoceteth-20; Isoleucine: Isooctyl Acrylate; Isopropyl Alcohol; Isopropyl Isostearate; Isopropyl Myristate; Isopropyl MyristateMyristyl Alcohol; Isopropyl Palmitate; Isopropyl Stearate; Isostearic Acid, Isostearyl Alcohol; Isotonic Sodium Chloride Solution; Jelene, Kaolin; Kathon Cg; Kathon Cg II; Lactate; Lactic Acid; Lactic Acid, D1-; Lactic Acid, L-; Lactobionic Acid; Lactose; Lactose Monohydrate; Lactose, Hydrous; Laneth; Lanolin, Lanolin AlcoholMineral Oil; Lanolin Alcohols; Lanolin Anhydrous; Lanolin Cholesterols; Lanolin Nonionic Derivatives; Lanolin, Ethoxylated; Lanolin, Hydrogenated; Lauralkonium Chloride; Laurarmine Oxide: Laurdimonium Hydrolyzed Animal Collagen; Laureth Sulfate; Laureth-2: Laureth-23; Laureth-4; Laurie Diethanolamide; Laurie Myristic Diethanolamide, Lauroyl Sarcosine; Lauryi Lactate; Lauryl Sulfate; Lavandula Angustifolia Flowering Top; Lecithin; Lecithin Unbleached; Lecithin, Egg; Lecithin, Hydrogenated; Lecithin, Hydrogenated Soy; Lecithin, Soybean; Lemon Oil; Leucine; Levulinic Acid: Lidofenin; Light Mineral Oil; Light Mineral Oil (85 Ssu); Limonene, (+/)-; Lipocol Sc-15; Lysine, Lysine Acetate; Lysine Monohydrate, Magnesium Aluminum Silicate, Magnesium Aluminum Silicate Hydrate; Magnesium Chloride; Magnesium Nitrate; Magnesium Stearate; Maleic Acid; Mannitol; Maprofix; Mebrofemn; Medical Adhesive Modified S-15; Medical Antiform A-F Emulsion; Medronate Disodium; Medronic Acid, Meglumine; Menthol; Metacresol; Metaphosphoric Acid; Methanesulfonic Acid, Methionine; Methyl Alcohol; Methyl Gluceth-10; Methyl Gluceth-20; Methyl Gluceth-20 Sesquistearate; Methyl Glucose Sesquistearate; Methyl Laurate; Methyl Pyrrolidine; Methyl Salicylate, Methyl Stearate; Methylboronic Acid; Methylcellulose (4000 Mpa.Math.S); Methylcelluloses; Methychloroisothiazoinone; Methylene Blue; Methylisothiazolinone; Methylparaben; Microcrystalline Wax; Mineral Oil: Mono and Diglyceride: Monostearyl Citrate; Monothioglycerol; Multisterol Extract; Myristyl Alcohol; Myristyl Lactate; Myristyl-Gamma.-Picolinium Chloride; N-Carbamoyl-Methoxy Peg-40)-1,2-Distearoyl-Cephalin Sodium; N,N-Dimethylacetamide; Niacinamide; Nioxime; Nitric Acid; Nitrogen; Nonoxynol Iodine; Nonoxynol-15; Nonoxynol-9; Norflurane; Oatmeal; Octadecene-1/Maleic Acid Copolymer; Octanoic Acid; Octisalate; Octoxynol-1;Octoxynol-40; Octoxynol-9; Octyldodecanol; Octylphenol Polymethylene; Oleic Acid; Oleth-10/Oleth-5; OIeth-2; Oleth-20; Oleyl Alcohol; Oleyl Oleate; Olive Oil; Oxidronate Disodium; Oxyquinoline; Palm Kernel Oil; Palmitamine Oxide; Parabens: Paraffin; Paraffin, White Soft, Parfum Creme 45/3; Peanut Oil; Peanut Oil, Refined, Pectin; Peg 6-32 Stearate/Glycol Stearate; Peg Vegetable Oil; Peg-100 Stearate; Peg-12 Glyceryl Laurate; Peg-120 Glyceryl Stearate; Peg-120 Methyl Glucose Dioleate; Peg-15 Cocamine; Peg-150 Distearate; Peg-2 Stearate, Peg-20 Sorbitan Isostearate; Peg-22 Methyl Ether/Dodecyl Glycol Copolymer; Peg-25 Propylene Glycol Stearate; Peg-4 Dilaurate; Peg-4 Laurate; Peg-40 Castor Oil; Peg-40 Sorbitan Diisostearate; Peg-45/Dodecyl Glycol Copolymer; Peg-5 Oleate; Peg-50 Stearate; Peg-54 Hydrogenated Castor Oil; Peg-6 Isostearate; Peg-60 Castor Oil; Peg-60 Hydrogenated Castor Oil; Peg-7 Methyl Ether, Peg-75 Lanolin; Peg-8 Laurate; Peg-8 Stearate, Pegoxol 7 Stearate; Pentadecalactone; Pentaerythritol Cocoate; Pentasodium Pentetate; Pentetate Calcium Trisodium; Pentetic Acid; Peppermint Oil; Perflutren; Perfume 25677; Perfume Bouquet, Perfume E-1991; Perfume Gd 5604; Perfume Tana 90/42 Scba; Perfume W-1952-1, Petrolatum; Petrolatum, Wiite; Petroleum Distillates; Phenol; Phenol, Liquefied; Phenonip; Phenoxyethanol; Phenylalanine; Phenylethyl Alcohol; Phenylmercuric Acetate; Phenylmercuric Nitrate; Phosphatidyl Glycerol, Egg; Phospholipid; Phospholipid, Egg; Phospholipon 90g; Phosphoric Acid, Pine Needle Oil (Pmus Sylvestris); Piperazine Hexahydrate; Plastibase-50w; Polacrilin; Polidronium Chloride; Poloxamer 124; Poloxamer 181; Poloxamer 182; Poloxamer 188; Poloxamer 237; Poloxamer 407; Poly(Bis(P-Carboxyphenoxy)Propane Anhy dride): Sebacic Acid; Poly(Dimethylsiloxane/Methylvinylsiloxane/Methylhydrogensiloxane) Dimethylvinyl Or Dimethylhydroxy Or Trimethyl Endblocked; Poly(D1-Lactic-Co-GIycolic Acid), (50:50; Poly(D1-Lactic-Co-Glycolic Acid), Ethyl Ester Terminated, (50:50; Polyacrylic Acid (250000Mw); Polybutene (1400 Mw); Polycarbophil; Polyester; Polyester Polyamine Copolymer; Polyester Rayon, Polyethylene Glycol 1000; Polyethylene Glycol 1450; Polyethylene Glycol 1500; Polyethylene Glycol 1540: Polyethylene Glycol 200; Polyethylene Glycol 300; Polyethylene Glycol 300-1600, Polyethylene Glycol 3350; Polyethylene Glycol 400; Polyethylene Glycol 4000; Polyethylene Glycol 540; Polyethylene Glycol 600; Polyethylene Glycol 6000; Polyethylene Glycol 8000; Polyethylene Glycol 900; Polyethylene High Density Containing Ferric Oxide Black (<1%); Polyethylene Low Density Containing Barium Sulfate (20-24%); Polyethylene T; Polyethylene Terephthalates; Polyglactin; Polyglyceryl-3 Oleate; Polyglyceryl-4 Oleate; Polyhydroxyethyl Methacrylate; Polyisobutylene; Polyisobutylene (1100000 Mw); Polyisobutylene (35000 Mw); Polyisobutylene 178-236; Polyisobutylene 241-294; Polyisobutylene 35-39, Polyisobutylene Low Molecular Weight; Polyisobutylene Medium Molecular Weight; Polyisobutylene/Polybutene Adhesive: Polylactide; Polyols; PolyoxyethylenePolyoxypropylene 1800; Polyoxyethylene Alcohols; Polyoxyethylene Fatty Acid Esters; Polyoxyethylene Propylene: Polyoxyl 20 Cetostearyl Ether; Polyoxyl 35 Castor Oil; Polyoxyl 40 Hydrogenated Castor Oil; Polyoxyl 40 Stearate; Polyoxyl 400 Stearate; Polyoxyl 6 And Polyoxyl 32 Palmitostearate: Polyoxyl Distearate; Polyoxyl Glyceryl Stearate; Polyoxyl Lanolin; Polyoxyl Palmitate; Polyoxyl Stearate; Polypropylene; Polypropylene Glycol; Polyquaternium-10; Polyquaternium-7 (70/30 Acrylanride/Dadmac; Polvsiloxane; Polysorbate 20; Polysorbate 40; Polysorbate 60; Polysorbate 65; Polysorbate 80; Polyurethane; Polyvinyl Acetate; Polyvinyl Alcohol; Polyvinyl Chloride; Polyvinyl Chloride-Polyvinyl Acetate Copolymer; Polyvinylpyridine; Poppy Seed Oil; Potash; Potassium Acetate; Potassium Alum; Potassium Bicarbonate; Potassium Bisulfite; Potassium Chloride; Potassium Citrate, Potassium Hydroxide; Potassium Metabisulfite; Potassium Phosphate, Dibasic; Potassium Phosphate, Monobasic; Potassium Soap; Potassium Sorbate; Povidone Acxylate Copolymer; Povidone Hydrogel; Povidone K17; Povidone K25; Povidone K29/32, Povidone K30; Povidone K90; Povidone K90f; Povidone/Eicosene Copolymer; Povidones; Ppg-12/Smdi Copolymer; Ppg-15 Stearyl Ether; Ppg-20 Methyl Glucose Ether Distearate; Ppg-26 Oleate; Product Wat; Proline; Promulgen D; Promulgen G; Propane; Propellant A-46; Propyl Gallate; Propylene Carbonate; Propylene Glycol; Propylene Glycol Diacetate; Propylene Glycol Dicaprylate, Propylene Glycol Monolaurate; Propylene Glycol Monopalmitostearate; Propylene Glycol Palmitostearate; Propylene Glycol Ricinoleate; Propylene Glycol/Diazolidinyl Urea/Methylparaben/Propylparben; Propylparaben; Protamine Sulfate; Protein Hydrolysate; Pvm/Ma Copolymer; Quatemium-15; Quatemium-15 Cis-Form; Quatemium-52; Ra-2397; Ra-3011; Saccharin; Saccharin Sodium; Saccharin Sodium Anhydrous; Saffiower Oil; Sd Alcohol 3a, Sd Alcohol 40, Sd Alcohol 40-2, Sd Alcohol 40b, Sepineo P 600: Serine; Sesame Oil; Shea Butter, Silastic Brand Medical Grade Tubing; Silastic Medical Adhesive,Silicone Type A; Silica, Dental; Silicon; Silicon Dioxide; Silicon Dioxide, Colloidal; Silicone; Silicone Adhesive 4102; Silicone Adhesive 4502, Silicone Adhesive Bio-Psa Q7-4201; Silicone Adhesive Bio-Psa Q7-4301; Silicone Emulsion; Silicone/Polyester Film Strip; Simethicone; Simethicone Emulsion; Sipon Ls 20np; Soda Ash; Sodium Acetate; Sodium Acetate Anhydrous; Sodium Alkyl Sulfate: Sodium Ascorbate; Sodium Benzoate; Sodium Bicarbonate, Sodium Bisulfate; Sodium Bisulfite; Sodium Borate: Sodium Borate Decahydrate; Sodium Carbonate: Sodium Carbonate Decahydrate; Sodium Carbonate Monohydrate; Sodium Cetostearyl Sulfate; Sodium Chlorate; Sodium Chloride; Sodium Chloride Injection, Sodium Chloride Injection, Bacteriostatic, Sodium Cholesteryl Sulfate, Sodium Citrate, Sodium Cocoyl Sarcosinate; Sodium Desoxycholate; Sodium Dithionite; Sodium Dodecylbenzenesulfonate; Sodium Formaldehyde Sulfoxylate; Sodium Gluconate; Sodium Hydroxide; Sodium Hypochlorite; Sodium Iodide: Sodium Lactate; Sodium Lactate, L-; Sodium Laureth-2 Sulfate, Sodium Laureth-3 Sulfate; Sodium Laureth-5 Sulfate; Sodium Lauroyl Sarcosinate; Sodium Lauryl Sulfate; Sodium Lauryl Sulfoacetate; Sodium Metabisulfite; Sodium Nitrate; Sodium Phosphate; Sodium Phosphate Dihydrate; Sodium Phosphate, Dibasic; Sodium Phosphate, Dibasic, Anhydrous; Sodium Phosphate, Dibasic, Dihydrate; Sodium Phosphate, Dibasic, Dodecahydrate; Sodium Phosphate, Dibasic, Heptahydrate; Sodium Phosphate, Monobasic: Sodium Phosphate, Monobasic, Anhydrous; Sodium Phosphate, Monobasic, Dihydrate; Sodium Phosphate, Monobasic, Monohydrate; Sodium Polyacrylate (2500000 Mw); Sodium Pyrophosphate; Sodium Pyrrolidone Carboxylate, Sodium Starch Glycolate; Sodium Succinate Hexahydrate; Sodium Sulfate; Sodium Sulfate Anhydrous; Sodium Sulfate Decahydrate; Sodium Sulfite; Sodium Sulfosuccinated Undecyclenic Monoalkylolamide; Sodium Tartrate; Sodium Thioglycolate; Sodium Thiomalate, Sodium Thiosulfate; Sodium Thiosulfate Anhydrous: Sodium Trimetaphosphate; Sodium Xylenesulfonate; Somay 44; Sorbic Acid; Sorbitan; Sorbitan Isostearate; Sorbitan Monolaurate; Sorbitan Monooleate; Sorbitan Monopalmitate; Sorbitan Monostearate; Sorbitan Sesquioieate; Sorbitan Trioleate, Sorbitan Tristearate; Sorbitol; Sorbitol Solution; Soybean Flour; Soybean Oil; Spearmint Oil, Spermaceti; Squalane; Stabilized Oxychloro Complex; Stannous 2-Ethylhexanoate; Stannous Chloride: Stannous Chloride Anhydrous; Stannous Fluoride; Stannous Tartrate; Starch; Starch 1500, Pregelatimzed; Starch, Corn; Stearalkomum Chloride, Stearalkonium Hectorite/Propylene Carbonate; Stearamidoethyl Diethylamine; Steareth-10, Steareth-100; Steareth-2; Steareth-20; Steareth-21; Steareth-40; Stearic Acid; Stearic Diethanolamide; Stearoxytrimethylsilane; Steartrimonium Hydrolyzed/nimal Collagen; Steaiyl Alcohol; Sterile Water For Inhalation; Styrene/Isoprene/Styrene Block Copolymer; Succimer; Succinic Acid; Sueralose; Sucrose; Sucrose Distearate; Sucrose Polyesters; Sulfacetamide Sodium, Sulfobutylether Beta-Cyclodextrin; Sulfur Dioxide, Sulfuric Acid; Sulfurous Acid; Surfactol Qs; Tagatose, D-; Talc; Tall Oil, Tallow Glycerides; Tartaric Acid; Tartaric Acid, D1-; Tenox; Tenox-2; Tert-Butyl Alcohol; Tert-Butyl Hydroperoxide; Tert-Butylhydroquinone; Tetrakis(2-Methoxisobutylisocyanide)Copper(I) Tetrafluoroborate; Tetrapropyl Orthosilicate; Tetrofosmin; Theophylline, Thimerosal; Threonine, Thymol; Tin, Titanium Dioxide; Tocopherol; Tocophersolan; Total parenteral nutrition, lipid emulsion; Triacetin; Tricaprylin; Trichloromonofluoromethane; Trideceth-10; Triethanolamine Lauryl Sulfate; Trifluoroacetic Acid; Triglycerides, Medium Cham, Trihydroxystearin; Trilaneth-4 Phosphate, Trilaureth-4 Phosphate, Trisodrum Citrate Dihydrate; Trisodium Hedta; Triton 720; Triton X-200; Trolamine; Tromantadine; Tromethamine (TRIS): Tryptophan; Tyloxapol; Tyrosine; Undecylenic Acid; Union 76 Amsco-Res 6038; Urea; Valine; Vegetable Oil; Vegetable Oil Glyceride, Hydrogenated; Vegetable Oil, Hydrogenated; Versetamide; Viscarin; Viscose/Cotton, Vitamin E; Wax, Emulsifying; Wecobee Fs; White Ceresin Wax; White Wax; Xanthan Gum; Zinc; Zinc Acetate; Zinc Carbonate; Zinc Chloride; and Zinc Oxide.

    [0398] Pharmaceutical composition formulations of AAV particles disclosed herein may include cations or anions. In one embodiment, the formulations include metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mn2+, Mg+ and combinations thereof. As a non-limiting example, formulations may include polymers and complexes with a metal cation (See e.g., U.S. Pat. Nos. 6,265,389 and 6,555,525, each of which is herein incorporated by reference in its entirety).

    [0399] Formulations of the invention may also include one or more pharmaceutically acceptable salts. As used herein, pharmaceutically acceptable salts refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, bemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthaenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamme, ethylamine, and the like. The pharmaceutieally acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.

    [0400] Solvates may be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF), N,N-dimethylacetamide (DMAC), 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU), acetonitriie (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a hydrate.

    III. ADMINISTRATION AND DOSING

    Administration

    [0401] The AAV particles of the present invention may be administered by any delivery route which results in a therapeutically effective outcome. These include, but are not limited to, enteral (into the intestine), gastroenteral, epidural (into the dura mater), oral (by way of the mouth), transdermal, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intra-arterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraparenchymal (into brain tissue), intraperitoneal (infusion or injection into the peritoneum), intravesical infusion, intravitreal (through the eye), intracavemous injection (into a pathologic cavity) intracavitary (into the base of the penis), intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), transvaginal, insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), ear drops, auricular (in or by way of the ear), buccal (directed toward the cheek), conjunctival, cutaneous, dental (to a tooth or teeth), electro-osmosis, endocervical, endosinusial, endotracheal, extracorporeal hemodialysis, infiltration, interstitial intra-abdominal, intra-amniotic, intra-articular, intrabiliary, intrabronchial, intrabursal, intracartilaginous (within a cartilage), intracaudal (within the cauda equine), intracisternal (within the cisterna magna cerebellomedularis), intracomeal (within th cornea), dental intracoronal, intracoronary (within the coronary arteries), intracorporus cavemosum (within the dilatable spaces of the corporus cavernosa of the penis), intradiscal (within a disc), intraductal (within a duct of a gland), intraduodenal (within the duodenum), intradural (within or beneath the dura), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (within the stomach), intragingival (within the gingivae), intraileal (within the distal portion of the small intestine), intralesional (within or introduced directly to a localized lesion), intraluminal (within a lumen of a tube), intralymphatic (within the lymph), intramedullary (within the marrow cavity of a bone), intrameningeal (within the meninges), intramyocardial (within the myocardium), intraocular (within the eye), intraovarian (within the ovary), intrapericardial (within the pericardium), intrapleural (within the pleura), intraprostatic (within the prostate gland), intrapulmonary (within the lungs or its bronchi), intrasinal (within the nasal or periorbital sinuses), intraspinal (within the vertebral column), intrasynovial (within the synovial cavity of a joint), intratendinous (within a tendon), intratesticular (within the testicle), intrathecal (within the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (within the thorax), intratubular (within the tubules of an organ), intratumor (within a tumor), intratympanic (within the aurus media), intravascular (within a vessel or vessels), intraventricular (within a ventricle), iontophoresis (by means of electric current where ions of soluble salts migrate into the tissues of the body), irrigation (to bathe or flush open wounds or body cavities), laryngeal (directly upon the larynx), nasogastric (through the nose and into the stomach), occlusive dressing technique (topical route administration which is then covered by a dressing which occludes the area), ophthalmic (to the external eye), oropharyngeal (directly to the mouth and pharynx), parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (within the respiratory tract by inhaling orally or nasally for local or systemic effect), retrobulbar (behind the pons or behind the eyeball), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (across or through the tympanic cavity), ureteral (to the ureter), urethral (to the urethra), vaginal caudal block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photopheresis, and spinal

    [0402] In some embodiments, compositions may be administered in a way which allows them to cross the blood-brain barrier, vascular barrier, or other epithelial barrier. The AAV particles of the present invention may be administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution. The AAV particles may be formulated with any appropriate and pharmaceutically acceptable excipient.

    [0403] In one embodiment, the AAV particles of the present invention may be delivered to a subject via a single route administration.

    [0404] In one embodiment, the AAV particles of the present invention may be delivered to a subject via a multi-site route of administration. A subject may be administered at 2, 3, 4, 5, or more than 5 sites.

    [0405] In one embodiment, a subject may be administered the AAV particles of the present invention using a bolus infusion.

    [0406] In one embodiment, a subject may be administered the AAV particles of the present invention using sustained delivery over a period of minutes, hours, or days. The infusion rate may be changed depending on the subject distribution, formulation or another delivery parameter.

    [0407] In one embodiment, the AAV particles of the present invention may be delivered by intramuscular delivery route. (See. e.g., U. S. Pat. No. 6,506,379; the content of which is incorporated herein by reference in its entirety). Non-limiting examples of intramuscular administration include an intravenous injection or a subcutaneous injection.

    [0408] In one embodiment, the AAV particles of the present invention may be delivered by oral administration. Non-limiting examples of oral administration include a digestive tract administration and a buccal administration,

    [0409] In one embodiment, the AAV particles of the present invention may be delivered by intraocular delivery route. A non-limiting example of intraocular administration include an intravitreal injection.

    [0410] In one embodiment, the AAV particles of the present invention may be delivered by intranasal delivery route. Non-limiting examples of intranasal delivery include administration of nasal drops or nasal sprays.

    [0411] In some embodiments, the AAV particles that may be administered to a subject by peripheral injections. Non-limiting examples of peripheral injections include intraperitoneal, intramuscular, intravenous, conjunctival, or joint injection. It was disclosed in the art that the peripheral administration of AAV vectors can be transported to the central nervous system, for example, to the motor neurons (e.g., U. S. Patent Publication Nos. US20100240739 and US20100130594: the content of each of which is incorporated herein by reference in their entirety).

    [0412] In one embodiment, the AAV particles may be delivered by injection into the CSF pathway. Non-limiting examples of delivery to the CSF pathway include intrathecal and intracerebroventricular administration.

    [0413] In one embodiment, the AAV particles may be delivered by systemic delivery. As a non-limiting example, the systemic delivery may be by intravascular administration.

    [0414] In one embodiment, the AAV particles of the present invention may be administered to a subject by intracranial delivery (See, e.g., U.S. Pat. No. 8,119,611; the content of which is incorporated herein by reference in its entirety).

    [0415] In one embodiment, the AAV particles of the present invention may be administered to a subject by intraparenchymal administration.

    [0416] In one embodiment, the AAV particles of the present invention may be administered to a subject by intramuscular administration.

    [0417] In one embodiment, the AAV particles of the present invention are administered to a. subject and transduce muscle of a subject. As a non-limiting example, the AAV particles are administered by intramuscular administration.

    [0418] In one embodiment, the AAV particles of the present invention may be administered to a subject by intravenous administration.

    [0419] In one embodiment, the AAV particles of the present invention may be administered to a subject by subcutaneous administration.

    [0420] In one embodiment, the AAV particles of the present invention may be administered to a subject by topical administration,

    [0421] In one embodiment, the AAV particles may be delivered by direct injection into the brain. As a non-limiting example, the brain delivery may be by intrastriatal administration.

    [0422] In one embodiment, the AAV particles may be delivered by more than one route of administration. As non-limiting examples of combination administrations, AAV particles may be delivered by intrathecal and intracerebroventricular, or by intravenous and intraparenchymal administration.

    Parenteral and Injectable Administration

    [0423] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be administered parenterally. Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutical acceptable emulsions, microemulsions, solutions, suspensions, syrups, and/or elixirs. In addition to active ingredients, liquid dosage forms may comprise inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsiliers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, oral compositions can include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and/or perfuming agents. In certain embodiments for parenteral administration, compositions are mixed with solubiiizmg agents such as CREMOPHOR, alcohols, oils, modified oils, glycols, poiysorbates, cyclodextrins, polymers, and/or combinations thereof. In other embodiments, surfactants are included such as hydroxypropylcellulose.

    [0424] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing agents, wetting agents, and/or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions, and/or emulsions in nontoxic parenteral acceptable diluents and/or solvents, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water. Ringer's solution, U.S.P., and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed, including synthetic mono- or diglycerides, Fatty acids such as oleic acid can be used in the preparation of injectables.

    [0425] Injectable formulations may be sterilized, for example, by filtration through a bacterial-retaining filter, and/or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved, or dispersed in sterile water or other sterile injectable medium prior to use.

    [0426] In order to prolong the effect of active ingredients, it is often desirable to slow the absorption of active ingredients from subcutaneous or intramuscular injections. This may be accomplished by the use of liquid suspensions of crystalline or amorphous material with poor water solubility. The rate of absorption of active ingredients depends upon the rate of dissolution which, in turn, may depend upon crystal size find crystalline form. Alternatively, delayed absorption of a parenteral administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues.

    Rectal and Vaginal Administration

    [0427] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be administered rectally and/or vaginally. Compositions for rectal or vaginal administration are typically suppositories which can be prepared by mixing compositions with suitable non-irritating excipients such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active ingredient.

    Oral Administration

    [0428] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be administered orally. Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, an active ingredient is mixed with at least one inert, pharmaceutically acceptable excipient such as sodium citrate or dicalcium phosphate and/or fillers or extenders (e.g. starches, lactose, sucrose, glucose, mannitol, and silicic acid), binders (e.g. carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia), humectants (e.g. glycerol), disintegrating agents (e.g. agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate), solution retarding agents (e.g. paraffin), absorption accelerators (e.g. quaternary ammonium compounds), wetting agents (e.g. cetyl alcohol and glycerol monostearate), absorbents (e.g. kaolin and bentonite clay), and lubricants (e.g. talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate), and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may comprise buffering agents.

    Topical or Transdermal Administration

    [0429] As described herein, pharmaceutical compositions, AAV particles of the present invention may be formulated for administration topically. The skin may be an ideal target site for delivery as it is readily accessible. Three routes are commonly considered to deliver pharmaceutical compositions, AAV particles of the present invention to the skin: (i) topical application (e.g. for local/regional treatment and/or cosmetic applications); (ii) intradermal injection (e.g. for local/regional treatment and/or cosmetic applications); and (iii) systemic delivery (e.g. for treatment of dermatologic diseases that affect both cutaneous and extracutaneous regions). Pharmaceutical compositions, AAV particles of the present invention can be delivered to the skin by several different approaches known in the art.

    [0430] In some embodiments, the invention provides for a variety of dressings (e.g., wound dressings) or bandages (e.g., adhesive bandages) for conveniently and/or effectively carrying out methods of the present invention. Typically dressing or bandages may comprise sufficient amounts of pharmaceutical compositions, AAV particles of the present invention described herein to allow users to perform multiple treatments.

    [0431] Dosage forms for topical and/or transdermal administration may include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and/or patches. Generally, active ingredients are admixed under sterile conditions with pharmaceutical acceptable excipients and/or any needed preservatives and/or buffers. Additionally, the present invention contemplates the use of transdermal patches, which often have the added advantage of providing controlled delivery of pharmaceutical compositions, AAV particles of the present invention to the body. Such dosage forms may be prepared, for example, by dissolving and/or dispensing pharmaceutical compositions, AAV particles in the proper medium. Alternatively, or additionally, rates may be controlled by either providing rate controlling membranes and/or by dispersing pharmaceutical compositions, AAV particles in a polymer matrix and/or gel.

    [0432] Formulations suitable for topical administration include, but are not limited to, liquid and/or semi liquid preparations such as liniments, lotions, oil in water and/or water in oil emulsions such as creams, ointments and/or pastes, and/or solutions and/or suspensions.

    [0433] Topicaliy-administrable formulations may, for example, comprise from about 1% to about 10% (w/w) active ingredient, although the concentration of active ingredient may be as high as the solubility limit of the active ingredient in the solvent. Formulations for topical administration may further comprise one or more of the additional ingredients described herein.

    Depot Administration

    [0434] As described herein, in some embodiments, pharmaceutical compositions, AAV particles of the present invention are formulated in depots for extended release. Generally, specific organs or tissues (target tissues) are targeted for administration.

    [0435] In some aspects of the invention, pharmaceutical compositions, AAV particles of the present invention are spatially retained within or proximal to target tissues. Provided are methods of providing pharmaceutical compositions, AAV particles, to target tissues of mammalian subjects by contacting target tissues (which comprise one or more target cells) with pharmaceutical compositions, AAV particles, under conditions such that they are substantially retained in target tissues, meaning that at least 10, 20, 30, 40, 50, 60, 70, 80, 85, 90. 95, 96, 97, 98. 99, 99.9, 99.99 or greater than 99.99% of the composition is retained in the target tissues. Advantageously, retention is determined by measuring the amount of pharmaceutical compositions, AAV particles, that enter one or more target cells. For example, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, or greater than 99.99% of pharmaceutical compositions, AAV particles, administered to subjects are present intracellularly at a period of time following administration. For example, intramuscular injection to mammalian subjects may be performed using aqueous compositions comprising pharmaceutical compositions, AAV particles of the present invention and one or more transfection reagents, and retention is determined by measuring the amount of pharmaceutical compositions, AAV particles, present in muscle cells.

    [0436] Certain aspects of the invention are directed to methods of providing pharmaceutical compositions, AAV particles of the present invention to a target tissues of mammalian subjects, by contacting target tissues (comprising one or more target cells) with pharmaceutical compositions, AAV particles under conditions such that they are substantially retained in such target tissues. Pharmaceutical compositions, AAV particles comprise enough active ingredient such that the effect of interest is produced in at least one target cell. In some embodiments, pharmaceutical compositions, AAV particles generally comprise one or more cell penetration agents, although naked formulations (such as without cell penetration agents or other agents) are also contemplated, with or without pharmaceutieally acceptable carriers.

    Pulmonary Administration

    [0437] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be prepared, packaged, and/or sold in formulations suitable for pulmonary administration. In some embodiments, such administration is via the buccal cavity. In some embodiments, formulations may comprise dry particles comprising active ingredients. In such embodiments, dry particles may have a. diameter in the range from about 0.5 nm to about 7 nm or from, about 1 nm to about 6 nm. In some embodiments, formulations may be in the form of dry powders for administration using devices comprising dry powder reservoirs to which streams of propellant may be directed to disperse such powder. In some embodiments, self-propelling solvent/powder dispensing containers may be used. In such embodiments, active ingredients may be dissolved and/or suspended in low-boiling propellant in sealed containers. Such powders may comprise particles wherein at least 98% of the particles by weight have diameters greater than 0.5 nm find at least 95% of the particles by number have diameters less than 7 nm. Alternatively, at least 95% of the particles by weight have a diameter greater than 1 nm and at least 90% of the particles by number have a diameter less than 6 nm. Dry powder compositions may include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.

    [0438] Low boiling propellants generally include liquid propellants having a boiling point of below 65 F. at atmospheric pressure. Generally, propellants may constitute 50% to 99.9% (w/w) of the composition, and active ingredient may constitute 0.1% to 20% (w/w) of the composition. Propellants may further comprise additional ingredients such as liquid non-ionic and/or solid anionic surfactant and/or solid diluent (which may have particle sizes of the same order as particles comprising active ingredients).

    [0439] Pharmaceutical compositions formulated for pulmonary delivery may provide active ingredients in the form of droplets of solution and/or suspension. Such formulations may be prepared, packaged, and/or sold as aqueous and/or dilute alcoholic solutions and/or suspensions, optionally sterile, comprising active ingredients, and may conveniently be administered using any nebulization and/or atomization device. Such formulations may further comprise one or more additional ingredients including, but not limited to, a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, and/or a preservative such as methyihydroxybenzoate. Droplets provided by this route of administration may have an average diameter in the range from about 0.1 nm to about 200 nm.

    Intranasal, Nasal and Buccal Administration

    [0440] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be administered nasally and/or intranasal. In some embodiments, formulations described herein useful for pulmonary delivery may also be useful for intranasal delivery. In some embodiments, formulations for intranasal administration comprise a coarse powder comprising the active ingredient and having an average particle from about 0.2 m to 500 m. Such formulations are administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close to the nose.

    [0441] Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1% (w/w) and as much as 100% (w/w) of active ingredient, and may comprise one or more of the additional ingredients described herein. A pharmaceutical composition may be prepared, packaged, and/or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets and/or lozenges made using conventional methods, and may, for example, 0.1% to 20% (w/w) active ingredient, the balance comprising an orally dissolvable and/or degradable composition and. optionally, one or more of the additional ingredients described herein. Alternately, formulations suitable for buccal administration may comprise powders and/or an aerosolized and/or atomized solutions and/or suspensions comprising active ingredients. Such powdered, aerosolized, and/or aerosolized formulations, when dispersed, may comprise average particle and/or droplet sizes in the range of from about 0.1 nm to about 200 nm, and may further comprise one or more of any additional ingredients described herein.

    Ophthalmic or Otic Administration

    [0442] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be prepared, packaged, and/or sold in formulations suitable for ophthalmic and/or otic administration. Such formulations may, for example, be in the form of eye and/or ear drops including, for example, a 0.1/1.0% (w/w) solution and/or suspension of the active ingredient in aqueous and/or oily liquid excipients. Such drops may further comprise buffering agents, salts, and/or one or more other of any additional ingredients described herein. Other ophthalmically-admimstrable formulations which are useful include those which comprise active ingredients in microcrystalline form and/or in liposomal preparations. Subretinal inserts may also be used as forms of administration.

    Delivery

    [0443] In one embodiment, the AAV particles or pharmaceutical compositions of the present invention may be administered or delivered using the methods for treatment of disease described in U.S. Pat. No. 8,999,948, or International Publication No. WO2014178863, the contents of which are herein incorporated by reference in their entirety.

    [0444] In one embodiment, the AAV particles or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering gene therapy in Alzheimer's Disease or other neurodegenerative conditions as described, in US Application No. 20150126590, the contents of which are herein incorporated by reference in their entirety.

    [0445] In one embodiment, the AAV particles or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivery of a CNS gene therapy as described in U.S. Pat. Nos. 6,436,708, and 8,946,152, and International Publication No. WO2015168666, the contents of which are herein incorporated by reference in their entirety.

    [0446] In one embodiment, the AAV particle or pharmaceutical compositions of the present, invention may be administered or delivered using the methods for delivering proteins using AAV vectors described in European Patent Application No. EP2678433, the contents of which are herein incorporated by reference in their entirety.

    [0447] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering DNA to the bloodstream described in U.S. Pat. No. 6,211,163, the contents of which are herein incorporated by reference in their entirety.

    [0448] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering a payload to the central nervous system described in U.S. Pat. No. 7,588,757, the contents of which are herein incorporated by reference in their entirety.

    [0449] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering a payload described in U.S. Pat. No. 8,283,151, the contents of which are herein incorporated by reference in their entirety.

    [0450] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering a payload using a glutamic acid decarboxylase (GAD) delivery vector described in International Patent Publication No. WO2001089583, the contents of which are herein incorporated by reference in their entirety.

    [0451] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering a payload to neural cells described in International Patent Publication No. WO2012057363, the contents of which are herein incorporated by reference in their entirety.

    Delivery to Cells

    [0452] The present disclosure provides a method of delivering to a cell or tissue any of the above-described AAV particles, comprising contacting the cell or tissue with said AAV particle or contacting the cell or tissue with a, formulation comprising said AAV particle, or contacting the cell or tissue with any of the described compositions, including pharmaceutical compositions. The method of delivering the AAV particle to a cell or tissue can be accomplished in vitro, ex vivo, or in vivo.

    Delivery to Subjects

    [0453] The present disclosure additionally provides a method of delivering to a subject, including a mammalian subject, any of the above-described AAV particles comprising administering to the subject said AAV particle, or administering to the subject a formulation comprising said AAV particle, or administering to the subject any of the described compositions, including pharmaceutical compositions.

    Dose and Regimen

    [0454] The present invention provides methods of administering AAV particles in accordance with the invention to a subject in need thereof. The pharmaceutical, diagnostic, or prophylactic AAV particles and compositions of the present invention may be administered to a subject using any amount and any route of administration effective for preventing, treating, managing, or diagnosing diseases, disorders and/or conditions. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. The subject may be a human, a mammal, or an animal. Compositions in accordance with the invention are typically formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate diagnostic dose level for any particular individual will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific payload employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific AAV particle employed, the duration of the treatment; drugs used in combination or coincidental with the specific AAV particle employed; and like factors well known in the medical arts.

    [0455] In certain embodiments, AAV particle pharmaceutical compositions in accordance with the present invention may be administered at dosage levels sufficient to deliver from about 0.0001 mg/kg to about 100 mg/kg, from about 0.001 mg/kg to about 0.05 mg/kg, from about 0.005 mg/kg to about 0.05 mg/kg, from about 0.001 mg/kg to about 0.005 mg/kg, from about 0.0.5 mg/kg to about 0.5 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, from about 0.1 mg/kg to about 40 mg/kg, from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, or from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic, diagnostic, or prophylactic, effect. It will be understood that the above dosing concentrations may be converted to vg or viral genomes per kg or into total viral genomes administered by one of skill in the art.

    [0456] In certain embodiments, AAV particle pharmaceutical compositions in accordance with the present disclosure may be administered at about 10 to about 600 l/site, 50 to about 500 l/site, 100 to about 400 l/site, 120 to about 300 l/site, 140 to about 200 l/site, about 160 l/site. As non-limiting examples, AAV particles may be administered at 50 l/site and/or 150 l/site.

    [0457] The desired dosage of the AAV particles of the present invention may be delivered only once, three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). When multiple administrations are employed, split dosing regimens such as those described herein may be used. As used herein, a split dose is the division of single unit dose or total daily dose into two or more doses, e.g., two or more administrations of the single unit dose. As used herein, a single unit dose is a dose of any therapeutic administered in one dose/at one time/single route/single point of contact, i.e., single administration event.

    [0458] The desired dosage of the AAV particles of the present invention may be administered as pulse dose or as a continuous flow. As used herein, a pulse dose is a series of single unit doses of any therapeutic administered with a set frequency over a period of time. As used herein, a continuous flow is a dose of therapeutic administered continuously for a period of time in a single route/single point of contact, i.e., continuous administration event. A total daily dose, an amount given or prescribed in 24-hour period, may be administered by any of these methods, or as a combination of these methods, or by any other methods suitable for a pharmaceutical administration.

    [0459] In one embodiment, delivery of the AAV particles of the present invention to a subject provides neutralizing activity to a subject. The neutralizing activity can be for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more than 10 years,

    [0460] In one embodiment, delivery of the AAV particles of the present invention results in minimal serious adverse events (SAEs) as a result of the delivery of the AAV particles.

    [0461] In one embodiment, delivery of AAV particles to cells of the central nervous system (e.g., parenchyma) may comprise a total dose between about 110.sup.6 VG and about 110.sup.16 VG. In some embodiments, delivery may comprise a total dose of about 110.sup.6, 210.sup.6, 310.sup.6, 410.sup.6, 510.sup.6, 610.sup.6, 710.sup.6, 810.sup.6, 910.sup.6, 110.sup.7, 2.sup.7, 310.sup.7, 410.sup.7, 410.sup.7, 510.sup.7, 610.sup.7, 710.sup.7, 810.sup.7, 910.sup.7, 110.sup.8, 210.sup.8, 310.sup.8, 410.sup.8, 510.sup.8, 510.sup.8, 610.sup.8, 710.sup.8, 810.sup.8, 910.sup.8, 110.sup.9, 210.sup.9, 310.sup.9, 410.sup.9, 510.sup.9, 610.sup.9, 710.sup.9, 810.sup.9, 910.sup.9, 110.sup.10, 1.910.sup.10, 210.sup.10, 310.sup.10, 3.7310.sup.10, 410.sup.10, 510.sup.10, 610.sup.10, 710.sup.10, 810.sup.10, 910.sup.11, 110.sup.11, 210.sup.11, 2.510.sup.11, 310.sup.11, 410.sup.11, 510.sup.11, 610.sup.11, 710.sup.11, 810.sup.11, 910.sup.11, 110.sup.12, 210.sup.12, 310.sup.12, 410.sup.12, 510.sup.12, 610.sup.12, 710.sup.12, 810.sup.12, 910.sup.12, 110.sup.13, 210.sup.13, 310.sup.13, 410.sup.13, 510.sup.13, 610.sup.13, 710.sup.13, 810.sup.13, 910.sup.13, 110.sup.14, 210.sup.14, 310.sup.14, 410.sup.14, 510.sup.14, 610.sup.14, 710.sup.14, 810.sup.14, 910.sup.14, 110.sup.15, 210.sup.15, 310.sup.15, 410.sup.15, 510.sup.15, 610.sup.15, 710.sup.15, 810.sup.15, 910.sup.15, or 110.sup.16 VG. As a non-limiting example, the total dose is 110.sup.15 VG. As another non-limiting example, the total dose is 2.110.sup.12 VG.

    [0462] In one embodiment, delivery of AAV particles to cells of the central nervous system (e.g., parenchyma) may comprise a composition concentration between about 110.sup.6 VG/mL and about 110.sup.16 VG/mL. In some embodiments, delivery may comprise a composition concentration of about VG mL. 110 .sup.6, 210.sup.6, 310.sup.6, 410.sup.6, 510.sup.6, 610.sup.6, 710.sup.6, 810.sup.6, 910.sup.6, 110.sup.7, 210.sup.7, 310.sup.7, 410.sup.7, 510.sup.7, 610.sup.7, 710.sup.7, 810.sup.7, 910.sup.7, 110.sup.8, 210.sup.8, 310.sup.8, 410.sup.8, 510.sup.8, 610.sup.8, 710.sup.8, 810.sup.8, 910.sup.8, 110.sup.9, 210.sup.9, 310.sup.9, 410.sup.9, 510.sup.9, 610.sup.9, 710.sup.9, 810.sup.9, 910.sup.9, 110.sup.10, 210.sup.10, 310.sup.10, 410.sup.10, 510.sup.10, 610.sup.10, 710.sup.10, 810.sup.10, 910.sup.10, 110.sup.11, 210.sup.11, 310.sup.11, 410.sup.11, 510.sup.11, 610.sup.11, 710.sup.11, 810.sup.11, 910.sup.11, 110.sup.12, 210.sup.12, 310.sup.12, 410.sup.12, 510.sup.12, 610.sup.12, 710.sup.12, 810.sup.12, 910.sup.12, 110.sup.13, 210.sup.13, 310.sup.13, 410.sup.13, 510.sup.13, 610.sup.13, 710.sup.13, 810.sup.13, 910.sup.13, 110.sup.14, 210.sup.14, 310.sup.14, 410.sup.14, 510.sup.14, 610.sup.14, 710.sup.14, 810.sup.14, 910.sup.14, 110.sup.15, 210.sup.15, 310.sup.15, 410.sup.15, 510.sup.15, 610.sup.15, 710.sup.15, 810.sup.15, 910.sup.15, or 110.sup.16 VG/mL. In one embodiment, the delivery comprises a composition concentration of 110.sup.13 VG/mL. In one embodiment, the delivery comprises a composition concentration of 2.11012 VG/mL.

    Combinations

    [0463] The AAV particles may be used in combination with one or more other therapeutic, prophylactic, research or diagnostic agents. By in combination with, it is not intended to imply that the agents must be administered at the same time and/or formulated for delivery together, although these methods of delivery are within the scope of the present invention. Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent. In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, research, or diagnostic compositions in combination with agents that may improve their bioavailability, reduce and/or modify their metabolism, inhibit their excretion, and/or modify their distribution within the body.

    Measurement of Expression

    [0464] Expression of pay loads from viral genomes may be determined using various methods known in the art such as, but not limited to immunochemistry (e.g., 1HC), in situ hybridization (ISH), enzyme-linked immunosorbent assay (ELISA), affinity ELISA, ELISPOT, flow cytometry, immunocytology, surface plasmon resonance analysis, kinetic exclusion assay, liquid chromatography-mass spectrometry (LCMS), high-performance liquid chromatography (HPLC), BCA assay, immunoelectrophoresis, Western blot, SDS-PAGE, protein immunoprecipitation, and/or PCR.

    Bioavailability

    [0465] The AAV particles, when formulated into a composition with a delivery agent as described herein, can exhibit an increase in bioavailability as compared to a composition lacking a delivery agent as described herein. As used herein, the term bioavailability refers to the systemic availability of a given amount of AAV particle or expressed payload administered to a mammal. Bioavailability can be assessed by measuring the area under the curve (AUC) or the maximum serum or plasma concentration (C.sub.max) of the composition following. AUC is a determination of the area under the curve plotting the serum or plasma concentration of a compound (e.g., AAV particles or expressed payloads) along the ordinate (Y-axis) against time along the abscissa (X-axis). Generally, the AUC for a particular compound can be calculated using methods known to those of ordinary skill in the art and as described in G. S. Banker, Modern Pharmaceutics, Drugs and the Pharmaceutical Sciences, v. 72, Marcel Dekker, New York, Inc., 1996, the contents of which are herein incorporated by reference in its entirety.

    [0466] The C.sub.max value is the maximum concentration of the AAV particle or expressed payload achieved in the serum or plasma of a mammal following administration of the AAV particle to the mammal. The C.sub.max value of can be measured using methods known to those of ordinary skill in the art. The phrases increasing bioavailability or improving the pharmacokinetics, as used herein mean that the systemic availability of a first AAV particle or expressed payload, measured as AUC, C.sub.max, or C.sub.min in a mammal is greater, when co-administered with a delivery- agent as described herein, than when such co-administration does not take place. In some embodiments, the bioavailability can increase by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%.

    Therapeutic Window

    [0467] As used herein therapeutic window refers to the range of plasma concentrations, or the range of levels of therapeutically active substance at the site of action, with a high probability of eliciting a therapeutic effect. In some embodiments, the therapeutic window of the AAV particle as described herein can increase by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%.

    Volume of Distribution

    [0468] As used herein, the term volume of distribution refers to the fluid volume that would be required to contain the total amount of the drug in the body at the same concentration as in the blood or plasma: V.sub.dist equals the amount of drug in the body/concentration of drug in blood or plasma. For example, for a 10 mg dose and a plasma concentration of 10 mg/L, the volume of distribution would be 1 liter. The volume of distribution reflects the extent to which the drug is present in the extravascular tissue. A large volume of distribution reflects the tendency of a compound to bind to the tissue components compared with plasma protein binding. In a clinical setting, V.sub.dist can be used to determine a loading dose to achieve a steady state concentration. In some embodiments, the volume of distribution of the AAV particles as described herein can decrease at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least, about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%.

    Biological Effect

    [0469] In one embodiment, the biological effect of the AAV particles delivered to the animals may be categorized by analyzing the payload expression in the animals. The payload expression may be determined from analyzing a biological sample collected from a mammal administered the AAV particles of the present invention. For example, a protein expression of 50-200 pg/ml for the protein encoded by the AAV particles delivered to the mammal may be seen as a therapeutically effective amount of protein in the mammal.

    IV. METHODS AND USES OF THE COMPOSITIONS OF THE INVENTION

    [0470] The present disclosure provides a method for treating a disease, disorder and/or condition in a mammalian subject, including a human subject, comprising administering to the subject any of the AAV particles described herein or administering to the subject any of the described compositions, including pharmaceutical compositions, described herein.

    [0471] In one embodiment, the AAV particles of the present invention are administered to a subject prophylacticaliy.

    [0472] In one embodiment, the AAV particles of the present invention are administered to a subject having at least one of the diseases described herein.

    [0473] In one embodiment, the AAV particles of the present invention are administered to a subject to treat a disease or disorder described herein. The subject may have the disease or disorder or may be at-risk to developing the disease or disorder.

    [0474] In one embodiment, the AAV particles of the present invention are part of an active immunization strategy to protect against diseases and disorders, in an active immunization strategy, a vaccine or AAV particles are administered to a subject to prevent an infectious disease by activating the subject's production of antibodies that can light off invading bacteria or viruses.

    [0475] In one embodiment, the AAV particles of the present invention are part of a passive immunization strategy. In a passive immunization strategy, antibodies against a particular infectious agent are given directly to the subject.

    [0476] In one embodiment, the AAV particles of the present invention may be used for passive immunotherapy of tauopathy, (e.g. Alzheimer Disease or Frontotemporal Dementia), as described in Liu et al, the contents of which are herein incorporated by reference in their entirety (Liu, W et al., 2016 J Neurosci 36(49):12425-12435). As a non-limiting example, the AAV particles of the present invention may encode a PHF1 antibody. Heavy and light chains of the PHFi antibody may be linked by a Tav2A and/or Furin 2A linker sequence. Antibody expression may be under the control of a CAG promoter. The AAV particle may comprise, as a non-limiting example, an AAVrh.10 serotype capsid. Further, these PHF1 encoding AAV particles may be administered by bilateral intraparenchymal delivery directly to the hippocampus. Such treatment with AAV-PHF1 may result in a 50-fold increase in antibody levels in the hippocampus as compared to antibody levels subsequent to systemic administration. Neuropathological tau species in the hippocampus may be reduced as much as 80-90% and hippocampal atrophy may be fully rescued alter treatment with AAV particles of the present invention.

    [0477] In one embodiment, the AAV particles of the present invention may be used to treat tauopathy as described in Ising et al, the contents of which are herein incorporated by reference in their entirety (Ising. C et al., 2017 J Exp Med April 17, Epub ahead of print). As a non-limiting example, the AAV particles of the present invention may encode an HJ8.5, HJ8.7, or Tau5 antibody or a single chain variable fragment (scFv) derived therefrom. Heavy and light chains of the HJ8.5 antibody or scFv may be linked by variable length linker sequences and may be flexible glycine and/or serine linkers. The AAV particle may comprise, as anon-limiting example, an AAV2/8 serotype. Further, these HJ8.5, HJ8.7 or Tau5 encoding AAV particles may be administered by bilateral intracerebroventricular delivery. Such treatment with HJ8.5, HJ8.7 or Tau5 encoding AAV particles may result in a significant reduction in neuropathological tau species in the hippocampus.

    Diseases and Toxins

    [0478] Various infectious diseases may be treated with pharmaceutical compositions. AAV particles, of the present invention. As used herein, the term infectious disease refers to any disorders caused by organisms such as bacteria, viruses, fungi or parasites. As a non-limiting example, the infectious disease may be Acute bacterial rhinosinusitis, 14-day measles. Acne, Acrodermatitis chronica atrophicans (ACA)-(Iate skin manifestation of latent Lyme disease), Acute hemorrhagic conjunctivitis, Acute hemorrhagic cystitis. Acute rhinosinusitis, Adult T-cell Leukemia-Lymphoma ( ATLL), African Sleeping Sickness, AIDS (Acquired Immunodeficiency Sydrome), Alveolarhydatid. Amebiasis, Amebic meningoencephalitis, Anaplasmosis, Anthrax, Arboviral or parainfectious, Ascariasis(Roundworm infections), Aseptic meningitis. Athlete's foot (Tinea pedis), Australian tick typhus, Avian Influenza, Babesiosis, Bacillary angiomatosis, Bacterial meningitis, Bacterial vaginosis, Balanitis, Balantidiasis, Bang's disease, Barmah Forest vims infection, Bartonellosis (Verruga peruana; Carrion's disease; Oroya fever), Bat Lyssavirus Infection, Bay sore (Chiclero's ulcer), Baylisascaris infection (Racoon roundworm infection), Beaver fever, Beef tapeworm, Bejel (endemic syphilis), Biphasic meningoencephalitis, Black Bane, Black death. Black piedra, Blackwater Fever, Blastomycosis, Blennorrhea of the newborn, Blepharitis, Boils, Bomholm disease (pleurodynia), Borrelia miyamotoi Disease, Botulism, Boutonneuse fever, Brazilian purpuric fever, Break Bone fever, Brill, Bronchiolitis, Bronchitis, Brucellosis (Bang's disease ), Bubonic plague, Bullous impetigo, Burkholderia mallei (Glanders), Burkholderia pseudomallei (Melioidosis), Buruli ulcers (also Mycoburuli ulcers), Busse, Busse-Buschke disease (Cryptococcosis), California group encephalitis, Campylobacteriosis, Candidiasis, Canefield fever (Canicola fever; 7-day fever; Weil's disease; leptospirosis; canefield fever), Canicola fever, Capillariasis, Carate, Carbapenem-resi stant Enterobacteriaceae (CRE), Carbuncle, Carrion's disease, Cat Scratch fever, Cave disease, Central Asian hemorrhagic fever, Central European tick, Cervical cancer, Chagas disease. Chancroid (Soft chancre), Chicago disease, Chickenpox (Varicella), Chiclero's ulcer, Chikungunya fever, Chlamydial infection, Cholera, Chromoblastomycosis, Ciguatera, Clap, Clonorchiasis (Liver fluke infection), (Clostridium Difficile Infection, ClostriDium Perfringens (Epsilon Toxin), Coccidioidomycosis fungal infection (Valley fever; desert rheumatism), Coenurosis, Colorado tick fever, Condyloma accuminata, Condyloma accuminata (Warts), Condyloma lata, Congo fever, Congo hemorrhagic fever virus, Conjunctivitis, cowpox, Crabs, Crimean, Croup, Cryptococcosis, Cryptosporidiosis (Crypto), (Cutaneous Larval Migrans, Cyclosporiasis, (Cystic hydatid, Cysticercosis, Cystitis, Czechoslovak tick, D68 (EV-D68), Dacryocytitis, Dandy fever. Darling's Disease, Deer fly fever, Dengue fever (1, 2, 3, and 4), Desert rheumatism. Devil's grip, Diphasic milk fever, Diphtheria, Disseminated Intravascular Coagulation, Dog tapeworm, Donovanosis, Donovanosis (Granuloma inguinale), Dracontiasis, Dracunculosis, Duke's disease. Dum Dum Disease, Durand-Nicholas-Favre disease, Dwarf tapeworm, E. Coli infection (E.Coli), Eastern equine encephalitis, Ebola Hemorrhagic Fever (Ebola vims disease EVD), Ectothrix, Ehrlichiosis (Sennetsu fever), Encephalitis, Endemic Relapsing fever, Endemic syphilis, Endophthalmitis, Endothrix, Enterobiasis (Pinwonn infection), EnterotoxinB Poisoning (Staph Food Poisoning), Enterovirus Infection, Epidemic Keratoconjunctivitis, Epidemic Relapsing fever, Epidemic typhus, Epiglottitis, Erysipelis, Erysipeloid (Erysipelothricosis), Erythema chronicum migrans, Erythema infectiosum, Erythema marginatum, Erythema multiforme, Erythema nodosum, Erythema nodosum leprosum, Erythrasma, Espundia, Eumycotic mycetoma, European blastomycosis, Exanthem subitum (Sixth disease), Eyevvorm, Far Eastern tick, Fascioliasis, Fievre boutonneuse (Tick typhus), Fifth Disease (erythema infectiosum), FilatowDukes' Disease (Scalded Skin Syndrome; Ritter's Disease), Fish tapeworm, Fitz-Hugh-Curtis syndromePerihepatitis, Flinders Island Spotted Fever, Flu (Influenza), Folliculitis, Four Corners Disease, Four Corners Disease (Human Pulmonary Syndrome (HPS)), Frambesia, Francis disease, Furunculosis, Gas gangrene, Gastroenteritis, Genital Herpes, Genital Warts, German measles, Gerstmann-Straussler-Scheinker (GSS), Giardiasis, Gilclirist's disease, Gingivitis, Gingivostomatitis, Glanders, Glandular fever (infectious mononucleosis), Gnatbostomiasis, Gonococcal Infection (Gonorrhea), Gonorrhea, Granuloma inguinale (Donovanosis), Guinea Worm, Haemophilus Influenza disease, Hamburger disease, Hansen's diseaseleprosy, Hantaan disease, Hantaan-Korean hemorrhagic fever, Hantavirus Pulmonary Syndrome, Hantavirus Pulmonary Syndrome (HPS), Hard chancre, Hard measles, Haverhill feverRat bite fever, Head and Body Lice, Heartland fever, Helicobacterosis, Hemolytic Uremic Syndrome (HUS), Hepatitis A, Hepatitis B, Hepatitis C, Hepatitis D, Hepatitis E, Herpangina, Herpesgenital, Herpes labialis, Herpesneonatal, Hidradenitis, Histoplasmosis, Histoplasmosis infection (Histoplasmosis), His-Werner disease, HIV infection, Hookworm infections, Hordeola, Hordeola (Stye), HTLV, HTLVassociated myelopathy (HAM), Human granulocytic ehrlichiosis, Human monocytic ehrlichiosis, Human Papillomanvus (HPV), Hitman Pulmonary Syndrome, Hydatid cyst, Hydrophobia, Impetigo, Including congenital (German Measles), Inclusion conjunctivitis, Inclusion conjunctivitisSwimming Pool conjunctivitisPannus, Infantile diarrhea, Infectious Mononucleosis, Infectious myocarditis, Infectious pericarditis, Influenza, Isosporiasis, Israeli spotted fever, Japanese Encephalitis, Jock itch, Jorge Lobo diseaselobomycosis, Jungle yellow fever, Junin Argentinian hemorrhagic fever, Kala Azar, Kaposi's sarcoma, Keloidal blastomycosis, Keratoconjunctivitis, Kuru, Kyasanur forest disease, LaCrosse encephalitis, Lassa hemorrhagic fever, Legionellosis (Legionnaires Disease), Legionnaire's pneumonia, Lemierre's Syndrome (Postanginal septicemia), Lemming fever, Leprosy, Leptospirosis (Nanukayami fever; Weil's disease). Listeriosis (Listeria), Liver fluke infection, Lobo's mycosis, Lockjaw, Loiasis, Louping III, Ludwig's angina, Lung fluke infection, Lung fluke infection (Paragonimiasis), Lyme disease, Lymphogranuloma venereum infection (LGV), Machupo Bolivian hemorrhagic fever, Madura foot, Mal del pinto. Malaria, Malignant pustule, Malta fever, Marburg hemorrhagic fever, Masters disease, Maternal Sepsis (Puerperal fever), Measles, Mediterannean spotted fever, Melioidosis (Whitraore's disease), Meningitis, Meningococcal Disease, MERS, Milker's nodule, Molluscum contagiosum, Moniliasis, monkeypox, Mononucleosis, Mononucleosis-like syndrome, Montezuma's Revenge, Morbilli, MRSA (xnethicillin-resistant Staphylococcus aureus) infection, Mucormycosis-Zvgomycosis, Multiple Organ Dysfunction Syndrome or MODS, Multiple-system atrophy (MSA), Mumps, Murine typhus, Murray Valley Encephalitis(MVE), Mycoburuli ulcers, Mycoburuli ulcersBuruli ulcers, Mycotic vulvovaginitis, Myositis, Nanukayami fever, Necrotizing fasciitis, Necrotizing fasciitis- Type 1, Necrotizing fasciitisType 2. Negislu, New world spotted fever, Nocardiosis, Nongonococcal urethritis, Non-Polio (Non-Polio Enterovirus), Norovirus infection, North American blastomycosis, North Asian tick typhus, Norwalk virus infection, Norwegian itch, O'Hara disease, Omsk hemorrhagic fever, Onchoceriasis, Onychomycosis, Opisthorchiasis, Opthalmia neonatorum, Oral hairy leukoplakia, Orf, Oriental Sore, Oriental Spotted Fever, Ornithosis (Parrot fever; Psittacosis), Oroya fever, Otitis externa, Otitis media, Pannus, Paracoccidioidomycosis, Paragonimiasis, Paralytic Shellfish Poisoning (Paralytic Shellfish Poisoning), Paronychia (Whitlow), Parotitis, PCP pneumonia, Pediculosis, Peliosis hepatica, Pelvic Inflammatory Disease, Pertussis (also called Whooping cough), Phaeobyphomycosis, Pliaryngocojunctival fever, Piedra (White Piedra), Piedra(Black Piedra), Pigbel, Pink eye conjunctivitis, Pinta, Pinworm infection, Pitted Keratolysis, Pityriasis versicolor (Tinea versicolor), Plague; Bubonic, Pleurodynia, Pneumococcal Disease, Pneumocystosis, Pneumonia, Pneumonic (Plague), Polio or Poliomyelitis. Polycystic hydatid, Pontiac fever, Pork tapeworm, Posada-Wernicke disease, Postangmal septicemia, Powassan, Progressive multifocal leukencephalopashy, Progressive Rubella Panencephalitis, Prostatitis, Pseudomembranous colitis, Psittacosis, Puerperal fever, Pustular Rash diseases (Small pox). Pyelonephritis, Pylephlebitis, Q-Fever, Quinsy, Quintana fever (5-day fever), Rabbit fever, Rabies, Racoon roundworm infection, Rat bite fever, Rat tapeworm, Reiter Syndrome, Relapsing fever, Respiratory syncytial virus (RSV) infection, Rheumatic fever, Rhodotorulosis, Ricin Poisoning, Rickettsialpox, Rickettsiosis, Rift Valley Fever, Ringworm, Ritter's Disease, River Blindness, Rocky Mountain spotted fever, Rose Handler's disease (Sporotrichosis), Rose rash of infants, Roseola, Ross River fever, Rotavirus infection, Roundworm infections, Rubella, Rubeola, Russian spring, Salmonellosis gastroenteritis, San Joaquin Valley fever, Sao Paulo Encephalitis, Sao Paulo fever, SARS, Scabies Infestation (Scabies) (Norwegian itch), Scalded Skin Syndrome, Scarlet fever (Scarlatina), Schistosomiasis, Scombroid, Scrub typhus, Sennetsu fever, Sepsis (Septic shock), Severe Acute Respiratory Syndrome, Severe Acute Respiratory Syndrome (SARS), Shiga Toxigenic Escherichia coli (STEC/VTEC), Shigellosis gastroenteritis (Shigella), Shinbone fever, Shingles, Shipping fever, Siberian tick typhus, Sinusitis, Sixth disease, Slapped cheek disease, Sleeping sickness, Smallpox (Variola), Snail Fever, Soft chancre, Southern tick associated rash illness, Sparganosis, Spelunker's disease, Sporadic typhus, Sporotrichosis, Spotted fever, Spring, St. Louis encephalitis, Staphylococcal Food Poisoning, Staphylococcal infection, Strep throat, Streptococcal Disease, Streptococcal Toxic-Shock Syndrome, Strongyloieiasis, Stye, Subacute Sclerosing Panencephalitis, Subacute Sclerosing Panencephalitis (SSPE), Sudden Acute Respiratory Syndrome, Sudden Rash, Swimmer's ear, Swimmer's Itch, Swimming Pool conjunctivitis, Sylvatic yellow fever, Syphilis, Systemic Inflammatory Response Syndrome (SIRS), Tabes dorsalis (tertiary syphilis), Taeniasis, Taiga encephalitis, Tanner's disease, Tapeworm infections, Temporal lobe encephalitis, Temporal lobe encephalitis, tetani (Lock jaw), Tetanus Infection, Threadworm infections, Thrush, Tick, Tick typhus, Tinea, barbae, Tinea capitis, Tinea corporis. Tinea cruris, Tinea manuum, Tinea nigra, Tmea pedis, Tinea unguium, Tinea versicolor, Torulopsosis, Torulosis, Toxic Shock Syndrome, Toxoplasmosis, transmissible spongioform (CJD), Traveler's diarrhea, Trench fever 5, Trichinellosis, Trichomoniasis, Trichomycosis axillaris, Trichuriasis, Tropical Spastic Paraparesis (TSP), Trypanosomiasis, Tuberculosis (TB), Tuberculousis, Tularemia, Typhoid Fever, Typhus fever, Ulcus molle, Undulant fever, Urban yellow fever, Urethritis, Vaginitis, Vaginosis, Vancomycin Intermediate (VISA), Vancomycin Resistant (VRSA), Varicella, Venezuelan Equine encephalitis, Verruga peruana, Vibrio cholerae (Cholera), Vibriosis (Vibrio), Vincent's disease or Trench mouth, Viral conjunctivitis, Viral Meningitis, Viral meningoencephalitis, Viral rash, Visceral Larval Migrans, Vomito negro, Vulvovaginitis, Warts, Waterhouse, Weil's disease, West Nile Fever, Western equine encephalitis, Whipple's disease, Whipworm infection, White Piedra, Whitlow, Whitmore's disease, Winter diarrhea, Wolhynia fever, Wool sorters' disease, Yaws, Yellow Fever, Yersinosis, Yersinosis (Yersinia), Zahorsky's disease, Zika virus disease. Zoster, Zygomycosis, John Cunningham Virus (JCV), Human immunodeficiency virus (HIV), Influenza virus, Hepatitis B, Hepatitis C, Hepatitis D, Respiratory syncytial virus (RSV), Herpes simplex virus 1 and 2, Human Cytomegalovirus, Epstein-Barr virus, Varicella zoster virus, Coronaviruses, Poxviruses, Enterovirus 71, Rubella virus, Human papilloma virus, Streptococcus pneumoniae, Streptococcus viridaris, Staphylococcus aureus (S. aureus), Methicillin-resistant Staphylococcus aureus (MRSA), Vancomycin-intermediate Staphylococcus aureus (VISA), Vancomycin-resistant Staphylococcus aureus (VRSA), Staphylococcus epidermidis (S. epidermidis), Clostridium Tetani, Bordetella pertussis, Bordetella paratussis, Mycobacterium, Francisella Tidarertsis, Toxoplasma gondii, Candida (C. albicans, C. glabrata, C. parapsilosis, C. tropicalis, C. krusei and C. lusitaniae), and/or any other infectious diseases, disorders, or syndromes.

    [0479] Various toxins may be treated with the pharmaceutical compositions, AAV particles, of the present invention. Non-limited examples of toxins include Ricin, Bacillus anthracis, Shiga toxin and Shiga-like toxin, Botulinum toxins.

    [0480] Various tropical diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. Non-limited examples of tropical diseases include Chikungunya fever, Dengue fever, Chagas disease, Rabies, Malaria, Ebola virus, Marburg virus, West Nile Virus, Yellow Fever, Japanese encephalitis virus, and St. Louis encephalitis virus.

    [0481] Various foodbome illnesses and gastroenteritis may be treated with pharmaceutical compositions, AAV particles, of the present invention. Non-limited examples of foodbome illnesses and gastroenteritis include Rotavirus, Norwalk virus (Noro virus), Campylobacter jejuni, Clostridium difficile, Entamoeba histolytica, Helicobacter pyroli, Enterotoxin B of Staphylococcus aureus, Hepatitis A virus (HAV), Hepatitis E. Listeria monocytogenes, Salmonella, Clostridium perfringens, and Salmonella.

    [0482] Various infectious agents may be treated with pharmaceutical compositions, AAV particles, of the present invention. Non-limited examples of infectious agents include adenoviruses, Anaplasma phagocytophilium, Ascaris lumbricoides, Bacillus anthracis, Bacillus cereus, Bacterlodes sp, Barmah Forest virus, Bartonella bacilliformis, Bartonella henselae, Bartonella quintam, beta-toxin of Clostridium perfringens, Bordetella pertussis, Bordetella parapertussis, Borrelia burgdorferi, Borrelia miyamotoi, Borrelia recurrentis, Borrelia sp., Botulinum toxin, Brucella sp., Burkholderia pseudomallei, California encephalitis virus, Campylobacter, Candida albicans, chikungunya virus, Chlamydiapsittaci, Chlamydia trachomatis, Clonorchis sinensis, Clostridium difficile bacteria, Clostridium tetani, Colorado tick fever virus, Corynebacterium diphtheriae, Corynebacterium minutissimum, Coxiella burneni, coxsackie A, coxsackie B, Crimean-Congo hemorrhagic fever virus, cytomegalovirus, dengue virus, Eastern Equine encephalitis virus, Ebola viruses, echovirus, Ehrlichia chaffeensis, Ehrlichia equi., Ehrlichia sp., Entamoeba histolytica, Enterobacter sp., Enterococcus feacalis, Enterovirus 71, Epstein-Barr virus (EBV), Erysipelothrix rhusiopathiae, Escherichia coli, Flavivirus, Fusobacterium necrophorum. Gardnerella vaginalis, Group B streptococcus, Haemophilus aegyptius, Haemophilus ducreyi, Haemophilus influenzae, hantavirus, Helicobacter pylori, Hepatitis A, Hepatitis B, Hepatitis C, Hepatitis D, Hepatitis E, herpes simplex virus 1 and 2, human herpes virus 6, human herpes Virus 8, human immunodeficiency virus 1 and 2, human T-cell leukemia viruses I and II, influenza viruses (A, B, C), Jamestown Canyon virus, Japanese encephalitis antigenic, Japanese encephalitis virus, John Cunningham virus, juninvirus, Kaposi's Sarcoma-associated Herpes Virus (KSHV), Klebsiella granuloniatis, Klebsiella sp., Kyasanur Forest Disease virus, La Crosse virus, Lassaviras, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, lymphocytic choriomeningitis virus, lyssavirus, Machupovirus, Marburg virus, measles virus, MERS coronavirus (MERS-CoV) Micrococcus sedentarius, Mobiluncus sp., Molluscipoxvirus, Moraxella catarrhalis, Morbilli-Rubeola virus, Mumpsvirus, Mycobacterium leprae, Mycobacterium, tuberculosis, Mycobacterium ulcerans, Mycoplasma genitalium, Mycoplasma sp, Nairovirus, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia, Norwalk virus, norovirus, Omsk hemorrhagic fever virus, papillomavirus, parainfluenza viruses 1-3, parapoxvirus, parvovirus B19, Peptostreptococccus sp., Plasmodium sp., polioviruses types I, II, and III, Proteus sp., Pseudomonas aeruginosa, Pseudotnonas pseudomallei, Pseudomonas sp., rabies virus, respiratory syncytial virus, ricin toxin, Rickettsia australis, Rickettsia conori, Rickettsia honei, Rickettsia prowazekii, Ross River Virus, rotavirus, rubellavirus, Saint Louis encephalitis, Salmonella Typhi, Sarcoptes scabiei, SARS-associated coronavirus (SARS-CoV), Serratia sp., Shiga toxin and Shiga-like toxin, Shigella sp., Sin Nombre Virus, Snowshoe hare virus, Staphylococcus aureus, Staphylococcus epidermidis, Streptobacillus moniliformis, Streptoccoccus pneumoniae, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus group A-H, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum subsp. Pallidum, Treponema pallidum var. carateum, Treponema pallidum var. endemicum, Tropheryma whippelii, Ureaplasma urealyticim, Varicella-Zoster virus, variola virus, Vibrio cholerae, West Nile virus, yellow fever virus, Yersinia enterocolitica, Yersinia pestis, and Zika virus.

    [0483] Various rare diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As used herein, the term rare disease refers to any disease that affects a small percentage of the population. As a non-limiting example, the rare disease may be Acrocephalosyndactylia, Acrodermatitis, Addison Disease, Adie Syndrome, Alagille Syndrome, Amylose, Amyotrophic Lateral Sclerosis, Angelraan Syndrome, Angiolymphoid Hyperplasia with Fosinophilia, Arnold-Chiari Malformation, Arthritis, Juvenile Rheumatoid, Asperger Syndrome, Bardet-Biedl Syndrome, Barrett Esophagus, Beckwith-Wiedemann Syndrome, Behcet Syndrome, Bloom Syndrome, Bowen's Disease, Brachial Plexus Neuropathies, Brown-Sequard Syndrome, Budd-Chiari Syndrome, Burkitt Lymphoma, Carcinoma 256, Walker, Caroli Disease, Charcot-Marie-Tooth Disease, Chediak-Higashi Syndrome, Chiari-Frommel Syndrome, Chondrodysplasia Punctata, Colonic Pseudo-Obstruction, Colorectal Neoplasms, Hereditary Nonpolyposis, Craniofacial Dysostosis, Creutzfeldt-Jakob Syndrome, Crohn Disease, Cushing Syndrome, Cystic Fibrosis, Dandy-Walker Syndrome, De Lange Syndrome, Dementia, Vascular, Dermatitis Herpetiformis, DiGeorge Syndrome, Diffuse Cerebral Sclerosis of Schilder, Duane Retraction Syndrome, Dupuytren Contracture, Ebstein Anomaly, Eisenmenger Complex, Ellis-Van Creveld Syndrome, Encephalitis, Enchondromatosis, Epidermal Necrolysis, Toxic. Facial Hemiatrophy, Factor XII Deficiency, Fanconi Anemia, Felty's Syndrome, Fibrous Dysplasia, Polyostotic, Fox-Fordyce Disease, Friedreich Ataxia, Fusobacterium, Gardner Syndrome, Gaucher Disease, Gerstmann Syndrome, Giant Lymph Node Hyperplasia, Glycogen Storage Disease Type I, Glycogen Storage Disease Type II, Glycogen Storage Disease Type IV, Glycogen Storage Disease Type V, Glycogen Storage Disease Type VII, Goldenhar Syndrome, Guillain-Barre Syndrome, Hallermann's Syndrome, Hamartoma Syndrome, Multiple, Hartnup Disease, Hepatolenticular Degeneration, Hepatolenticular Degeneration, Hereditary Sensory and Motor Neuropathy, Hirschsprung Disease, Histiocytic Necrotizing Lymphadenitis, Histiocytosis, Langerhans-Cell, Hodgkin Disease, Horner Syndrome, Huntington Disease, Hyperaldosteronism, Hyperhidrosis, Hyperostosis, Diffuse Idiopathic Skeletal, Hypopituitarism, Inappropriate ADH Syndrome, Intestinal Polyps, Isaacs Syndrome, Kartagener Syndrome. Kearns-Sayre Syndrome, Klippel-Feil Syndrome, Klippel-Trenaunay-Weber Syndrome, Kluver-Bucy Syndrome, Korsakoff Syndrome, Lafora Disease, Lambert-Eaton Myasthenic Syndrome, Landau-Kleffner Syndrome, Langer-Giedion Syndrome, Leigh Disease, Lesch-Nyhan Syndrome, Leukodystrophy, Globoid Cell, Li-Fraumeni Syndrome, Long QT Syndrome, Machado-Joseph Disease, Mallory-Weiss Syndrome. Marek Disease, Marfan Syndrome, Meckel Diverticulum, Meige Syndrome, Melkersson-Rosenthal Syndrome, Meniere Disease, Mikulicz' Disease, Miller Fisher Syndrome, Mobius Syndrome, Moyamoya Disease, Mucocutaneous Lymph Node Syndrome, Mucopolysaccharidosis I, Mucopolysaccharidosis II, Mucopolysaccharidosis III, Mucopolysaccharidosis IV, Mucopolysaccharidosis VI, Multiple Endocrine Neoplasia Type 1, Munchausen Syndrome by Proxy, Muscular Atrophy, Spinal, Narcolepsy, Neuroaxonal Dystrophies. Neuromyelitis Optica, Neuronal Ceroid-Lipofuscinoses, Niemann-Pick Diseases, Noonan Syndrome, Optic Atrophies, Hereditary, Osteitis Deformans, Osteochondritis, Osteochondrodysplasias, Osteolysis, Essential, Paget Disease Extramammaiy, Paget's Disease, Mammary, Panniculitis, Nodular Nonsuppurative, Papillon-Lefevre Disease, Paralysis, Pelizaeus-Merzbacher Disease, Pemphigus, Benign Familial, Penile Induration, Pericarditis, Constrictive, Peroxisomal Disorders, Peutz-Jeghers Syndrome, Pick Disease of the Brain, Pierre Robin Syndrome, Pigmentation Disorders, Pityriasis Lichenoides, Polycystic Ovary Syndrome, Polyendocrinopathies, Autoimmune, Prader-Willi Syndrome, Pupil Disorders, Rett Syndrome, Raye Syndrome, Rubinstein-Taybi Syndrome, Sandhoff Disease, Sarcoma, Ewing's, Schnitzler Syndrome, Sjogren's Syndrome, Sjogren-Larsson Syndrome, Smith-Lemli-Opitz Syndrome, Spinal Muscular Atrophies of Childhood, Sturge-Weber Syndrome, Sweating, Gustatory, Takayasu Arteritis, Tangier Disease, Tay-Sachs Disease, Thromboangiitis Obliterans, Thyroiditis, Autoimmune, Tietze's Syndrome, Togaviridae Infections, Tolosa-Hunt Syndrome, Tourette Syndrome, Uveomeningoencephalitic Syndrome, Waardenburg's Syndrome, Wegener Granulomatosis, Weil Disease, Werner Syndrome, Williams Syndrome, Wilms Tumor, Wolff-Parkinson-White Syndrome, Wolfram Syndrome, Wolraan Disease, Zellweger Syndrome, ZoIlinger-EIlison Syndrome, and von Willebrand Diseases.

    [0484] Various autoimmune diseases and autoimmune-related diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As used herein, the term autoimmune disease refers to a disease in which the body produces antibodies that attack its own tissues. As a non-limiting example, the autoimmune disease may be Acute Disseminated Encephalomyelitis (ADEM), Acute necrotizing hemorrhagic leukoencephalitis, Addison's disease. Agammaglobulinemia, Alopecia areata, Amyloidosis, Ankylosing spondylitis, Anti-GBM/Anti-TBM nephritis, Antiphospholipid syndrome (APS), Autoimmune angioedema, Autoimmune aplastic anemia, Autoimmune dysautonomia, Autoimmune hepatitis, Autoimmune hyperlipidemia, Autoimmune immunodeficiency, Autoimmune inner ear disease (AIED), Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune pancreatitis, Autoimmune retinopathy, Autoimmune thrombocytopenic purpura (ATP), Autoimmune thyroid disease, Autoimmune urticaria, Axonal & neuronal neuropathies, Balo disease, Behcet's disease, Bullous pemphigoid, Cardiomyopathy, Castleraan disease, Celiac disease, Chagas disease. Chronic fatigue syndrome**, Chronic inflammatory demyelinating polyneuropathy (CIDP), Chronic recurrent multifocal ostomyelitis (CRMO), Churg-Strauss syndrome, Cicatricial pemphigoid/benign mucosal pemphigoid, Crohn's disease, Cogans syndrome, Cold agglutinin disease, Congenital heart block, Coxsackie myocarditis, CREST disease, Essential mixed cryoglobulinemia, Demyelinating neuropathies, Dermatitis herpetiformis, Derrnatomyositis, Devic's disease (neuromyelitis optica), Discoid lupus, Dressler's syndrome, Endometriosis, Eosinophilic esophagitis, Eosinophilic fasciitis, Erytherna nodosum, Experimental allergic encephalomyelitis, Evans syndrome, Fibromyalgia**, Fibrosing alveolitis, Giant cell arteritis (temporal arteritis), Giant cell myocarditis, Glomerulonephritis, Goodpasture's syndrome, Granulomatosis with Polyangiitis (GPA) (formerly called Wegener's Granulomatosis), Graves' disease, Guillain-Barre syndrome, Hashimoto's encephalitis, Hashimoto's thyroiditis, Hemolytic anemia, Henoch-Schonlein purpura, Herpes gestations, Hypogammaglobulinernia, Idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, IgG4-related sclerosing disease, Tmmunoregulaioiy lipoproteins, Inclusion body myositis, Interstitial cystitis, Juvenile arthritis, Juvenile diabetes (Type 1 diabetes), Juvenile myositis, Kawasaki syndrome, Lambert-Eaton syndrome, Leukocytoclastic vasculitis, Lichen planus, Lichen sclerosus, Ligneous conjunctivitis, Linear IgA disease (LAD), Lupus (SLE), Lyme disease, chronic, Meniere's disease, Microscopic polyangiitis, Mixed connective tissue disease (MOD), Mooren's ulcer, Mucha-Habermann disease, Multiple sclerosis, Myasthenia gravis. Myositis, Narcolepsy, Neuromyelitis optica (Devic's), Neutropenia, Ocular cicatricial pemphigoid, Optic neuritis, Palindromic rheumatism, PANDAS (Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcus), Paraneoplastic cerebellar degeneration, Paroxysmal nocturnal hemoglobinuria (PNH), Parry Romberg syndrome, Parsonnage-Turner syndrome, Pars planitis (peripheral uveitis). Pemphigus, Peripheral neuropathy, Perivenous encephalomyelitis, Pernicious anemia, POEMS syndrome, Polyarteritis nodosa, Type I, II, & III autoimmune polyglandular syndromes, Polymyalgia rheumatica, Polymyositis, Postmyocardial infarction syndrome, Postpericardiotomy syndrome, Progesterone dermatitis, Primary biliary cirrhosis, Primary sclerosing cholangitis, Psoriasis, Psoriatic arthritis, Idiopathic pulmonary fibrosis, Pyoderma gangrenosum, Pure red cell aplasia, Raynauds phenomenon, Reactive Arthritis, Reflex sympathetic dystrophy, Reiter's syndrome, Relapsing polychondritis, Restless legs syndrome, Retroperitoneal fibrosis, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Schmidt syndrome, Scleritis, Scleroderma, Sjogren's syndrome, Sperm & testicular autoimmunity, Stiff person syndrome, Subacute bacterial endocarditis (SBE), Susac's syndrome, Sympathetic ophthalmia, Takayasu's arteritis, Temporal arteritis/Giant cell arteritis, Thrombocy topenic purpura (TTP), Tolosa-Hurvt syndrome, Transverse myelitis, Ulcerative colitis, Undifferentiated connective tissue disease (UCTD), Uveitis, Vasculitis, Vesiculobullous dermatosis, Vitiligo, and Wegener's granulomatosis (now termed Granulomatosis with Polyangiitis (GPA).

    [0485] Various kidney diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the kidney disease Abderhalden-Kaufmann-Lignac syndrome (Nephropathic Cystmosis), Abdominal Compartment Syndrome, Acute Kidney Failure/Acute Kidney Injury, Acute Lobar Nephroma, Acute Phosphate Nephropathy, Acute Tubular Necrosis, Adenine Phosphoribosyltransferase Deficiency, Adenovirus Nephritis, Alport Syndrome, Amyloidosis, ANCA Vasculitis Related to Endocarditis and Other Infections, Angiomyolipoma, Analgesic Nephropathy, Anorexia Nervosa and Kidney Disease, Angiotensin Antibodies and Focal Segmental Glomerulosclerosis, Antiphospholipid Syndrome, Anti-TNF- Therapy-related Glomerulonephritis, APOL1 Mutations, Apparent Mineralocorticoid Excess Syndrome, Aristolochic Acid Nephropathy, Chinese Herbal Nephropathy, Balkan Endemic Nephropathy, Bartter Syndrome, Beeturia, -Thalassernia Renal Disease, Bile Cast Nephropathy, BK Polyoma Virus Nephropathy in the Native Kidney, Bladder Rupture, Bladder Sphincter Dyssynergia, Bladder Tamponade, Border-Crossers' Nephropathy, Bourbon Virus and Acute Kidney Injury, Burnt Sugarcane Harvesting and Acute Renal Dysfunction, Byetta and Renal Failure, Clq Nephropathy, Cannabinoid Hyperemesis Acute Renal Failure, Cardiorenal syndrome, Carfilzomib-Indiced Renal Injury, CFHR5 nephropathy, Charcot-Marie-Tooth Disease with Glomerulopathy, Cherry Concentrate and Acute Kidney Injury, Cholesterol Emboli, Churg-Strauss syndrome, Chyluria, Colistin Nephrotoxicity, Collagenofibrotic Glomerulopathy, Collapsing Glomerulopathy, Collapsing Glomerulopathy Related to CMV, (Congenital Nephrotic Syndrome, Conorenal syndrome (Mainzer-Saldino Syndrome or Saldino-Mainzer Disease), Contrast Nephropathy, Copper Sulpfate Intoxication, Cortical Necrosis, Crizotinib-related Acute Kidney injury, Cryogiobuinemia, Crystalglobulin-Induced Nephropathy, Crystal-Induced Acute Kidney injury, Cystic Kidney Disease, Acquired, Cystinuria, Dasatinib-Induced Nephrotic-Range Proteinuria, Dense Deposit Disease (MPGN Type 2), Dent Disease (X-linked Recessive Nephrolithiasis), Dialysis Disequilibrium Syndrome, Diabetes and Diabetic Kidney Disease, Diabetes Insipidus, Dietary Supplements and Renal Failure, Drugs of Abuse and Kidney Disease, Duplicated Ureter, EAST syndrome, Ebola and the Kidney, Ectopic Kidney, Ectopic Ureter, Edema, Swelling, Erdheim-Chester Disease, Fabry's Disease, Familial Hypocalciuric Hypercalcemia, Fanconi Syndrome. Fraser syndrome, Fibronectin Glomerulopathy, Fibrillary Glomerulonephritis and Immunotactoid Glomerulopathy, Fraley syndrome, Focal Segmental Glomerulosclerosis, Focal Sclerosis, Focal Glomerulosclerosis, Galloway Mowaf syndrome, Giant Cell (Temporal) Arteritis with Kidney Involvement, Gestational Hypertension, Gitelman Syndrome, Glomerular Diseases, Glomerular Tubular Reflux, Glycosuria, Goodpasture Syndrome, Hair Dye Ingestion and Acute Kidney Injury. Hantavirus Infection Podocytopaihy, Hernaturia (Blood in Urine), Hemolytic Uremic Syndrome (HUS), Atypical Hemolytic Uremic Syndrome (aHUS), Hemophagocytic Syndrome, Hemorrhagic Cystitis, Hemorrhagic Fever with Renal Syndrome (HFRS, Hantavirus Renal Disease, Korean Hemorrhagic Fever, Epidemic Hemorrhagic Fever, Nephropathis Epidemica), Hemosiderosis related to Paroxysmal Nocturnal Hemoglobinuria and Hemolytic Anemia, Hepatic Glomerulopathy, Hepatic Veno-Occlusive Disease, Sinusoidal Obstruction Syndrome, Hepatitis C-Associated Renal Disease, Hepatorenal Syndrome, Herbal Supplements and Kidney Disease, High Blood Pressure and Kidney Disease, HIV-Associated Nephropathy (HIVAN), Horseshoe Kidney (Renal Fusion), Hunner's Ulcer, Hyperaldosteronism, Hypercalcernia, Hyperkalemia, Hypermagnesemia, Hypernatrenna, Hyperoxaluria, Hyperphosphatemia, Hypocalcemia, Hypokalemia, Hypokalemia-induced renal dysfunction, Hypokalemic Periodic Paralysis, Hypomagnesemia, Hyponatremia, Hypophosphatemia, IgA Nephropathy, IgG4Nephropathy, Interstitial Cystitis, Painful Bladder Syndrome (Questionnaire), Interstitial Nephritis, Ivemark's syndrome. Ketamine-Associated Bladder Dysfunction, Kidney Stones, Nephrolithiasis, Kombucha Tea Toxicity, Lead Nephropathy and Lead-Related Nephrotoxicity, Leptospirosis Renal Disease, Light Chain Deposition Disease, Monoclonal Immunoglobulin Deposition Disease, Liddle Syndrome, Lightwood-Albright Syndrome, Lipoprotein Glomerulopathy, Lithium Nephrotoxicity, LMX1B Mutations Cause Hereditary FSGS, Loin Pain Hematuria, Lupus, Systemic Lupus Erythematosis, Lupus Kidney Disease, Lupus Nephritis, Lupus Nephritis with Antieutrophil Cytoplasmic Antibody Seropositivity, Lyme Disease-Associated Glomerulonephritis, Malarial Nephropathy, Malignancy-Associated Renal Disease, Malignant Hypertension, Malakoplakia, Meatal Stenosis, Medullary Cystic Kidney Disease, Medullary Sponge Kidney, Megaureter, Melamine Toxicity and the Kidney. Membranoproliferative Glomerulonephritis, Membranous Nephropathy, MesoAmerican Nephropathy, Metabolic Acidosis, Metabolic Alkalosis, Methotrexate-related Renal Failure, Microscopic Polyangiitis, Milk-alkalai syndrome, Minimal Change Disease, MDMA (Molly; Ecstacy; 3,4-Methylenedioxymethamphetamine) and Kidney Failure, Multicystic dysplastic kidney, Multiple Myeloma, Myeloproliferative Neoplasms and Glomerulopathy, Nail-patella Syndrome, Nephrocalcinosis, Nephrogenic Systemic Fibrosis, Nephroptosis (Floating Kidney, Renal Ptosis), Nephrotic Syndrome, Neurogenic Bladder, Nodular Glomerulosclerosis, Non-Gonococcal Urethritis, Nutcracker syndrome, Orofaciodigital Syndrome, Orotic Aciduria, Orthostatic Hypotension, Orthostatic Proteinuria, Osmotic Diuresis, Ovarian Hyperstimulation Syndrome, Page Kidney, Papillary Necrosis, Papiliorenal Syndrome (Renal-Coloboma Syndrome, Isolated Renal Hypoplasia), Parvovirus B19 and the Kidney, The Peritoneal-Renal Syndrome, Posterior Urethral Valve, Post-infectious Glomerulonephritis, Post-streptococcal Glomerulonephritis, Polyarteritis Nodosa, Polycystic Kidney Disease, Posterior Urethral Valves, Preeclampsia, Propofol infusion syndrome, Proliferative Glomerulonephritis with Monoclonal IgG Deposits (Nasr Disease), Propolis (Honeybee Resin) Related Renal Failure, Proteinuria (Protein in Urine), Pseudohyperaldosteronism, Pseudohypobicarbonatemia, Pseudohypoparathyroidism, Pulmonary-Renal Syndrome, Pyelonephritis (Kidney infection), Pyonephrosis, Radiation Nephropathy, Ranolazine and the Kidney. Refeeding syndrome, Reflux Nephropathy, Rapidly Progressive Glomerulonephritis, Renal Abscess, Peripnephric Abscess, Renal Agenesis, Renal Arcuate Vein Microthrombi-Associated Acute Kidney Injury, Renal Artery Aneurysm, Renal Artery Stenosis, Renal Cell Cancer, Renal Cyst, Renal Hypouricemia with Exercise-induced Acute Renal Failure, Renal Infarction, Renal Osteodystrophy, Renal Tubular Acidosis, Renin Secreting Tumors (Juxtaglomerular Cell Tumor), Reset Osmostat, Retrocaval Ureter, Retroperitoneal Fibrosis, Rhabdomyolysis, Rhabdomyolysis related to Bariatric Sugery, Rheumatoid Arthritis-Associated Renal Disease, Sarcoidosis Renal Disease, Salt Wasting, Renal and Cerebral, Schistosomiasis and Glomerular Disease, Schimke immuno-osseous dysplasia, Scleroderma Renal Crisis, Serpentine Fibula-Poly cystic Kidney Syndrome, Exner Syndrome, Sickle Cell Nephropathy, Silica Exposure and Chronic Kidney Disease, Sri Lankan Farmers' Kidney Disease, Sjgren's Syndrome and Renal Disease, Synthetic Cannabinoid Use and Acute Kidney Injury, Kidney Disease Following Hematopoietic Cell Transplantation, Kidney Disease Related to Stem Cell Transplantation, Thin Basement Membrane Disease, Benign Familial Hematuria, Trigonitis, Tuberculosis, Genitourinary, Tuberous Sclerosis, Tubular Dysgenesis, Immune Complex Tubulointerstitial Nephritis Due to Autoantibodies to the Proximal Tubule Brush Border, Tumor Lysis Syndrome, Uremia, Uremic Optic Neuropathy, Ureteritis Cystica, Ureterocele, Urethral Caruncle, Urethral Stricture, Urinary Incontinence, Urinary Tract Infection, Urinary Tract Obstruction, Vesicointestinal Fistula, Vesicoureteral Reflux, Volatile Anesthetics and Acute Kidney Injury, Von Hippel-Lindau Disease, Waldenstrom's Macroglobulmemic Glomerulonephritis, Warfarin-Related Nephropathy, Wasp Stings and Acute Kidney Injury, Wegener's Granulomatosis, Granulomatosis with Polyangiitis, West Nile Virus and Chronic Kidney Disease, and Wunderlich syndrome.

    [0486] Various cardiovascular diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the cardiovascular disease may be Ischemic heart disease also known as coronary artery disease, cerebrovascular disease (Stroke), Peripheral vascular disease, Heart failure, Rheumatic heart disease, and Congenital heart disease.

    [0487] Various antibody deficiencies may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the antibody deficiencies may be X-Lmked Agammaglobulinemia (XLA), Autosomal Recessive Agammaglobulinemia (ARA), Common Variable Immune Deficiency (CVID), IgG (IgG1, IgG2, IgG3 and IgG4) Subclass Deficiency, Selective IgA Deficiency, Specific Antibody Deficiency (SAD), Transient Hypogammaglobulinemia of Infancy, Antibody Deficiency with Normal or Elevated Immunoglobulins, Selective IgM Deficiency, Immunodeficiency with Thymoma (Good's Syndrome), Transcobalamin II Deficiency, Warts, Hypogammaglobulinemia, Infection, Myelokathexis (WHIM) Syndrome, Drug-Induced Antibody Deficiency, Kappa Chain Deficiency. Heavy Chain Deficiencies, Post-Meiotic Segregation (PMS2) Disorder, and Unspecified Hypogammaglobulinemia.

    [0488] Various ocular diseases may be treated with pharmaceutical compositions, i.e. AAV particles, of the present invention. As a non-limiting example, the ocular disease may be thyroid eye disease (TED), Graves' disease (GD) and orbitopathy, Retina Degeneration, Cataract, optic atrophy, macular degeneration, Leber congenital amaurosis, retinal degeneration, cone-rod dystrophy, Usher syndrome, leopard syndrome, photophobia, and photoaversion.

    [0489] Various neurological diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the neurological disease may be Absence of the Septum Pellucidum, Acid Lipase Disease, Acid Maltase Deficiency, Acquired Epileptiform Aphasia, Acute Disseminated Encephalomyelitis, Attention Deficit-Hyperactivity Disorder (ADHD), Adie's Pupil, Adie's Syndrome, Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Agnosia, Aicardi Syndrome, Aicardi-Goutieres Syndrome Disorder, AIDSNeurological Complications, Alexander Disease, Alpers' Disease, Alternating Hemiplegia, Alzheimer's Disease, Amyotrophic Lateral Sclerosis (ALS), Anencephaly, Aneurysm, Angelman Syndrome, Angiomatosis, Anoxia, Antiphospholipid Syndrome, Aphasia, Apraxia, Arachnoid Cysts, Arachnoiditis, Arnold-Chiari Malformation, Arteriovenous Malformation, Asperger Syndrome, Ataxia, Ataxia Telangiectasia, Ataxias and Cerebellar or Spinocerebellar Degeneration, Atrial Fibrillation and Stroke, Attention Deficit-Hyperactivity Disorder, Autism Spectrum Disorder, Autonomic Dysfunction, Back Pain, Barth Syndrome, Batten Disease, Becker's Myotonia, Behcet's Disease, Bell's Palsy, Benign Essential Blepharospasm, Benign Focal Amyotrophy, Benign Intracranial Hypertension, Bernhardt-Roth Syndrome, Binswanger's Disease, Blepharospasm, Bloch-Sulzberger Syndrome, Brachial Plexus Birth injuries, Brachial Plexus Injuries, Bradbury-Eggleston Syndrome, Brain and Spinal Tumors, Brain Aneurysm, Brain Injury, Brown-Sequard Syndrome, Bulbospinal Muscular Atrophy, Cerebral Autosomal Dominant Arteriopathy with Sub-cortical Infarcts and Leukoencephalopathy (CADASIL), Canavan Disease, Carpal Tunnel Syndrome, Causalgia, Cavenomas, Cavernous Angioma, Cavernous Malformation, Central Cervical Cord Syndrome, Central Cord Syndrome, Central Pain Syndrome, Central Pontine Myelinolysis, Cephalic Disorders, Ceramidase Deficiency, Cerebellar Degeneration, Cerebellar Hypoplasia, Cerebral Aneurysms, Cerebral Arteriosclerosis, Cerebral Atrophy, Cerebral Beriberi, Cerebral Cavernous Malformation, Cerebral Gigantism, Cerebral Hypoxia, Cerebral Palsy, Cerebro-Oculo-Facio-Skeletal Syndrome (COFS), Charcot-Mane-Tooth Disease, Chiari Malformation, Cholesterol Ester Storage Disease, (Chorea, Choreoacanthocytosis, Chronic Inflammatory Demyelinating Polyneuropathy (CIDP), Chronic Orthostatic Intolerance, Chronic Pain, Cockayne Syndrome Type II, Coffin Lowry Syndrome, Colpocephaly, Coma, Complex Regional Pain Syndrome, Congenital Facial Diplegia, Congenital Myasthenia, Congenital Myopathy, Congenital Vascular Cavernous Malformations, Corticobasal Degeneration, Cranial Arteritis, Craniosynostosis, Cree encephalitis, Creutzfeldt-Jakob Disease, Cumulative Trauma Disorders, Cushing's Syndrome, Cytomegalic Inclusion Body Disease, Cytomegalovirus Infection, Dancing Eyes-Dancing Feet Syndrome, Dandy-Walker Syndrome, Dawson Disease, De Morsier's Syndrome, Dejerine-Klumpke Palsy, Dementia, Dementia-Multi-Infarct, DementiaSemantic, DementiaSubcortical, Dementia With Lewy Bodies, Dentate Cerebellar Ataxia, Dentatorubral Atrophy, Dermatomyositis, Developmental Dyspraxia, Devic's Syndrome, Diabetic Neuropathy, Diffuse Sclerosis, Dravet Syndrome, Dysautonomia, Dysgraphia, Dyslexia, Dysphagia, Dyspraxia, Dyssvnergia Cerebellaris Myoclonica, Dyssvnergia Cerebellaris Progressiva, Dystonias, Early Infantile Epileptic Encephalopathy, Empty Sella Syndrome, Encephalitis, Encephalitis Lethargica, Encephaloceles, Encephalopathy, Encephalopathy (familial infantile), Encephalotrigeminal Angiomatosis, Epilepsy, Epileptic Hemiplegia, Erb's Palsy, Erb-Duchenne and Dejerine-Klumpke Palsies, Essential Tremor, Extrapontine Myelinoiysis, Fabry Disease, Fahr's Syndrome, Fainting, Familial Dysautonomia, Familial Hemangioma, Familial Idiopathic Basal Ganglia Calcification, Familial Periodic Paralyses, Familial Spastic Paralysis, Farber's Disease, Febrile Seizures, Fibromuscular Dysplasia, Fisher Syndrome, Floppy Infant Syndrome, Foot Drop, Friedreich's Ataxia, Frontotemporai Dementia, Gaucher Disease, Generalized Gangliosidoses, Gerstmann's Syndrome, Gerstmann-Straussler-Scheinker Disease, Giant Axonal Neuropathy, Giant Cell Arteritis, Giant Cell Inclusion Disease, Globoid Cell Leukodystrophy, Glossopharyngeal Neuralgia, Glycogen Storage Disease, Guiliain-Barr Syndrome, Hallervorden-Spatz Disease, Head Injury, Headache, Hemicrania Continua, Hemifacial Spasm, Hemiplegia Alterans, Hereditary Neuropathies, Hereditary Spastic Paraplegia, Heredopatlua Atactica Polyneuritiformis, Herpes Zoster, Herpes Zoster Oticus, Hirayama Syndrome. Holmes-Adie syndrome, Holoprosencephaly, HTLV-1 Associated Myelopathy, Hughes Syndrome, Huntington's Disease, Hydranencephaly, Hydrocephalus, HydrocephalusNormal Pressure, Hydromyelia, Hypercortisolism, Hypersomnia, Hypertonia, Hypotonia, Hypoxia, Immune-Mediated Encephalomyelitis, Inclusion Body Myositis, incontinentia Pigmenti, Infantile Hypotonia, Infantile Neuroaxonal Dystrophy, Infantile Phytanic Acid Storage Disease, Infantile Refsurn Disease, Infantile Spasms, Inflammatory Myopathies, Iniencephaly, Intestinal Lipodystrophy, Intracranial Cysts, Intracranial Hypertension, Isaacs' Syndrome, Joubert Syndrome, Kearns-Sayre Syndrome, Kennedy's Disease, Kinsbourae syndrome, Kleine-Levin Syndrome, Klippel-Feil Syndrome, Klippel-Trenaunay Syndrome (KTS), Kluver-Bucy Syndrome, Korsakoff's Amnesic Syndrome, Krabbe Disease, Kugelberg-Weiander Disease, Kuru, Lambert-Eaton Myasthenic Syndrome, Landau-Kleffher Syndrome, Lateral Femoral Cutaneous Nerve Entrapment, Lateral Medullary Syndrome, Learning Disabilities, Leigh's Disease, Lennox-Gastaut Syndrome, Lesch-Nyhan Syndrome, Leukodystrophy, Levine-Critchley Syndrome, Lewy Body Dementia, Lipid Storage Diseases, Lipoid Proteinosis, Lissencephaly, Locked-In Syndrome, Lou Gehrig's Disease, LupusNeurological Sequelae, Lyme DiseaseNeurological Complications, Machado-Joseph Disease, Macrencephaly, Megalencephaly, Melkersson-Rosenthal Syndrome, Meningitis, Meningitis and Encephalitis, Menkes Disease, Meralgia Paresthetica, Metachromatic Leukodystrophy, Microcephaly, Migraine, Miller Fisher Syndrome, Mini Stroke, Mitochondrial Myopathy, Moebius Syndrome, Monomelic Amyotrophy, Motor Neuron Diseases, Moyamoya Disease, Mucolipidoses, Mucopolysaccharidoses, Multi-Infarct Dementia, Multifocal Motor Neuropathy, Multiple Sclerosis, Multiple System Atrophy, Multiple System Atrophy with Orthostatic Hypotension, Muscular Dystrophy, MyastheniaCongenital, Myasthenia Gravis, Myeiinoclastic Diffuse Sclerosis, Myoclonic Encephalopathy of Infants, Myoclonus, Myopathy, MyopathyCongenital, MyopathyThyrotoxic, Myotonia, Myotonia Congenita, Narcolepsy, Neuroacanthocytosis, Neurodegeneration with Brain Iron Accumulation, Neurofibromatosis, Neuroleptic Malignant Syndrome, Neurological Complications of AIDS, Neurological Complications of Lyme Disease, Neurological Consequences of Cytomegalovirus Infection, Neurological Manifestations of Pompe Disease, Neurological Sequelae Of Lupus, Neuromyelitis Optica, Neuromyotoma, Neuronal Ceroid Lipofuscinosis, Neuronal Migration Disorders, NeuropathyHereditary, Neurosarcoidosis, Neurosyphilis, Neurotoxicity, Nevus Cavemosus, Niemann-Pick Disease, O'Sullivan-McLeod Syndrome, Occipital Neuralgia, Ohtahara Syndrome, Olivopontocerebellar Atrophy, Opsoclonus Myoclonus, Orthostatic Hypotension, Overuse Syndrome, PainChronic, Pantothenate Kinase-Associated Neurodegeneration, Paraneoplastic Syndromes, Paresthesia, Parkinson's Disease, Paroxysmal Choreoathetosis, Paroxysmal Hemicrania, Parry-Romberg, Pelizaeus-Merzbacher Disease, Pena Shokeir II Syndrome, Perineural Cysts, Periodic Paralyses, Peripheral Neuropathy, Periventricular Leukomalacia, Persistent Vegetative State, Pervasive Developmental Disorders, Phytanic Acid Storage Disease, Pick's Disease, Pinched Nerve, Piriformis Syndrome, Pituitary Tumors, Polymyositis, Pompe Disease, Porencephaly, Post-Polio Syndrome, Postherpetic Neuralgia, Postinfectious Encephalomyelitis, Postural Hypotension, Postural Orthostatic Tachycardia Syndrome, Postural Tachycardia Syndrome, Primary Dentatum Atrophy, Primary Lateral Sclerosis, Primary Progressive Aphasia, Prion Diseases, Progressive Hemifacial Atrophy, Progressive Locomotor Ataxia, Progressive Multifocal Leukoencephalopathy, Progressive Sclerosing Poliodystrophy, Progressive Supranuclear Palsy, Prosopagnosia, Pseudo-Torch syndrome, Pseudotoxoplasmosis syndrome, Pseudotumor Cerebri, Psychogenic Movement, Ramsay Hunt Syndrome I, Ramsay Hunt Syndrome II, Rasraussen's Encephalitis, Reflex Sympathetic Dystrophy Syndrome, Refsum Disease, Refsum DiseaseInfantile, Repetitive Motion Disorders, Repetitive Stress Injuries, Restless Legs Syndrome, Retrovirus-Associated Myelopathy, Rett Syndrome, Reye's Syndrome, Rheumatic Encephalitis, Riley-Day Syndrome, Sacral Nerve Root Cysts, Saint Vitus Dance, Salivary Gland Disease, Sandhoff Disease, Schilder's Disease, Schizencephaly, Seiteiberger Disease, Seizure Disorder, Semantic Dementia, Septo-Optic Dysplasia, Severe Myoclonic Epilepsy of Infancy (SME1), Shaken Baby Syndrome, Shingles, Shy-Drager Syndrome, Sjgren's Syndrome, Sleep Apnea, Sleeping Sickness, Solos Syndrome, Spasticity, Spina Bifida, Spinal Cord infarction, Spinal Cord Injury, Spinal Cord Tumors, Spinal Muscular Atrophy, Spinocerebellar Atrophy, Spinocerebellar Degeneration, Steele-Richardson-Olszewski Syndrome, Stiff-Person Syndrome, Striatonigral Degeneration, Stroke, Sturge-Weber Syndrome, Subacute Sclerosing Panencephalitis, Subcortical Arteriosclerotic Encephalopathy, Short-lasting, Unilateral, Neuralgiform (SUNCT) Headache, Swallowing Disorders, Sydenham Chorea, Syncope, Syphilitic Spinal Sclerosis, Syringohydromyelia, Syringomyelia, Systemic Lupus Erythematosus, Tabes Dorsalis, Tardive Dyskinesia, Tarlov Cysts, Tay-Sachs Disease, Temporal Arteritis, Tethered Spinal Cord Syndrome, Thomson's Myotonia, Thoracic Outlet Syndrome, Thyrotoxic Myopathy, Tic Douloureux, Todd's Paralysis, Tourette Syndrome, Transient Ischemic Attack, Transmissible Spongiform Encephalopathies, Transverse Myelitis, Traumatic Brain Injury, Tremor, Trigeminal Neuralgia, Tropical Spastic Paraparesis, Troyer Syndrome, Tuberous Sclerosis, Vascular Erectile Tumor, Vasculitis Syndromes of the Central and Peripheral Nervous Systems, Von Economo's Disease, Von Hippel-Lindau Disease (VHL), Von Recklinghausen's Disease, Wallenberg's Syndrome, Werdnig-Hoffman Disease, Wernicke-Korsakoff Syndrome, West Syndrome, Whiplash, Whipple's Disease, Williams Syndrome, Wilson Disease, Wolman's Disease, X-Lmked Spinal, and Bulbar Muscular Atrophy,

    [0490] Various psychological disorders may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the psychological disorders may be Abouha, Absence epilepsy, Acute stress Disorder, Adjustment Disorders, Adverse effects of medication NOS, Age related cognitive decline, Agoraphobia, Alcohol Addiction, Alzheimer's Disease, Amnesia (also known as Amnestic Disorder), Amphetamine Addiction, Anorexia Nervosa, Anterograde amnesia, Antisocial personality disorder (also known as Sociopathy), Anxiety Disorder (Also known as Generalized Anxiety Disorder), Anxiolytic related disorders, Asperger's Syndrome (now part of Autism Spectrum Disorder), Attention Deficit Disorder (Also known as ADD), Attention Deficit Hyperactivity Disorder (Also known as ADHD), Autism Spectrum Disorder (also known as Autism), Autophagia Avoidant Personality Disorder, Barbiturate related disorders, Benzodiazepine related disorders, Bereavement, Bibliomania, Binge Eating Disorder, Bipolar disorder (also known as Manic Depression, includes Bipolar I and Bipolar II), Body Dysmorphic Disorder, Borderline intellectual functioning, Borderline Personality Disorder, Breathing-Related Sleep Disorder, Brief Psychotic Disorder, Bruxism, Bulimia Nervosa, Caffeine Addiction, Cannabis Addiction, Catatonic disorder, Catatonic schizophrenia, Childhood amnesia, Childhood Disintegrative Disorder (now part of Autism Spectrum Disorder), Childhood Onset Fluency Disorder (formerly known as Stuttering), Orcadian Rhythm Disorders, Claustrophobia, Cocaine related disorders, Communication disorder, Conduct Disorder, Conversion Disorder, Cotard delusion, Cyclothymia (also known as Cyclothymic Disorder), Delerium, Delusional Disorder, dementia, Dependent Personality Disorder (also known, as Asthenic Personality Disorder), Depersonalization disorder (now known as Depersonalization/Derealization Disorder), Depression (also known as Major Depressive Disorder), Depressive personality disorder, Derealization disorder (now known as Depersonalization/Derealization Disorder), Dermotillomania, Desynchronosis, Developmental coordination disorder, Diogenes Syndrome, Disorder of written expression, Dispareunia, Dissocial Personality Disorder, Dissociative Amnesia, Dissociative Fugue, Dissociative Identity Disorder (formerly known as Multiple Personality Disorder), Down syndrome, Dyslexia, Dyspareunia, Dysthymia (now known as Persistent Depressive Disorder), Eating disorder NOS, Ekbom's Syndrome (Delusional Parasitosis), Emotionally unstable personality disorder, Encopresis, Enuresis (bedwetting), Erotomania, Exhibitionistic Disorder, Expressive language disorder, Factitious Disorder, Female Sexual Disorders, Fetishistic Disorder, Folie deux, Fregoli delusion, Frotteuristic Disorder, Fugue State, Ganser syndrome, Gambling Addiction, Gender Dysphoria (formerly known as Gender Identity Disorder), Generalized Anxiety Disorder, General adaptation syndrome, Grandiose delusions. Hallucinogen Addiction, Haltlose personality disorder, Histrionic Personality Disorder, Primary hypersomnia, Huntington's Disease, Hypoactive sexual desire disorder, Hypochondriasis, Hypomania, Hyperkinetic syndrome, Hypersomnia, Hysteria, Impulse control disorder, Impulse control disorder NOS, Inhalant Addiction, Insomnia, Intellectual Development Disorder, Intermittent Explosive Disorder, Joubert syndrome, Kleptomania, Korsakoff's syndrome, Lacunar amnesia, Language Disorder, Learning Disorders, Major Depression (also known as Major Depressive Disorder), major depressive disorder, Male Sexual Disorders, Malingering, Mathematics disorder, Medication-related disorder, Melancholia, Mental Retardation (now known as Intellectual Development Disorder), Misophobia, Morbid jealousy, Multiple Personality Disorder (now known as Dissociative Identity Disorder), Munchausen Syndrome, Munchausen by Proxy, Narcissistic Personality Disorder, Narcolepsy, Neglect of child, Neurocognitive Disorder (formerly known as Dementia), Neuroleptic-related disorder, Nightmare Disorder, Non Rapid Eye Movement, Obsessive-Compulsive Disorder, Obsessive-Compulsive Personality Disorder (also known as Anankastic Personality Disorder), Oneirophrenia, Onychophagia, Opioid Addiction, Oppositional Defiant Disorder, Orthorexia (ON), Pain disorder, Panic attacks, Panic Disorder, Paranoid Personality Disorder, Parkinson's Disease, Partner relational problem, Passive-aggressive personality disorder, Pathological gambling, Pedoplnlic Disorder, Perfectionism, Persecutory delusion, Persistent Depressive Disorder (also known as Dysthymia), Personality change due to a general medical condition, Personality disorder, Pervasive developmental disorder (PDD), Phencyclidine related disorder, Phobic disorder, Phonological disorder, Physical abuse, Pica, Polysubstance related disorder, Postpartum Depression, Post-traumatic embitterment disorder (PTED), Post Traumatic Stress Disorder, Premature ejaculation, Premenstrual Dysphoric Disorder, Psychogenic amnesia, Psychological factor affecting medical condition, Psychoneurotic personality disorder, Psychotic disorder, not otherwise specified, Pyromania, Reactive Attachment Disorder, Reading disorder, Recurrent brief depression, Relational disorder, REM: Sleep Behavior Disorder, Restless Leg Syndrome, Retrograde amnesia, Retts Disorder (now part of Autism Spectrum Disorder), Rumination syndrome, Sadistic personality disorder, Schizoaffective Disorder, Schizoid Personality Disorder, Schizophrenia, Schizophreniform disorder, Schizotypal Personality Disorder, Seasonal Affective Disorder, Sedative, Hypnotic, or Anxiolytic Addiction, Selective Mutism, Self-defeating personality disorder, Separation Anxiety Disorder, Sexual Disorders Female, Sexual Disorders Male, Sexual Addiction, Sexual Masochism Disorder, Sexual Sadism Disorder, Shared Psychotic Disorder, Sleep Arousal Disorders, Sleep Paralysis, Sleep Terror Disorder (now part of Nightmare Disorder, Social Anxiety Disorder, Somatization Disorder, Specific Phobias, Stendhal syndrome, Stereotypic movement disorder, Stimulant Addiction, Stuttering (now known as Childhood Onset Fluency Disorder), Substance related disorder, Tardive dyskinesia, Tobacco Addiction, Tourettes Syndrome, Transient tic disorder, Transient global amnesia. Transvestic Disorder, Trichotillomania, Undifferentiated Somatoform Disorder, Vaginismus, and Voyeuristic Disorder.

    [0491] Various lung diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the lung diseases may be Asbestosis, Asthma, Bronchiectasis, Bronchitis, Chronic Cough, Chronic Obstructive Pulmonary Disease (COPD), Croup, Cystic Fibrosis, Hantavirus, Idiopathic Pulmonary Fibrosis, Pertussis, Pleurisy, Pneumonia, Pulmonary Embolism, Pulmonary Hypertension, Sarcoidosis, Sleep Apnea, Spirometry, Sudden Infant Death Syndrome (SIDS), Tuberculosis, Alagille Syndrome, Autoimmune Hepatitis, Biliary Atresia, Cirrhosis, ERCP (Endoscopic Retrograde Cholangiopancreatography), and Hemochromatosis, Nonalcoholic Steatohepatitis, Porphyria, Primary Biliary Cirrhosis, Primary Sclerosing Cholangitis.

    [0492] Various bone diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the bone diseases may be osteoporosis, neurofibromatosis, osteogenesis imperfecta (O1), rickets, osteosarcoma, achondroplasia, fracture, osteomyelitis, Ewing tumour of bone, osteomalacia, hip dysplasia, Paget disease of bone, marble bone disease, osteochondroma, bone cancer, bone disease, osteochondrosis, osteoma, fibrous dysplasia, cleidocranial dysostosis, osteoclastoma, bone cyst, metabolic bone disease, melorheostosis, callus, Caffey syndrome, and mandibulofacial dysostosis.

    [0493] Various blood diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the blood diseases may be Anemia and CKD (for health care professionals), Aplastic Anemia and Myelodysplastic Syndromes, Deep Vein Thrombosis, Hemochromatosis, Hemophilia, Henoch-Schnlein Purpura, Idiopathic Thrombocytopenic Purpura, Iron-Deficiency Anemia, Pernicious Anemia, Pulmonary Embolism, Sickle Cell Anemia, Sickle Cell Trait and Other Hemoglobinopathies, Thalassemia, Thrombotic Thrombocytopenic Purpura, and Von Willebrand Disease.

    [0494] Various diseases associated with TNF-alpha may be treated with the pharmaceutical compositions. AAV particles, of the present invention. As a non-limiting example, the disease may be respiratory disorder; asthma; allergic and nonallergic asthma; asthma due to infection; asthma due to infection with respiratory syncytial virus (RSV); chronic obstructive pulmonary disease (COPD); a condition involving airway inflammation; eosinophilia; fibrosis and excess mucus production; cystic fibrosis; pulmonary fibrosis; an atopic disorder; atopic dermatitis; urticaria; eczema; allergic rhinitis; allergic enterogastritis; an inflammatory and/or autoimmune condition of the skin; an inflammatory and/or autoimmune condition of gastrointestinal organs; inflammatory bowel diseases (IBD); ulcerative colitis, Crohn's disease; an inflammatory and/or autoimmune condition of the liver; liver cirrhosis; liver fibrosis; liver fibrosis caused by hepatitis B and/or C virus; scleroderma; tumors or cancers; hepatocellular carcinoma; glioblastoma; lymphoma; Hodgkin's lymphoma; a viral infection; a bacterial infection; a parasitic infection; HTLV-1 infection; suppression of expression of protective type 1 immune responses, and suppression of expression of a protective type 1 immune response during vaccination, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, septic arthritis, Lyme arthritis, psoriatic arthritis, reactive arthritis, spondyloarthropathy, systemic lupus erythematosus, (Crohn's disease, ulcerative colitis, inflammatory bowel disease, insulin dependent diabetes mellitus, thyroiditis, asthma, allergic diseases, psoriasis, dermatitis scleroderma, graft versus host disease, organ transplant rejection, acute or chronic immune disease associated with organ transplantation, sarcoidosis, atherosclerosis, disseminated intravascular coagulation, Kawasaki's disease, Grave's disease, nephrotic syndrome, chronic fatigue syndrome, Wegener's granulomatosis, Henoch-Schoenlein purpurea, microscopic vasculitis of the kidneys, chronic active hepatitis, uveitis, septic shock, toxic shock syndrome, sepsis syndrome, cachexia, infectious diseases, parasitic diseases, acquired immunodeficiency syndrome, acute transverse myelitis, Huntington's chorea, Parkinson's disease, Alzheimer's disease, stroke, primary biliary cirrhosis, hemolytic anemia, malignancies, heart failure, myocardial infarction, Addison's disease, sporadic, polyglandular deficiency type I and polyglandular deficiency type II, Schmidt's syndrome, adult (acute) respiratory distress syndrome, alopecia, alopecia greata, seronegative arthropathy, arthropathy, Reiter's disease, psoriatic arthropathy, ulcerative colitic arthropathy, enteropathy synovitis, chlamydia, yersinia and salmonella associated arthropathy, spondyloarthropathy, atheromatous disease/arteriosclerosis, atopic allergy, autoimmune bullous disease, pemphigus vulgaris, pemphigus foliaceus, pemphigoid, linear IgA disease, autoimmune haemolytic anaemia, Coombs positive haemolytic anaemia, acquired pernicious anaemia, juvenile pernicious anaemia, myalgic encephalitis/Royal Free Disease, chronic mucocutaneous candidiasis, giant cell arteritis, primary sclerosing hepatitis, cryptogenic autoimmune hepatitis. Acquired Immunodeficiency Disease Syndrome, Acquired Immunodeficiency Related Diseases, hepatitis B, hepatitis C, common varied immunodeficiency (common variable hypogammaglobulinaemia), dilated cardiomyopathy, female infertility, ovarian failure, premature ovarian failure, flbrotic lung disease, cryptogenic fibrosing alveolitis, post-inflammatory interstitial lung disease, interstitial pneumonitis, connective tissue disease associated interstitial lung disease, mixed connective tissue disease associated lung disease, systemic sclerosis associated interstitial lung disease, rheumatoid arthritis associated interstitial lung disease, systemic lupus eiythematosus associated lung disease, dermatoray ositis/polyrayositis associated lung disease, Sjgren's disease associated lung disease, ankylosing spondylitis associated lung disease, vasculitic diffuse lung disease, haernosiderosis associated lung disease, drug-induced interstitial lung disease, fibrosis, radiation fibrosis, bronchiolitis obliterans, chronic eosinophilic pneumonia, lymphocytic infiltrative lung disease, postinfectious interstitial lung disease, gouty arthritis, autoimmune hepatitis, type-1 autoimmune hepatitis (classical autoimmune or lupoid hepatitis), type-2 autoimmune hepatitis (anti-LKM antibody hepatitis), autoimmune mediated hypoglycaemia, type B insulin resistance with acanthosis nigricans, hypoparathyroidism, acute immune disease associated with organ transplantation, chronic immune disease associated with organ transplantation, osteoarthrosis, primary sclerosing cholangitis, psoriasis type 1, psoriasis type 2, idiopathic leucopaenia, autoimmune neutropaema, renal disease NOS, glomerulonephritides, microscopic vasculitis of the kidneys, Lyme disease, discoid lupus erythematosus, male infertility idiopathic or NOS, sperm autoimmunity, multiple sclerosis (all subtypes), sympathetic ophthalmia, pulmonary hypertension secondary to connective tissue disease, Goodpasture's syndrome, pulmonary manifestation of polyarteritis nodosa, acute rheumatic fever, rheumatoid spondylitis, Still's disease, systemic sclerosis, Sjrgren's syndrome, Takayasu's disease/arteritis, autoimmune thrombocytopaenia, idiopathic thrombocytopaenia, autoimmune thyroid disease, hyperthyroidism, goitrous autoimmune hypothyroidism (Hashimoto's disease), atrophic autoimmune hypothyroidism, primary myxoedema, phacogenic uveitis, primary vasculitis, vitiligo acute liver disease, chronic liver diseases, alcoholic cirrhosis, alcohol-induced liver injury, choleostasis, idiosyncratic liver disease, drug-Induced hepatitis, non-alcoholic steatohepatitis, allergy and asthma, group B streptococci (GBS) infection, mental disorders (e.g., depression and schizophrenia), Th2 Type and Th1 Type mediated diseases, acute and chronic pain (different forms of pain), and cancers such as lung, breast, stomach, bladder, colon, pancreas, ovarian, prostate and rectal cancer and hematopoietic malignancies (leukemia and lymphoma) abetalipoproteinemia, acrocyanosis, acute and chronic parasitic or infectious processes, acute leukemia, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute or chronic bacterial infection, acute pancreatitis, acute renal failure, adenocarcinomas, aerial ectopic beats, AIDS dementia complex, alcohol-induced hepatitis, allergic conjunctivitis, allergic contact dermatitis, allergic rhinitis, allograft rejection, alpha-1-antitrypsin deficiency, amyotrophic lateral sclerosis, anemia, angina pectoris, anterior horn cell degeneration, anti-CD3 therapy, antiphospholipid syndrome, anti-receptor hypersensitivity reactions, aortic and peripheral aneurysms, aortic dissection, arterial hypertension, arteriosclerosis, arteriovenous fistula, ataxia, atrial fibrillation (sustained or paroxysmal), atrial flutter, atrioventricular block, B cell lymphoma, bone graft rejection, bone marrow transplant (BMT) rejection, bundle branch block, Burkitt's lymphoma, burns, cardiac arrhythmias, cardiac stun syndrome, cardiac tumors, cardiomyopathy, cardiopulmonary bypass inflammation response, cartilage transplant rejection, cerebellar cortical degenerations, cerebellar disorders, chaotic or multifocal atrial tachycardia, chemotherapy associated disorders, chronic myelocytic leukemia (CML), chronic alcoholism, chronic inflammatory pathologies, chronic lymphocytic leukemia (CLL), chronic obstructive pulmonary disease (COPD), chronic salicylate intoxication, colorectal carcinoma, congestive heart failure, conjunctivitis, contact dermatitis, corpulmonale, coronary artery disease, Creutzfeldt-Jakob disease, culture negative sepsis, cystic fibrosis, cytokine therapy associated disorders, dementia pugilistica, demyelinating diseases, dengue hemorrhagic fever, dermatitis, dermatologic conditions, diabetes, diabetes mellitus, diabetic arteriosclerotic disease, Diffuse Lewy body disease, dilated congestive cardiomyopathy, disorders of the basal ganglia, Down's Syndrome in middle age, drug-induced movement disorders induced by drugs which block CNS dopamine receptors, drug sensitivity, eczema, encephalomyelitis, endocarditis, endocrinopathy, epiglottitis, Epstein-Barr virus infection, erythromelalgia, extrapyramidal and cerebellar disorders, familial hemophagocytic lymphohistiocytosis, fetal thymus implant rejection, Friedreich's ataxia, functional peripheral arterial disorders, fungal sepsis, gas gangrene, gastric ulcer, glomerular nephritis, graft rejection of any organ or tissue, gram negative sepsis, gram positive sepsis, granulomas due to intracellular organisms, hairy cell leukemia, Hallervorden-Spatz disease, Hashimoto's thyroiditis, hay fever, heart transplant rejection, hemochromatosis, hemodialysis, hemolytic uremic syndrome/thrombolytic thrombocytopenic purpura, hemorrhage, hepatitis (A), His bundle arrhythmias, HIV infection/HIV neuropathy, Hodgkin's disease, hyperkinetic movement disorders, hypersensitivity reactions, hypersensitivity pneumonitis, hypertension, hypokinetic movement disorders, hypothalamic-pituitary-adrenal axis evaluation, idiopathic Addison's disease, idiopathic pulmonary fibrosis, antibody mediated cytotoxicity, asthenia, infantile spinal muscular atrophy, inflammation of the aorta, influenza a, ionizing radiation exposure, iridocyclitis/uveitis/optic neuritis, ischemia-reperfusion injury, ischemic stroke, juvenile rheumatoid arthritis (JRA), juvenile spinal muscular atrophy, Kaposi's sarcoma, kidney transplant rejection, legionella, leishmaniasis, leprosy, lesions of the corticospinal system, lipedema, liver transplant rejection, lymphedema, malaria, malignant lymphoma, malignant histiocytosis, malignant melanoma, meningitis, meningococcemia, metabolic/idiopathic, migraine headache, mitochondrial multi-system disorder, mixed connective tissue disease, monoclonal gammopathy, multiple myeloma, multiple systems degenerations (Menzel, Dejerine-Thomas, Shy-Drager, and Machado-Joseph), myasthenia gravis, mycobacterium avium intracellulare, mycobacterium tuberculosis,myelodysplastic syndrome, myocardial infarction, myocardial ischemic disorders, nasopharyngeal carcinoma, neonatal chronic lung disease, nephritis, nephrosis, neurodegenerative diseases, neurogenic I muscular atrophies, neutropenic fever, non-Hodgkins lymphoma, occlusion of the abdominal aorta and its branches, occlusive arterial disorders, OKT3 therapy, orchitis/epidydimitis, orchitis/vasectomy reversal procedures, organomegaly, osteoporosis, pancreas transplant rejection, pancreatic carcinoma, paraneoplastic syndrome/hypercalcemia of malignancy, parathyroid transplant resection, pelvic inflammatory disease, perennial rhinitis, pericardial disease, peripheral atherosclerotic disease, peripheral vascular disorders, peritonitis, pernicious anemia, pneumocystis carinii pneumonia pneumonia, POEMS syndrome (polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy, and skin changes syndrome), post perfusion syndrome, post pump syndrome, post-MI cardiotomy syndrome, preeclampsia, progressive supranucleo palsy, primary pulmonary hypertension, radiation therapy, Raynaud's phenomenon and disease, Raynaud's disease, Refsum's disease, regular narrow QRS tachycardia, renovascular hypertension, reperfusion injury, restrictive cardiomyopathy, sarcomas, scleroderma, senile chorea, senile dementia of Lewy body type, seronegative arthropathies, shock, sickle cell anemia, skin allograft rejection, skin changes syndrome, small bowel transplant rejection, solid tumors, specific arrhythmias, spinal ataxia, spinocerebellar degenerations, streptococcal myositis, structural lesions of the cerebellum, subacute sclerosing panencephalitis, syncope, syphilis of the cardiovascular system, systemic anaphylaxis, systemic inflammatory response syndrome, systemic onset juvenile rheumatoid arthritis, T-cell or FAB ALL, telangiectasia, thrornboangitis obliterans, thrombocytopenia, toxicity, transplants, trauma/hemorrhage, type III hypersensitivity reactions, type IV hypersensitivity, unstable angina, uremia, urosepsis, urticaria, valvular heart diseases, varicose veins, vasculitis, venous diseases, venous thrombosis, ventricular fibrillation, viral and fungal infections, viral encephalitis/aseptic meningitis, viral-associated hemophagocytic syndrome, Wernicke-Korsakoff syndrome. Wilson's disease, xenograft rejection of any organ or tissue, acute coronary syndromes, acute idiopathic polyneuritis, acute inflammatory demyelinating polyradiculoneuropathy, acute ischemia, adult Still's disease, alopecia greata, anaphylaxis, anti-phospholipid antibody syndrome, aplastic anemia, arteriosclerosis, atopic eczema, atopic dermatitis, autoimmune dermatitis, autoimmune disorder associated with streptococcus infection, autoimmune enteropathy, autoimmune hearing loss, autoimmune lymphoproliferative syndrome (ALPS), autoimmune myocarditis, autoimmune premature ovarian failure, blepharitis, bronchiectasis, bullous pemphigoid, cardiovascular disease, catastrophic antiphospholipid syndrome, celiac disease, cervical spondylosis, chronic ischemia, cicatricial pemphigoid, clinically isolated syndrome (CIS) with risk for multiple sclerosis, conjunctivitis, childhood onset psychiatric disorder, chronic obstructive pulmonary disease (COPE), dacryocystitis, dermatomyositis, diabetic retinopathy, diabetes mellitus, disk herniation, disk prolapse, drug induced immune hemolytic anemia, endocarditis, endometriosis, endophthalmitis, episcleritis, erythema multiforme, erythema multiforme major, gestational pemphigoid, Guillam-Barre syndrome (GBS), hay fever, Hughes syndrome, idiopathic Parkinson's disease, idiopathic interstitial pneumonia, IgE-mediated allergy, immune hemolytic anemia, inclusion body myositis, infectious ocular inflammatory disease, inflammatory demyelinating disease, inflammatory heart disease, inflammatory kidney disease, IPF/UIP, iritis, keratitis, keratojunctivitis sicca, Kussmaul disease or Kussmaul-Meier disease, Landry's paralysis, Langerhan's cell histiocytosis, livedo reticularis, macular degeneration, microscopic polyangiitis, morbus bechterev, motor neuron disorders, mucous membrane pemphigoid, multiple organ failure, myasthenia gravis, myelodysplastic syndrome, myocarditis, nerve root disorders, neuropathy, non-A non-B hepatitis, optic neuritis, osteolysis, ovarian cancer, pauciarticular JRA, peripheral artery occlusive disease (PAOD), peripheral vascular disease (PVD), peripheral artery disease (PAD), phlebitis, polyarteritis nodosa (or periarteritis nodosa), polychondritis, polymyalgia rheumatica, poliosis, polyarticular JRA, polyendocrine deficiency syndrome, polymyositis, polymyalgia rheumatica (PMR), post-pump syndrome, primary Parkinsonism, prostate and rectal cancer and hematopoietic malignancies (leukemia and lymphoma), prostatitis, pure red cell aplasia, primary adrenal insufficiency, recurrent neuromyelitis optica, restenosis, rheumatic heart disease, sapho (synovitis, acne, pustulosis, hyperostosis, and osteitis), scleroderma, secondary amyloidosis, shock lung, scleritis, sciatica, secondary adrenal insufficiency, silicone associated connective tissue disease, Sneddon-Wilkinson dermatosis, spondylitis ankylosans, Stevens-Johnson syndrome (SJS), systemic inflammatory response syndrome, temporal arteritis, toxoplasmic retinitis, toxic epidermal necrolysis, transverse myelitis, TRAPS (tumor necrosis factor receptor associated periodic syndrome), type 1 allergic reaction, type II diabetes, urticaria, usual interstitial pneumonia (UIP), vasculitis, vernal conjunctivitis, viral retinitis, Vogt-Koyanagi-Harada syndrome (VKH syndrome), wet macular degeneration, wound healing, yersinia, or salmonella associated arthropathy.

    [0495] Various receptor for advanced glycation endproducts (RAGE) diseases may be treated with the pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the disease may be Amytropic Lateral Sclerosis, Brachial Plexus Injury, Brain Injury, including traumatic brain injury, Cerebral Palsy, Friedrich's Ataxia, Guillain Barre, Leukodystrophies, Multiple Sclerosis, Post Polio, Spina Bifida, Spinal Cord Injury, Spinal Muscle Atrophy, Spinal Tumors, Stroke, Transverse Myelitits, dementia, senile dementia, mild cognitive impairment, Alzheimer-related dementia, Huntington's chorea, tardive dyskinesia, hyperkinesias, manias, Morbus Parkinson, steel-Richard syndrome, Down's syndrome, myasthenia gravis, nerve trauma, vascular amyloidosis, cerebral hemorrhage I with amyloidosis, bram inflammation, Friedrich's ataxia, acute confusion disorder, amyotrophic lateral sclerosis, glaucoma. Alzheimer's disease, diabetic nephropathy, sepsis, rheumatoid arthritis and related inflammatory diseases.

    [0496] Various neurite degenerative diseases may be treated with the pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the disease may be multiple sclerosis, Parkinson's disease, Alzheimer's disease, Tay-Sachs disease, Niemann-Pick disease, Gaucher's disease, Hurler's syndrome, Huntington's disease, amyotrophic lateral sclerosis, idiopathic inflammatory demyelinating diseases, vitamin B12 deficiency, central pontine myelinolysis, tabes dorsalis, transverse myelitis, Devic's disease, progressive multifocal leukoencephalopathy, optic neuritis, traumatic injury to the CNS, an ischemic cerebral stroke, glaucoma, diabetic retinopathy, age-dependent macular degeneration, and a leukodystrophy.

    [0497] Various neurological diseases may be treated with the pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the disease may be Amyotrophic Lateral Sclerosis, Brachial Plexus Injury, Bram Injury, including traumatic brain injury, Cerebral Palsy, Guillain Barre, Leukodystrophies, Multiple Sclerosis, Post Polio, Spina Bifida, Spinal Cord Injury, Spinal Muscle Atrophy, Spinal Tumors, Stroke, Transverse Myelitis; dementia, senile dementia, mild cognitive impairment, Alzheimer-related dementia, Huntington's chorea, tardive dyskinesia, hyperkinesias, manias, Morbus Parkinson, steel-Richard syndrome, Down's syndrome, myasthenia gravis, nerve trauma, vascular amyloidosis, cerebral hemorrhage I with amyloidosis, brain inflammation, acute confusion disorder, amyotrophic lateral sclerosis, glaucoma and Alzheimer's disease.

    [0498] Various cancers may be treated with pharmaceutical compositions, AAV particles, of the present invention. As used herein, the term cancer refers to any of various malignant neoplasms characterized by the proliferation of anaplastic cells that tend to invade surrounding tissue and metastasize to new body sites and also refers to the pathological condition characterized by such malignant neoplastic growths. Cancers may be tumors or hematological malignancies, and include but are not limited to, all types of lymphomas/leukemias, carcinomas and sarcomas, such as those cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon/rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovaries, pancreas, penis, prostate, skin, small intestine, stomach, spinal marrow, tail bone, testicles, thyroid and uterus.

    [0499] Types of carcinomas which may be treated with the AAV particles of the present invention include, but are not limited to, papilioma/carcinoma, choriocarcinoma, endodermal sinus tumor, teratoma, adenoma/adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma, rhabdomyoma, mesothelioma, angioma, osteoma, chondroma, glioma, lymphoma/leukemia, squamous cell carcinoma, small cell carcinoma, large cell undifferentiated carcinomas, basal cell carcinoma and sinonasal undifferentiated carcinoma.

    [0500] Types of sarcomas which may be treated with the AAV particles of the present invention include, but are not limited to soft tissue sarcoma such as alveolar soft part sarcoma, angiosarcoma, dermatofibrosarcoma, desmoid tumor, desmoplastic small round cell tumor, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, hemangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, synovial sarcoma, and Asian's tumor, Ewing's sarcoma (primitive neuroectodermal tumor), malignant hemangioendothelioma, malignant schwannoma, osteosarcoma, and chondrosarcoma.

    [0501] As a non-limiting example, the cancer which may be treated may be Acute granulocytic leukemia, Acute lymphocytic leukemia, Acute myelogenous leukemia, Adenocarcinoma, Adenosarcoma, Adrenal cancer. Adrenocortical carcinoma, Anal cancer, Anaplastic astrocytoma, Angiosarcoma, Appendix cancer, Astrocytoma, Basal cell carcinoma, B-Cell lymphoma), Bile duct cancer, Bladder cancer, Bone cancer, Bowel cancer, Brain cancer, Brain stem glioma, Brain tumor, Breast cancer, Carcinoid tumors, Cervical cancer, Cholangiocarcinoma, Chondrosarcoma, Chronic lymphocytic leukemia, Chronic myelogenous leukemia, Colon cancer, Colorectal cancer, Craniopharyngioma, Cutaneous lymphoma, Cutaneous melanoma, Diffuse astrocytoma, Ductal carcinoma in situ, Endometrial cancer, Ependymoma, Epithelioid sarcoma, Esophageal cancer, Ewing sarcoma, Extrahepatic bile duct cancer, Eye cancer, Fallopian tube cancer, Fibrosarcoma, Gallbladder cancer, Gastric cancer, Gastrointestinal cancer, Gastrointestinal carcinoid cancer, Gastrointestinal stromal tumors, General, Germ cell tumor, Glioblastoma multiforme, Glioma, Hairy cell leukemia, Head and neck cancer, Hemangioendothelioma, Hodgkin lymphoma, Hodgkin's disease, Hodgkin's lymphoma, Hypopharyngeal cancer, Infiltrating ductal carcinoma, Infiltrating lobular carcinoma, Inflammatory breast cancer, Intestinal Cancer, Intrahepatic bile duct cancer, Invasive/infiltrating breast cancer, Islet cell cancer, Jaw cancer, Kaposi sarcoma, Kidney cancer, Laryngeal cancer, Leiomyosarcoma, Leptomeningeal metastases, Leukemia, Lip cancer, Liposarcoma, Liver cancer, Lobular carcinoma in situ, Low-grade astrocytoma, Lung cancer, Lymph node cancer, Lymphoma, Male breast cancer, Medullary carcinoma, Medullohlastoma, Melanoma, Meningioma, Merkel cell carcinoma, Mesenchymal chondrosarcoma, Mesenchymous, Mesothelioma, Metastatic breast cancer, Metastatic melanoma, Metastatic squamous neck cancer, Mixed gliomas, Mouth cancer, Mucinous carcinoma, Mucosal melanoma, Multiple myeloma, Nasal cavity cancer, Nasopharyngeal cancer, Neck cancer, Neuroblastoma, Neuroendocrine tumors, Non-Hodgkm lymphoma, Non-Hodgkin's lymphoma, Non-small cell lung cancer, Oat cell cancer, Ocular cancer, Ocular melanoma, Oligodendroglioma, Oral cancer, Oral cavity cancer, Oropharyngeal cancer, Osteogenic sarcoma, Osteosarcoma, Ovarian cancer, Ovarian epithelial cancer, Ovarian germ cell tumor, Ovarian primary peritoneal carcinoma, Ovarian sex cord stromal tumor, Paget's disease, Pancreatic cancer, Papillary carcinoma, Paranasal sinus cancer, Parathyroid cancer, Pelvic cancer, Penile cancer, Peripheral nerve cancer, Peritoneal cancer, Pharyngeal cancer, Pheochromocytoma, Pilocytic astrocytoma, Pineal region tumor, Pineoblastoma, Pituitary gland cancer, Primary central nervous system lymphoma, Prostate cancer, Rectal cancer, Renal cell cancer, Renal pelvis cancer, Rhabdomyosarcoma, Salivary gland cancer, Sarcoma, Sarcoma, bone, Sarcoma, soft tissue, Sarcoma, uterine, Sinus cancer, Skin cancer, Small cell lung cancer, Small intestine cancer, Soft tissue sarcoma, Spinal cancer, Spinal column cancer, Spinal cord cancer, Spinal tumor, Squamous cell carcinoma, Stomach cancer, Synovial sarcoma, T-cell lymphoma), Testicular cancer, Throat cancer, Thymoma/thymic carcinoma, Thyroid cancer, Tongue cancer, Tonsil cancer, Transitional cell cancer, Transitional cell cancer, Transitional cell cancer, Triple-negative breast cancer, Tubal cancer, Tubular carcinoma, Ureteral cancer, Ureteral cancer. Urethral cancer, Uterine adenocarcinoma, Uterine cancer, Uterine sarcoma, Vaginal cancer, and Vulvar cancer.

    Diagnostic Applications

    [0502] The AAV particles of the present invention may be used for diagnostic purposes or as diagnostic tools for any of the aforementioned diseases or disorders. As non-limiting examples, the AAV particles of the present invention or the antibodies encoded within the viral genome therein may be used as a biomarker for disease diagnosis. As a second non-limiting example, the AAV particles of the present invention or the antibodies encoded within the viral genome therein may be used for diagnostic imaging purposes, e.g., MRI, PET, CT or ultrasound.

    [0503] Preventative Applications

    [0504] The AAV particles of the present invention or the antibodies encoded by the viral genome therein may be used to prevent disease or stabilize the progression of disease. In one embodiment, the AAV particles of the present invention are used to as a prophylactic to prevent a disease or disorder in the future. In one embodiment, the AAV particles of the present invention are used to halt further progression of a disease or disorder. As a non-limiting example, the AAV particles of the invention may be used in a manner similar to that of a vaccine.

    Research Applications

    [0505] The AAV particles of the present invention or the antibodies encoded by the viral genome therein may also be used as research tools. The AAV particles of the invention may be used as in any research experiment, e.g., in vivo or in vitro experiments. In a non-limiting example, the AAV particles of the invention may be used in cultured cells. The cultured cells may be derived from any origin known to one with skill in the art, and may be as non-limiting examples, derived from a stable cell line, an animal model or a human patient or control subject. In a non-limiting example, the AAV particles of the invention may be used in in vivo experiments in animal models (i.e., mouse, rat, rabbit, dog, cat, non-human primate, guinea pig, ferret c-elegans, drosophila, zebrafish, or any other animal used for research purposes, known in the art). In another non-limiting example, the AAV particles of the invention may be used in human research experiments or human clinical trials.

    Combination Applications

    [0506] The AAV particles of the invention may be used as a combination therapy with any other therapeutic molecule known in the art. The therapeutic molecule may be approved by the US Food and Drug Administration or may be in clinical trial or at the preclinical research stage. The therapeutic molecule may utilize any therapeutic modality known in the art, with non-limiting examples including gene silencing or interference (i.e., miRNA, siRNA, RNAi, shRNA), gene editing (i.e., TALEN, CRISPR/Cas9 systems, zinc finger nucleases), and gene, protein or enzyme replacement.

    Therapeutic Applications

    [0507] The present disclosure additionally provides a method for treating neurological diseases and/or disorders in a mammalian subject, including a human subject, comprising administering to the subject any of the AAV particles of the invention. In some cases, neurological diseases and/or disorders treated according to methods described herein include indications involving irregular expression or aggregation of tau. Such indications may include, but are not limited to Alzheimer's disease (AD), frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), Frontotemporal lobar degeneration (FTLD), chronic traumatic encephalopathy (CTE), Progressive Supranuclear Palsy (PSP), Down's syndrome, Pick's disease, Corticobasai degeneration (CBD), Amyotrophic lateral sclerosis (ALS), Prion diseases, Creutzfeldt-Jakob disease (CJD), Multiple system atrophy, Tangle-only dementia, and Progressive subcortical gliosis.

    [0508] In some embodiments, methods of treating neurological diseases and/or disorders in a subject in need thereof may comprise the steps of: (1) deriving, generating and/or selecting an anti-tau antibody, antibody-based composition or fragment thereof; (2) producing an AAV particle with a viral genome that includes a payload region encoding the selected antibody of (1); and (3) administering the AAV particle (or pharmaceutical composition thereof) to the subject.

    [0509] The present disclosure provides a method for administering to a subject in need thereof, including a human subject, a therapeutically effective amount of the AAV particles of the invention to slow, stop or reverse disease progression. As a non-limiting example, disease progression may be measured by cognitive tests such as, but not limited to, the Mini-Mental State Exam (MMSE) or other similar diagnostic tool(s), known to those skilled in the art. As another non-limiting example, disease progression may be measured by change in the pathological features of the brain, CSF or other tissues of the subject, such as, but not limited to a decrease in levels of tau (either soluble or insoluble). In one embodiment levels of insoluble hyperphosphorylated tau are decreased. In one embodiment levels of soluble tau are decreased. In one embodiment both soluble and insoluble tau are decreased. In. one embodiment, levels of insoluble hyperphosphorylated tau are increased. In one embodiment levels of soluble tau are increased. In one embodiment both insoluble and soluble tau levels are increased. In one embodiment, neurofibrillary tangles are decreased in size, number, density, or combination thereof. In another embodiment, neurofibrillary tangles are increased in size, number, density or combination thereof.

    Alzheimer's Disease

    [0510] Alzheimer Disease (AD) is a debilitating neurodegenerative disease currently afflicting more than 35 million people worldwide, with that number expected to double in coming decades. Symptomatic treatments have been available for many years but these treatments do not address the underlying pathophysiology. Recent clinical trials using these and other treatments have largely failed and, to date, no known cure has been identified.

    [0511] The AD brain is characterized by the presence of two forms of pathological aggregates, the extracellular plaques composed of -amyloid (A) and the intracellular neurofibrillary tangles (NFT) composed of hyperphosphorylated microtubule associated protein tau. Based on early genetic findings, -amyloid alterations were thought to initiate disease, with changes in tau considered downstream. Thus, most clinical trials have been A-centric. Although no mutations of the tau gene have been linked to AD, such alterations have been shown to result in a family of dementias known as tauopathies, demonstrating that changes in tau can contribute to neurodegenerative processes. Tau is normally a very soluble protein known to associate with microtubules based on the extent of its phosphorylation. Hyperphosphorylation of tau depresses its binding to microtubules and microtubule assembly activity. In tauopathies, the tau becomes hyperphosphorylated, misfolds and aggregates as NFT of paired helical filaments (PHF), twisted ribbons or straight filaments. In AD, NFT pathology, rather than plaque pathology, correlates more closely with neuropathological markers such as neuronal loss, synaptic deficits, severity of disease and cognitive decline. NFT pathology marches through the brain in a stereotyped manner and animal studies suggest a trans-cellular propagation mechanism along neuronal connections.

    [0512] Several approaches have been proposed for therapeutically interfering with progression of tau pathology and preventing the subsequent molecular and cellular consequences. Given that NFT are composed of a hyperphosphorylated, misfolded and aggregated form of tau, interference at each of these stages has yielded the most avidly pursued set of targets. Introducing agents that limit phosphorylation, block misfolding or prevent aggregation have all generated promising results. Passive and active immunization with late stage anti-phospho-tau antibodies in mouse models have led to dramatic decreases in tau aggregation and improvements in cognitive parameters. It has also been suggested that introduction of anti-tau antibodies can prevent the trans-neuronal spread of tau pathology.

    [0513] The vectored antibody delivery (VAD) of tau disease associated antibodies of the present invention may be used to treat subjects suffering from AD and other tauopathies. In some cases, methods of the present invention may be used to treat subjects suspected of developing AD or other tauopathies.

    Frontotemporal Dementia ami Parkinsonism Linked to Chromosome 17 (FTDP-17)

    [0514] Although Alzheimer's disease is, in part, characterized by the presence of tau pathology, no known mutations in the tau gene have been causally linked to the disease. Mutations in the tau gene have been shown to lead to an autosomal dominantly inherited tauopathy known as frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17) and demonstrate that alterations in tau can lead to neurodegenerative changes in the brain. Mutations in the tau gene that lead to FTDP-17 are thought to influence splicing patterns. thereby leading to an elevated proportion of tau with four microtubule binding domains (rather than three). These molecules are considered to be more arayloidogenic, meaning they are more likely to become hyperphosphorylated and more likely to aggregate into NFT (Button, M. et al., 1998, Nature 393(6686):702-5). Although physically and behaviorally, FTDP-17 patients can appear quite similar to Alzheimer's disease patients, at autopsy FTDP-17 brains lack the prominent A plaque pathology of an AD brain (Gotz, J. et al. 2012, British Journal of Pharmacology 165(5):1246-59). Therapeutically targeting the aggregates of tau protein may ameliorate and prevent degenerative changes in the brain and potentially lead to improved cognitive ability.

    [0515] As of today, there is no treatment to prevent, slow the progression, or cure FTD. Medication may be prescribed to reduce aggressive, agitated or dangerous behavior. There remains a need for therapy affecting the underlying pathophysiology, such as antibody therapies targeting tau protein.

    [0516] In some embodiments, the vectored antibody delivery of the present invention may be used to treat subjects suffering from FTDP-17. In some cases, methods of the present invention may be used to treat subjects suspected of developing FTDP-17.

    Chronic Traumatic Encephalopathy

    [0517] Unlike the genetically linked tauopathies, chronic traumatic encephalopathy is a degenerative tauopathy linked to repeated head injuries. The disease was first described in boxers whom behaved punch drunk and has since been identified primarily in athletes that play American football, ice hockey, wrestling and other contact sports. The brains of those suffering from CTE are characterized by distinctive patterns of brain atrophy accompanied by accumulation of hyperphosphorylated species of aggregated tau in NFT. In CTE, pathological changes in tau are accompanied by a number of other pathobiological processes, such as inflammation (Daneshvar, D. H. et al., 2015 Mol Cell Neurosci 66(Pt B): 81-90). Targeting the tau aggregates may provide reprieve from the progression of the disease and may allow cognitive improvement.

    [0518] As of today, there is no medical therapy to treat or cure CTE. The condition is only diagnosed after death, due to lack of in vivo techniques to identify CTE specific biomarkers. There remains a need for therapy affecting the underlying pathophysiology, such as antibody therapies targeting tau protein.

    [0519] In some embodiments, the vectored antibody deliver/methods of the present invention may be used to treat subjects suffering from CTE. In some cases, methods of the present invention may be used to treat, subjects suspected of developing CTE.

    Prion Diseases

    [0520] Prion diseases, also known as transmissible spongiform encephalopathies (TSEs), are a group of rare progressive conditions affecting the nervous system. The related conditions are rare and are typically caused by mutations in the PRNP gene which enables production of the prion protein. Gene mutations lead to an abnormally structured prion protein. Alternatively, the abnormal prion may be acquired by exposure from an outside source, e.g. by consumption of beef products containing the abnormal prion protein. Abnormal prions are misfolded, causing the brain tissue to degenerate rapidly. Prion diseases include, but are not limited to, Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), fatal insomnia (FFI), variably protease-sensitive prionopathy (VPSPr), and kuru. Prion diseases are rare. Approximately 350 cases of prion diseases are diagnosed in the US annually.

    [0521] CJD is a degenerative brain disorder characterized by problems with muscular coordination, personality changes including mental impairment, impaired vision, involuntary muscle jerks, weakness and eventually coma. The most common categories of CJD are sporadic, hereditary due to a genetic mutation, and acquired. Sporadic CJD is the most common form affecting people with no known risk factors for the disease. The acquired form of CJD is transmitted by exposure of the brain and nervous system tissue to the prion. As an example, variant CJD (vCDJ) is linked to a bovine spongiform encephalopathy (BSE), also known as a mad cow disease. CJD is fatal and patients typically die within one year of diagnosis.

    [0522] Prion diseases are associated with an infectious agent consisting of an alternative conformational isoform of the prion protein, PrPSc. PrPSc replication is considered to occur through an induction of the infectious prion in the normal prion protein (PrP(C). The replication occurs without a nucleic acid.

    [0523] As of today, there is no therapy to manage or cure CJD, or other prion diseases. Typically, treatment is aimed at alleviating symptoms and increasing comfortabiiity of the patient, e.g. with pain relievers. There remains a need for therapy affecting the underlying pathophysiology, such as antibody therapies targeting the prion protein.

    [0524] In some embodiments, vectored antibody delivery methods of the present invention may be used to treat subjects suffering from a prion disease. In some cases, methods of the present invention may be used to treat subjects suspected of developing a prion disease.

    Neurodegeneration and Stroke

    [0525] Neurodegenerative diseases and other diseases of the nervous system share many common features. Neurodegenerative diseases, in particular, are a group of conditions characterized by progressive loss of neuronal structure and function, ultimately leading to neuronal cell death. Neurons are the building blocks of the nervous system(s) and are generally not able to reproduce and/or be replaced, and therefore neuron damage and/or death is especially devastating. Other, non-degenerating diseases that lead to neuronal cell loss, such as stroke, have similarly debilitating outcomes. Targeting molecules that contribute to the deteriorating cell structure or function may prove beneficial generally for treatment of nervous system diseases, neurodegenerative disease and/or stroke.

    [0526] Certain molecules are believed to have inhibitory effects on neurite outgrowth, contributing to the limited ability of the central nervous system to repair. Such molecules include, but are not limited to, myelin associated proteins, such as, but not limited to, RGM (Repulsive guidance molecule), NOGO (Neurite outgrowth inhibitor), NOGO receptor, MAG (myelin associated glycoprotein), and MAI (myelin associated inhibitor). In one embodiment, the vectored antibody delivery of the present invention is utilized to target the aforementioned antigens (e.g., neurite outgrowth inhibitors).

    [0527] Many neurodegenerative diseases are associated with aggregation of misfolded proteins, including, but not limited to, alpha synuclein, tau, amyloid , prion proteins, TDP-43, and huntingtin (see. e.g. De Genst et al. 2014, Biochim Biophys Acta;1844(11):1907-1919, and Yu et al, 2013, Neurotherapeutics.; 10(3): 459-472, references therein). The aggregation results from disease-specific conversion of soluble proteins to an insoluble, highly ordered fibrillary deposit. This conversion is thought to prevent the proper disposal or degradation of the misfolded protein, thereby leading to further aggregation. Conditions associated with alpha synuclein and tau may be referred to as synucleinopathi.es and tauopathies, respectively. In one embodiment, the vectored antibody delivery of the present invention is utilized to target the aforementioned antigens (e.g., misfolded or aggregated proteins).

    Other Therapeutic Targets

    [0528] The AAV particles or pharmaceutical compositions of the present invention useful in preventing or treating tauopathies or tau-associated diseases may alternatively, or in combination, encode an antibody that does not bind to the tau protein (e.g., the antigen is a polypeptide other than tau). Non-limiting examples of other target antigens include any of the following, including fragments or variants thereof, -synuclein (monomers, oligomers, aggregates, fragments), ABCA1 (ATP-binding cassette, sub-family A, member 1), ABCA4 (ATP-binding cassette, sub-family A, member 4), ABCB1 (ATP-binding cassette, sub-family B, member 1), ACE (angiotensin I converting enzyme), ACKR1 (atypical chemokine receptor 1 (Duffy blood group)), AMPA (DL--amino-3-hydroxy-5-methyl-4-isoxazole propionic acid), ACTH (Adrenocorticotropic Hormone), ACVR2A (Activin receptor type-2A), ACVR2B (Activin receptor type-2B), ADDL (Adducin-Like Protein 70), ADORA2A (adenosine A2a receptor), ADRA2A (adrenoceptor alpha 2A), ATFM1 (apoptosis-inducing factor), AKT1 (RAC-alpha serine/threnine-protein kinase), ALK-1 (activin receptor-like kinase 1), Alpha beta fibril, alpha subunit (basic helix-loop-helix transcription factor), AMT (Aminomethyltransferase), Amyloid (monomers, oligomers, aggregates, fragments), amyloid or amyloid-like proteins, ANGPTL3 (Angiopoietin-Like 3), ANGTP1 (angiopoitin 1), ANGTP2 (angiopoietin 2), ANK3 (ankyrin 3), ANKG (ankyrin G), Annexin IV, phospholipid, Anx-A1 (annexin A1), APOE (apolipoprotein E), APP (amyloid beta precursor protein), ARSD (Arylsulfatase D), ATM (Ataxia Telangiectasia Mutated serine/threonine kinase), ATXN1 (ataxin 1), ATXN2 (ataxin 2), ATXN3 (ataxin 3), ATXN7 (ataxin 7), B Lymphocyte Stimulator, BDNF (brain-derived neurotrophic factor), beta A4 peptide/Alpha beta 4, beta A4 peptide, Alpha beta 5, bAlpha beta 6, Alpha beta 7, Alpha beta 8, Alpha beta 9, Beta-secretases (BACE), BRAF (B-Raf Proto-Oncogene, Serine/Threonine Kinase), Properdin (factor P), Factors Ba and Bb, C1, C1q (complement component 1, subcomponent q), C2, C3, C4, C3a, C3b, C5, C5a, C5b, C6, C7, C8, C9 and C5b-9 (complement components), CAIX (Carbonic anhydrase IX), CA 125 (cancer antigen 1.25), CACNA1A (calcium channel voltage-dependent P/Q type alpha 1A subunit), cadherins, CA-IX (carbonic anhydrase 9), CALCA (calcitonin-related polypeptide alpha), CCKBR (cholecystokinin B receptor), CCL11 (eotaxin-1), CCL2 (Chemokine (C-C Motif) Ligand 2), CD11 (integrin alpha component), CD 147 (basigin), CD154 (CD40L), CD 19 (Cluster of Differentiation 19), CD2 (cluster of differentiation 2), CD20 (B-lymphocyte antigen), CD200 (cluster of differentiation 200). CD22 (cluster of differentiation 22), CD221 (insulin-like growth factor 1 (IGF-1) receptor), CD248 (Endosialin), CD26 (Dipeptidyl peptidase-4), CD27 (antigen precursor), CD274 (cluster of differentiation 274), CD28 (Cluster of Differentiation 28), CD29 (Integrin, Beta 1), CD33 (cluster of differentiation 33), CD30 (cluster of differentiation 30), CD31 (cluster of differentiation 31), CD33 (cluster of differentiation 33), CD37 (Leukocyte antigen), CD38 (cyclic ADP ribose hydrolase), CD3E (T-Cell Surface Antigen T3/Leu-4 Epsilon Cham), CD4 (T-Cell Surface Antigen T4/Leu-3), CD40 (CD40 Molecule, TNF Receptor Superfamily Member 5), CD41 (Integrin, Alpha 2b (Platelet Glycoprotein IIb Of IIb/IIIa Complex, Antigen CD41)), CD44 (cluster of differentiation 44), CD51 (integrin alpha 1), CD52 (Human Epididymis-Specrfic Protein 5), CD55 (Decay Accelerating Factor For Complement (Cromer Blood Group)), CD58 (lymphocyte function-associated antigen 3), CD59 (MAC-inhibitory protein), CD6 (cluster of differentiation 6), CD70 (cluster of differentiation 70, ligand for CD27), CD74 (HLA class II histocompatibility aiitigen gamma chain), CD79B (immunoglobulin-associated beta), CEA (Carcinoembryonic antigen), CFHR1 (Complement Factor H-Related 1), CGRP (Calcitonin gene-related peptide), CFMP2B (charged multivesicular body protein 2B), CHRNA4 (cholinergic receptor nicotinic alpha 4 (neuronal)). CHRNB2 (cholinergic receptor nicotinic beta 2 (neuronal)), CISD2 (CDGSH iron sulfur domain 2), CLEC16A (C-type lectin domain family 16 member A), CLRN1 (clarin 1), CNR1 (cannabinoid receptor 1), CNTNAP2 (contactin associated protein-like 2), COMT (eatechol-O-methyltransferase), CRB1 (crumbs family member 1, photoreceptor morphogenesis associated), CRX (cone-rod homeobox), CRY (crystallin), CSF1R (Colony Stimulating Factor 1 Receptor), CSF2 (Colony Stimulating Factor 2 (Granulocyte-Macrophage)), CSF2RA (Colony Stimulating Factor 2 Receptor, Alpha, Low-Affinity). CTGF (Connective Tissue Growth Factor). CTLA4 (Cytotoxic T-Lymphocyte-Associated Protein 4), CXC (chemokine receptor type 4), CXCL.10 (Chemokine (C-X-C Motif) Ligand 10), DDC (dopa decarboxylase (aromatic L-amino acid decarboxylase)), DIABLO (IAP-Binding Mitochondrial Protein), differentiation factor 8 (GDF8), DISC1 (disrupted in schizophrenia 1), DLL3 (Delta-Like 3 (Drosophila)j, DLL4 (Delta-Like 4 (Drosophila)), DPP4 (dipeptyl-peptidase 4), DPP6 (dipeptidyl-peptidase 6), DR6 (Death receptor 6), DRD1 (dopamine receptor D1), DRD2 (dopamine receptor D2), DRD4 (dopamine receptor D4), DRD5 (dopamine receptor 5), DRD5 (dopamine receptor D5), DTNBP1 (dystrobrevin binding protein 1), EAG1 (Ether-A-Go-Go Potassium Channel 1). EDB (fibronectin extra domain-B), EDNRA (endothelin receptor type A), EFNA1 (Ephrin-A1), EGFL7 (EGF-Like-Domain, Multiple 7), EGFR/ERBB1/HER1 (epidermal growth factor receptor 1), EN2 (Engrailed Homeobox 2), EPCAM (Epithelial cell adhesion molecule). EPHA3 (EPH Receptor A3), episialin (a carcinoma-associated mucin, MUC-1), ERBB2 (epidermal growth factor receptor 2), ERBB3 (epidermal growth factor receptor 3), ESR1 (estrogen receptor 1), F3 (coagulation factor III), F9 (human factor 9), F10 (human factor 10), FAAH (fatty acid amide hydrolase), Factor D C3 proactivator convertase), humanized IgGl, humanized IgG2, FAP (Fibroblast Activation Protein, Alpha), FBN2 (fibrillin 2), FBP (Folate-binding protein), FcRIIB (Fc receptor gamma B), FcRIIIA (Fc receptor gamma A), FLT1 (Fms-Related Tyrosine Kinase 1), FOLR1 (folate receptor alpha), Frizzled receptor, FXN (frataxin), FUS/TLS (RNA binding protein), G protein-coupled, GAA (glucosidase alpha acid), Gc-globulin (Vitamin D binding protein), Gangliosides, GD2 (ganglioside G2), GD3 (ganglioside g3), GM2 (monosialotetrfihexosylganglioside 2) (GDF-8 (myostatin), GDNF (glial cell derived neurotrophic factor), GDNF (glial cell derived neurotrophic factor), GFAP (glial fibrillary acidic protein), GFR3 (GDNF family receptor alpha-3), ghrelin, GIT1 (G protein-coupled receptor kinase interacting ArfGAP 1), GJA (Gap junction protein), GLDC Glycine Dehydrogenase (Decarboxylating), glycoprotein NMB (GPNMB), gpA33 (Glycoprotein A33 (Transmembrane)). GPC3 (glypican 3), GRIN2B (glutamate receptor ionotropic N-methyl D-aspartate 2B). GRN (granulin), GDF8 (growth differentiation factor 8), GTPases (guanosine triphosphate), GSTP1 (glutathione S-transferase pi 1), GUCA1A (guanylate cyclase activator 1A (retina), GUCY2C (anti-GCC), HMCN1 (hemicentin 1), HGF (Hepatocyte Growth Factor), HIF1A (hypoxia inducible factor 1, HINT1 (histidine triad nucleotide binding protein 1), HIST3H3 (Histone H3), histone, HLA-DQB1 (major histocompatibility complex class II DQ beta 1), HLA-DR (MHC class II cell surface receptor), HLA-DRB; (major histocompatibility complex class II DR beta 1), hNav1.7 (sodium ion channel), HTR1A (5-hydroxytryptamine (serotonin) receptor 1A G protein-coupled), HTR2A (5-hydroxytryptamine (serotonin) receptor 2A, HTR2A (5-hydroxytryptamine (serotonin) receptor 2A G protein-coupled), HIT (huntingtin), 1AP-binding mitochondrial protein, IFNAR1 (Interferon (Alpha, Beta And Omega) Receptor 1), IFNB1(interferon beta 1 fibroblast), IFN- (Interferon gamma), IGF-1 receptor, IGF1R (insulin-like growth factor 1 receptor), IGF-1 (insulin-like growth factor 1), IGG1 (immunoglobulin subclass 1), IgG2 (immunoglobulin subclass 2), lgG4 (immunoglobulin subclass 4), 1GHE (Immunoglobulin Heavy Constant Epsilon), IL 1B (interleukin 1 beta), IL12 (interleukin 12), IL12B (interleukin 12B), IL13 (interleukin 13), IL17A (interleukin 17A), IL17F (interleukin 17F), IL1A (interleukin 1 A), IL1B (interleukin 1 beta), IL1-Ri (Interleukin 1 receptor, type 1), IL20 (Interleukin 20), IL23A (interleukin 23A), IL-23p19 subunit (interleukin 23 subunit p19), IL2RA (interleukin 2 receptor alpha), IL4R (interleukin 4 receptor alpha, IL6 (inteleukin 6), IL6R (interleukin 6 receptor), IL7R (interleukin 7 receptor), ILGF2 (insulin like growth factor 2), INS (insulin), Integrin 51, Integrin V3, integrin IIp3/GPIIb/IIIa, IP6K2 (inositol hexakisphosphate kinase 2), ITGA4 (Integrin, Alpha 4 (Antigen CD49D, Alpha 4 Subunit Of VLA-4 Receptor)), ITGB7 (Integrin, Alpha 7 (Antigen CD49D, Alpha 4 Subunit Of VLA-7 Receptor)), ITGAL (integrin alpha L chain), ITGAV ((Vitronectin Receptor, Alpha Polypeptide, Antigen CD51), ITGB3 (Integrin alpha-V/beta-3), KCNQ2 (potassium channel voltage gated KQT-like subfamily Q member 2), KDR (Kinase Insert Domain Receptor), KIR2D (killer immunoglobulin-like receptor (KIR) 2D subtype), KLRC 1 (Killer Cell Lectin-Like Receptor Subfamily C, Member 1), LAG-3 (Lymphocyte-activation gene 3), Le (y) (Lewis y) antigen, LINGO (Leucine rich repeat and Immunoglobin-like domain-containing protein 1), LOXL2 (Lysyl oxidase homolog 2), LPG (lysophosphatidylglucoside), LPS (Lipopolysaccharides), LRP1 (low density lipoprotein receptor-related protein 1), I.RRC6 (Leucine Rich Repeat Containing 6), LRRK2 (leucine-rich repeat kinase 2), LTA (Lymphotoxin Alpha), MAF (maf avian musculoaponeurotic fibrosarcoma oncogene homolog), MAG (Myelin Associated Glycoprotein), MAI (myelin associated inhibitor), MAOB (monoamine oxidase B), MAPT (microtubule-associated protein tau), MBP (myelin basic protein), MCAF (monocyte chemotactic and activating factor), MCP-1 (Monocyte chemoattractant protein-1), MBL (mannose binding lectin), mannose, MET (Tyrosine-Protein Kinase Met), MIF (Macrophage Migration Inhibitor Factor (Glycosylation-Iiihibitmg Factor), MS4A1 (Membrane-Spanning 4-Domains, Subfamily A, Member 1), MSLN (Mesothelin), MST1R (Macrophage Stimulating 1 Receptor), MSTN (mayostatin), MUC1/Episialin, MUC5AC (Mucin 5 AC, Oligomeric Mueus/Gel-Forming), mucin CanAg (glycoform MUC-1), Mucins, myostatin, myostatin antagonists, N-acetyl glucosamine, NCAM1 (Neural Cell Adhesion Molecule 1), Neu5Gc/NGNA (Neurogenin A), neuregulin (NRG), neurokinin B, NGF (Nerve growth factor), NMDA (N-methyl-D-aspartate), NOGO (Neurite outgrowth inhibitor), NOGO receptor-1, Nogo-66, NOGOA/NiG (Neurite Outgrowth Inhibitory Fragments of NOGOA), Notch receptor, NOTCH-1 (Notch homolog 1, translocation-associated (Drosophila)), NRG1 (neuregulin 1), NRP1 (Neuropilin 1), NT-3 trkC ligand, N-terminal region of A8-x peptide, OGG1 (8-oxoguanine DNA glycosylase), oligomers of N-terminal truncated A, OPA2 (Optic Atrophy 2), OPA3 (Optic Atrophy 3), oxLDL (Oxidized low-density lipoprotein), P75 (Low-affinity Nerve Growth Factor Receptor), PAND1 9Panic disorder 1), PAND2 (Panic disorder 2), PAND3 9Panic disorder 3), PARK2 (parkin RBR E3 ubiquitin protein ligase). PCSK9 (proprotein convertase subtilisin/kexin type 9), PD-1 (Programmed cell death protein 1), PD-2 (Programmed cell death protein 2), PD-3 (Programmed cell death protein 3), PD-4 (Programmed cell death protein 4), PD-5 (Programmed cell death protein 5), PD-6 (Programmed cell death protein 6), PD-7 (Programmed cell death protein 7), PD-8 (Programmed cell death protein 8), PDGFRA (Platelet-derived growth factor receptor alpha), PDGFRB (Platelet-derived growth factor receptor beta), PD-L1 (Programmed cell death protein 1 ligand), PEX7 (Peroxisomal Biogenesis Factor 7), PHOBS (phobia specific), PhosphatidyL-serine, chimeric IgG1 Phosphatide L-serine, Chimeric IgG2, PINK1 (PTEN induced putative kinase 1), platelet-derived growth factor receptor beta PDGFRB, PLAU (plasminogen activator urokinase), PLP (protelopid protein). PMP22 (peripheral myelin protein 22), POLG (polymerase (DNA directed) gamma), PRDM16 (PR domain containing 16), Prion proteins. PrP, PrPC, PrPSc, PRKCG (protein kinase C gamma), PSEN1 (presenilin 1), PSEN2 (presenilin 2), PSMA (Prostate-specific membrane antigen), PTGS2 (prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)), PTPN11 (Tyrosine-protein phosphatase non-receptor type 11), PVR14 (Poliovirus Receptor-Related 4), PVRL5 (Poliovirus Receptor-Related 5), pyroglutamated A RAf1 (proto-oncogene serine/threonine-protein kinase), RAGE protein, RANKL (Receptor activator of nuclear factor kappa-B ligand). RCAN1 (regulator of calcineurin 1), RDh12 (retinol dehydrogenase 12 (all-trans/9-cis/11-cis)), RGM A (Repulsive guidance molecule A), RHD (Rh blood group, D antigen), RHO (rhodopsin), RPE65 (retinal pigment epithelium-specific protein 65kDa), RTN4 (Reticulon-4, NOGO), S100B (calcium-binding protein R), S1P4 (Type 4 sphingosine 1-phosphate G protein-coupled receptor), SCN1A (Sodium Channel, Voltage Gated, Type I Alpha Subunit), SBC1 (Syndecan 1), selectin P, SHANK3 (SH3 And Multiple Ankyrin Repeat Domains 3), SLAMF7 (SLAM Family Member 7), SLC18A2 (solute carrier family 18 (vesicular monoamine transporter, member 2), SLC1A2 (solute carrier family 1 (glial high affinity glutamate transporter, member 2), SLC34A2 (Solute Carrier Family 34 (Type II Sodium/Phosphate Cotransporier), SLC6A3 (solute carrier family 6 (neurotransmitter transporter) member 3), SLC6A4 (Solute Carrier Family 6 (Neurotransmitter Transporter), SMN1 (survival of motor neuron 1 telomeric), SMN2 (survival of motor neuron 2 centromeric), SNCA (synuclein alpha (non A4 component of amyloid precursor)), SNCA (synuclem alpha (non A4 component of amyloid precursor), SNCB (synuclein beta), SOD1 (superoxide dismutase 1 soluble), SOST (Sclerostin), sphingosine-1-phosphate, SQSTM1 (sequestosome 1), STEAP1(Six Transmembrane Epithelial Antigen Of The Prostate 1), SULF2 (Sulfatase 2), TACR1 (tachykinin receptor 1), TAG-72 (Tumor-associated glycoprotein 72), TARDBP (TAR DNA binding protein), tau antigen, tau protein, tau pS422, TDP-43, tenascin, tenascin C, TFP1 (Tissue Factor Pathway Inhibitor (Lipoprotein-Associated Coagulation inhibitor)), TGF beta (Transforming growth factor beta), TH (Tyrosine hydroxylase), TkrC (Tropomyosin receptor kinase C), TMEFF2 (Transmembrane Protein With EGF-Like And Two Follistatin-Like Domains 2), TMEFF3 (Transmembrane Protein With EGF-Like And Two Follistatin-Like Domains 3), TNF (tumor necrosis factor), TNFa (tumor necrosis factor alpha), TNFRSF10B (Tumor Necrosis Factor Receptor Superfamily, Member 10b), TNFRSF12A (Tumor Necrosis Factor Receptor Superfamiiy, Member 12A), TNFRSF8 (Tumor Necrosis Factor Receptor Superfamily, Member 8), TNFRSF9 (Tumor Necrosis Factor Receptor Superfamiiy, Member 9), TNFSFI11 (Tumor Necrosis Factor Receptor Superfamiiy, Member 11), TNFSF13B (Tumor Necrosis Factor Receptor Superfamiiy, Member 13b), TNF- (Tumor Necrosis Factor alpha)), TNNT2 (troponin T type 2), TOR1A (torsin family 1 member A (torsin A)), TP EG (Trophoblast Glycoprotein), TPH2 (tryptophan hydroxylase 2), TRAILR1 (Death receptor 4), TRAILR2 (Death receptor 5), TrkA (Tropomyosin receptor kinase A), TRPY4 (Transient Receptor Potential Cation Channel, Subfamily V, Member 4), TSC2 (tuberous sclerosis 2), TULP1 (tubby like protein 1), tumor necrosis factor related protein 5, tumor specific glycosylation of MUC1, tumor-associated calcium signal transducer 2, tumor protein p53, TYRP1 (glycoprotein 75), UCHI1 (ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)), UNC-13A (unc-13 homolog A), USH1C (Usher Syndrome 1C), USH2A (Usher Syndrome 2A (Autosomal Recessive, Mild), VEGF (Vascular endothelial growth factor), VEGF A (Vascular endothelial growth factor A), C5, Factor P, Factor D, EPO (Erythropoietin), EPOR (EPO receptor), Interleukins, IL-1,IL-17A, Il-10, TNF, FGFR2 (Fibroblast Growth Factor Receptor 2), VEGFR (vascular endothelial growth factor receptor), VEGFR2 (vascular endothelial growth factor receptor 2), vimentin, voltage gated ion channels, VWF (Von Willebrand Factor), WFS1 (Wolfram syndrome 1 (wolframin)), and YES1 (Yamaguchi Sarcoma Viral Oncogene Homolog 1).

    [0529] In one embodiment, the AAV particle of the present invention, useful in treating a tauopathy or tau-associated disease, targets an antigen considered to be part, of the immune system (i.e., target antigens commonly associated with treatment of cancers or autoimmune diseases).

    [0530] In one embodiment, tire AAV particle of the present invention, useful in treating a tauopathy or tau-associated disease, targets an antigen considered to be part of the inflammatory system (i.e., target antigens commonly associated with treatment of inflammatory diseases).

    [0531] In one embodiment, the AAV particle of the present invention, useful in treating a tauopathy or tau-associated disease, targets an antigen considered to be pail, of the cell-death signaling cascade.

    [0532] In one embodiment, the AAV particle of the present invention, useful in treating a tauopathy or tau-associated disease, targets an antigen considered to be a neuroprotective agent.

    [0533] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat tauopathies or tau associated disease. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 3 or Table 4 (SEQ ID NO: 2948-4269 and 4276-4320).

    V. KITS AND DEVICES

    Kits

    [0534] In one embodiment, the invention provides a variety of kits for conveniently and/or effectively carrying out methods of the present invention. Typically, kits will comprise sufficient amounts and/or numbers of components to allow a user to perform multiple treatments of a suhject(s) and/or to perform multiple experiments.

    [0535] Any of the AAV particles of the present invention may be comprised in a kit. In some embodiments, kits may further include reagents and/or instructions for creating and/or synthesizing compounds and/or compositions of the present invention. In some embodiments, kits may also include one or more buffers. In some embodiments, kits of the invention may include components for making protein or nucleic acid arrays or libraries and thus, may include, for example, solid supports.

    [0536] In some embodiments, kit components may be packaged either in aqueous media or lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one kit component, (labeling reagent and label may be packaged together), kits may also generally contain second, third or other additional containers into which additional components may be separately placed. In some embodiments, kits may also comprise second container means for containing sterile, pharmaceutically acceptable buffers and/or other diluents. In some embodiments, various combinations of components may be comprised in one or more vial. Kits of the present invention may also typically include means for containing compounds and/or compositions of the present invention, e.g., proteins, nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which desired vials are retained.

    [0537] In some embodiments, kit components are provided in one and/or more liquid, solutions. In some embodiments, liquid solutions are aqueous solutions, with sterile aqueous solutions being particularly preferred. In some embodiments, kit components may be provided as dried powder(s). When reagents and/or components are provided as dry powders, such powders may be reconstituted by the addition of suitable volumes of solvent, in some embodiments, it is envisioned that solvents may also be provided in another container means. In some embodiments, labeling dyes are provided as dried powders. In some embodiments, it is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 micrograms or at least or at most those amounts of dried dye are provided in kits of the invention. In such embodiments, dye may then be resuspended in any suitable solvent, such as DMSO.

    [0538] In some embodiments, kits may include instructions for employing kit components as well the use of any other reagent not included in the kit. Instructions mav include variations that may be implemented.

    Devices

    [0539] In one embodiment, the AAV particles may delivered to a subject using a device to deliver the AAV particles and a head fixation assembly. The head fixation assembly may be, but is not limited to, any of the head fixation assemblies sold by MRI interventions. As a non-limiting example, the head fixation assembly may be airy of the assemblies described in U.S. Pat. Nos. 8,099,150, 8,548,569, and 9,031,636 and International Patent Publication Nos. WO201108495 and WO2014014585, the contents of each of which are incorporated by reference in their entireties. A head fixation assembly may be used in combination with an MRI compatible drill such as, but not limited to, the MRI compatible drills described in International Patent Publication No. WO2013181008 and US Patent Publication No. US20130325012, the contents of which are herein incorporated by reference in its entirety.

    [0540] In one embodiment, the AAV particles may be delivered using a method, system and/or computer program for positioning apparatus to a target point on a subject to deliver the AAV particles. As a non-limiting example, the method, system and/or computer program may be the methods, systems and/or computer programs described in U.S. Pat. No. 8,340,743, the contents of which are herein incorporated by reference in its entirety. The method may include: determining a target point in the body and a reference point, wherein the target point and the reference point define a planned trajectory line (PTL) extending through each; determining a visualization plane, wherein the PTL intersects the visualization plane at a sighting point; mounting the guide device relative to the body to move with respect to the PTL, wherein the guide device does not intersect the visualization plane; determining a point of intersection (GPP) between the guide axis and the visualization plane; and aligning the GPP with the sighting point in the visualization plane.

    [0541] In one embodiment, the AAV particles may be delivered to a subject using a convention-enhanced delivery device. Non-limiting examples of targeted delivery of drugs using convection are described in US Patent Publication Nos. US20100217228, US20130035574, and US 20130035660 and International Patent Publication No. WO2013019830 and WO2008144585, the contents of each of which are herein incorporated by reference in their entireties.

    [0542] In one embodiment, a subject may be imaged prior to, during and or after delivery of the AAV particles. The imaging method may be a method known in the art and/or described herein, such as but not limited to, magnetic resonance imaging (MRI). As anon-limiting example, imaging may be used to assess therapeutic effect. As another non-limiting example, imaging may be used for assisted delivery of AAV particles.

    [0543] In one embodiment, the AAV particles may be delivered using an MRI-guided device. Non-limiting examples of MRI-guided devices are described in U.S. Pat. Nos. 9,055,884, 9,042,958, 8,886,288, 8,768,433, 8,396,532, 8,369,930, 8,374,677, and 8,175,677 and US Patent Application No. US20140024927 the contents of each of which are herein incorporated by reference in their entireties. As a non-limiting example, the MRI-guided device may be able to provide data in real time such as those described in U.S. Pat. Nos. 8,886,288 and 8,768,433, the contents of each of which is herein incorporated by reference in its entirety. As another non-limiting example, the MRI-guided device or system may be used with a targeting cannula such as the systems described in U.S. Pat. Nos. 8,175,677 and 8,374,677, the contents of each of which are herein incorporated, by reference in their entireties. As yet another non-limiting example, the MRI-guided device includes a trajectory guide frame for guiding an interventional device as described, for example, in U.S. Pat. 9,055,884 and US Patent Application No. US20140024927, the contents of each of which are herein incorporated by reference in their entireties.

    [0544] In one embodiment, the AAV particles may be delivered using an MRI-compatible tip assembly. Non-limiting examples of MRI-compatible tip assemblies are described in US Patent Publication No. US20140275980, the contents of which is herein incorporated by reference in its entirety.

    [0545] In one embodiment, the AAV particles may be delivered using a cannula which is MRI-compatible. Non-limiting examples of MRI-compatible cannulas include those taught in International Patent Publication No. WO2011130107, the contents of which are herein incorporated by reference in its entirety.

    [0546] In one embodiment, the AAV particles may be delivered using a catheter which is MRI-compatible. Non-limiting examples of MRI-compatible catheters include those taught in International Patent Publication No. WO2012116265, U.S. Pat. No. 8,825,133 and US Patent Publication No. US20140024909, the contents of each of which are herein incorporated by reference in their entireties.

    [0547] In one embodiment, the AAV particles may be delivered using a device with an elongated tubular body and a diaphragm as described in US Patent Publication Nos. US20140276582 and US20140276614, the contents of each of which are herein incorporated by reference in their entireties,

    [0548] In one embodiment, the AAV particles may be delivered using an MRI compatible localization and/or guidance system such as, but not limited to, those described in US Patent Publication Nos. US20150223905 and US20150230871, the contents of each of which are herein incorporated by reference in their entireties. As a non-limiting example, the MRI compatible localization and/or guidance systems may comprise a mount adapted for fixation to a patient, a targeting cannula with a lumen configured to attach to the mount so as to be able to controllably translate in at least three dimensions, and an elongate probe configured to snugly advance via slide and retract in the targeting cannula lumen, the elongate probe comprising at least one of a stimulation or recording electrode.

    [0549] In one embodiment, the AAV particles may be delivered to a subject using a trajectory frame as described in US Patent Publication Nos. US20150031982 and US20140066750 and International Patent Publication Nos. WO2015057807 and WO2014039481, the contents of each of which are herein incorporated by reference in their entireties.

    [0550] In one embodiment, the AAV particles may be delivered to a subject using a gene gun.

    VI. DEFINITIONS

    [0551] At various places in the present specification, substituents of compounds of the present disclosure are disclosed in groups or in ranges. It is specifically intended that the present disclosure include each and every individual subcombination of the members of such groups and ranges.

    [0552] About: As used herein, the term about means +/10% of the recited value.

    [0553] Adeno-associated virus: The term adeno-associated virus or AAV as used herein refers to members of the dependovirus genus comprising any particle, sequence, gene, protein, or component derived therefrom.

    [0554] AAV Particle: As used herein, an AAV particle is a vims which comprises a viral genome with at least one payload region and at least one ITR region. AAV vectors of the present disclosure may be produced recombinantly and may be based on adeno-associated virus (AAV) parent or reference sequences. AAV particle may be derived from any serotype, described herein or known in the art, including combinations of serotypes (i.e., pseudotyped AAV) or from various genomes (e.g., single stranded or self-complementary). In addition, the AAV particle may be replication defective and/or targeted.

    [0555] Activity: As used herein, the term activity refers to the condition in which things are happening or being done. Compositions of the invention may have activity and this activity may involve one or more biological events.

    [0556] Administered in combination: As used herein, the term administered in combination or combined administration means that two or more agents are administered to a subject at the same time or w ithin an interval such that there may be an overlap of an effect of each agent on the patient. In some embodiments, they are administered within about 60, 30, 15, 10, 5, or 1 minute of one another. In some embodiments, the administrations of the agents are spaced sufficiently closely together such that a combinatorial (e.g., a synergistic) effect is achieved.

    [0557] Amelioration: As used herein, the term amelioration or ameliorating refers to a lessening of severity of at least one indicator of a condition or disease. For example, in the context of neurodegeneration disorder, amelioration includes the reduction of neuron loss.

    [0558] Animal: As used herein, the term animal refers to any member of the animal kingdom. In some embodiments, animal refers to humans at any stage of development. In some embodiments, animal refers to non-human animals at any stage of development. In. certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some embodiments, the animal is a transgenic animal, genetically-engineered animal, or a clone.

    [0559] Antibody: As used herein, the term antibody is referred to in the broadest sense and specifically covers various embodiments including, but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g. bispecific antibodies formed from at least two intact antibodies), and antibody fragments (e.g., diabodies) so long as they exhibit a desired biological activity (e.g., functional). Antibodies are primarily amino-acid based molecules but may also comprise one or more modifications (including, but not limited to the addition of sugar moieties, fluorescent moieties, chemical tags, etc.). Non-limiting examples of antibodies or fragments thereof include V.sub.H and V.sub.L domains, scFvs, Fab, Fab, F(ab*).sub.2, Fv fragment, diabodies, linear antibodies, single chain antibody molecules, multispecific antibodies, bispeclfic antibodies, intrabodies, monoclonal antibodies, polyclonal antibodies, humanized antibodies, codon-optimized antibodies, tandem scFv antibodies, bispecifie T-eeil engagers, mAb2 antibodies, chimeric antigen receptors (CAR), tetravalent bispeclfic antibodies, biosynthetic antibodies, native antibodies, miniaturized antibodies, unibodies, maxibodies, antibodies to senescent cells, antibodies to conformers, antibodies to disease specific epitopes, or antibodies to innate defense molecules.

    [0560] Antibody-based composition: As used herein, antibody-based or antibody-derived compositions are monomelic or multi-meric polypeptides which comprise at least one amino-acid region derived, from a known or parental antibody sequence and at least one amino acid region derived from a non-antibody sequence, e.g., mammalian protein.

    [0561] Approximately: As used herein, the term approximately or about, as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term approximately or about refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

    [0562] Associated with: As used herein, the terms associated with, conjugated, linked, attached, and tethered, when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. An association need not be strictly through direct covalent chemical bonding. It may also suggest ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the associated entities remain physically associated.

    [0563] Bijunctional: As used herein, the term bifunctional refers to any substance, molecule or moiety which is capable of or maintains at least two functions. The functions may affect the same outcome or a different outcome. The structure that produces the function may be the same or different.

    [0564] Biocompatible: As used herein, the term biocompatible means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system.

    [0565] Biodegradable: As used herein, the term biodegradable means capable of being broken down into innocuous products by the action of living things.

    [0566] Biologically active: As used herein, the phrase biologically active refers to a characteristic of any substance that has activity in a biological system and/or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active, in particular embodiments, an AAV particle of the present invention may be considered biologically active if even a portion of the encoded payload is biologically active or mimics an activity considered biologically relevant.

    [0567] Capsid: As used herein, the term capsid refers to the protein shell of a virus particle.

    [0568] Chimeric antigen receptor (CAE): As used herein, the term, chimeric antigen receptor or CAR refers to an artificial chimeric protein comprising at least one antigen specific targeting region (ASTR), a transmembrane domain and an intracellular signaling domain, wherein the antigen specific targeting region comprises a full-length antibody or a fragment thereof. As a non-limiting example the ASTR of a CAR may be any of the antibodies listed in Table 3, antibody-based compositions or fragments thereof. Any molecule that is capable of binding a target antigen with high affinity can be used in the ASTR of a CAR. The CAR may optionally have an extracellular spacer domain and or a co-stimulatory domain. A CAR may also be used to generate a cytotoxic cell carrying the CAR.

    [0569] Complementary and substantially complementary: As used herein, the term complementary refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in amiparallel polynucleotide strands. Complementary polynucleotide strands can form base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. However, when a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated. Perfect complementarity or 100% complementarity refers to the situation in which each nucleotide unit of one polynucleotide strand can form hydrogen bond with a nucleotide unit of a second polynucleotide strand. Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands can form hydrogen bond with each other. For example, for two 20-mers, if only two base pairs on each strand can form hydrogen bond with each other, the polynucleotide strands exhibit 10% complementarity. In the same example, if 18 base pairs on each strand can form hydrogen bonds with each other, the polynucleotide strands exhibit 90% complementarity. As used herein, the term substantially complementary means that the siRNA has a sequence (e.g., in the antisense strand) which is sufficient to bind the desired target mRNA, and to trigger the RNA silencing of the target mRNA.

    [0570] Compound: (Compounds of the present disclosure include all of the isotopes of the atoms occurring in the intermediate or final compounds. Isotopes refers to atoms having the same atomic number but different mass numbers resulting from a different number of neutrons in the nuclei. For example, isotopes of hydrogen include tritium and deuterium.

    [0571] The compounds and salts of the present disclosure can be prepared in combination with solvent or water molecules to form solvates and hydrates by routine methods.

    [0572] Comprehensive Positional Evolution (CPE): As used herein, the term comprehensive positional evolution refers to an antibody evolution technology that allows for mapping of the effects of amino acid changes at every position along an antibody variable domain's sequence. This comprehensive mutagenesis technology can be used to enhance one or more antibody properties or characteristics.

    [0573] Comprehensive Protein Synthesis (CPS): As used herein, the term comprehensive protein synthesis refers to a combinatorial protein synthesis technology that can be used to optimize antibody properties or characteristics by combining the best properties into anew, high-performance antibody.

    [0574] Conditionally active: As used herein, the term conditionally active refers to a mutant or variant of a wild-type polypeptide, wherein the mutant or variant is more or less active at physiological conditions than the parent polypeptide. Further, the conditionally active polypeptide may have increased or decreased activity at aberrant conditions as compared to the parent polypeptide. A conditionally active polypeptide may be reversibly or irreversibly inactivated at normal physiological conditions or aberrant conditions.

    [0575] Conserved. As used herein, the term conserved refers to nucleotides or amino acid residues of a polynucleotide sequence or polypeptide sequence, respectively, that are those that occur unaltered in the same position of two or more sequences being compared. Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.

    [0576] In some embodiments, two or more sequences are said to be completely conserved if they are 100% identical to one another. In some embodiments, two or more sequences are said to be highly conserved if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another, in some embodiments, two or more sequences are said to be highly conserved if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some embodiments, two or more sequences are said to be conserved if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some embodiments, two or more sequences are said to be conserved if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence may apply to the entire length of a polynucleotide or polypeptide or may apply to a portion, region or feature thereof.

    [0577] Control Elements: As used herein, control, elements, regulatory control element, or regulatory sequences refers to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (IRES), enhancers, and the like, which provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control elements need always be present as long as the selected coding sequence is capable of being replicated, transcribed and/or translated in an appropriate host cell.

    [0578] Controlled Release: As used herem, the term controlled release refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome.

    [0579] Cytostatic: As used herein, cytostatic refers to inhibiting, reducing, suppressing the growth, division, or multiplication of a cell (e.g., a mammalian cell (e.g., a human cell)), bacterium, virus, fungus, protozoan, parasite, prion, or a combination thereof.

    [0580] Cytotoxic: As used herein, cytotoxic refers to killing or causing injurious, toxic, or deadly effect on a cell (e.g., a mammalian cell (e.g., a human cell)), bacterium, virus, fungus, protozoan, parasite, prion, or a combination thereof.

    [0581] Delivery: As used herein, delivery refers to the act or manner of delivering an AAV particle, a compound, substance, entity, moiety, cargo or payload.

    [0582] Delivery Agent: As used herein, delivery agent refers to any substance which facilitates, at least in part, the in vivo delivery of an AAV particle to targeted cells.

    [0583] Destabilized: As used herein, the term destabie, destabilize, or destabilizing region means a region or molecule that is less stable than a starting, wild-type or native form of the same region or molecule.

    [0584] Detectable label: As used herein, detectable label refers to one or more markers, signals, or moieties which are attached, incorporated or associated with another entity that is readily detected by methods known in the art including radiography, fluorescence, chemiluminescence, enzymatic activity, absorbance and the like. Detectable labels include radioisotopes, fluorophores, chromophores, enzymes, dyes, metal ions, ligands such as biotin, avidin, streptavidin and haptens, quantum dots, and the like. Detectable labels may be located at any position in the peptides or proteins disclosed herein. They may be within the amino acids, the peptides, or proteins, or located at the N- or C-termini.

    [0585] Digest: As used herein, the term digest means to break apart into smaller pieces or components. When referring to polypeptides or proteins, digestion results in the production of peptides.

    [0586] Distal: As used herein, the term distal means situated away from the center or away from a point or region of interest.

    [0587] Dosing regimen: As used herein, a dosing regimen is a schedule of administration or physician determined regimen of treatment, prophylaxis, or palliative care.

    [0588] Encapsulate: As used herein, the term encapsulate means to enclose, surround or encase.

    [0589] Engineered: As used herein, embodiments of the invention are engineered when they are designed to have a feature or property, whether structural or chemical, that varies from a starting point, wild type or native molecule.

    [0590] Effective Amount: As used herein, the term effective amount of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an effective amount depends upon the context in which it is being applied. For example, in the context of administering an agent that treats cancer, an effective amount of an agent is, for example, an amount sufficient to achieve treatment, as defined herein, of cancer, as compared to the response obtained without administration of the agent.

    [0591] Epitope: As used herein, an epitope refers to a surface or region on a molecule that is capable of interacting with a biomolecule. For example, a protein may contain one or more amino acids, e.g., an epitope, which interacts with an antibody, e.g., a biomolecule. In some embodiments, when referring to a protein or protein module, an epitope may comprise a linear stretch of amino acids or a three-dimensional structure formed by folded amino acid chains.

    [0592] EvoMap: As used herein, an EvoMap refers to a map of a polypeptide, wherein detailed informatics are presented about the effects of single amino acid mutations within the length of the polypeptide and their influence on the properties and characteristics of that polypeptide.

    [0593] Expression: As used herein, expression of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5 cap formation, and/or 3 end processing), (3) translation of an RNA into a polypeptide or protein, and (4) post-translational modification of a polypeptide or protein.

    [0594] Feature: As used herein, a feature refers to a characteristic, a property, or a distinctive element.

    [0595] Formulation: As used herein, a formulation includes at least one AAV particle and a delivery agent.

    [0596] Fragment: A fragment, as used herein, refers to a portion. For example, fragments of proteins may comprise polypeptides obtained by digesting full-length protein isolated from cultured cells.

    [0597] Functional: As used herein, a functional biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized.

    [0598] Gene expression: The term gene expression refers to the process by which a nucleic acid sequence undergoes successful transcription find in most instances translation to produce a protein or peptide. For clarity, when reference is made to measurement of gene expression, this should be understood to mean that measurements may be of the nucleic acid product of transcription, e.g., RNA or mRNA or of the amino acid product of translation, e.g., polypeptides or peptides. Methods of measuring the amount or levels of RNA, mRNA, polypeptides and peptides are well known in the art.

    [0599] Homology: As used, herein, the term homology refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be homologous to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%. 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical or similar. The term homologous necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). In accordance with the invention, two polynucleotide sequences are considered to be homologous if the polypeptides they encode are at least about 50%, 60%, 70%, 80%, 90%, 95%, or even 99% for at least one stretch of at least about 20 amino acids. In some embodiments, homologous polynucleotide sequences are characterized by the ability to encode a stretch of at least 4-5 uniquely specified amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by the ability to encode a stretch of at least 4-5 uniquely specified amino acids. In accordance with the invention, two protein sequences are considered to be homologous if the proteins are at least about 50%, 60%, 70%, 80%, or 90% identical for at least one stretch of at least about 20 amino acids.

    [0600] Heterologous Region: As used herein the term heterologous region refers to a region which would not be considered a homologous region.

    [0601] Homologous Region: As used herein the term homologous region refers to a region which is similar in position, structure, evolution origin, character, form or function.

    [0602] Identity: As used herein, the term identity refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of the percent identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993: Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the (JAP program in the GCG software package using an NWSgapdna CMP matrix. Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H. and Lipman, D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplar computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)). BLASTP, BLASTN, and FASTA Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).

    [0603] Inhibit expression of a gene: As used herein, the phrase inhibit expression of a gene means to cause a reduction in the amount of an expression product of the gene. The expression product can be an RNA transcribed from the gene (e.g., an mRNA) or a polypeptide translated from an mRNA transcribed from the gene. Typically, a reduction in the level of an mRNA results in a reduction in the level of a polypeptide translated therefrom. The level of expression may be determined using standard techniques for measuring mRNA or protein.

    [0604] In vitro: As used herein, the term in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

    [0605] In vivo: As used herein, the term in vivo refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).

    [0606] Isolated: As used herein, the term isolated refers to a substance or entity that has been separated from at least some of the components with which it was associated (whether in nature or in an experimental setting). Isolated substances may have varying levels of purity in reference to the substances from which they have been associated. Isolated substances and/or entities may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which they were initially associated. In some embodiments, isolated agents are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is pure if it is substantially free of other components.

    [0607] Substantially isolated: By substantially isolated is meant that a substance is substantially separated from the environment in which it was formed or detected. Partial separation can include, for example, a composition enriched in the substance or AAV particles of the present disclosure. Substantial separation can include compositions containing at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% by weight of the compound of the present disclosure, or salt thereof. Methods for isolating compounds and their salts are routine in the art.

    [0608] Linker: As used herein linker refers to a molecule or group of molecules which connects two molecules, such as a V.sub.H chain and V.sub.L chain or an antibody. A linker may be a nucleic acid sequence connecting two nucleic acid sequences encoding two different polypeptides. The linker may or may not be translated. The linker may be a cleavable linker.

    [0609] MicroRNA (miRNA) binding site: As used herein, a microRNA (miRNA) binding site represents a nucleotide location or region of a nucleic acid transcript to which at least the see region of a miRNA binds.

    [0610] Modified: As used herein modified refers to a changed state or structure of a molecule of the invention. Molecules may be modified in many ways including chemically, structurally, and functionally.

    [0611] Naturally Occurring: As used herein, naturally occurring or wild-type means existing in nature without artificial aid, or involvement of the hand of man.

    [0612] Non-human vertebrate: As used herein, a non-human vertebrate includes all vertebrates except Homo sapiens, including wild and domesticated species. Examples of non-human vertebrates include, but are not limited to, mammals, such as alpaca, banteng, bison, camel, cat, cattle, deer, dog, donkey, gayal, goat, guinea pig, horse, llama, mule, pig, rabbit, reindeer, sheep water buffalo, and yak.

    [0613] Off-target: As used herein, off target refers to any unintended effect on any one or more target, gene, or cellular transcript.

    [0614] Open reading frame: As used herein, open reading frame or ORF refers to a sequence which does not contain a. stop codon in a given reading frame.

    [0615] Operably linked: As used herein, the phrase operably linked refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like.

    [0616] Particle: As used herein, a particle is a virus comprised of at least two components, a protein capsid and a polynucleotide sequence enclosed within the capsid.

    [0617] Patient: As used herein, patient refers to a subject who may seek or be in need of treatment, requires treatment, is receiving treatment, will receive treatment, or a subject who is under care by a trained professional for a particular disease or condition.

    [0618] Payload: As used herein, payload or payload region refers to one or more polynucleotides or polynucleotide regions encoded by or within a viral genome or an expression product of such polynucleotide or polynucleotide region, e.g., a transgene, a polynucleotide encoding a polypeptide or raulti-polypeptide or a modulatory nucleic acid or regulatory nucleic acid.

    [0619] Payload construct: As used herein, payload construct is one or more polynucleotide regions encoding or comprising a payload that is flanked on one or both sides by an inverted terminal repeat (ITR) sequence. The payload construct is a template that is replicated in a viral production cell to produce a viral genome.

    [0620] Payload construct vector. As used herein, payload construct vector is a vector encoding or comprising a payload construct, and regulatory regions tor replication and expression in bacterial cells.

    [0621] Payload construct expression vector: As used herein, a payload construct expression vector is a vector encoding or comprising a payload construct and which further comprises one or more polynucleotide regions encoding or comprising components for viral expression in a viral replication cell.

    [0622] Peptide: As used herein, peptide is less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

    [0623] Pharmaceutically acceptable: The phrase pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

    [0624] Pharmaceutically acceptable excipients: The phrase pharmaceutically acceptable excipient, as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butyiated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methyl cellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xyiitol.

    [0625] Pharmaceutically acceptable salts: The present disclosure also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, pharmaceutically acceptable salts refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, campborate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyisulfate, ethanesuifonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, laurvl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamme, dimethylamme, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutieally acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceuticallv acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17.sup.th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P. H. Stahl and C. G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety.

    [0626] Pharmaceutieally acceptable solvate: The term pharmaceutieally acceptable solvate, as used herein, means a compound of the invention wherein molecules of a suitable solvent are incorporated in the crystal lattice. A suitable solvent is physiologically tolerable at the dosage administered. For example, solvates may be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF), N,N-dimethylacetamide (DMAC), 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPI), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a hydrate.

    [0627] Pharmacokinetic: As used herein, pharmacokinetic refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetics is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body: (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the body. In rare cases, some drugs irreversibly accumulate in body tissue.

    [0628] Physicochemical: As used herein, physicochemical means of or relating to a physical and/or chemical property.

    [0629] Preventing: As used herein, the term preventing refers to partially or completely delaying onset of an infection, disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular infection, disease, disorder, and/or condition, partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and/or condition: partially or completely delaying progression from an infection, a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and/or condition.

    [0630] Proliferate: As used herein, the term proliferate means to grow, expand or increase or cause to grow, expand or increase rapidly. Proliferative means having the ability to proliferate. Anti-proliferative means having properties counter to or inapposite to proliferative properties.

    [0631] Prophylactic: As used herein, prophylactic refers to a therapeutic or course of action used to prevent the spread of disease.

    [0632] Prophylaxis: As used herein, a prophylaxis refers to a measure taken to maintain health and prevent the spread of disease.

    [0633] Protein of interest: As used herein, the terms proteins of interest or desired proteins include those provided herein and fragments, mutants, variants, and alterations thereof.

    [0634] Proximal: As used herein, the term proximal means situated nearer to the center or to a point or region of interest.

    [0635] Purified: As used herein, purify, purified, purification means to make substantially pure or clear from unwanted components, material defilement, admixture or imperfection. Purified refers to the state of being pure, Purification refers to the process of making pure.

    [0636] Region: As used herein, the term region refers to a zone or general area. In some embodiments, when referring to a protein or protein module, a region may comprise a linear sequence of amino acids along the protein or protein module or may comprise a three-dimensional area, an epitope and/or a cluster of epitopes. In some embodiments, regions comprise terminal regions. As used herein, the term terminal region refers to regions located at the ends or termini of a given agent. When referring to proteins, terminal regions may comprise N- and/or C-termim. N-termini refer to the end of a protein comprising an amino acid with a free amino group. C-termini refer to the end of a protein comprising an amino acid with a free earboxyl group. N- and/or C-terminal regions may there for comprise the N- and/or C-termim as well as surrounding amino acids. In some embodiments, N- and/or C-terminal regions comprise from about 3 amino acid to about 30 amino acids, from about 5 amino acids to about 40 amino acids, from about 10 amino acids to about 50 amino acids, from about 20 amino acids to about 100 amino acids and/or at least 100 amino acids. In some embodiments, N-terminal regions may comprise any length of amino acids that includes the N-terminus, but does not include the C-terminus. In some embodiments, C-terminal regions may comprise any length of amino acids, which include the C-terminus, but do not comprise the N-terminus.

    [0637] In some embodiments, when referring to a polynucleotide, a region may comprise a linear sequence of nucleic acids along the polynucleotide or may comprise a three-dimensional area, secondary structure, or tertiary structure. In some embodiments, regions comprise terminal regions. As used herein, the term terminal region refers to regions located at the ends or termini of a given agent. When referring to polynucleotides, terminal regions may comprise 5 and 3 termini. 5 termini refer to the end of a polynucleotide comprising a nucleic acid with a free phosphate group. 3 termini refer to the end of a polynucleotide comprising a nucleic acid with a free hydroxyl group. 5 and 3 regions may there for comprise the 5 and 3 termini as well as surrounding nucleic acids. In some embodiments, 50 and 3 terminal regions comprise from about 9 nucleic acids to about 90 nucleic acids, from about 15 nucleic acids to about 120 nucleic acids, from about 30 nucleic acids to about 150 nucleic acids, from about 60 nucleic acids to about 300 nucleic acids and/or at least 300 nucleic acids. In some embodiments, 5 regions may comprise any length of nucleic acids that includes the 5 terminus, but does not include the 3 terminus. In some embodiments, 3 regions may comprise any length of nucleic acids, which include the 3 terminus, but does not comprise the 5 terminus.

    [0638] RNA or RNA molecule: As used herein, the term RNA or RNA molecule or ribonucleic acid molecule refers to a polymer of ribonucleotides; the term DNA or DNA molecule or deoxyribonucleic acid molecule refers to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally, e.g., by DNA replication and transcription of DNA, respectively; or be chemically synthesized. DNA and RNA can be single-stranded (i.e., ssRNA or ssDNA, respectively) or multi-stranded (e.g., double stranded, i.e., dsRNA and dsDNA, respectively). The term mRNA or messenger RNA, as used herein, refers to a single stranded RNA that encodes the amino acid sequence of one or more polypeptide chains.

    [0639] Sample: As used herein, the term sample or biological sample refers to a subset of its tissues, cells or component parts (e.g. body fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). A sample further may include a homogenate, lysate or extract prepared from a whole organism or a subset of its tissues, cells or component parts, or a fraction or portion thereof, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs. A sample further refers to a medium, such as a nutrient broth or gel, which may contain cellular components, such as proteins or nucleic acid molecule.

    [0640] Self-complementary viral particle: As used herein, a self-complementary viral particle is a particle comprised of at least two components, a protein capsid and a polynucleotide sequence encoding a self-complementary genome enclosed within the capsid.

    [0641] Signal Sequences: As used herein, the phrase signal sequences refers to a sequence which can direct the transport or localization of a protein.

    [0642] Single unit dose: As used herein, a single unit dose is a dose of any therapeutic administered in one dose/at one time/single route/single point of contact, i.e., single administration event. In some embodiments, a single unit dose is provided as a discrete dosage form. (e.g., a tablet, capsule, patch, loaded syringe, vial, etc.).

    [0643] Similarity: As used herein, the term similarity refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same maimer as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.

    [0644] Split dose: As used herein, a split dose is the division of single unit dose or total daily dose into two or more doses.

    [0645] Stable: As used herein stable refers to a compound that is sufficiently robust to survive isolation to a useful degree of purity from, a reaction mixture, and preferably capable of formulation into an efficacious therapeutic agent.

    [0646] Stabilized: As used herein, the term stabilize, stabilized, stabilized region means to make or become stable.

    [0647] Subject: As used herein, the term subject or patient refers to any organism to which a composition in accordance with the invention may be administered, e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and/or plains.

    [0648] Substantially. As used herein, the terra substantially refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term substantially is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

    [0649] Substantially equal: As used herein as it relates to time differences between doses, the term means plus/minus 2%.

    [0650] Substantially simultaneously: As used herein and as it relates to plurality of doses, the term means within 2 seconds.

    [0651] Suffering from: An individual who is suffering from a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of a disease, disorder, and/or condition.

    [0652] Susceptible to: An individual who is susceptible to a disease, disorder, and/or condition has not been diagnosed with and/or may not exhibit symptoms of the disease, disorder, and/or condition but harbors a propensity to develop a disease or its symptoms. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition (for example, cancer) may be characterized by one or more of the following: (1) a genetic mutation associated with development of the disease, disorder, and/or condition; (2) a genetic polymorphism associated with development of the disease, disorder, and/or condition; (3) increased and/or decreased expression and/or activity of a protein and/or nucleic acid associated with the disease, disorder, and/or condition; (4) habits and/or lifestyles associated with development of the disease, disorder, and/or condition; (5) a family history of the disease, disorder, and/or condition; and (6) exposure to and/or infection with a microbe associated with development of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition, in some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.

    [0653] Sustained release: As used herein, the terra sutained release refers to a pharmaceutical composition or compound release profile that conforms to a release rate over a specific period of time.

    [0654] Synthetic: The term synthetic means produced, prepared, and/or manufactured by the hand of man. Synthesis of polynucleotides or polypeptides or other molecules of the present invention may be chemical or enzymatic.

    [0655] Targeting: As used herein, targeting means the process of design and selection of nucleic acid sequence that will hybridize to a target nucleic acid and induce a desired effect.

    [0656] Targeted Cells: As used herein, targeted cells refers to any one or more cells of interest. The cells may be found in vitro, in vivo, in situ or in the tissue or organ of an organism. The organism may be an animal, preferably a mammal, more preferably a human and most preferably a patient.

    [0657] Therapeutic Agent: The term therapeutic agent refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and/or prophylactic effect and/or elicits a desired biological and/or pharmacological effect.

    [0658] Therapeutically effective amount: As used herein, the term therapeutically effective amount means an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition. In some embodiments, a therapeutically effective amount is provided in a single dose. In some embodiments, a therapeutically effective amount is administered in a dosage regimen comprising a plurality of doses. Those skilled in the art will appreciate that in some embodiments, a unit dosage form may be considered to comprise a therapeutically effective amount of a particular agent or entity if it comprises an amount that is effective when administered as part of such a dosage regimen.

    [0659] Therapeutically effective outcome: As used herein, the term therapeutically effective outcome means an outcome that is sufficient in a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition.

    [0660] Total daily dose: As used herein, a total daily dose is an amount given or prescribed in 24 hr period. It may be administered as a single unit dose.

    [0661] Transfection: As used herein, the term transfection refers to methods to introduce exogenous nucleic acids into a cell. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures.

    [0662] Treating: As used herein, the term treating refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a particular infection, disease, disorder, and/or condition. For example, treating cancer may refer to inhibiting survival, growth, and/or spread of a tumor. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition and/or to a subject who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.

    [0663] Unmodified: As used herein, unmodified refers to any substance, compound or molecule prior to being changed in any way. Unmodified may, but does not always, refer to the wild type or native form of a biomolecule. Molecules may undergo a series of modifications whereby each modified molecule may serve as the unmodified starting molecule for a subsequen t modification.

    [0664] Vector: As used herein, a vector is any molecule or nicuety which transports, transduces or otherwise acts as a carrier of a heterologous molecule. Vectors of the present invention may be produced recombinantly and may be based on and/or may comprise adeno-associated virus (AAV) parent or reference sequence. Such parent or reference AAV sequences may serve as an original, second, third or subsequent sequence for engineering vectors. In non-limiting examples, such parent or reference AAV sequences may comprise any one or more of the following sequences: a polynucleotide sequence encoding a polypeptide or multi-polypeptide, which sequence may be wild-type or modified from wild-type and which sequence may encode full-length or partial sequence of a protein, protein domain, or one or more sub units of a protein; a polynucleotide comprising a modulatory or regulatory nucleic acid which sequence may be wild-type or modified from wild-type; and a transgene that may or may not be modified from wild-type sequence. These AAV sequences may serve as either the donor sequence of one or more codons (at the nucleic acid level) or amino acids (at the polypeptide level) or acceptor sequences of one or more codons (at the nucleic acid level) or amino acids (at the polypeptide level).

    [0665] Viral genome: As used herein, a viral genome or vector genome is a polynucleotide comprising at least one inverted terminal repeat (ITR) and at least one encoded payload. A viral genome encodes at least one copy of the payload.

    [0666] Described herein are compositions, methods, processes, kits and devices for the design, preparation, manufacture and/or formulation of AAV particles. In some embodiments, payloads, such as but not limited to AAV polynucleotides, may be encoded by payload constructs or contained within plasmids or vectors or recombinant adeno-associated viruses (AAVs).

    [0667] The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred materials and methods are now described. Other features, objects and advantages of the invention will be apparent from the description. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, ail technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the case of conflict, the present description will control.

    [0668] The present invention is further illustrated by the following non-limiting examples.

    VII. EXAMPLES

    Example 1

    Production and Purification of AAV particles

    [0669] AAV particles described herein may be produced using methods known in the art, such as, for example, triple transfection or baculovirus mediated virus production. Any suitable permissive or packaging cell known in the art may be employed to produce the vectors. Mammalian cells are often preferred. Also preferred are trans-complementing packaging cell lines that provide functions deleted from a replication-defective helper virus, e.g., 293 cells or other E1a trans-complementing cells.

    [0670] The gene cassette may contain some or all of the parvovirus (e.g., AAV) cap and rep genes. Preferably, however, some or all of the cap and rep functions are provided in trans by introducing a packaging vector(s) encoding the capsid and/or Rep proteins into the cell. Most preferably, the gene cassette does not encode the capsid or Rep proteins. Alternatively, a. packaging cell line is used that is stably transformed to express the cap and/or rep genes.

    [0671] Recombinant AAV virus particles are, in some cases, produced and purified from culture supematants according to the procedure as described in US20160032254, the contents of which are incorporated by reference. Production may also involve methods known in the art including those using 293T cell, sf9 insect cells, triple transfection or any suitable production method.

    [0672] In some cases, 293 cells are transfected with CaPO4 with plasmids required for production of AAV, i.e., AAV2 rep, an adenoviral helper construct and a ITR flanked transgene cassette. The AAV2 rep plasmid also contains the cap sequence of the particular virus being studied. Twenty-four hours after transfection, which occurs in serum containing DMEM, the medium is replaced with fresh medium with or without serum. Three (3) days after transfection, a sample is taken from the culture medium of the 293 adherent cells. Subsequently cells are scraped and transferred into a receptacle. After centrifugation to remove cellular pellet, a second sample is taken from the supernatant after scraping. Next cell lysis is achieved by three consecutive freeze-thaw cycles (80 C. to 37 C.). Cellular debris is removed and sample 3 is taken from the medium. The samples are quantified for AAV particles by DNase resistant genome titration by Taqman PCR. The total production yield from such a transfection is equal to the particle concentration from sample 3.

    [0673] AAV vector titers are measured according to genome copy number (genome particles per milliliter). Genome particle concentrations are based on Taqman PCR of the vector DNA as previously reported (Clark et al. (1999) Hum. Gene Ther., 10:1031-1039; Veldwijk et al. (2002) Moi. Ther., 6:272-278).

    Example 2

    Tissue Specific Expression

    [0674] To evaluate the expression of various encoded antibody pay loads in tissues, a series of AAV particles carrying the encoded antibody sequences driven by a panel of ubiquitous and tissue-specific promoters are made. These particles are administered to the specific tissue, e.g., intramuscularly, via an appropriate route, e.g., a single injection in the gastrocnemius muscle and expression is monitored to determine the relative expression potential of the payload as well as of each promoter in this target tissue. Measurement of antibody production is performed using standard techniques, for example by ELISA.

    [0675] In some cases, the cytomegalovirus immediate early promoter (CMV), chimeric chicken-beta-actin (CAG), and ubiquitin C (UBC), CBA, H1 promoters provide robust expression.

    Example 3

    Generation of Antibodies

    Antibody Production by Hybridoma Technology

    [0676] Host animals (e.g. mice, rabbits, goats, and llamas) are immunized by an injection with an antigenic protein (e.g., tau) to elicit lymphocytes that specifically bind to the antigen (e.g., tau). Lymphocytes are collected and fused with immortalized cell lines to generate hybridomas. Hybridomas are cultured in a suitable culture medium that is enriched with appropriate selection agents to promote growth.

    [0677] Antibodies produced by the cultured hybridomas are subjected to analysis to determine binding specificity of the antibodies for the target antigen. Once antibodies with desirable characteristics are identified, corresponding hybridomas are subcloned through limiting dilution procedures and grown by standard methods. Antibodies produced by these cells are isolated and purified using standard immunoglobulin purification procedures.

    Recombinant Antibody Production

    [0678] Recombinant antibodies are produced using heavy and light chain variable region cDNA sequences selected from hybridomas or from other sources. Sequences encoding antibody variable domains expressed by hybridomas are determined by extracting RNA molecules from antibody-producing hybridoma cells and producing cDNA by reverse transcriptase polymerase chain reaction (PCR). PCR is used to amplify cDNA using primers specific for heavy and light chain sequences. PCR products are then subcloned into plasmids for sequence analysis. Antibodies are produced by insertion of resulting variable domain sequences into expression vectors.

    [0679] Recombinant antibodies are also produced using phage display technology. Target antigens are screened, in vitro, using phage display libraries having millions to billions of phage particles expressing unique single chain variable fragments (scFvs) on their viral coat. Precipitated phage particles are analyzed and sequences encoding expressed scFvs are determined. Sequences encoding antibody variable domains and/or CDRs are inserted into expression vectors for antibody production.

    [0680] Recombinant antibodies are further produced using yeast surface display technology, wherein antibody variable domain sequences are expressed on the cell surface of Saccharomyces cerevisiae. Recombinant antibodies are developed by displaying the antibody fragment of interest as a fusion to e.g. Aga2p protein on the surface of the yeast, where the protein interacts with proteins and small molecules in a solution. scFvs with affinity towards desired receptors are isolated from the yeast surface using magnetic separation and flow cytometry. Several cycles of yeast surface display and isolation will be done to attain scFvs with desired properties through directed evolution.

    Example 4

    Optimization of the Encoded Antibody

    [0681] To design an optimal framework for the expression of an antibody, the heavy and light chains of several antibodies separated by an F2A self-processing peptide sequence are cloned into a mammalian expression vector under the control of the CMV promoter. 293T cells or any suitable cell line transfected with these vectors exhibit secretion of human IgG into the culture supernatant that is then detected by ELISA.

    [0682] To increase expression, the antibody chains and/or the processing peptide are codon optimized for mammalian expression, in some instances, a furin cleavage site at the N-terminus is inserted for better processing.

    [0683] To improve secretion of the antibody, the endogenous signal sequences are replaced with a sequence which may or may not be codon optimized, derived from any gene. In some cases, the human growth hormone signal sequence is used. Any of the heavy, light or both chains may be driven by any signal sequence, whether the same or different. Antibody expression is confirmed using standard immunohistochemical techniques, including ELISA.

    Example 5

    Vectored Antibodies

    [0684] Viral genomes are designed for AAV delivery of antibodies to cells. The viral genome comprises a payload region and at least one inverted terminal repeat (ITR) region. The payload region may optionally encode regulatory elements e.g., a promoter region, an intronic region, or a polyadenylation sequence. The payload region comprises a sequence encoding one or more polypeptides selected from the group consisting of those listed in Table 3. An exemplary payload region comprises a sequence encoding an antibody heavy chain, a region encoding an antibody light chain and a region encoding a linker connecting the heavy and light chain sequences or polypeptides before further processing. A promoter is selected to target the desired tissue or for desired regulation of expression, or both. The promoter may be selected from human EF1, CMV, CBA, and its derivative C AG, GUSB, UBC, or any other promoter known to one with skill in the art, or combinations thereof. The 5 and 3 ITRs may or may not be of the same serotype as the capsid of the AAV particle.

    [0685] Payload regions may optionally encode a linker between light and heavy antibody chain sequences or polypeptides. Sequence encoding linkers are derived from an internal ribosome entry site (IRES; SEQ ID NO: 899), foot and mouth disease virus 2A (F2A; SEQ ID NO: 900), porcine teschovirus-1 virus 2A (P2A; SEQ ID NO: 901), a furin cleavage site (F; SEQ ID NO: 902), or a 5G4S (SEQ ID NO: 4321 encoded by SEQ ID NO: 903) linker sequence. In various payload regions, the order of heavy and light chains is alternated with respect to 5 to 3 direction. Payioads are further designed to encode protein signal sequences (to aid in protein processing, localization, and/or secretion) as well as an untranslated poly A tail.

    [0686] Each viral genome is then incorporated into an AAV cloning vector to create payload expression vectors.

    [0687] The payload expression vectors are expressed in e.g. Expi293 cells. The supematants are collected and expressed antibodies are purified using protein A/G beads. Supematants are diluted with a loading buffer and applied, to a column prepared with A/G beads. Unbound proteins are washed through with loading buffer. Elution buffer is added to the column, fractions collected, and fractions containing proteins of interest are identified with absorption spectroscopy technique, pooled together, and neutralized. Western blotting techniques are used, to identify payload regions producing the antibody proteins of interest. Purified antibodies are then tested for their affinity to their specific target by e.g. ELISA essay technique and antibodies with the highest affinity are identified and selected.

    [0688] Finally, the rAAVs are produced, using, for example, HEK293T cells. The cells are transfected simultaneously with the viral genome of the present invention, a viral genome encoding helper proteins and a viral genome encoding replication and capsid proteins.

    Example 6

    In Vivo Expression and Efficacy of Antibody Payloads

    [0689] To determine the efficacy or comparative expression of encoded antibodies, dose-dependent expression is determined at a series of time points. Samples from mice treated with AAV particles encoding antibodies or luciferase at various levels are examined for expression using standard techniques such as nucleic acid analyses for RNA levels, protein analyses for antibody levels and compared to the expression of the luciferase control.

    Example 7

    Treatment of Tau-Assodated Disease

    [0690] AAV particles of the current invention for delivery of an antibody are administered to a patient who has been diagnosed with a tau associated disease, disorder or condition. The purpose of the treatment may be aimed to manage the disease, prevent or slow the progression of the disease, treat, the symptoms associated with the disease ami/or cure the disease.

    [0691] The AAV particles are administered to a subject by IV, ICV, I/Pa or IT administration. The administration may include one or more injections over a period of time. The level and distribution of AAV particles and antibody expression is monitored by standard diagnostic techniques known in the art. Such diagnostic techniques include e.g. (e.g. from blood, urine, or saliva), cerebrospinal fluid (CSF) testing, or any other testing useful for monitoring antibody levels in the body.

    [0692] Additionally, the progression of the disease and the health of the patient is monitored by standard diagnostic techniques known in the art. Such techniques may include diagnostic imaging (e.g. X-ray, MRI scans, Ultrasound scans, PET scans, Nuclear scans, mammography), biopsy, laboratory tests (e.g. from blood, urine, or saliva), cerebrospinal fluid (CSF) testing, vital signs, clinical tests (cognitive, motor or reflex tests) and other relevant techniques. Treatment with the AAV particles may results in cure of the tau-associated disease, slowing down or stabilizing the progression of the disease, or have no effect on the progression of the disease. Additionally, the treatment may reduce seventy of one or more symptoms associated with the disease, eliminate one or more symptoms associated with the disease or have no effect on the symptoms.

    Example 8

    Payloads for Tau Associated Diseases

    [0693] Payloads were designed for viral delivery of anti-tau antibodies MC-1 (with heavy chain of SEQ ID NO: 2948 and light chain of SEQ ID NO: 3153), PHF1 (with heavy chain of SEQ ID NO: 2949 and tight chain of SEQ ID NO: 3154) and IPN002 (with heavy chain of SEQ ID NO: 2950 and light chain of SEQ ID NO: 3155) to cells. The viral genome includes, besides the coding region, a 5 ITR (SEQ ID NO: 4270), CB6 promoter (SEQ ID NO: 4271), SV40 intron (SEQ ID NO: 4272), rabbit globin poly A tail (SEQ ID NO: 4273), and 3ITR (SEQ ID NO: 4274) sequences.

    [0694] Payloads were designed to encode a tinker between light and heavy antibody chains. Sequence encoding linkers were derived from an internal ribosome entry site (IRES, SEQ ID NO: 899), foot and mouth disease virus 2A (F2A; SEQ ID NO: 900), porcine teschovirus-1 virus 2A (P2A; SEQ ID NO: 901), a furin cleavage site (F; SEQ ID NO: 902), or a 5G4S (also referred to herein as G4S5) (SEQ ID NO: 4321 encoded by SEQ ID NO: 903) linker sequence. In various payload regions, the order of heavy and light chains was alternated with respect to 5 to 3 direction. Payloads were further designed to encode protein signal sequences (to aid in protein processing, localization, and/or secretion) as well as an untranslated poly A tail, Payioad region sequences included in the prepared viral genomes are listed in Table 4. Each viral genome was then cloned into a pAAVss cloning vector (SEQ ID NO: 4275) to create the AAV particle listed in Table 4.

    TABLE-US-00004 TABLE 4 AAV Particle Sequences Coding Viral Complete Region Genome Sequence Description Abbreviation SEQ ID SEQ ID NO SEQ ID pAAVss-CB6-SV40-MC1HIRESL MC1HIRESL 4276 4292 4291 pAAVss-CB6-SV40-MC1LIRESH MC1LIRESH 4277 4294 4293 pAAVss-CB6-SV40-MC1HF2AL MC1HF2AL 4278 4296 4295 pAAVss-CB6-SV40-MC1LF2AH MC1LF2AH 4279 4298 4297 pAAVss-CB6-SV40-MC1HF.F2AL MC1HF.F2AL 4280 4300 4299 pAAVss-CB6-SV40-MC1LF.F2AH MC1LF.F2AH 4281 4302 4301 pAAVss-CB6-SV40-MC1HP2AL MC1HP2AL 4282 4304 4303 pAAVss-CB6-SV40-MC1LP2AH MC1LP2AH 4283 4306 4305 pAAVss-CB6-SV40-MC1HF.P2AL MC1HF.P2AL 4284 4308 4307 pAAVss-CB6-SV40-MC1LF.P2AH MC1LF.P2AH 4285 4310 4309 pAAVss-CB6-SV40-MC1LG4S5H MC1LG4S5H 4286 4312 4311 pAAVss-CB6-SV40-IPN002LF2AH IPN002LF2AH 4287 4314 4313 pAAVss-CB6-SV40-IPN002HF.F2AL IPN002HF.F2AL 4288 4316 4315 pAAVss-CB6-SV40-PHF-1LF2AH PHF-1LF2AH 4289 4318 4317 pAAVss-CB6-SV40-PHF-1HF.F2AL PHF-1HF.F2AL 4290 4320 4319

    Example 9

    Development of ELISA Assay to Determine Affinity to ePHF Tau

    [0695] An assay was developed to determine the affinity of anti-tau antibodies expressed from various payload coding region constructs for extracellular tau in the form of paired helical filaments (ePHF). The ePHF were first immobilized on a 96-well plate overnight by pre-coating with 1500 of the concentrated PHF tau at 4 C. washed 3 times with PBS then blocked with 3% BSA for 2 hrs at room temperature or overnight at 4 C. Supematants from suspensions of Expi 293 cells transfected with MC-1 payload coding region constructs were collected and loaded onto the plates. Anti-tau antibody MC-1 was diluted in 3% BSA and analyzed separately as a control. Plates were then incubated, for 2 hrs at room temperature. Weils were washed 5 times with TBS/0.5% Tween 20 wash buffer, then incubated with 1:5000 dilution of anti-mouse antibody labeled with HRP (Thermo Fisher Scientific, Waltham, Mass.) for 30 mm. Plates were then developed by incubating with one-step TMB substrate (Thermo Fisher Scientific, Waltham, Mass.) for 30 mm, stopped by 2H.sub.2SO.sub.4 and read using a BioTek Synergy H1 hybnd reader (BioTek, Winooski, Vt.) at 450 nm. The concentration of anti-tau antibodies, and their affinity for ePHF tau, was determined using a standard curve. Anti-tau antibodies produced using MC1LIRESH, MC1LF2AH, MC1HF.F2AL, MC1LF.F2AH, and MC1HF.P2AL payload coding region constmcts showed similar affinity for ePHF tau as the MC-1 control. Anti-tau antibodies generated using MC1HIRESL, MC1LP2AH and MC1LF.P2AH payload coding region constructs demonstrated lower affinity to ePHF tau than control MC-1.

    [0696] According to the same assay, MC 1LF2AH, MC 1HF.F2AL, IPN002LF2AH, IPN002HF.F2AL, PHF-1LF2AH, and PHF-1 HF.F2AL payload coding region constructs were expressed in Expi 293 cells, the supematants collected and expressed antibodies were tested for affinity to ePHF tau. Antibodies generated, using all six constructs tested showed similar affinity for ePHF tau in comparison to their respective control antibodies (MC-1, PHF1 and IPN002 antibodies).

    Example 10

    ELISA Assay for Detection of Expressed Antibodies

    [0697] Expi 293 cell culture supematants from cells expressing anti-tau antibodies were tested by sandwich ELISA to detect and determine concentrations of expressed antibodies. Ninety-six well plates were pre-coated with anti-mouse IgG1 overnight at 4 C. then washed 3 times with PBS and blocked, with 3% BSA for 2 hrs at room temperature. Supematants were diluted in blocking buffer (3% BSA), added to the wells and incubated for 2 hrs at room temperature. Samples were then washed 5 times with TBS/0.5% Tween 20 wash buffer and incubated with 1:5000 dilution of anti-mouse antibody labeled with HRP (Thermo Fisher Scientific, Waltham, Mass.) for 30 min. Plates were developed by incubating with one-step TMB substrate for 30 min, stopped by 2N H2SO.sub.4 and read using a BioTek Synergy H1 hybrid reader (BioTek, Wmooski, Vt.) at 450 nm. The concentration of expressed MC-1 anti-tau antibodies was then determined for each construct using a standard curve (see Table 5).

    TABLE-US-00005 TABLE 5 Concentrations of expressed antibodies Construct Antibody concentration name g/mL MC1HIRESL 4.42 MC1LIRESH 32.29 MC1LF2AH 10.74 MC1HF.F2AL 12.10 MC1LF.F2AH 12.94 MC1LP2AH 44.12 MC1HF.P2AL 23.79 MC1LF.P2AH 46.43

    [0698] Cells expressing MC1LIRESH, MC1LP2AH and MC1LP2AH coding region constructs produced the highest concentration of antibodies from transfected cells.

    [0699] In a subsequent experiment using the same methods, cell supernatants from Expi 293 cells expressing MC1LF2AH, MC1HF.F2AL, PHF1LF2AH, PHF1HF.F2AL, IPN002LF2AH, or IPN002HF.F2AL coding region constructs were also assessed for concentrations of expressed antibodies by ELISA. Antibody concentrations from supernatants tested, are presented in Table 6.

    TABLE-US-00006 TABLE 6 Concentrations of expressed antibodies Construct name Antibody concentration g/ml MC1LF2AH 40.4 MC1HF.F2AL 4.5 PHF1LF2AH 28.3 PHF1HF.F2AL 2.9 IPN002LF2AH 10.2 IPN002HF.F2AL 1.6

    [0700] Cells expressing MC1LF2AH, PHF1LF2AH and IPN002LF2AH coding constructs produced the highest concentration of antibodies from transfected cells.

    Example 11

    Western Blotting for Anti-Tans Antibody Expression

    [0701] Anti-tau antibodies expressed using MC1HIRESL, MC1LIRESH, MC1HF2AL, MC1LF2AH, MC1HF.F2AL, MC1LF.F2AH, MC1HP2AL, MC1LP2AH, MC1HF.P2AL, MC1LF.P2AH, and MC1LG4S5H coding region constructs was assessed by Western blotting in both small and large volume (30 mL) cell culture experiments. Expi 293 cells expressing MC1HIRESL, MC1LIRESH, MC1HF2AL, MC1LF2AH, MC1HF.F2AL, MC1LF.F2AH, MEC1HP2AL, MC1LP2AH, MC1HF.P2AL, MC1LF.P2AB, or MC1LG4S5H coding region constructs were cultured to produce antibody-rich supernatant After centrifugation, supermatants were collected and two small samples of each were removed and mixed with equal volumes of Laemmli sample buffer. Samples were then boiled at 95 C. for 5 min before loading into two 4-20% polyacrylamide gels along with molecular weight markers. Both gels were run for 1-2hrs at 100V under reducing or non-reducing conditions. Proteins were then transferred to a nitrocellulose membrane for 2 hr at 4 C. and stained with anti-mouse IgGs. First membranes were placed in blocking buffer for 1 h at room temperature or overnight at 4 C. followed by incubation with anti-mouse IgG antibodies in blocking buffer overnight at 4 C. The membranes were then washed three times each for 5 min in TEST and incubated with enzyme-labeled secondary antibody in blocking buffer for 1 hr at room temperature. Membranes were washed three times each for 5 min in TBST then developed using a luminescent substrate.

    [0702] Under both reducing and non-reducing conditions, three coding region constructs showed limited expression when initially assessed by Western blot. In normal (reducing) conditions, antibody heavy chains usually run at approximately 50 kD, while light chains are evident at 25 kD. In supernatant from cells expressing MC1HF2AL and MC1LG4S5H coding regions, only the 25 kD species was evident while in supernatant from, cells expressing MC1HP2AL, neither species appeared. The remaining supematants showed the anticipated 25 and 5 GkD species under reducing conditions and several high molecular weight (80-150 kD) bands under non-reducing conditions.

    [0703] A similar experiment was conducted using MC1 LF2AH, MC 1HF.F2AL, IPN002LF2AH, IPN002HF.F2AL, PHF-1LF2AH, and PHF-1HF.F2AL coding region constructs. Western blot showed the expected 25 kD and 50 kD bands under reducing conditions and high molecular weight triplets under non-reducing conditions, similar to the appropriate controls (MC-1, PHF1 and IPN002 antibodies). LF2AH coding region constructs generated better expression levels for all three antibodies than the HF.F2AL coding region constructs.

    [0704] Antibody concentrations from scaled-up culture conditions (30 mL) were determined for select constructs (see Table 7).

    TABLE-US-00007 TABLE 7 Antibody concentrations from 30 mL cultures Construct name Concentration g/ml MC1LIRESH 20.3 MC1LF2AH 86.2 MC1HF.F2AL 9.9 MC1LF.F2AH 14.7 MC1HF.P2AL 15.9

    [0705] Coding construct MC1LF2AH yielded the highest concentration of antibody from transfected cells.

    Example 12

    Purification of Anti-Tau Antibody Constructs

    [0706] Anti-tau antibodies expressed in large volumes of Expi 293 cells (30 mL) were purified using protein A/G beads. A column was prepared with protein A/G bead resin and washed 3 times with loading buffer. Supematants were diluted with equal volumes of loading buffer and applied to the column. Unbound proteins were washed through with loading buffer. Elution buffer was added to the column and fractions collected. Fractions containing proteins were identified by absorbance at 280 nm, pooled together, neutralized and run on polyacrylamide gels as described in Example 4. Under reducing conditions, antibodies produced using MC1L1RE SH, MC1LF2AH, MC1LF.F2AL, MC1LF.F2AH, and MC1HF.P2AL coding region constructs yielded protein bands when examined by Western blotting that were similar to those observed with MC-1 control antibody (bands at 25 kD and 50 kD). Under non-reducing conditions, all expressed antibodies generated a triplet set of bands between 80-150kD, as did the MC-1 control.

    [0707] Purified anti-tau antibodies were then tested for their affinity to ePHF tau by ELISA assay as described in Example 9. Antibodies with the highest affinity for ePHF tau were those produced using MC1LF2AH, MC1HF.F2AL and MC1LF.F2AH coding region constructs. These antibodies all demonstrated affinity for ePHF tau that was similar to that observed with MC-1 control antibody.

    Example 13

    rAAV Production of Anti-Tau Autobodies Using HEK293T Cells

    [0708] HEK293 cells were transfected with three vectors simultaneously: anti-tau antibody encoding viral genomes, vectors expressing rep and cap genes; and a helper vector to generate rAAV9 products. Vector production was the greatest (highest AAV titer Vg/L) when using MC1F2AH and MC1HF.F2AL viral genomes. These two formats were then utilized to generate rAAV9 particles encoding anti-tau antibodies PHF1 and IPN002.

    Example 14

    Evaluation of Anti-Tau Antibody Constructs in Non-Human Primates

    [0709] Adult Rhesus macaque monkeys, pre-screened for low anti-AAV antibody levels, will receive intraparenchymal (IPa; thalamus and putamen) or intracisternal (CM) administration of anti-tau antibody AAV particles to assess expression, distribution and therapeutic potential.

    [0710] Anti-tau antibody AAV particles will be formulated in a solution comprising 180 mM sodium chloride, 10 mM sodium phosphate, and 0.001% Piuronic Acid. Dosing concentrations will be 2.110.sup.12 vg/ml for IPa administration and 110.sup.13 vg/ml for CM administration. For IPa administration (2.110.sup.12 vg/ml), two animals will each receive bilateral infusions (1-2 L) into the thalamus (150 L) and putamen (60 L) by convection enhanced delivery device guided by MRI. An additional three animals will each receive a single 1 ml. bolus injection into the CSF via the cisterna magna (110.sup.13 vg/ml). Animals will be monitored post-injection(s) for 28 days, with weekly body weight measurements and daily cage-side behavioral, mortality and morbidity checks serving as secondary readouts. Serum and CSF samples will be collected pre-dose and prior to necropsy.

    [0711] On day 29, animals will be transcardially perfused with PBS, tissues will be collected and drop fixed in paraformaldehyde for histological analyses or flash frozen for biochemical assay. Tissues processed for histological analysis will be sectioned and immunostained with HRP-labeled mouse IgG1 for presence of the tau antibodies. Further, these samples will be co-immunostained with NeuN, Iba1 or GFAP to identify cell-type. Samples snap frozen for biochemical analyses will be utilized for PCR to detect vector genomes and mRNA, ELISA to detect antibodies and MS to determine protein levels. Blood and CSF samples will be assessed for antibody and AAV levels.

    VIII. EQUIVALENTS AND SCOPE

    [0712] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims.

    [0713] In the claims, articles such as a, an, and the may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include or between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or the entire group members are present in, employed in, or otherwise relevant to a given product or process.

    [0714] It is also noted that the term comprising is intended to be open and permits but does not require the inclusion of additional elements or steps. When the term comprising is used herein, the term consisting of is thus also encompassed and disclosed.

    [0715] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

    [0716] In addition, it is to be understood that any particular embodiment of the present invention that fails within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the invention (e.g., any antibiotic, therapeutic or active ingredient; any method of production; any method of use: etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.

    [0717] It is to be understood that the words which have been used are words of description rather than limitation, and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the invention in its broader aspects.

    [0718] While the present invention has been described at some length and with some particularity with respect to the several described embodiments, it is not intended that it should be limited to any such particulars or embodiments or any particular embodiment, but it is to be construed with reference to the appended claims so as to provide the broadest possible interpretation of such claims in view of the prior art and, therefore, to effectively encompass the intended scope of the invention.