COL14A1-DERIVED TUMOR ANTIGEN POLYPEPTIDE AND USE THEREOF

20190224291 ยท 2019-07-25

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided are a tumour antigen polypeptide having the amino acid sequence as shown in SEQ ID NO: 2 or a variant thereof; a nucleic acid encoding same; a nucleic acid construct, an expression vector, and a host cell comprising the encoding nucleic acid; and an antigen presenting cell presenting the tumour antigen polypeptide on the cell surface and an immune effector cell thereof. Also provided is the use of the polypeptide, nucleic acid, antigen presenting cell or immune effector cell in the diagnosis, prevention and treatment of cancers.

    Claims

    1. An isolated peptide selected from the group consisting of: (a) a peptide consisting of the amino acid sequence shown in SEQ ID NO: 2; (b) a peptide which is derived from the amino acid sequence shown in SEQ ID NO: 2 by substitution, addition and/or deletion of one or more amino acid residues therein, and has the ability to induce cytotoxic T lymphocytes; and (c) a variant or derivative of the peptide (a) or the peptide (b) that has the ability to induce cytotoxic T lymphocytes, or an immunologically active fragment thereof.

    2. The peptide according to claim 1, wherein the peptide can be recognized by CD8+ T cells.

    3. The peptide according to claim 1, wherein the substitution, addition and/or deletion of one or more amino acids is the substitution of the amino acid at position 2 and/or position 9 of the amino acid sequence as shown in SEQ ID NO: 2; preferably, the substitution, addition and/or deletion of one or more amino acids is the substitution of L for the amino acid at position 2 and/or of L or V for the amino acid at position 9 of the amino acid sequence as shown in SEQ ID NO: 2; further preferably, the peptide (b) has the amino acid sequence as shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.

    4. An isolated nucleic acid encoding the peptide according to any one of claims 1-3.

    5. A nucleic acid construct comprising the nucleic acid according to claim 4, and one or more control sequences operably linked thereto and able to direct the production of the peptide in an expression host.

    6. An expression vector comprising the nucleic acid construct according to claim 5.

    7. A host cell into which the nucleic acid construct according to claim 5 or the expression vector according to claim 6 has been transformed or transfected.

    8. An antigen-presenting cell which presents the peptide according to any one of claims 1 to 3 on the cell surface.

    9. A method for producing the antigen-presenting cell according to claim 8, comprising the step of: contacting the peptide according to any one of claims 1 to 3 with a cell having an antigen-presenting ability, or comprising the steps of: introducing the nucleic acid according to claim 4, or the nucleic acid construct according to claim 5, or the expression vector according to claim 6 into a cell having an antigen-presenting ability and expressing the same therein; preferably, the cell having an antigen-presenting ability is a dendritic cell.

    10. An immune effector cell which can recognize the peptide according to any one of claims 1 to 3, or recognize an antigen-presenting cell which presents the peptide according to any one of claims 1 to 3 on the cell surface.

    11. A method for producing the immune effector cell according to claim 10, comprising the step of: contacting the antigen-presenting cell according to claim 8 with a cell with the ability of immune effect; preferably, the cell with the ability of immune effect is a T cell, preferably a CD8+ T cell.

    12. A targeted immune cell population which is formed by mixing and co-cultivating antigen-presenting cells with lymphocytes.

    13. A conjugate comprising the peptide according to any one of claims 1-3 and an anti-cancer drug.

    14. An antibody which specifically recognizes the peptide according to any one of claims 1-3.

    15. A method for producing an antibody, comprising: immunizing an animal with the peptide according to any one of claims 1-3; collecting serum of the immunized animal; and purifying the antibody of interest from the serum.

    16. A vaccine for treating or preventing a cancer in a patient, comprising the peptide according to any one of claims 1-3, or comprising the nucleic acid according to claim 4, or comprising the nucleic acid construct according to claim 5, or comprising the expression vector according to claim 6, or comprising the antigen-presenting cell according to claim 8, or comprising the immune effector cell according to claim 10; preferably, the cancer expresses the peptide according to any one of claims 1-3; further preferably, the cancer is selected from the group consisting of lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, and brain tumors.

    17. A pharmaceutical composition for treating or preventing a cancer in a patient, comprising the peptide according to claims 1-3, and a pharmaceutically acceptable carrier.

    18. Use of the peptide according to any one of claims 1 to 3 for the preparation of an antibody for preventing or treating a tumor, optionally, the tumor expresses both HLA-A0201 and the peptide, optionally, the tumor is selected from lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, and brain tumors.

    19. Use of the peptide according to any one of claims 1 to 3 for the preparation of a medicament for preventing or treating a tumor, optionally, the tumor expresses both HLA-A0201 and the peptide, optionally, the tumor is selected from lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, and brain tumors.

    20. Use of the peptide according to any one of claims 1 to 3 for the preparation of a vaccine for preventing or treating a tumor, optionally, the tumor expresses both HLA-A0201 and the peptide, optionally, the tumor is selected from lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, and brain tumors.

    21. Use of a detection reagent for the peptide according to any one of claims 1 to 3 or for the nucleic acid according to claim 4 for the preparation of a kit for diagnosing a cancer in a patient; preferably, the cancer expresses the peptide according to any one of claims 1-3; further preferably, the cancer is selected from the group consisting of lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, and brain tumors.

    22. A kit for diagnosing a cancer in a patient, comprising a detection reagent for the peptide according to any one of claims 1 to 3 or for the nucleic acid according to claim 4.

    23. A therapeutic method, comprising: administering to a patient an effective amount of the peptide according to any one of claims 1-3, the antigen-presenting cell according to claim 8, the immune effector cell according to claim 10, the targeted immune cell population according to claim 12, the conjugate according to claim 13, the antibody according to claim 14, the vaccine according to claim 16, or the pharmaceutical composition according to claim 17.

    24. A diagnostic method, comprising: detecting a biological sample from a patient for the presence of the peptide according to any one of claims 1-3; and determining the patient as having a tumor based on the presence of the peptide in the biological sample, optionally, the tumor expresses both HLA-A0201 and the peptide; optionally, the tumor is selected from the group consisting of lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, and brain tumors.

    Description

    DESCRIPTION OF THE DRAWINGS

    [0075] FIG. 1 is a graph showing the results of detecting the affinity of the peptide of the present invention to T2 cells by flow cytometry.

    [0076] FIG. 2 is a graph showing the results of specific killing of target cells presenting the peptide of the present invention by immune cells.

    [0077] FIG. 3 shows the inhibitory effect on tumor growth and mouse survival rate after immunotherapy with the peptide of the present invention; wherein FIG. 3A shows the inhibitory effect on tumor growth after treatment with an adjuvant, an adjuvant+a wild-type peptide (FMVDGSWSI, SEQ ID NO: 1), or an adjuvant+a mutant peptide FMVDGFWSI or the variant peptides thereof, FIG. 3B shows the mouse survival rate after treatment with an adjuvant, an adjuvant+a wild-type peptide (FMVDGSWSI), or an adjuvant+a mutant peptide FMVDGFWSI or the variant peptides thereof.

    [0078] FIG. 4 shows the inhibitory effect on tumor growth and mouse survival rate after immunotherapy with the peptide of the present invention; wherein FIG. 4A shows the inhibitory effect on tumor growth after treatment with DC loaded with a wild-type peptide (FMVDGSWSI), or DC loaded with a mutant peptide (FMVDGFWSI) or the variant peptides thereof, FIG. 4B shows the mouse survival rate after treatment with DC loaded with a wild-type peptide (FMVDGSWSI), or DC loaded with a mutant peptide FMVDGFWSI or the variant peptides thereof.

    [0079] FIG. 5 shows the inhibitory effect on tumor growth and mouse survival rate after immunotherapy with the peptide of the present invention; wherein FIG. 5A shows the inhibitory effect on tumor growth after treatment with DCs infected with lentivirus vector carrying a wild-type peptide (FMVDGSWSI), or a mutant peptide (FMVDGFWSI) or the variant peptides thereof; FIG. 5B shows the mouse survival rate after treatment with DCs infected with lentivirus vector carrying a wild-type peptide (FMVDGSWSI), or a mutant peptide (FMVDGFWSI) or the variant peptides thereof.

    [0080] FIG. 6 shows the inhibitory effect on tumor growth and mouse survival rate after immunotherapy with the peptide of the present invention; wherein FIG. 6A shows the inhibitory effect on tumor growth after treatment with DC loaded with a wild-type peptide (FMVDGSWSI)+CTL, or DC loaded with a mutant peptide (FMVDGFWSI) or the variant peptides thereof+CTL, FIG. 6B shows the mouse survival rate after treatment with DC loaded with a wild-type peptide (FMVDGSWSI)+CTL, or DC loaded with a mutant peptide (FMVDGFWSI) or the variant peptides thereof+CTL.

    DETAILED DESCRIPTION

    [0081] In order to facilitate understanding of the present invention, the following examples are exemplified in the present invention. It should be understood by those skilled in the art that the examples are only to facilitate the understanding of the present invention and should not be construed as specific limitations to the present invention.

    Example 1 Affinity Prediction of the Peptides of the Present Invention

    [0082] Affinity of the peptides was predicted by the following procedure:

    [0083] Based on the selected HLA allele type, affinity of the peptides was predicted by using a self-developed software for predicting the binding ability of a mutant peptide based on tumor DNA and RNA sequencing (software copyright number: 2016SR002835). The prediction results were expressed as IC50 score. An IC50 of less than 500 nm indicated that the peptide had an affinity, and an IC50 of less than 50 nm indicated that the peptide had a high affinity.

    [0084] The wild-type peptide FMVDGSWSI (SEQ ID NO: 1), the mutant peptide FMVDGFWSI of the present invention and the five variant peptides of the mutant peptide FMVDGFWSI (also belonging to the present invention) were obtained by standard solid phase synthesis and purified by reverse phase HPLC. The purity (>90%) and identity of the peptide were determined by HPLC and mass spectrometry, respectively. This example predicted the affinity of the above peptides of the present invention and the wild-type peptide to HLA-A0201 in the manner as above, and the prediction scores were shown in Table 1 below.

    TABLE-US-00001 TABLE 1 Affinity prediction results of the peptides to HLA-A0201 Mutant Peptides IC50 (nM) Wild-type Peptide IC50 (nM) FMVDGFWSI 2.18 FMVDGSWSI 3.93 FMVDGFWSL 2.32 FMVDGFWSV 2.56 FLVDGFWSI 2.87 FLVDGFWSL 3.01 FLVDGFWSV 3.14

    [0085] It can be seen from Table 1 that as predicted by the computer software, the IC50 scores of the mutant peptides of the present invention were less than 50 nM, indicating that the mutant peptides of the present invention had a high affinity to HLA-A0201.

    Example 2 Affinity Verification of the Peptides of the Present Invention to T2 Cells

    [0086] According to the manner described in Example 1, the wild-type peptide FMVDGSWSI, the peptide FMVDGFWSI of the present invention and the FMVDGFWSI's five variant peptides were obtained; 210.sup.5 T2 cells (a lymphocyte, tumor cell line, expressing HLA-A0201; T2 cell is a cell strain that is deficient in an antigen peptide transporter (TAP) that is essential for endogenous antigen presentation pathway, and is a hybridoma cell from HLA-A2-positive T and B lymphocytess, and can be used to study the affinity of a peptide to HLA-A2 and the interaction of T cells with MHC-I molecule; ATCC Cat. No.: CRL-1992) were resuspended into a 24-well plate with 500 l of serum-free IMDM medium. 10 g/ml of each peptide as described above was added, and human (32 microglobulin (at a final concentration of 3 g/ml) was added and cultured overnight in an incubator (37 C., 5% CO.sub.2). Two replicate wells were set up for each group. T2 cells without the addition of a peptide were used as a background control (i.e., blank), and the group added with the CMV peptide (NLVPMVATV) was used as a positive control.

    [0087] Cells were collected by centrifugation of the cell culture at 200 g for 5 minutes. The collected cells were washed twice with PBS, and then directly incubated with FITC-conjugated anti-HLA-A0201 monoclonal antibody at 4 C. for 30 minutes. The mean fluorescence intensity (MFI) was then detected and analyzed by flow cytometer (BD FACSJazz) and its software. The fluorescence index (FI) was calculated by using the following formula:


    FI=[MFI.sub.sampleMFI.sub.background]/MFI.sub.background;

    [0088] Wherein, the MFI.sub.background represents a value without peptide; FI>1.5 indicates that the peptide has a high affinity for HLA-A0201 molecule, 1.0<FI<1.5 indicates that the peptide has a medium affinity for HLA-A0201 molecule, and 0.5<FI<1.0 indicates that the peptide has a low affinity for HLA-A0201 molecule.

    [0089] The affinity detection results of the respective peptides described above to HLA-A 0201 were shown in Table 2 below.

    TABLE-US-00002 TABLE 2 Concentration of Average the added fluorescence Sample peptide intensity FI FMVDGSWSI 100 M 772.5 2.38 FMVDGFWSI 100 M 763.9 2.35 FMVDGFWSL 100 M 748.3 2.28 FMVDGFWSV 100 M 721.2 2.16 FLVDGFWSI 100 M 701.3 2.07 FLVDGFWSL 100 M 663.9 1.91 FLVDGFWSV 100 M 642.5 1.81 blank 0 M 228.3 0 CMV 100 M 663.2 1.90

    [0090] It can be seen from Table 2 that, through the affinity verification, the FI of the blank group was 0, and the FI of the CMV peptide which was used as a positive control was 1.90, both of which were normal; while the FIs of the wild-type peptide and the mutant peptides of the present invention were both greater than 1.5, further demonstrating that the wild-type peptide and the mutant peptides of the present invention were all highly affinitive.

    Example 3 In Vitro Stimulation and Expansion of CD8+ T Cells by the Peptides of the Present Invention

    [0091] 210.sup.7 PBMC cells were taken from the subtype HLA-A0201-positive volunteers. Mononuclear cells were isolated by an adherence method (adhering for 3 h), and CD8+ T cells were isolated by using CD8 magnetic beads. Adherent mononuclear cells were induced into immature DCs with GM-CSF (1000 U/ml) and IL-4 (1000 U/ml), and further induced into peptide-specific mature DCs with IFN- (100 U/ml), CD40L (100 U/ml) and each of the mutant peptide FMVDGFWSI of the present invention and the five variant peptides thereof. The mature DCs loaded with peptides were irradiated, and co-cultured with CD8+ T cells from volunteers, and IL-21 was added. After 3 days, IL-2 and IL-7 were supplemented. Afterwards, IL-2 and IL-7 were again supplemented on day 5 and day 7, respectively (the final concentrations of IL-21, IL-2 and IL-7 were 30 ng/ml, 5 ng/ml and 10 ng/ml, respectively). The co-cultured cells were counted on day 10 and subsequently subjected to ELISPOTs and LDH tests. The counting results were shown in Table 3 below.

    TABLE-US-00003 TABLE 3 Cell counting results after culture Total number of cells in Total number of cells in the well before culture the well after culture FMVDGFWSI 2.5 10{circumflex over ()}6 1.72 10{circumflex over ()}7 FMVDGFWSL 2.5 10{circumflex over ()}6 1.67 10{circumflex over ()}7 FMVDGFWSV 2.5 10{circumflex over ()}6 1.61 10{circumflex over ()}7 FLVDGFWSI 2.5 10{circumflex over ()}6 1.56 10{circumflex over ()}7 FLVDGFWSL 2.5 10{circumflex over ()}6 1.46 10{circumflex over ()}7 FLVDGFWSV 2.5 10{circumflex over ()}6 1.37 10{circumflex over ()}7

    [0092] It can be seen from Table 3 that after 10 days of culture, the cells proliferated significantly, and the expansion fold of the total number of cells was between 5-7 folds, indicating that the addition of the peptides of the present invention can significantly stimulate the expansion of CD8+ T cells.

    Example 4 Activation of a CD8+ T Cell Immune Response by the Peptides of the Present Invention as Verified by ELISPOTs

    [0093] In this example, a ELISPOTs detection kit (Cat. No.: 3420-4AST-10, MABTECH) was used to verify the activation of an immune response of CD8+ T cells by the peptides of the present invention.

    [0094] Principle of the ELISPOTs detection method is as follows: CD8+ T cells can specifically recognize the complex of HLA-A0201 and a peptide. The population of T cells recognizing the complex of the peptide and HLA-A0201 is varying, depending on the peptide sequence. Since T2 cells express HLA-A0201, CD8+ T cells can specifically recognize the T2 cells loaded with a peptide. After specific recognition of the complex of HLA-A0201 and the peptide, peptide-specific CD8+ T cells can be activated again to secrete IFN-gamma interferon. The IFN-gamma interferon secreted by the activated CD8+ T cells can be captured by antibodies on the ELISPOTs plate. Finally, the enzyme-conjugated antibody that recognizes IFN-gamma can degrade the substrate through the enzyme conjugated thereto and develop color, eventually producing spots. The number of spots represents the number of cells that are activated to secrete IFN-gamma interferon.

    [0095] The cultured cells from Example 3 were added, along with T2 cells loaded with the mutant peptide FMVDGFWSI of the present invention and the wild-type peptide FMVDGSWSI, respectively, into ELISPOTs plates, and cultured for 20 h, and then a ELISPOTs detection was performed (see the kit instruction). Finally, the spots produced by the ELISPOTs detection were counted.

    [0096] The peptide was determined to have immunogenicity when the number of spots of the tested peptide/the number of spots of an unrelated peptide>2; that is, if the number of spots caused by the tested peptide is more than twice than that of an unrelated peptide, the tested peptide is determined to have immunogenicity.

    [0097] ELISPOTs detection results of the peptides of the present invention were shown in Table 4 below.

    TABLE-US-00004 TABLE 4 Secretion of IFN- interferon by specific CD8+ T cells stimulated by a peptide Number Peptide and its of spots variants in the Number of capable mutant spots in the Fold of activating T peptide wild-type (tested/wild- cells group peptide group type) Conclusion FMVDGFWSI 332 33 10.06 immunogenic FMVDGFWSL 328 37 8.86 immunogenic FMVDGFWSV 323 41 7.87 immunogenic FLVDGFWSI 314 28 11.21 immunogenic FLVDGFWSL 308 30 10.26 immunogenic FLVDGFWSV 301 31 9.71 immunogenic

    [0098] It can be seen from Table 4 that the peptide of the present invention and its variants are immunogenic and can specifically activate a CD8+ T cell immune response.

    Example 5 Specific Killing Activity of CD8+ T Cells Against Target Cells Presenting the Peptide of the Present Invention as Demonstrated by a LDH Release Assay

    [0099] The cells cultured in Example 3 were co-cultured with T2 cells loaded with the mutant peptides of the present invention or the wild-type peptide or without a peptide. A maximum release well, a volume correction well, a medium control well, a spontaneous release well and control wells for example at different effector-to-target ratios (ratios of T cells to T2 cells) were set in this experiment. Three replicate wells were set for each group. After 4 h, 50 l of the co-culture supernatant was taken out and added to 50 l of LDH substrate mixture to catalyze the reaction of LDH substrate. Finally, the plates were read at a wavelength of 490 nm, with a reference wavelength of 680 nm, and the killing activity against target cells T2 was calculated based on the control wells. The test results were shown in FIG. 2 and Table 5 below.

    TABLE-US-00005 TABLE 5 Specific recognition and killing of target cells presenting test peptides by T cells effector- effector- to-target to-target Group ratio (1:1) ratio (10:1) T cells (FMVDGFWSI) + T2 (FMVDGSWSI) 2.23% 5.23% T cells (FMVDGFWSI) + T2 (FMVDGFWSI) 9.22% 46.37% T cells (FMVDGFWSL) + T2 (FMVDGSWSI) 3.12% 4.91% T cells (FMVDGFWSL) + T2 (FMVDGFWSI) 9.03% 44.48% T cells (FMVDGFWSV) + T2 (FMVDGSWSI) 3.37% 5.63% T cells (FMVDGFWSV) + T2 (FMVDGFWSI) 8.76% 41.36% T cells (FLVDGFWSI) + T2 (FMVDGSWSI) 2.65% 5.53% T cells (FLVDGFWSI) + T2 (FMVDGFWSI) 8.53% 40.12% T cells (FLVDGFWSL) + T2 (FMVDGSWSI) 3.13% 6.33% T cells (FLVDGFWSL) + T2 (FMVDGFWSI) 8.37% 37.26% T cells (FLVDGFWSV) + T2 (FMVDGSWSI) 3.26% 6.01% T cells (FLVDGFWSV) + T2 (FMVDGFWSI) 8.07% 35.24%

    [0100] It can be seen from the results of FIG. 2 and Table 5 that, at an effector-to-target ratio of 1:1 or 1:10, the activated T cells by the mutant peptide FMVDGFWSI of the present invention or the variant peptides thereof were capable of killing T2 cells presenting the mutant peptide, but not the T2 cells presenting a wild-type peptide, further demonstrating that the mutant peptides of the present invention were capable of specifically killing target cells presenting the mutant peptide FMVDGFWSI.

    Example 6 Construction and Packaging of Recombinant Lentiviruses of the Mutant Peptide FMVDGFWSI and the Variant Peptides Thereof

    [0101] The following DNA sequences were synthesized: TTCATGGTGGATGGATCTTGGAGCATA (SEQ ID NO: 8), encoding the wild-type peptide FMVDGSWSI; TTCATGGTGGATGGATTCTGGAGCATA (SEQ ID NO: 9), encoding the mutant peptide FMVDGFWSI; TTCATGGTGGATGGATTCTGGAGCCTG (SEQ ID NO: 10), encoding the FMVDGFWSI's variant peptide FMVDGFWSL; TTCATGGTGGATGGATTCTGGAGCGTC (SEQ ID NO: 11), encoding the FMVDGFWSI's variant peptide FMVDGFWSV; TTCCTGGTGGATGGATTCTGGAGCATA (SEQ ID NO: 12), encoding the FMVDGFWSI's variant peptide FLVDGFWSI; TTCCTGGTGGATGGATTCTGGAGCCTG (SEQ ID NO: 13), encoding the FMVDGFWSI's variant peptide FLVDGFWSL; and TTCCTGGTGGATGGATTCTGGAGCGTC (SEQ ID NO: 14), encoding the FMVDGFWSI's variant peptide FLVDGFWSV. The wild-type peptide FMVDGSWSI, the mutant peptide FMVDGFWSI and the mutant peptide FMVDGFWSI's variant peptides were constructed into the lentiviral vector pHBLV-Puro, respectively, to name as pHBLV-Puro-FMVDGSWSI, pHBLV-Puro-FMVDGFWSI, pHBLV-Puro-FMVDGFWSL, pHBLV-Puro-FMVDGFWSV, pHBLV-Puro-FLVDGFWSI, pHBLV-Puro-FLVDGFWSL and pHBLV-Puro-FLVDGFWSV, respectively. The seven lentiviral constructs were co-transfected into 293T cells with helper plasmids pSPAX2 and pMD2G for packaging, and lentiviruses of the wild-type peptide FMVDGSWSI, the mutant peptide FMVDGFWSI and the mutant peptide's variant peptides were obtained.

    Example 7 Establishment of a Human Lung Cancer Cell Line Expressing the Mutant Peptide FMVDGFWSI

    [0102] The human non-small cell lung adenocarcinoma cell line NCI-H2087 which was HLA-A*0201 positive was purchased from ATCC. The cells were cultured in DMEM medium containing 10% fetal bovine serum, 100 U/mL penicillin and 100 U/ml streptomycin in an incubator at 37 C., 5% CO.sub.2. The lentivirus of FMVDGFWSI as packaged in Example 6 was transfected into the H2087 cell line. Transfected cells were continuously screened by using antibiotic puromycin to finally establish a H2087 cell line expressing FMVDGFWSI peptide which was named as H2087-FMVDGFWSI cell line.

    Example 8 Human Immune Reconstitution in NOD SCID Mice

    [0103] 600-900 ml of anticoagulated peripheral blood was collected from healthy volunteers for isolating peripheral blood mononuclear cells (PBMCs) via Ficoll. Cells were collected for use. 2PBMCs per 0.5 ml was intraperitoneally injected into each of 300 NOD SCID mice without immune leakage to perform human immune reconstitution in NOD SCID mice. After 4 weeks, the mice were selected to be inoculated with the human lung cancer cell line.

    Example 9 Establishment of a Subcutaneous Xenograft Model of H2087-FMVDGFWSI

    [0104] The human non-small cell lung adenocarcinoma cell line H2087-FMVDGFWSI as established in Example 7 was cultured in DMEM medium containing 10% fetal bovine serum, 100 U/mL penicillin and 100 U/mL streptomycin in an incubator at 37 C., 5% CO.sub.2. H2087-FMVDGFWSI tumor cells were collected, centrifuged at 1500 rpm for 5 min, and washed 3 times with sterile physiological saline. The tumor cells were diluted appropriately. To 40 l of cell suspension was added 10 l of 0.4% phenol blue for staining and microscopically counting cells. A tumor cell suspension at a concentration of 1*10.sup.8 cells/ml was prepared. 100 l of the tumor cell suspension was inoculated subcutaneously into a NOD/SCID mouse or an immune-reconstituted NOD/SCID mouse. After inoculation, the inoculation site was daily observed for the presence or absence of an infection. It was also observed whether there was a spontaneous regression after tumor growth. The long diameter a and the short diameter b of the tumor were measured with a vernier caliper every 2-3 days and the size of the tumor was calculated as a*b*b/2. The mice and tumors were weighed and recorded every day. After 7 days, a tumor with about the size of a grain of rice could be touched under the skin of mouse. At this time, the H2087-FMVDGFWSI subcutaneous tumor model NOD/SCID mice were treated with DC-CTL vaccines. The H2087-FMVDGFWSI subcutaneous tumor model NOD/SCID mice that had been subjected to immune reconstitution for 4 weeks were treated with a peptide+complete Freund's adjuvant, or a peptide+DC vaccine, or lentivirus-infected DC vaccine, and DC-CTL vaccine, respectively. The tumor volume and the survival rate of mice were recorded every 2 days.

    Example 10 Treatment Regimen with Peptide Vaccines

    [0105] The H2087-FMVDGFWSI subcutaneous tumor model NOD/SCID mice that had been subjected to immune reconstitution for 4 weeks were randomly divided into 8 groups: adjuvant+wild-type peptide group, adjuvant group, adjuvant+FMVDGFWSI peptide group, and groups of adjuvant+each of the FMVDGFWSI's 5 variant peptides, with 6 mice per group. The first immunization dose of the peptides described above was 100 g/mouse. Each of the peptides was resuspended in PBS, mixed with 150 l of Freund's complete adjuvant per mouse, and then adjusted with PBS to 300 l per mouse, and injected subcutaneously at two points on the back. After 2 weeks, the same dose was used for booster immunization (using a complete Freund's adjuvant for the first one, and using an incomplete Freund's adjuvant for the others), with a total of 4 immunizations. The general characteristics including mental state, activity, response, diet, body weight and tumor growth of the tumor-bearing mice were observed daily. The longest diameter (a) and the shortest diameter (b) of a tumor were measured with a vernier caliper every 2 days. Tumor volume was calculated as: lengthwidth.sup.2. The results were shown in FIG. 3. The results showed that, as compared to the adjuvant alone group and the wild-type peptide group, FMVDGFWSI or its variant forms+Freund's adjuvant effectively inhibited tumor growth and prolonged the survival period of mice. The formula for calculating the survival period was as follows: survival rate within a certain period of time=surviving mice within this period of time/(surviving mice within this period of time+dead mice within this period of time)*100%.

    Example 11 Preparation of a DC Peptide Vaccine and Treatment Regimen Using this Vaccine

    [0106] 100-150 ml of anticoagulated peripheral blood was collected from healthy volunteers for isolating peripheral blood mononuclear cells via Ficoll. PBMCs were collected, resuspended in RPMI 1640 medium at 2310.sup.6 cells/ml, and incubated at 37 C. for 2 h. The adherent cells which were DCs were induced into mature DCs with 1000 U/ml GM-CSF, 1000 U/ml IL-4, 100 U/ml IFN- and 100 U/ml CD40L. Mature DCs were harvested, and then wild-type peptide, the mutant peptide FMVDGFWSI and the FMVDGFWSI's five variant peptides (at a concentration of 10 g/ml) were added respectively, co-incubated for 4 hours and then washed with physiological saline for three times. The DCs loaded with a peptide were adjusted to (4.00.5)10.sup.7 cells/ml with physiological saline for subsequent experiments.

    [0107] Tumor-bearing mice were randomly divided into 7 groups: DC loaded with wild-type peptide group, DC loaded with the mutant peptide FMVDGFWSI group, and groups of DC loaded with each of the FMVDGFWSI's 5 variant peptides, with 6 mice per group. Cell suspensions of the DCs loaded with wild-type peptide, the DCs loaded with the mutant peptide FMVDGFWSI, and the DCs loaded with each of the FMVDGFWSI's 5 variant peptides were prepared. 0.1 ml was injected intracutaneously into each side of the inner thigh near groin of the tumor-bearing mouse once a week. For each group, the dose was (4.00.5)10.sup.6 cells/injection, and a total of 2 injections was performed. After injection, vital signs of the mice were observed, and the vertical and horizontal dimensions of tumors were measured with a vernier caliper every two days. Tumor volume was calculated as follows: tumor volume=lengthwidth.sup.2. At the same time, the changes in body weight and survival of the mice were recorded. The results were shown in FIG. 4. The results in FIG. 4 showed that, compared to the group of DC vaccine loaded with wild-type peptide, DC vaccines loaded with FMVDGFWSI or the variant peptides thereof significantly prolonged survival period of mice and slowed down tumor growth in mice.

    Example 12 Preparation of a DC Vaccine by Injection with Recombinant Lentivirus Containing a Peptide Gene and Treatment Regimen Using this Vaccine

    [0108] 100-150 ml of anticoagulated peripheral blood was collected from healthy volunteers for isolating peripheral blood mononuclear cells via Ficoll. PBMCs were collected, and incubated at 37 C. for 2 h. Non-adherent cells were washed away and DCs were cultured with recombinant human granulocyte-macrophage colony-stimulating factor (rhGM-CSF) and recombinant human interleukin-4 (rhlL-4). On day 5 of culturing, half of the medium was replaced and the cell density was adjusted to 1*10.sup.6 cell/ml; solutions of recombinant lentiviruses of the wild-type peptide, the mutant peptide FMVDGFWSI or the FMVDGFWSI's five variant peptides (as constructed in Example 6) were added at an appropriate amount. After 24 h, the virus-containing culture medium was removed, and a culture medium containing 50 ng/ml rhlL-4, 100 ng/ml rh GM-CSF, 100 U/ml IFN- and 100 U/ml CD40L was added for culturing in an incubator at 37 C., 5% CO.sub.2. After 16 h, the DCs were adjusted to (4.00.5)10 cells/ml for subsequent experiments.

    [0109] Tumor-bearing mice were randomly divided into 7 groups: wild-type peptide-DC group, FMVDGFWSI peptide-DC group, and groups of each of the FMVDGFWSI's 5 variant peptides-DC, with 6 mice per group. Cell suspensions of the DCs loaded with wild-type peptide, the DCs loaded with the mutant peptide FMVDGFWSI, and the DCs loaded with each of the FMVDGFWSI's 5 variant peptides were prepared. 0.1 ml was injected intracutaneously into each side of the inner thigh near groin of the immune-reconstituted tumor-bearing mouse once a week. For each group, the dose was (4.00.5)10.sup.6 cells/injection, and a total of 2 injections was performed. After injection, vital signs of the mice were observed, and the vertical and horizontal dimensions of tumors were measured with a vernier caliper every two days. Tumor volume was calculated as follows: tumor volume=lengthwidth.sup.2. At the same time, the changes in body weight and survival of the mice were recorded. The results were shown in FIG. 5 which showed that the DC vaccines infected with recombinant lentivirus containing gene of the mutant peptide FMVDGFWSI or its five variant peptides had significant tumor-suppressing effects and prolonged the survival period of mice compared to the group of wild-type peptide which had no effect on this tumor.

    Example 13 Preparation of a Peptide-Specific CTL Vaccine and a In Vivo Treatment Regimen Using this Vaccine

    [0110] 100-150 ml of anticoagulated peripheral blood was collected from healthy volunteers for isolating peripheral blood mononuclear cells via Ficoll. PBMCs were collected, resuspended in RPMI 1640 medium at 2-310.sup.6 cells/ml, and incubated at 37 C. for 2 h. The non-adherent cells, which were peripheral blood lymphocytes (PBLs), were pipetted.

    [0111] The collected PBLs were subjected to magnetic bead sorting to obtain CD8+ T cells, which were sensitized by co-incubation with DCs loaded with the wild-type peptide, DCs loaded with the mutant peptide FMVDGFWSI and its five variant peptides at a cell ratio of DCs:CD8+ T cells=1:4. 500 IU/ml of IL-2 and 50 ng/ml of IL-7 were added to the medium to co-incubate in an incubator at 37 C., 5% CO.sub.2, and cell counting was performed after 1 week of culturing; a second round of stimulation was performed at week 2 by adding DCs loaded with FMVDGFWSI peptide, DCs loaded with the FMVDGFWSI's five variant peptides, or DCs loaded with the wild-type peptide, and 500 IU/ml of IL-2. The same procedure was carried out at week 3. Thus, three rounds of stimulation were performed. Medium was appropriately added during culturing. The number of lymphocytes was counted and a cell proliferation index (PI) was calculated on days 0, 7, 14, and 21 of culture, respectively. PI=number of cells after expansion/number of cells inoculated. On day 7 after the third stimulation (i.e., day 21 of culture), cells, i.e., cytotoxic T lymphocytes (CTLs) were harvested. The cells were resuspended in physiological saline to a volume of 0.2 ml, and were reinfused through tail vein at about 110.sup.8 cells per tumor model mouse. After injection, vital signs of the mice were carefully observed and the vertical and horizontal dimensions of the tumors were measured with a vernier caliper every 2 days.

    [0112] The results were shown in FIG. 6. The results in FIG. 6 showed that, compared to the wild-type peptide group, the DC-CTL vaccines that were activated by the mutant peptide FMVDGFWSI or the five variant peptides thereof had significant tumor-suppressing effects and prolonged the survival period of mice.

    [0113] The Applicant states that the method of the present invention and application and effects thereof are illustrated through the above examples, however, the present invention is not limited thereto. Those skilled in the art should understand that, for any improvement of the present invention, the equivalent replacement of the products of the present invention, the addition of auxiliary components, and the selection of specific modes, etc., will all fall within the scope of protection and the scope of disclosure of the present invention.