NOVEL SACCHAROMYCES CEREVISIAE EXPRESSION SYSTEM AND CONSTRUCTION METHOD THEREOF

Abstract

A Saccharomyces cerevisiae expression system and a construction method and application thereof, including an expression vector which includes, from 5 to 3, a YEplac195 plasmid backbone, an exogenous gene expression cassette, and a selective marker gene expression cassette. The exogenous gene expression cassette includes from upstream to downstream an rDNA promoter, an internal ribosome entry site (IRES) sequence, an exogenous gene expression cassette, a poly(T) sequence, and an rDNA terminator. The selective marker gene expression cassette includes a promoter, a selective marker gene, and a transcription terminator.

Claims

1. A Saccharomyces cerevisiae expression system consisting of a host transfected by an expression vector, wherein the expression vector is circular and is a shuttle plasmid vector constructed between Saccharomyces cerevisiae and Escherichia coli, and the expession vector comprises a plurality of operable elements, the plurality of operable elements comprising sequentially from 5 to 3 a YEplac195 plasmid backbone, an exogenous or endogenous gene expression cassette, and a selective marker gene expression cassette; wherein the YEplac195 plasmid is a yeast episomal plasmid including an ori of a yeast 2 plasmid; wherein the exogenous or endogenous gene expression cassette comprises sequentially from upstream to downstream: an rDNA promoter, an internal ribosome entry site sequence, an exogenous or endogenous gene expression cassette, a poly(T) sequence, and an rDNA terminator; and wherein the selective marker gene expression cassette comprises a promoter, a selective marker gene, and a transcription terminator.

2. The expression system of claim 1, wherein the exogenous or endogenous gene in the exogenous or endogenous gene expression cassette is a uracil gene or GFP gene.

3. The expression system of claim 2, wherein the uracil gene is derived from Saccharomyces cerevisiae, and has a sequence of SEQ ID NO: 4.

4. The expression system of claim 1, wherein the rDNA promoter and the rDNA terminator in the exogenous or endogenous gene expression cassette have sequences of SEQ ID NO: 1 and SEQ ID NO: 2 respectively; the internal ribosome entry site sequence in the exogenous or endogenous gene expression cassette is SEQ ID NO: 3; and the poly(T) sequence in the exogenous or endogenous gene expression cassette is SEQ ID NO: 5.

5. The expression system of claim 1, wherein the sequence of the promoter in the selective marker gene expression cassette is SEQ ID NO: 8; and the sequence of the terminator in the selective marker gene expression cassette is SEQ ID NO: 9.

6. The expression system of claim 5, wherein the selective marker gene in the selective marker gene expression cassette is a hygromycin B resistance gene and/or a G418 resistance gene; wherein the sequence of the hygromycin B resistance gene is SEQ ID NO: 6, and the sequence of the G418 resistance gene is SEQ ID NO: 7.

7. A method for constructing an expression system comprising: constructing the expression vector of claim 1; inserting a gene coding frame into the expression vector at cleavage sites to be inserted by exogenous genes to obtain a recombinant expression vector; transforming the recombinant expression vector into a host strain Saccharomyces cerevisiae; and screening and verifying positive transformants of the host strain Saccharomyces cerevisiae.

8. The method of claim 7, wherein transforming the recombinant expression vector into the host strain Saccharomyces cerevisiae comprises PEG-LiAc transformation, electrotransformation, or protoplast transformation.

9. A protein expressed by the expression system of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0024] FIG. 1 is a PCR validation diagram of a hygromycin b gene expression cassette constructed onto YEplac195 in Embodiment 1, where M represents a 1 kb DNA marker; and 1 represents a Hyg B-TEF1 terminator gene fragment obtained by amplifying through colony PCR using primers Hyg B-F and pJ-TEF1-Nco I-R;

[0025] FIG. 2 is a PCR validation diagram of respective elements of a uracil gene expression cassette constructed onto YEp-Hyg B in Embodiment 1, where M represents a 1 kb DNA marker; and 1 represents a URA3-poly(T)-rDNA terminator gene fragment obtained by amplifying using primers Asc I-URA3-F and rDNAt-Hind III-R;

[0026] FIG. 3 is a PCR validation diagram for confirming the transformation of the novel expression vector YEp-Hyg B-RIUTR into Saccharomyces cerevisiae in Embodiment 2, where M represents a 1 kb DNA marker; and 1 represents an rDNA promoter-IRES-URA3 gene fragment obtained by amplifying through PCR using primers Sac I-rDNAp-F and URA3-Xho I-R; and

[0027] FIG. 4 shows a gradient growth test of the novel expression system on a synthetic medium with or without uracil in Embodiment 3.

DETAILED DESCRIPTION

[0028] The technical solution of the present invention will be described in detail below with reference to embodiments. These embodiments are for illustrative only, and should not be considered as limiting the scope of the present invention. Modifications or substitutions made to methods, steps or conditions of the present invention are deemed to fall within the scope of the present invention, without departing from the spirit and essence of the present invention.

[0029] In order to verify the feasibility and effectiveness of the expression system in a yeast described herein, the expression of a uracil gene is used as an example, and the example in which this expression system is used to express the uracil gene to enable a host strain which cannot synthesize uracil to obtain the ability of synthesizing uracil is illustrated, where the specific implementation process is as follows:

Embodiment 1: Construction of Yeast Expression Vector

[0030] 1. Construction of Expression Cassette for Hygromycin B-Resistant Gene

[0031] A hygromycin B gene expression cassette Sal I-TEF1p-Hyg B-TEF1t-Nco I which was about 1500 bp and had cleavage sites to be digested by enzymes Sal I and Nco I was obtained through amplification by using the plasmid YEp-CH as a template, and using primers Sal I-pJ-TEF1-F (5-CATTTCCCCGAAAAGTGCCACCTGACGTCGACATGGAGGCCCAGAATA CC-3SEQ ID NO: 10) and pJ-TEF1-Nco I-R (5-CTTTAGCGGCTTAACTGTGCCCTCCATGGCAGTATAGCGACCAGCATTC AC-3SEQ ID NO: 11), where the PCR amplification conditions were 30 cycles of pre-denaturation at 95 C. for 3 min, denaturation at 95 C. for 45 s, annealing at 52 C. for 15 s, and extension at 72 C. for 1.5 min, and final extension at 72 C. for 5 min.

[0032] 2. Construction of Plasmid YEp-Hyg B Containing Hygromycin B Resistance Gene

[0033] The plasmid YEplac195 and the hygromycin B gene expression cassette Sal I-TEF1p-Hyg B-TEF1t-Nco I were digested by the enzymes Sal I and Nco I, then ligated and transformed into Escherichia coli DH5a. The transformants were picked, and then the plasmid was extracted and validated through colony PCR by using primers Hyg B-F (5-ATGCCTGAACTCACCGCG-3SEQ ID NO: 12) and pJ-TEF1-Nco I-R (5-CTTTAGCGGCTTAACTGTGCCCTCCATGGCAGTATAGCGACCAGCATTC AC-3SEQ ID NO: 11), where the PCR amplification conditions were 30 cycles of pre-denaturation at 95 C. for 3 min, denaturation at 95 C. for 45 s, annealing at 56 C. for 15 s, and extension at 72 C. for 2 min, and final extension at 72 C. for 5 min. A band of about 1300 bp was obtained through the amplification (as shown in FIG. 1), indicating that the hygromycin B expression cassette was successfully ligated onto YEplac195, and a recombinant plasmid YEp-Hyg B containing the hygromycin B gene expression cassette was obtained.

[0034] 3. Amplification of Respective Elements in Uracil Gene Expression Cassette

[0035] (1) Amplification of rDNA promoter: an rDNA promoter fragment which was about 600 bp and had an IRES element homology arm was obtained through PCR amplification by using the genomic DNA of Saccharomyces cerevisiae BY4741 as a template, and using primers Sac I-rDNAp-F (5-CATTTCCCCGAAAAGTGCCACCTGACGTCGACATGGAGGCCCAGAATA CC-3SEQ ID NO: 10) and rDNAp-IRES-R (5-CTTTAGCGGCTTAACTGTGCCCTCCATGGCAGTATAGCGACCAGCATTC AC-3SEQ ID NO: 11), where the PCR amplification conditions were 30 cycles of pre-denaturation at 95 C. for 3 min, denaturation at 95 C. for 45 s, annealing at 52 C. for 15 s, and extension at 72 C. for 40 s, and final extension at 72 C. for 5 min.

[0036] (2) Amplification of IRES fragments: The sequence of CrPV intergenic region (IGR) IRES was obtained by looking it up in the NCBI (National Center for Biotechnology Information) Genome. The IRES sequence was then obtained by full-length gene synthesis, and then was subjected to PCR amplification by using a plasmid pUC57-IRES which contains the IRES sequence as a template, and using primers rDNAp-IRES-F (5-GAAAGCAGTTGAAGACAAGTTCGAAAAGAGAAAGCAAAAATGTGATC TTGC-3SEQ ID NO: 13) and Asc I-IRES-R (5-TTGGCGCGCCTTGAAATGTAGCAGGTAAATTTC-3SEQ ID NO: 14), so as to obtain a IRES element fragment which was about 250 bp and had an rDNA promoter element homology arm, where the PCR amplification conditions were 30 cycles of pre-denaturation at 95 C. for 3 min, denaturation at 95 C. for 45 s, annealing at 52 C. for 15 s, and extension at 72 C. for 20 s, and final extension at 72 C. for 5 min.

[0037] (3) Fused amplification of rDNA promoter fragment and IRES fragment: a Sac I-rDNAp-IRES-Asc I fragment which was about 850 bp and had cleavage sites to be digested by enzymes Sac I and Asc I was obtained through fused amplification by using the rDNA promoter fragment which had the IRES element homology arm and the IRES element fragment which had the rDNA promoter element homology arm as templates respectively and using primers Sac I-rDNAp-F and Asc I-IRES-R, where the PCR amplification conditions were 30 cycles of pre-denaturation at 95 C. for 3 min, denaturation at 95 C. for 45 s, annealing at 52 C. for 15 s, and extension at 72 C. for 50 s, and final extension at 72 C. for 5 min.

[0038] (4) Amplification of uracil gene open reading expression cassette: the uracil sequence was subjected to PCR amplification by for example using a plasmid pJFE3 as a template and using primers Asc I-URA3-F (5-TTGGCGCGCCATGTCGAAAGCTACATATAAG-3SEQ ID NO: 15) and URA3-Xho I-R (5-CCGCTCGAGTTAGTTTTGCTGGCCGC-3SEQ ID NO: 16), so as to obtain a uracil gene open reading frame of about 850 bp, where the PCR amplification conditions were 30 cycles of pre-denaturation at 95 C. for 3 min, denaturation at 95 C. for 45 s, annealing at 52 C. for 15 s, and extension at 72 C. for 50 s, and final extension at 72 C. for 5 min.

[0039] (5) Acquisition of poly(T) sequence: Since it was difficult to obtain a poly(T) sequence by PCR, in the present invention the poly(T) sequence were constructed onto the plasmid pUC57-poly(T) through artificial synthesis, and then double digested by enzymes Xho I and Xba I, to obtain a poly(T) containing cleavage sites.

[0040] (6) Amplification of rDNA terminator fragment: an rDNA terminator fragment which was about 300 bp and had cleavage sites to be digested by enzymes Xba I and Hind III was obtained through PCR amplification by using the genomic DNA of Saccharomyces cerevisiae BY4741 as a template, and using primers rDNAt-Xba I-F (5-CTAGTCTAGATTTTTATTTCTTTCTAAGTGGGTAC-3SEQ ID NO: 17) and rDNAt-Hind III-R (5-GATGCTAGCTTGTGAAAGCCCTTCTCTTTC-3SEQ ID NO: 18), where the PCR amplification conditions were 30 cycles of pre-denaturation at 95 C. for 3 min, denaturation at 95 C. for 45 s, annealing at 50 C. for 15 s, and extension at 72 C. for 25 s, and final extension at 72 C. for 5 min.

[0041] 4. Construction of Novel Expression Vector YEp-Hyg B-RIUTR

[0042] The recombinant plasmid YEp-Hyg B and respective elements in the exogenous gene expression cassette were digested with the corresponding restriction enzymes respectively, then ligated and transformed into Escherichia coli, and then verified accordingly, where after 4 times of ligation and after transformation of Escherichia coli DH5a, the transformants were picked, and then the plasmid was extracted and finally validated through PCR by using primers Asc I-URA3-F and rDNAt-Hind III-R (as shown in FIG. 2), where the PCR amplification conditions were 30 cycles of pre-denaturation at 94 C. for 10 min, denaturation at 94 C. for 30 s, annealing at 52 C. for 30 s, and extension at 72 C. for 1.5 min, and final extension at 72 C. for 10 min. A band of about 1,300 bp was obtained through PCR amplification, indicating that the URA3 open reading frame, the poly(T) and the rDNA terminator were successfully ligated onto YEp-Hyg B, and finally the novel expression vector, i.e., the recombinant plasmid YEp-Hyg B-RIUTR, was obtained. The expression vector contains an hygromycin B resistance gene expression cassette and a uracil gene expression cassette, where the transcription and translation of the uracil gene was achieved by adding the IRES sequence and the poly(T) sequence into the uracil gene under the control of an rDNA promoter and an rDNA terminator.

Embodiment 2: Construction of the Novel Saccharomyces cerevisiae Expression System

[0043] The novel expression vector YEp-Hyg B-RIUTR was transformed into Saccharomyces cerevisiae BY4741 by a transformation method which was a PEG-LiAc-mediated Saccharomyces cerevisiae transformation method. The transformants were screened by a YPD plate containing 200 mg/L hygromycin B, and picked. The plasmids were back-extracted from the yeast, and then subjected to PCR amplification by using primers Sac I-rDNAp-F and URA3-Xho I-R, where the PCR amplification conditions were 30 cycles of pre-denaturation at 95 C. for 3 min, denaturation at 95 C. for 45 s, annealing at 52 C. for 15 s, and extension at 72 C. for 1.5 min, and final extension at 72 C. for 5 min. A band of about 1400 bp was obtained through PCR amplification, indicating that the information expression vector was successfully transformed into Saccharomyces cerevisiae.

Embodiment 3: Functional Test of the Novel Expression System

[0044] A control strain (i.e., the empty plasmid YEp-Hyg B not containing the URA3 gene expression cassette) and an experimental strain (i.e., Single colony of Saccharomyces cerevisiae which expressed the uracil gene (containing the plasmid YEp-Hyg B-RIUTR) which had been subjected to plate streaking were picked and inoculated into YPD, and then subjected to activated shaking culture at 30 C. twice. The strains were cultured overnight, taken out at a late stage of the logarithmic growth phase, collected by centrifugation, washed with sterile water for three times, re-suspended in 1 mL sterile water, incubated in an incubator at 30 C. for 9 h to consume endogenous nutrients, so as to prepare resting cells. The resting cell concentration of the strains was regulated to achieve a suspension OD.sub.600 of about 1, and 10-fold serially diluted to three dilutions (10.sup.0, 10.sup.1, 10.sup.2, and 10.sup.3). 4 L of the diluent was dropped onto a synthetic medium plate containing or not containing uracil, and cultured thereon at 30 C. for 3-5 days to observe the colony growth condition. The results were photographed and as shown in FIG. 4, where both the control strains and the experimental strains grew well on the synthetic medium containing uracil; and the control could not grow on the synthetic medium not containing uracil since it could not synthesize uracil due to the lack of the uracil gene expression cassette, while the experimental strain which expressed the uracil gene using the novel expression vector could grow relatively well on the synthetic medium not containing uracil, which indicates that under the action of the RNA polymerase I, the uracil gene was transcribed under the control of the rDNA promoter and the rDNA terminator, and was successfully translated into uracil under the action of the Cricket paralysis virus intergenic region (CrPV IGR) IRES sequence and the poly(T), such that the experimental strain can eventually grow on the medium not containing uracil.

[0045] The embodiments described above are only descriptions of preferred embodiments of the present invention, and do not intended to limit the scope of the present invention. Various variations and modifications can be made to the technical solution of the present invention by those of ordinary skills in the art, without departing from the design and spirit of the present invention. The variations and modifications should all fall within the claimed scope defined by the claims of the present invention.