Recombinant nucleoside-specific ribonuclease and method of producing and using same

11535834 · 2022-12-27

Assignee

Inventors

Cpc classification

International classification

Abstract

A recombinant ribonuclease is disclosed. The recombinant ribonuclease is produced by introducing a recombinant DNA sequence into a host; activating expression of the recombinant DNA sequence within the host to produce the recombinant ribonuclease; and isolating the recombinant ribonuclease from the host. Additionally, a method of analyzing an RNA sequence includes digesting the RNA with a first recombinant ribonuclease to give digestion products comprising nucleotides of the RNA sequence; and analyzing the digestion products using an analytical method to provide the identity of at least some of the nucleotides. The recombinant ribonuclease includes at least one of a uridine-specific recombinant RNase MC1 and a cytidine-specific recombinant RNase Cusativin.

Claims

1. A method of analyzing an RNA sequence comprising: transcribing the nucleic acid sequence of SEQ ID NO. 4; obtaining the recombinant ribonuclease encoded by the nucleic acid sequence of SEQ ID NO. 4; obtaining digestion products by digesting an RNA having an RNA sequence with the recombinant ribonuclease, wherein the digestion products comprise nucleotides of the RNA sequence; and analyzing the digestion products using an analytical method to provide the identity of at least some of the nucleotides.

2. The method of claim 1, further comprising digesting the RNA with a second ribonuclease.

3. The method of claim 2, wherein the second ribonuclease is selected from the group consisting of RNase T1, RNase A, RNase U2, and mixtures thereof.

4. The method of claim 1, wherein the analytical method is selected from the group consisting of mass spectrometry, polyacrylamide gel electrophoresis, a sequencing method, and combinations thereof.

5. The method of claim 4, wherein the analytical method includes mass spectrometry.

6. The method of claim 4, wherein the analytical method includes a sequencing method.

7. The method of claim 6, wherein the sequencing method includes RNA Sequencing (RNA Seq).

8. The method of claim 1, wherein the RNA is an mRNA, tRNA, rRNA, IncRNA, or a combination thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and, together with a general description of the invention given above and the detailed description given below, serve to explain the principles of the invention.

(2) FIG. 1A provides a listing of all possible codons that are capable of coding for the amino acid sequence of RNase MC1.

(3) FIG. 1B provides a nucleotide sequence for a recombinant RNase MC1.

(4) FIG. 2A provides a listing of all possible codons that are capable of coding for the amino acid sequence of RNase Cusativin.

(5) FIG. 2B provides a natural nucleotide sequence for RNase Cusativin.

(6) FIG. 2C provides the nucleotide sequence coding for a recombinant RNase Cusativin.

(7) FIG. 2D provides an alignment of the natural nucleotide sequence coding for RNase Cusativin with the recombinant nucleotide sequence.

(8) FIG. 3 is a comparison of digestion products from RNase T1 and RNase MC1.

(9) FIG. 4A is a representative growth curve of E. coli cells used to produce the recombinant RNase MC1.

(10) FIG. 4B is a comparison of the protein amounts purified from harvested cells at various values of OD.sub.600.

(11) FIG. 4C is an SDS-PAGE of a purified recombinant RNase MC1.

(12) FIG. 4D is a comparison of A.sub.260 observed with various amounts of RNase MC1.

(13) FIG. 5 is MS data for the ΨC digestion product.

(14) FIG. 6 is MS data for the UCC digestion product.

(15) FIG. 7 is MS data for the UCCCCCACCACCA digestion product.

(16) FIG. 8 is MS data for the UGGGG[2.sup.4U] digestion product.

(17) FIG. 9 is MS data for the UCGAAGG[m.sup.5U] digestion product.

(18) FIG. 10 is MS data for the ΨCGAA digestion product.

(19) FIG. 11 is MS data for the U[Q]UA[ms.sup.2i.sup.6A]A digestion product.

(20) FIG. 12 shows the absorbance at 280 nm of each eluted fraction after eluting the Cusativin from a CM-Cellulose column.

(21) FIG. 13 shows an SDS-PAGE used to verify the presence of ˜23-25 kDa polypeptide.

(22) FIG. 14 shows the absorbance at 280 nm of each eluted fraction after eluting the Cusativin from a Sephadex G-75 column.

(23) FIG. 15 is an SDS-PAGE to show the progression of RNase Cusativin purification.

(24) FIG. 16 shows absorbance when using various protein concentrations after incubating the samples for two hours at 37° C.

(25) FIG. 17 shows absorbance when using various protein concentrations after incubating the samples for two hours at 50° C.

(26) FIG. 18-36 show graphical representations of quantitative data for each digestion product of Cusativin.

(27) FIG. 37 shows an agarose gel used to monitor the amplification of the synthetic gene.

(28) FIG. 38 shows an agarose gel used to monitor the presence of recombinant plasmids in E. coli.

(29) FIG. 39 shows an agarose gel used to visualize if recombinant plasmid digestion had successfully showed the presence of insert.

(30) FIG. 40 shows the SDS-PAGE gel for the column fractions collected from one colony of Cusativin-producing E. coli.

(31) FIG. 41 shows the SDS-PAGE gel for the column fractions collected from another colony of Cusativin-producing E. coli.

(32) FIG. 42 shows absorbance when using various protein concentrations after incubating the samples for two hours at 37° C.

(33) FIG. 43 shows absorbance when using various protein concentrations after incubating the samples for two hours at 50° C.

(34) FIG. 44 is an SDS-PAGE to show the relative amount of purified Cusativin from two colonies of Cusativin-producing E. coli.

(35) FIG. 45 shows an LC-MS analysis of Cusativin digestion product.

(36) FIG. 46 shows an LC-MS analysis of Cusativin digestion product.

(37) FIG. 47 shows an LC-MS analysis of Cusativin digestion product.

DETAILED DESCRIPTION

(38) Unless clearly defined otherwise from the context, any range of values presented in the following Detailed Description and Claims includes each end point as well as each whole number or fractional part thereof, within the recited range. Additionally, approximating language may be applied to modify any quantitative representation that may vary without resulting in a change in the basic function to which it is related. Accordingly, a value modified by a term or terms, such as “about” and “substantially,” may not be limited to the precise value specified.

(39) According to exemplary embodiments of the present invention a recombinant RNase is disclosed. The recombinant RNase is prepared from a recombinant nucleic acid sequence. In an embodiment, the RNase is a uridine-specific recombinant RNase MC1 having a codon sequence that has been selectively modified to enhance expression in a host. In an embodiment, the RNase MC1 has SEQ ID NO. 1 In another embodiment, the RNase is a cytidine-specific recombinant Cusativin having a codon sequence that has been similarly selectively modified to enhance expression in a host. In an embodiment, the recombinant RNase Cusativin has SEQ ID NO. 2.

(40) Alternative embodiments may include other sequences of RNase MC1 and/or RNase Cusativin wherein the codons are selectively modified to cause enhanced expression in a host. In addition, the host may include any system capable of providing the necessary components for protein expression. Stated differently, the invention is not limited only to the use of E. coli as the host.

(41) FIG. 1A provides a listing of all possible codons that are capable of coding for the amino acid sequence of RNase MC1, while FIG. 2A provides a listing of all possible codons that are capable of coding for the amino acid sequence of RNase Cusativin. The natural nucleotide sequence of RNase MC1 is unknown. However, the amino acid sequence is known, and is the basis for the information contained in FIGS. 1A and 1s provided as SEQ ID NO. 1. A nucleotide sequence for a recombinant RNase MC1 is given in FIG. 1B (SEQ ID NO. 2). The natural nucleotide sequence for RNase Cusativin, however, is known and is presented in FIG. 2B (SEQ ID NO. 3). FIG. 2C provides the nucleotide sequence coding for a recombinant RNase Cusativin designed to encourage overexpression in a host (SEQ ID NO. 4). The amino acid sequence of Cusativin is given by SEQ ID NO. 5. FIG. 2D provides an alignment of the natural nucleotide sequence coding for RNase Cusativin (SEQ ID NO. 3) with the recombinant nucleotide sequence of FIG. 2C coding for the recombinant RNase Cusativin (SEQ ID NO. 4). Although one embodiment each of the nucleotide sequence coding for the recombinant RNase MC1 and RNase Cusativin are provided, it should be emphasized that, in embodiments of the invention, other recombinant codon combinations could also produce functional protein, and the invention is not limited only to the two recombinant sequences provided in FIGS. 1B and 2C.

(42) To prepare the recombinant RNase MC1, a natural MC1 amino acid sequence was used as a template in a codon modification tool. Restriction sites were added at the 5′- and 3′-ends to the recombinant codon sequence so that fusion of a tag for enzyme localization and fusion of a purification tag could later be performed on these available termini. After optimization of expression conditions, active protein was successfully purified and characterized. The uridine-specificity of the recombinant RNase MC1 was confirmed experimentally.

(43) To prepare the recombinant Cusativin, natural Cusativin was purified from bulk cucumber seeds, and partial protein sequencing was conducted using MS. This partial protein sequence information was used to identify the protein coding sequence of the Cusativin gene in the cucumber genome. A synthetic RNase Cusativin gene with its codons changed to improve overexpression of the protein in a host was designed. After the expression conditions for the host was optimized, active protein was successfully purified and characterized. The cytidine-specificity of the recombinant Cusativin was confirmed experimentally.

(44) In embodiments of the invention, the recombinant RNases may be used to analyze an RNA sequence. To analyze the RNA sequence, the RNA must first be digested by the recombinant RNase. Then, an analytical method is used to analyze the digested RNA.

(45) During digestion of the RNA sequence, without intending to be bound by any particular theory, it is believed that the recombinant RNase MC1 cleaves RNA at the 5′-end of the substrate nucleoside, uridine, with the phosphate being retained on the 3′-end of the preceding nucleoside. However, most known RNases cleave RNA at the 3′-end of the substrate nucleoside. Indeed, this behavior was observed with the recombinant Cusativin, which cleaved RNA at the phophodiester bond 3′-end with high specificity.

(46) The analytical method may include one or more of MS, polyacrylamide gel electrophoresis (hereinafter “PAGE”), and high throughput sequencing methods, among other methods.

(47) In one embodiment, the digested RNA may be analyzed by MS. For instance, analysis may be performed using IP-RP-HPLC-MS, LC-MS, or CID-MS/MS, among other methods. One of ordinary skill in the art is capable of selecting the appropriate analytical technique for the particular application of the inventive method.

(48) In the same or a different embodiment, the analytical method may be a high throughput sequencing method. For instance, the high throughput sequencing method may be Next-Gen RNA-Seq. These methods may be used to discover potential modifications in any type of cellular RNA, either coding or non-coding, including mRNA, tRNA, rRNA, IncRNA, among others.

(49) With an understanding of the cleavage specificity of MC1 and Cusativin, the predicted advantages of including these RNases within a general RNA modification mapping strategy are significant. For instance, RNase MC1, with its demonstrated uridine specificity, directly complements data obtained from the guanosine-specific RNase T1, allowing four of the five nonpseudouridine modifications to be unambiguously placed within the overall sequence (Table 1). Indeed, a comparison of the sequenced T1 digestion products (SEQ ID NO. 6, Seq ID NO. 25) of tRNA.sup.Tyr I (SEQ ID. NO. 7) with that found here after MC1 digestion (SEQ ID NO. 8, SEQ ID NO. 26, and SEQ ID No. 27)) results in >95% tRNA sequence coverage, as shown in FIG. 3. In FIG. 3, the nucleotides at position 46 and 47, shown in underlined italics, are substituted by CA for the isodecoder tRNA.sup.Tyr II, resulting in a digestion product UCACAGAC instead of UCA and UCGAC from positions 47 to 47:7. Detection of all three digestion products indicates the presence of both isodecoders in the sample. Modified nucleosides are denoted by boldface, bracketed text. (Ψ) is pseudouridine, (m.sup.5U) is 5-methyluridine, (s.sup.4U) is 4-thiouridine, (Gm) is 2′-O-methylguanosine, (Q) is queuosine, (ms.sup.2i.sup.6A) is 2-methylthio-N.sup.6-(3-methyl-2-butenyl)adenosine. Additionally, a further digestion by RNase Cusativin (not shown) provides nearly complete sequence coverage.

(50) TABLE-US-00001 TABLE 1 MC1 Products T1 Products pGGP (m/z 787.2) UGp UGGGG[s.sup.4U]p (m/z 1012.1) [s.sup.4U]UCCCGp U[Q]UA[ms.sup.2i.sup.6A]Ap (m/z 1100.5) AGp ΨCp (m/z 628.3) C[Gm]Gp UGCCGp (m/z 811.1) CCAAAGp UCAp (m/z 957.2) CAGp UCGACp (m/z 803.1) ACU[Q]UA[ms.sup.2i.sup.6A]AΨCUGp  (SEQ ID NO. 10) UCGAAGG[m.sup.5U] (m/z 1320.5) CCGp [Ψ]CGAAp (m/z 815.1) UCAUCGp UCCp (m/z 933.2) ACUUCGp UCCCCCACCACCA (m/z 1325.3)  AAGp (SEQ ID NO. 9)  [m.sup.5U][Ψ]CGp AAUCCUUCCCCCACCACCA (SEQ ID NO. 11)

(51) A further advantage of another nucleoside-specific RNase was noted by the detection of an MC1 digestion product, UCGCAGACp, m/z 1284.3, positions 46-53, as shown in FIG. 8, by LC-MS that arises from a second isodecoder (tRNA.sup.Tyr II) in the commercial sample. One would predict that GC-rich RNAs would be more amenable to RNase MC1 analysis as larger oligonucleotide digestion products should be generated. Conversely, GC-poor RNAs would remain amenable to RNase T1, with the two used in tandem being a preferred option.

(52) Another significant advantage of RNase MC1 for RNA modification mapping by mass spectrometry is the inherent challenge in characterizing oligonucleotides containing multiple cytidines and uridines. Uridine differs from cytidine by 1 Da (O versus NH), and the presence of C-13 isotopes, which are readily detected by mass spectrometry, can easily result in challenges in differentiating the number and sequence location of these pyrimidines. This challenge is particularly noteworthy for larger digestion products wherein the “all light” (C-12) isotope peak is no longer the most abundant. Because digestion with MC1 ensures a single uridine will be present at the 5′-terminus of each digestion product, the number of cytidines should also be more easily determined based on accurate mass measurements and prior sequence reconstruction challenges will be minimized.

(53) The advantages of a uridine-specific nuclease that is inhibited by modifications (except pseudouridine) should also accrue in other areas. Methylated uridines, for example, should be detectable in RNA-seq analyses as each site would be missed during MC1 digestion. A comparison of RNA-seq transcripts generated using this nuclease against the genomic prediction would, therefore, reveal such post-transcriptional modifications on a genome-wide basis. Other biochemical approaches that have effectively been limited to RNase T1, such as RNA footprinting, should also benefit from an additional RNase of high specificity.

(54) Similar advantages are expected to inure to the cytidine-specific Cusativin. Additionally, Cusativin exhibits lower rate of cleavage of the phosphodiester bond between cytidines. When the RNA has cytidines in tandem, Cusativin exhibits a lower rate of cleavage, unlike other enzymes such as Rnase T1, U2, or MC1. This feature is useful for mapping cytidine modifications even in a cytidine rich sequence of RNA. Such a feature is not known to be present with any of the other RNase.

(55) Examples

(56) Design of Synthetic Gene and Cloning

(57) Using the MC1 amino acid sequence as a template, a synthetic gene with the natural codon bias of E. coli was designed using the codon modification tool from Integrated DNA Technologies available at http://www.idtdna.com/CodonOpt. The resulting sequence is provided as SEQ ID NO. 1. BamH1 and HindIII sites were added at the 5′- and 3′-ends, respectively, to enable cloning into the IPTG (Isopropyl 3-D-1-thiogalactopyranoside)-inducible expression cassette of the pET22b vector (EMD-Millipore). Such a strategy was expected to yield an MC1 polypeptide with an N-terminal fusion of the pelB leader peptide and a C-terminal fusion of the His-tag (His).sub.6 sequence. The pelB signal peptide is expected to direct the fusion protein to the periplasmic space, thus obviating any potential deleterious effects of ribonuclease activity on host cell RNA machinery.

(58) After confirming the sequence and reading frame of the recombinant clone through translation of the experimentally obtained sequence, Rosetta (DE3) cells bearing the recombinant pET22b-MC1 were used for MC1 production. Rosetta DE3 cells were transformed with recombinant pET22b (+) MC1 plasmid and plated on an LB-ampicillin (50 μg/mL) and chloramphenicol (34 μg/mL) plate. A single colony was then grown overnight in LB-medium supplemented with ampicillin and chloramphenicol for a starter culture. The starter culture was subsequently used to inoculate either 0.20 L (small scale) or 1 L media supplemented with antibiotics. The cells were grown in an orbital shaker at 30° C. with constant shaking at 200 rpm. Expression was induced by adding IPTG to the broth media.

(59) Optimization of Protein Expression Conditions

(60) Four different experimental variables-growth stage for protein induction, growth temperature, duration of induction, and concentration of inducer-were investigated to determine the optimal conditions for inducible expression of RNase MC1.

(61) Specifically, different bacterial growth stages (measured by optical density at 600 nm ranging from 0.3 to 0.9 units) were evaluated for protein induction. Four different flasks of 200 mL LB media supplemented with ampicillin and chloramphenicol were inoculated with 2 mL from the same starter culture of a Rosetta (DE3) cell line bearing the recombinant plasmid. One mL of cells was drawn at regular intervals (30-90 min) to measure the optical density at 600 nm. MC1 expression was induced by adding IPTG at different stages in the log-phase growth curve as measured by optical cell densities ranging from 0.3 to 0.9 units at λ.sub.600. FIG. 4A depicts the representative growth curves following induction at each growth stage. In almost all cases, inducible expression of MC1 resulted in a change in the growth curve, shifting growth into the log phase. A comparison of the protein amounts purified from harvested cells revealed higher yields when cells were induced around an OD.sub.600 of 0.6, as shown in FIG. 4B.

(62) The purified protein was analyzed for its relative molecular mass and purity by SDS-PAGE, as shown in FIG. 4C. This analysis revealed a major polypeptide band at M.sub.r ˜24 kDa (indicated at arrow 10) with a few minor polypeptides of low molecular mass when cells were induced at an OD.sub.600 of 0.6 and 0.9. The expected molecular mass of the MC1-(His).sub.6 fusion protein (24.1 kDa) is similar to that observed in SDS-PAGE, suggesting the production of the anticipated polypeptide in the bacterial host. Surprisingly, no such polypeptide was observed when cells were induced at OD.sub.600 of 0.3 and 0.7. An examination of the respective growth curves suggests that the optical density remains essentially unchanged after 3 h of induction at OD.sub.600 of 0.7, indicating the suspension of metabolic activity in these host cells. Induction at early log phase (OD.sub.600 of 0.3) did not produce the anticipated polypeptide, likely because of a lower cell count and slower multiplication of cultured cells. Although induction at OD.sub.600 of 0.9 resulted in the ˜24 kDa polypeptide, the resulting protein yield was significantly less than the amount observed when induction occurred at OD.sub.600 of 0.6. Hence, induction at OD.sub.600 of 0.6 was considered optimal for expression of MC1 protein in the E. coli host.

(63) The optimal duration of MC1 induction was observed to be 2 h from the point of IPTG addition at OD.sub.600 of 0.6, where protein yield peaked at ˜5 μg per 200 mL culture. Altering the growth temperature between 30° C. and 37° C. and IPTG concentrations between 0.4 and 1.0 mM had no significant impact on protein yield, which remained unchanged at ˜5 μg per 200 mL culture (data not shown).

(64) RNase MC1 Purification

(65) The induced MC1 protein was purified by either a batch process or column chromatography using a Nickel-Sepharose resin (Novagen) as per the manufacturer's instructions. Batch purification was employed during investigation of the optimal expression conditions, and column chromatography was performed for large-scale purification. The purified protein yield was measured by Bradford assay. The eluted protein was exchanged with 100 mM ammonium acetate (pH 5.5) buffer and concentrated using an Amicon Ultra 0.5 mL filter.

(66) Characterization of MC1 for Mapping Nucleoside Modifications

(67) The presence of putative MC1 protein in the eluted fractions was confirmed by the detection of a ˜24 kDa polypeptide on 4%-20% denaturing polyacrylamide gels (Precise, Thermo Scientific). Nonspecific RNase activity of the purified protein was tested by incubating 200 pmol of a substrate oligonucleotide, UAACUAUAACG (SEQ ID NO. 12), and defined amounts (100-800 ng) of protein at 37° C. for 1 h in a 10 μL volume. UV-absorbance measurements at 260 nm (A.sub.260) were recorded at T.sub.0 and after 1 h (T.sub.1h) on a nanophotometer (Implen) as per the manufacturer's instructions. Buffer controls containing RNA oligomer with no protein were also assayed in an identical fashion.

(68) Cleavage of SEQ ID NO. 12 by the RNase will result in oligonucleotide products with reduced stacking interactions compared with the starting substrate leading to an increase in A.sub.260 values. Three protein amounts were tested (200, 400, and 800 ng). An increase in A.sub.260 was measured when increasing the protein amount from 200 to 400 ng, while no additional increase was detected at 800 ng of protein, as shown in FIG. 4D. Presumably, the higher protein amount resulted in no further cleavage of the oligonucleotide substrate or the increased protein amount interferes with detection of any additional changes in the UV absorbance.

(69) The nucleoside-specific enzymatic cleavage of RNA by the purified protein was tested by incubating 3 μg of the commercially available E. coli tRNA.sup.Tyr I (Sigma-Aldrich) with a defined amount of purified enzyme (100-2000 ng) at 37° C. for 2 h and analyzing the digestion products by IP-RP-HPLC-MS. The digestion products were separated on a 1×150 mm XBridge C18 column (Waters) employing mobile phase A (200 mM hexafluoroisopropanol [HFIP] [Sigma], 8.15 mM triethylamine [TEA, Fisher Fair Lawn] in water [Burdick and Jackson, Bridgeport], pH 7.0) and mobile phase B (100 mM HFIP, 4.08 mM TEA in 50% methanol [Burdick and Jackson], pH 7.0) at a flow rate of 30 μL/min. The gradient was as follows: 5% B to 20% B in 5 min; 20% B to 30% B in 2 min; 30% B to 95% B in 43 min; hold at 95% B for 5 min, followed by equilibration for another 15 min at 5% B.

(70) The eluted digestion products were subjected to mass analysis using a Thermo Scientific LTQ-XL mass spectrometer. The instrument settings for automatic acquisition of tandem mass spectrum of each mass-selected precursor ions are known and will not be further described. The sheath gas, auxiliary gas, and sweep gas at the ionization source were set to 25, 14, and 10 arbitrary units (au), respectively. The spray voltage was 4 kV, the capillary temperature was 275° C., the capillary voltage was −23 V and the tube lens was set to −80 V.

(71) The theoretical m/z (mass/charge) values of putative digestion products (both U-specific and nonspecific) and the corresponding collision-induced dissociated (CID) fragment ions were computed using Mongo Oligo (http://mods.rna.albany.edu/masspec/Mongo-Oligo). To confirm uridine specificity for digestion, an LC-MS/MS data set from RNase MC1 digestion of E. coli tRNA.sup.Tyr I was acquired as described. Each MS/MS spectrum was analyzed for the presence of m/z 328.1 (A), 344.2 (G), 304.1 (C), and 305.1 (U) that correspond to the c.sub.1 product ion masses for the canonical nucleotides. Similarly, the MS/MS spectra were also examined for the presence of m/z 346.2 (A), 362.2 (G), 322.1 (C), and 323.1 (U) that correspond to the y.sub.1 product ion masses for the canonical nucleotides assuming the digestion product was present with a 3′-linear phosphate. If none of these m/z values were observed (as in the case of longer oligomers or exclusive 2′,3′-cyclic phosphates), the m/z values corresponding to the c.sub.2 product ion combinations, e.g., UA/UG/UC/UU/AU/GU/CU, were considered.

(72) The nucleotide-specific cleavage properties were determined by a systematic examination of the MS/MS spectra from each oligonucleotide precursor ion whose mass is consistent with a cleavage product containing a 3′-phosphate. Evaluation of these data revealed oligonucleotide digestion products exhibiting 5′-uridine residues. In contrast, the 3′-termini of digestion products were highly variable. Uridine was conspicuous in its absence at the 3′-termini. Two such representative digestion products, ΨC and UCC, are shown in FIGS. 5A-5D and 6A-6D, respectively. In FIGS. 5A-5D, (A) is the total ion chromatogram (TIC), (B) is the extracted ion chromatogram (XIC) for m/z 628.3, corresponding to the digestion product ΨCp (position 55-56 of SEQ ID NO. 7), (C) is the mass spectrum associated with the XIC at 11.7 min., and (D) is the tandem mass spectrum (MS/MS) of the collision-induced dissociation (CID) of the m/z 628.3 precursor ion. The observed sequence informative product ions, c (with common 5′ end) and y (with common 3′-end) with a subscript denoting the position of cleavage on phosphodiester backbone, are labeled and plotted following the standard nomenclature of the art. In FIG. 6, (A) is the XIC for m/z 933.4, corresponding to the digestion product UCCp (position 55-56 of SEQ ID NO. 7), (B) is the mass spectrum associated with the XIC at 24.5 min., and (C) is the CID tandem mass spectrum of m/z 933.4 precursor ion. As in FIG. 5, the sequence informative fragment ions are labeled.

(73) For longer digestion products where the 5′-terminus could not be directly observed in the MS/MS data, fragment ions at the second position consistent with the presence of uridine were observed. Based on this examination of the MS/MS data, a list of m/z values of expected tRNA.sup.Tyr I digestion products and their collision-induced dissociation (CID) fragment ions were calculated assuming cleavage at uridine residues yielding digestion products with 5′-uridine or 5′-modified uridine nucleosides.

(74) Using these digestion rules, the entire LC-MS/MS data set for tRNA.sup.Tyr I was examined. Among the predicted digestion products was one from the 3′ end of the tRNA, UCCCCCACCACCA (SEQ ID NO. 9). This cytidine-rich digestion product was detected experimentally in high abundance, as shown in FIG. 7. In FIG. 7, (A) is XIC for m/z 1325.1, corresponding to the digestion product SEQ ID NO. 9 (position 73-85 of SEQ ID NO. 7), (B) is the mass spectrum associated with the XIC at 39.5 min, and (C) is the CID tandem mass spectrum of m/z 1325.2 precursor ion. Sequence informative fragment ions labeled as in FIG. 5. An asterisk (*) denotes c-type fragment ions and solid bullet (•) denotes y-type fragment ions. Significantly, no digestion products corresponding to cleavage at cytidine were observed in the LC-MS/MS data indicating the specificity of the purified protein toward uridine.

(75) A further examination of the experimental data revealed the presence of 3′-linear and 2′,3′-cyclic phosphates for digestion products (a representative digestion product is shown in FIG. 6). In FIG. 8, (A) is XICs of m/z 1012.3 (linear phosphate) and m/z 1003.3 (2′,3′-cyclic phosphate), (B) is the MS associated with the XICs at 35 and 33 minutes, and (C) is the CID tandem mass spectrum of m/z 1012.3 precursor ion. Sequence informative fragment ions are labeled. The presence of cyclic phosphates is consistent with an RNase T2 mechanism, which proceeds via the 2′,3′-cyclic phosphate intermediate before forming the 3′-linear phosphate as the final product. This feature was not enzyme concentration dependent, as excess enzyme (up to 50× enzyme) did not affect cyclic phosphate levels. Concentration-independent formation of the cyclic phosphate is more consistent with a slow rate of phosphodiester bond hydrolysis.

(76) Cleavage Preferences at Post-Transcriptionally Modified Uridines

(77) The tRNA.sup.Tyr I substrate allowed for an initial investigation into the influence of modified nucleosides on the cleavage properties of MC1. This tRNA contains multiple modified nucleosides: 4-thiouridine [s.sup.4U8], 2′-O-methylguanosine [Gm17], queuosine [Q34], 2-methylthio-N.sup.6-isopentenyladenosine [ms.sup.2i.sup.6A37], 5-methyluridine [m.sup.5U54], and two pseudouridines [Ψ39 and Ψ55]. While uridine and pseudouridine are indistinguishable based on mass, other modifications can be directly identified by their characteristic mass shift from the unmodified canonical nucleoside, and placed within the overall tRNA.sup.Tyr I sequence upon examination of the MS/MS data.

(78) 4-thiouridine and 5-methyluracil

(79) Of great interest was determining whether MC1 cleavage is impacted by the presence of modified uridines. As tRNA.sup.Tyr I contains three modified uridines (s.sup.4U, m.sup.5U, and Ψ), the LC-MS/MS data were evaluated by generating in silico predicted digestion products where s.sup.4U and m.sup.5U are either recognized for cleavage or not and comparing the experimental data against these predicted m/z values. The data revealed the presence of m/z values that correspond to the scenario where s.sup.4U and m.sup.5U are not recognized by MC1. For example, the digestion product UGGGG[s.sup.4U]p was detected at m/z 1012.3 (FIG. 6A,B) and this sequence was confirmed by MS/MS (FIG. 6C). Similarly, m.sup.5U was not recognized as a substrate for cleavage as noted by detection of the digestion product UCGAAGG[m.sup.5U] at m/z 1320.5, which also was confirmed by the MS/MS data, as shown in FIG. 9. In FIG. 9, (A) is XIC for m/z 1320.2, corresponding to the digestion product UCGAAGG[m.sup.5U] (position 47-54), (B) is the MS associated with the XIC at 37.7 minutes, and (C) is the CID tandem mass spectrum of m/z 1320.6 precursor ion. A co-eluting ion (m/z 1284.6) observed in the MS corresponds to the MC1 digestion product (UCACAGAC, position 46-53) belonging to the tRNA.sup.Tyr II isodecoder (RY1661). Sequence informative fragment ions are labeled. An asterisk (*) denotes c-type fragment ions and a solid bullet (*) denotes y-type fragment ions.

(80) If MC1 had recognized these modified nucleosides as substrates, the digestion products would have been single nucleotides (5′ monophosphates of s.sup.4U or m.sup.5U) as they are followed by either uridine or pseudouridine in the tRNA.sup.Tyr I sequence. To confirm that no partial cleavages at s.sup.4U or m.sup.5U occurred, the predicted doubly charged digestion products consistent with such cleavage, (3)-UGGGG-(7) at m/z 851.1 and (56)-UCGAAGG-(62) at m/z 1160.1, were also searched for within the data. No ions for these m/z values were detected, confirming that s.sup.4U and m.sup.5U are not recognized as substrates by MC1.

(81) Pseudouridine

(82) If MC1 recognizes pseudouridine as a substrate, the expected digestion products are predicted at m/z 628.4 (PC) and m/z 815.1 (ΨCGAA). The former was found, as illustrated in FIG. 5, and data consistent with the latter is shown in FIG. 10. In FIG. 10, (A) is the XIC for m/z 815.4, corresponding to the digestion product ΨCGAAp (position 55-59), (B) is the MS associated with the XIC at 37.7 minutes, and (C) is the CID tandem MS of m/z 815.4 precursor ion. Sequence informative fragment ions are labeled. Although pseudouridine cannot be distinguished from uridine by mass, no other tRNA.sup.Tyr I digestion products corresponding to the sequence UC or UCGAA are expected. Therefore, uridine and pseudouridine are indistinguishable in terms of the nucleoside specificity of MC1.

(83) Missed Cleavages

(84) An analysis of the MC1 cleavage patterns of tRNA.sup.Tyr I also revealed that cleavage was not observed if a uridine is preceded by a bulky modified nucleoside. For example, queuosine at position 34 inhibited MC1 cleavage at U35 as noted by digestion products detected at m/z 1100.5 and m/z 1091.7, which are consistent with the 3′-linear phosphate and 2′,3′-cyclic phosphate digestion products, respectively, for the oligonucleotide U[Q]UA[ms.sup.2i.sup.6A]A, as shown in FIG. 11. Tandem MS of these precursor ions confirmed the sequence, revealing the influence of the 5′-nucleoside on uridine recognition and cleavage. In FIG. 11, (A) is XIC for m/z 1091.5, (B) is the MS associated with the XIC at 48.3 min, and (C) is the CID tandem MS of m/z 1091.7 precursor ion with sequence informative fragment ions labeled. The mass spectrum reveals the doubly charged ions for both linear (m/z 1100.5) and 2′,3′-cyclic phosphate (m/z 1091.7) digestion products of U[Q]UA[ms.sup.2i.sup.6A]A (positions 33-38 of SEQ ID NO. 7). Fragmentation of queuosine in the oligonucleotide by loss of 115 Da is indicated in the MS.

(85) To determine whether partial digestion at uridines occurs, tRNA.sup.Tyr I substrate was incubated with varying amounts of MC1. At low enzyme/substrate ratios (0.05-1 μg protein per 3 μg of tRNA), partial digestion at consecutive uridines was noted. These partial digestions could be eliminated by increasing the enzyme/substrate ratio (2.5 μg protein per 3 μg of tRNA).

(86) Obtaining and Purifying the Crude Cusativin Protein Extract

(87) Dried seeds of the pickling variety of Cucumis sativus were ground into flour and extracted overnight at 4° C. using 5 mM sodium phosphate (pH 7.2) containing 0.14 M NaCl with vigorous stirring. The extract was then filtered through 4 layers of cheesecloth and acidified with 20% glacial acetic acid to pH 4. The filtrate was then centrifuged for 20 min at 10,000 rpm, and the pellet was discarded. The supernatant was then centrifuged for 30 additional min at 15,000 rpm, and the resultant pellet was again discarded. The extract was then filtered through Whatman No. 1 filter paper to remove the majority of the remaining particulates.

(88) The filtrate was then applied to a Sephadex G-25 column (2.5 mL bed volume) equilibrated with 10 mM sodium acetate (pH 4.5). The flow-through was used for the subsequent step of ion-exchange chromatography.

(89) The eluate was then applied to a CM-Cellulose column equilibrated with 10 mM sodium acetate (pH 4.5). The column was then washed with 5 mM sodium phosphate (pH 7), and the eluate was discarded. The protein was then eluted from the column with a discontinuous gradient of 5 mM sodium phosphate (pH 7) containing 50 mM, 100 mM, 200 mM, and 500 mM NaCl. The eluate was collected in 2 mL fractions, and either Bradford Assay or the UV absorbance at 280 nm was used to identify the fractions containing the protein.

(90) The presence of protein was not monitored until after the ion exchange chromatography on CM-Cellulose. After eluting the protein from CM-Cellulose column, the absorbance at 280 nm of each eluted fraction was monitored, as shown in FIG. 12. The protein-containing ion-exchange chromatography fractions exhibiting highest absorbance were subjected to denaturing gel electrophoresis (SDS-PAGE) to verify the presence of ˜23-25 kDa polypeptide, based on the comparison with protein size standards (EZ run Rec Protein size standards, Fisher scientific). It was found that the target protein (˜25 kDa) eluted mostly in the 5 mM sodium phosphate containing 200 mM NaCl, as shown in FIG. 13 (indicated at arrow 20). Additionally, many smaller proteins (5-10 kDa) also eluted in these fractions.

(91) The fractions containing the 25 kDa protein were concentrated to a combined volume of 2 mL or less on a speedvac (Thermo Scientific) and subjected to size-exclusion chromatography on a Sephadex G-75 column (approximate bed volume of 36 mL, GE Life Sciences) equilibrated with 5 mM sodium phosphate (pH 7) containing 500 mM NaCl. The protein was eluted with approximately 1.5 column volumes of 5 mM sodium phosphate (pH 7) containing 500 mM NaCl. 1.5 mL fractions were collected, and a Bradford Assay was performed to determine which fractions contained protein. See FIG. 14. The presence of 23-25 kDa polypeptide in the size-exclusion column fractions was verified by SDS-PAGE. The target enzyme eluted after about 1-1.2 column volumes of buffer (fractions 30-34) had passed through the column.

(92) The size-exclusion chromatography fractions containing a polypeptide of ˜23-25 kDa were pooled, concentrated, and desalted with autoclaved water using Amicon Ultra-5 Centrifugal filter devices (size=3k). The absorbance at 280 nm was then used to determine the approximate concentration of the pure protein (356 μg/mL).

(93) Protein containing aliquots obtained at each step of purification were subjected to SDS-PAGE to show the progression of RNase Cusativin purification, as shown in FIG. 15. Following the initial extraction and centrifugation, the target enzyme (˜23-25 kDa in size) was not visible on the gel, indicating its presence at very low concentration. The target enzyme was still not visible following gel-filtration on Sephadex G-25, as it filters only small molecules. It took ion exchange chromatography on a CM-Cellulose column to concentrate the target protein as it eluted with many other smaller proteins in these fractions. Size exclusion chromatography on Sephadex G-75 with high salt concentration finally separated the target protein from the smaller proteins and yielded relatively pure enzyme.

(94) Confirmation of Cusativin Activity of Pure Enzyme

(95) Aliquots of the concentrated pure protein (2.5 μL, 5 μL, 7 μL) were combined with 1 μL 220 mM ammonium acetate and 200 pmol of an RNA oligonucleotide sequence, AUCACCUCCUUUCU (SEQ ID NO. 13). Autoclaved water was used to dilute the samples to a constant volume of 10 μL. These samples were then incubated for 2 hours at either 37° C. or 50° C., and the absorbance at 260 nm was monitored. Both a blank (autoclaved water and ammonium acetate) and a negative control (autoclaved water, ammonium acetate, and RNA oligonucleotide) were also incubated. Increase in absorbance at A.sub.260 was attributed to the presence of active enzyme.

(96) When the general activity assays of the enzyme were initially conducted using Poly (C) and Poly (U), no increase in absorbance was observed after incubation. When activity assays were conducted using the RNA oligonucleotide with the purified (more concentrated) protein, as shown in FIG. 15, significant increases in absorbance were observed when compared to the negative control (0 μL protein), as shown in FIGS. 16 and 17. These increases in absorbance were observed after incubating the samples for two hours both at 37° C. and 50° C. Initial analysis of the digested RNA on LC-MS did not show any digestion products; however, when diluted enzyme was used, digestion products were observed.

(97) Several concentrations of the purified enzyme were incubated with E. coli tRNA.sup.Tyr (SEQ ID NO. 7) for 1-2 hours at either 37° C. or 50° C. One μL (˜35.6 ng), 2 μL (˜71.2 ng), or 5 μL (178 ng) of diluted enzyme (1 μL stock enzyme diluted into 10 μL with water) and 1 μL of undiluted enzyme (356 ng) were incubated with tRNA.sup.Tyr at both temperatures. The tRNA.sup.Tyr digestion products were then analyzed by IP-RP-LC-MS/MS. Mass-to-charge (m/z) values of theoretically expected digestion products based on assumed cytidine-specific cleavage of RNA and their product ions following CID of digestion product precursor ions were computed by Mongo Oligo Mass Calculator (http://mods.rna.albany.edu/masspec/Mongo-Oligo).

(98) Because the modified nucleotide sequence of tRNA.sup.Tyr is known, the theoretical digestion products of tRNA.sup.Tyr were compiled for CpN bond cleavage, and the raw MS data was initially searched for the respective m/z of digestion product precursor ions. The nucleotide sequence of these precursor ions was further confirmed by CID where the presence of sequence-informative product ions was scored. Additionally, digestion products resulting from cleavages at other nucleobases were also assessed to evaluate the specific cleavage of RNA by Cusativin enzyme. This was necessary because of the known occasional cleavage of RNA at certain uridines by Cusativin. The digestion products found in this study following incubation of tRNA.sup.Tyr with 1 μL of the diluted protein (˜36 ng) are shown in Table 2. Each of these digestion products found with 36 ng of enzyme was also searched for their presence in other samples, where different amounts of purified protein were used. The ion chromatogram peaks for each of the digestion product precursor ions were integrated using Xcalibur software. Graphical representations of this quantitative data for each digestion product are shown in FIGS. 18-36. 3′-linear phosphates were found on all of the cytidine-specific products, while only 3′-cyclic phosphates were found on the uridine specific products.

(99) TABLE-US-00002 TABLE 2 C-specific - U-specific - No Missed C-specific - Low Cleavages Missed Cleavages Abundance GAGC GGUGGGG[s.sup.4U]UCCC  GGU 3′ > p (SEQ ID NO. 14) AAAGGGAGC [Gm]GCC AGACU 3′ > p AGAC UGCC GU 3′ > p U[Q]UA[ms.sup.2i.sup.6A]A[Ψ]C GAAUCC UGC/GUC UUCCCCC GUC ACC AUC ACCA GAC UUCCCCCACCACCA  (SEQ ID NO. 15) UUC GAAGG[m.sup.5U][Ψ]C

(100) Design of Synthetic Gene, Amplification, and Purification

(101) The purified protein was digested with Trypsin. The tryptic peptides identified by LC-MS analysis of Cusativin following treatment with proteolytic enzyme trypsin are shown in Table 3. Tryptic peptides for two other small seed coat proteins were also found. The first two peptides listed in the table were previously known in the literature. The amino acid sequences of a portion of the tryptic peptides were blasted against Cucumis sativus protein database (GCF_0000040752_ASM407V2_protein.faa) using Protein Lynx (Waters) to identify the predicted polypeptide as an RNase MC-like protein.

(102) TABLE-US-00003 TABLE 3 Tryptic Peptides in Tryptic Peptides Our Study from Literature SFTIHGLWPQK SFTIHGLWPNK (SEQ ID NO. 16) (SEQ ID NO. 16) YFQTAINMR YFQTAINMR (SEQ ID NO. 17) (SEQ ID NO. 17) HGIDLLSVLR PPXGHEXNK (SEQ ID NO. 18) (SEQ ID NO. 19) IAHLENDLNVVWPNVVTGNNK (SEQ ID NO. 20) YVGR (SEQ ID NO. 21) ASNGQVLLTEIVMXFDDDXXTL (SEQ ID NO. 22)

(103) A conserved domain architecture search on the NCBI database shows that Cusativin is a T2-type RNase. Similar results were obtained through the use of InterPro (http://www.ebi.ac.uk/interpro/).

(104) A synthetic gene with modified codons was designed based on the identified amino acid sequence so as to enable enhanced protein expression in E. coli, as provided in SEQ ID NO. 4. Restriction sites were added to both ends to enable cloning into the protein expression vector, pET 22b (Novagen). The synthetic DNA (651 bp) was made as gene block by IDT DNA technologies.

(105) The gene was amplified via PCR. 5 μL 10×PCR buffer, 1 μL dNTPs, 0.5 μL synthetic DNA template, and 0.6 μL PfuTurbo DNA Polymerase were combined. Additionally, to the mixture were added 0.5 μL each of the forward and reverse primers, ATGGAAAAATGGAAAAGACCAAAAGTGTCGATG (SEQ ID NO. 23), and AAAAATAAATGAGCCTGCGCAATTGG (SEQ ID NO. 24), respectively, which also have sequences for BglII and HindII for restriction endonucleases at 5′ and 3′-ends, respectively. The primer concentration was 100 pmol/μL. These primers enabled easy amplification of the gene sequence in this exemplary system, but other primers may be used in other embodiments of this invention. The resulting mixture was diluted with water to a total volume of 50 μL. A total of three samples were prepared and subjected to the following PCR cycle: 94° C. for 2 minutes, 92° C. for 0.5 min, 35 cycles of 57° C. for 0.5 min and 72° C. for 2 min, and one cycle of 72° C. for 5 min. Agarose gel (1.0%) electrophoresis was performed to verify the size of the PCR product.

(106) The amplified gene was purified using the QIAquick PCR Purification Kit (spin protocol). A 1.0% agarose gel was used to check the success of the purification, as shown in FIGS. 37 and 38 (indicated at arrow 30 of FIG. 38).

(107) The gene was digested using restriction enzymes BglII and HindIII. The following 50 μL reaction mixture was incubated at 37° C. for 2 hours: 15 μL DNA, 5 μL NEB 2.1 Buffer, 1.5 μL BglII, 1 μL HindIII. Additionally, a second experiment was performed using 10 μL DNA. The digested DNA was purified using the QIAquick PCR Purification Kit (spin protocol).

(108) The purified gene was ligated into a pET-22b(+) vector. The vector had previously been digested with BamHI and HindIII. The ligation reaction mixture was as follows: 9.5 μL DI water, 2 μL 10× ligase buffer, 2 μL pET-22b(+) vector, 6 μl of the digested gene, and 0.5 μL of ligase. This reaction mixture was kept at room temperature for 1 hour, and then chilled at 4° C. for about 5 days.

(109) The ligation mixture was then transformed into BL21 E. coli cells. 10 μL of the ligation mixture was added to two different 1.5 mL tubes of the BL21 E. coli cells and vortexed. The tubes were then put on ice for 30 minutes, incubated at 42° C. for 2 min, and then put back on ice for 2 min. 200 μL SOC media was added to each tube, which were then incubated and agitated at 37° C. for 1 hour and 10 minutes. The transformed cells were then plated on LB+amp plates. The plates were then allowed to sit at room temperature for 15 min prior to being placed in the 37° C. incubator overnight.

(110) Following overnight incubation, 10 colonies were collected from the plate. The colonies were collected by stabbing an autoclaved pipet tip into the colony. This tip was then rubbed onto the bottom of a PCR tube and then dropped into a test tube containing 1 mL of LB media with 0.05 μg/mL ampicillin. The test tubes were incubated overnight at 250 rpm and at 37° C. 38 μL of PCR mixture (similar to the mixture used for amplification of the gene, with the colony substituted as the template) was added to each PCR tube. The colonies were then subjected to the following PCR cycle: 2 min at 94° C., 0.5 min at 92° C., 30 cycles of 0.5 min at 57° C. followed by 2 min at 72° C., and finally 5 min at 72° C. A 1.0% agarose gel of the PCR products was performed to visualize which colonies contained the gene.

(111) To the colonies containing the gene were added 10 mL of LB media supplemented with 0.05 mg/mL ampicillin. These cultures were incubated at 37° C. on a shaker (Innova) overnight. Experiments were conducted with other media, including terrific broth, and autoinduction was also tried.

(112) 0.5 mL of each colony was placed in 0.5 mL 65% glycerol and put in the deepfreeze to serve as future culture stock. The remaining cultures of each colony were pelleted. Pelleting was performed using 1.5 mL Eppendorf tubes centrifuged for 1 min at 6700 rpm. The supernatant was then discarded. Additional cell culture was added to the tube and spun down. This pelleting procedure was repeated until all of the cell culture had been pelleted. The plasmids were purified from the pellets using a Qiagen miniprep kit.

(113) The purified plasmids were then digested using the following recipe: 5 μL plasmid, 5 μL NEB buffer 2.1, 1.5 μL BglII, 1 μL HindIII, and 37.5 μL water. The reaction mixtures were incubated for two hours at 37° C. and run on a 1.0% agarose gel to visualize if the digest had been successful, as shown in FIG. 39 (indicated at arrow 40). The purified plasmids were then prepared for sequencing. The sequencing data confirmed that the purified plasmids were the pET-22b(+) vector with the inserted Cusativin gene. The stock colonies (in the deepfreeze) containing these correct plasmids were then cultured in 500 mL LB media containing 0.05 mg/mL ampicillin. The cells were induced to produce the recombinant enzyme by adding IPTG to the culture. His-tag column chromatography was used to purify the protein from the cells following overexpression. Table 4 shows the protein content in each elution fraction as determined by Bradford Assay. Based on this data it was found that each 500 mL culture yielded approximately 34 μg of target protein total in the three elution fractions combined. FIGS. 40 and 41 show the SDS-PAGE gels for the column fractions collected from each clone (at least 5 μg protein were loaded in each lane). All three elution fractions in each purification were found to contain target protein (indicated at arrow 50 in FIG. 40 and arrow 60 in FIG. 41), so they were all concentrated and used for activity assays.

(114) TABLE-US-00004 TABLE 4 Fraction # (Total Volume) Clone 4 Clone 9 Fraction 1 (500 μL) 0.5 μg in 50 μL.sup.  0.5 μg in 50 μL.sup.  Fraction 2 (950 μL) 1 μg in 50 μL 1 μg in 50 μL Fraction 3 (500 μL) 1 μg in 50 μL 1 μg in 50 μL

(115) To prepare the lysate, 2 mg of lysozyme was added for each mL of cell suspension. The suspensions were then chilled at 4° C. for 30 min. Following incubation at 4° C., the suspensions were centrifuged for 30 min at 15 000 rpm. The supernatant was then filtered through 0.45 μm Durapore filters. The filtered supernatant was loaded onto the charged nickel column three times. The column was then washed with 10 column volumes 1× bind buffer and then washed with 5 column volumes 1× wash buffer. The recombinant enzyme was eluted in three fractions. The first fraction was 500 μL elute buffer, the second fraction was 750 μL elute buffer (loaded on column twice) plus an additional 200 μL elute buffer, and the third fraction was 500 μL elute buffer. The column was then stripped with 6 column volumes 1× strip buffer. Bradford Assay was used to determine the protein concentration of each fraction, and at least 5 μg of protein for each fraction were analyzed by SDS-PAGE to check for presence of the 23-25 kDa protein. Protein elution fractions from each clone were concentrated and desalted with water using Amicon Ultra-5 Centrifugal filter devices (size=3k).

(116) Characterization of Recombinant Cusativin for Mapping Nucleoside Modifications

(117) The activity of the enzyme was tested by incubating aliquots of protein with RNA and checking the A.sub.260. The activity assay was performed using 1 μL of a 1:10 dilution of the concentrated protein, 1 μL concentrated protein, 2 μL concentrated protein, and 5 μL concentrated protein. Each sample had a total volume of 10 μL and contained 200 pmol RNA oligonucleotide sequence, AUCACCUCCUUUCU (SEQ ID NO. 13), and 1 μL 220 mM ammonium acetate. The blank contained no protein or RNA, and the negative control contained no protein. The samples were incubated at both 37° C. and 50° C., and the absorbance was checked using the Nanodrop.

(118) 1 μL concentrated protein and 1 μL of a 1:10 protein dilution did not show any increase in A.sub.260 following incubation with RNA oligonucleotide. However, when 2 μL (0.02 μg) and 5 μL (0.1 μg) of concentrated protein were used, the absorbance did increase. These increases in absorbance are shown in FIGS. 42 and 43.

(119) SDS-PAGE was used to approximate the amount of protein contained in the concentrated fractions. One gel was run with 1 μL and 5 μL of the protein concentrated from each clone. Another gel was run with 20 μL of the protein from each clone. Each gel also had lanes where 0.1 μg BSA, 0.5 μg BSA, 1 μg BSA, 3 μg BSA, and 6 μg BSA were run. As shown in FIG. 44, the concentrated clone 9 elution fractions contained approximately 0.2 μg protein in 20 μL, while the concentrated clone 4 elution fractions contained much less protein (indicated at arrow 70). Each concentrated protein sample had a total volume of approximately 100 μL.

(120) The RNA digestions were prepared by placing 3 μL tRNA.sup.Tyr into an Eppendorf tube for each digestion. The tRNA was then incubated at 95° C. for 2 min, followed by 2 min at 4° C. Then, 10 μL of 220 mM ammonium acetate and a designated amount of protein (5 μL concentrated, 1 μL 1:5 dilution, 1 μL 1:10 dilution, and 1 μL 1:20 dilution) were added to each sample. The samples were then incubated for 2 hours and dried in the SpeedVac.

(121) As shown in FIGS. 42 and 43, the recombinant enzyme did exhibit RNase activity. The slight increases in A.sub.260 observed are very similar to the activity observed with the enzyme purified from the seeds (FIGS. 16 and 17).

(122) FIG. 45 shows an LC-MS analysis of Cusativin digestion product, U[Q]UA[ms.sup.2i.sup.6A]A[Ψ]C, from tRNA.sup.Tyr. The recombinant protein (0.1 μg) was used to digest E. coli tRNATyr (2 μg) and analyzed by LC-MS. In FIG. 45, (A) is the TIC of all the digestion product precursor ions observed in the analysis, (B) is the XIC for m/z 1406.4, corresponding to the linear phosphate of U[Q]UA[ms.sup.2i.sup.6A]A[Ψ]C, (C) is the XIC for m/z 1397.4, corresponding to the 2′,3′-cyclic phosphate, (D) is an MS depicting the multiply charged ions, and (E) is the CID-based sequencing of U[Q]UA[ms.sup.2i.sup.6A]A[Ψ]C with a 3′-phosphate. Sequence informative product ions (c.sub.n having a common 5′-end and y.sub.n, having a common 3′-end) from which the sequence is reconstructed are labeled on the spectrum.

(123) Additionally, Cusativin cleaves RNA at modified cytidines unlike RNase MC1. FIG. 46 provides the LC-MS analysis of Cusativin digestion product, UGGAA[m.sup.7G]UC[m5C]>p, from yeast tRNA.sup.Phe. In FIG. 46, (A) is the TIC, (B) is the XIC for m/z 1479.4, corresponding to cyclic phosphate, (C) is the MS corresponding to peak retention time at 32.94 min depicting the doubly charged ions, and (D) is the CID-based sequencing of UGGAA[m.sup.7G]UC[m5C] with a 2′-3′ cyclic phosphate. A portion of the observed sequence informative product ions (c.sub.n having a common 5′-end and y.sub.n having a common 3′-end) are shown in the spectrum. The characteristic product ion that corresponds to the loss of [m.sup.7G] from the molecular ion, which is at the highest abundance (m/z 1396.2), is shown.

(124) Although Cusativin exhibits cytidine-specific cleavage of RNA, Cusativin exhibits a lower rate of cleaveage of the phosphodiester bond between multiple cytidines in tandem, as shown in FIG. 47. FIG. 47 shows an LC-MS analysis of Cusativin digestion product, UUCCCCC>p, from yeast tRNA.sup.Phe. (A) is the TIC, (B) is the XIC for m/z 1067.8, corresponding to cyclic phosphate, (C) is the MS corresponding to peak retention time at 35.9 min depicting the doubly charged ions, and (E) is the CID-based sequencing of UUCCCCC>p. A portion of the observed sequence informative product ions (c.sub.n with a common 5′-end and y.sub.n with a common 3′-end) are shown in the spectrum.

(125) This has been a description of the present invention along with the various methods of practicing the present invention. However, the invention itself should only be defined by the appended claims.