FERMENTATION PRODUCT OF PUNICA GRANATUM AND USES THEREOF

Abstract

The present disclosure provides a fermentation product of Punica granatum and methods for regulating expression of MMP gene, TIMP gene and COL4A4 gene, promoting collagen production, and anti-aging by using the fermentation product of Punica granatum.

Claims

1. A fermentation product of Punica granatum obtained by a process comprising the following steps: (a) extracting the Punica granatum with water to obtain a Punica granatum extract; and (b) sequentially fermenting the Punica granatum extract with Saccharomyces cerevisiae and Lactobacillus plantarum to obtain a first fermentation product of Punica granatum; wherein the Saccharomyces cerevisiae has a concentration ranging from 0.01% to 0.5%, and the Lactobacillus plantarum has a concentration ranging from 0.01% to 0.25%.

2. The fermentation product of Punica granatum according to claim 1, wherein a fermentation time of the Saccharomyces cerevisiae ranges from 1 to 2 days, and a fermentation time of the Lactobacillus plantarum ranges from 1 to 3 days.

3. The fermentation product of Punica granatum according to claim 1, wherein the first fermentation product of Punica granatum is further fermented with Acetobacter aceti to obtain a second fermentation product of Punica granatum.

4. The fermentation product of Punica granatum according to claim 3, wherein the Acetobacter aceti has a concentration ranging from 1% to 20%.

5. The fermentation product of Punica granatum according to claim 4, wherein a fermentation time of the Acetobacter aceti ranges from 14 to 21 days.

6. The fermentation product of Punica granatum according to claim 1, wherein an extraction temperature of the process ranges from 50 C. to 100 C., and an extraction time of the process ranges from 0.5 to 3 hours.

7. A method for regulating expression of matrix metalloproteinase (MMP) gene, tissue inhibitor of matrix metalloproteinase (TIMP) gene, and collagen type IV alpha 4 chain (COL4A4) gene, comprising administering to a subject in need thereof a composition comprising an effective amount of the first fermentation product of Punica granatum according to claim 1.

8. The method according to claim 7, wherein the first fermentation product of Punica granatum is further fermented with Acetobacter aceti to obtain a second fermentation product of Punica granatum.

9. The method according to claim 7, wherein the composition is in the form of a pharmaceutical composition, a food product, or a cosmetic composition.

10. The method according to claim 7, wherein the MMP gene is MMP2 gene.

11. The method according to claim 7, wherein the TIMP gene is TIMP1 gene.

12. A method for promoting collagen production and anti-aging, comprising administering to a subject in need thereof a composition comprising an effective amount of the first fermentation product of Punica granatum according to claim 1.

13. The method according to claim 12, wherein the composition is in the form of the cosmetic composition.

14. The method according to claim 12, wherein the first fermentation product of Punica granatum is further fermented with Acetobacter aceti to obtain a second fermentation product of Punica granatum.

15. The method according to claim 14, wherein the composition is in the form of the food product.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The following drawings form part of the present specification and are included here to further demonstrate some aspects of the present invention, which can be better understood by reference to one or more of these drawings, in combination with the detailed description of the embodiments presented herein.

[0023] FIG. 1 is a schematic diagram showing the total polyphenol content detection of the fermentation product of Punica granatum of the present invention.

[0024] FIG. 2 is a schematic diagram showing the antiglycative activity analysis of the fermentation product of Punica granatum of the present invention.

[0025] FIG. 3 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on the ability to resist and defend against UVA.

[0026] FIG. 4 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on inhibiting melanin production.

[0027] FIG. 5 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on anti-inflammation.

[0028] FIG. 6 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on elevating the degree of skin firmness.

[0029] FIG. 7 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on regulating the expression of MMP2 gene.

[0030] FIG. 8 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on regulating the expression of TIMP1 gene.

[0031] FIG. 9 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on regulating the expression of COL4A4 gene.

[0032] FIG. 10 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on inhibiting melanin production in humans, wherein * indicates p<0.05 when compared with week 0.

[0033] FIG. 11 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on reducing the production of red pigment in humans.

[0034] FIG. 12 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on improving the firmness of human skin.

[0035] FIG. 13 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on increasing the human collagen density, wherein * indicates p<0.05 when compared with week 0; and *** indicates p<0.001 when compared with week 0.

[0036] FIG. 14 is an image drawing showing the effect of the fermentation product of Punica granatum of the present invention on increasing the human collagen density.

[0037] FIG. 15 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on improving the firmness of human skin, wherein * indicates p<0.05 when compared with week 0.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

[0038] In the following detailed description of the embodiments of the present invention, reference is made to the accompanying drawings, which are shown to illustrate the specific embodiments in which the present disclosure may be practiced. These embodiments are provided to enable those skilled in the art to practice the present disclosure. It is understood that other embodiments may be used and that changes can be made to the embodiments without departing from the scope of the present invention. The following description is therefore not to be considered as limiting the scope of the present invention.

Definition

[0039] As used herein, the data provided represent experimental values that can vary within a range of 20%, preferably within 10%, and most preferably within 5%.

[0040] Statistical analysis was performed using Excel. Data are expressed as meanstandard deviation (SD), and the difference between each group is analyzed by the Student's t-test.

[0041] According to the present invention, Punica granatum, English name Pomegranate, is a deciduous shrub in the family Lythraceae and the genus Punica. The leaves are opposite or nearly clustered, and the appearance is oblong or obovate. The flowers are born from the top or the axillary. The berry is nearly spherical, reddish with fleshy rind. The production areas are mainly distributed in Iran, the Himalayas in northern India, China, the United States, and the Mediterranean region. The main areas of utilization of Punica granatum are leaves, flowers, peels, and roots. In Chinese folk medicine, the peel of Punica granatum is used to treat epistaxis, otitis media, traumatic bleeding, menstrual disorders, leucorrhea, toothache, vomiting blood, chronic diarrhea, long-term sputum, blood in the stool, rectal prolapse, slippery sperm, uterine bleeding, vaginal discharge, insects and abdominal pain, and scabies. In addition, Punica granatum has antiviral, antibacterial, antifungal and anticancer effects, and can be used to improve cardiovascular health, prevent diabetes, relieve menopausal symptoms, improve erectile dysfunction, and treat Alzheimer's disease and rheumatoid arthritis.

[0042] As used herein, the term Punica granatum juice means the juice produced by the fruit of Punica granatum comprising peel, pulp (i.e., edible portion) and seed.

[0043] As used herein, the term water extract of Punica granatum means that the Punica granatum juice and water are extracted at a specific time and temperature in a ratio of 1:5 to 1:10 (w/w).

[0044] As used herein, the term anti-aging means preventing or slowing the aging of the appearance of human skin, such as the production of wrinkles and loss of elasticity. The extent to which this is achieved is determined by a number of factors known to those skilled in the art, such as the general condition of the consumer, age, and gender.

[0045] As used herein, the terms culturing and cultivation can be used interchangeably.

[0046] According to the present invention, operational procedures and parameter conditions relating to fermentation culturing are within the scope of professional literacy and routine techniques of those skilled in the art.

[0047] As used herein, the terms Saccharomyces cerevisiae, Lactobacillus plantarum and Acetobacter aceti are intended to encompass those easily obtained by those skilled in the art, respectively. For example, those microorganisms can be available from domestic or foreign depository, or isolated and purified from natural sources by the microorganism separation process conventionally used in the art.

[0048] According to the present invention, the pharmaceutical composition can be manufactured to a form suitable for parenteral or topical administration, using techniques well known to those skilled in the art, including, but not limited to, injection (e.g., sterile aqueous solution or dispersion), sterile powder, external preparation, and the like.

[0049] According to the present invention, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier which is widely used in pharmaceutically manufacturing techniques. For example, the pharmaceutically acceptable carrier can comprise one or more reagents selected from the group consisting of solvent, buffer, emulsifier, suspending agent, decomposer, disintegrating agent, dispersing agent, binding agent, excipient, stabilizing agent, chelating agent, diluent, gelling agent, preservative, wetting agent, lubricant, absorption delaying agent, liposome, and the like. The selection and quantity of these reagents fall within the scope of the professional literacy and routine techniques of those skilled in the art.

[0050] According to the present invention, the pharmaceutically acceptable carrier comprises a solvent selected from the group consisting of water, normal saline, phosphate buffered saline (PBS), aqueous solution containing alcohol, and combinations thereof.

[0051] According to the present invention, the pharmaceutical composition can be administered by parenteral routes selected from the group consisting of subcutaneous injection, intraepidermal injection, intradermal injection, and intralesional injection.

[0052] According to the present invention, the pharmaceutical composition can be manufactured to an external preparation suitable for topical application to the skin using techniques well known to those skilled in the art, including, but not limited to, emulsion, coagulation, gel, ointment, cream, patch, liniment, powders, aerosol, spray, lotion, serum, paste, foam, drop, suspension, salve, and bandage.

[0053] According to the present invention, the external preparation is prepared by mixing the pharmaceutical composition of the present invention with a base well known to those skilled in the art.

[0054] According to the present invention, the base may comprise one or more additives selected from the group consisting of water, alcohols, glycol, hydrocarbons such as petroleum jelly and white petrolatum, wax such as paraffin and yellow wax, preserving agents, antioxidants, surfactants, absorption enhancers, stabilizing agents, gelling agents such as Carbopol 974P, microcrystalline cellulose and carboxymethylcellulose, active agents, humectants, odor absorbers, fragrances, pH adjusting agents, chelating agents, emulsifiers, occlusive agents, emollients, thickeners, solubilizing agents, penetration enhancers, anti-irritants, colorants, and propellants. The selection and quantity of these additives fall within the scope of professional literacy and routine techniques of those skilled in the art.

[0055] According to the present invention, the cosmetic composition can further comprise an acceptable adjuvant that is widely used in the manufacture of cosmetic compositions. For example, the acceptable adjuvant may comprise one or more reagents selected from the group consisting of solvents, gelling agents, active agents, preservatives, antioxidants, screening agents, chelating agents, surfactants, coloring agents, thickening agents, fillers, fragrances, and odor absorbers. The selection and quantity of these reagents fall within the scope of professional literacy and routine techniques of those skilled in the art.

[0056] According to the present invention, the cosmetic composition can be manufactured to a form suitable for skincare or makeup using techniques well known to those skilled in the art, including, but not limited to, aqueous solution, aqueous-alcohol solution or oily solution, oil-in-water type, water-in-oil type or composite type emulsion, gel, ointment, cream, mask, patch, pack, liniment, powders, aerosol, spray, lotion, serum, paste, foam, dispersion, drop, mousse, sunblock, tonic water, foundation, makeup remover products, soap, and other body cleansing products.

[0057] According to the present invention, the cosmetic composition may also be used in combination with one or more external use agents with known activities selected from the group consisting of whitening agents such as tretinoin, catechin, kojic acid, arbutin and vitamin C, humectants, anti-inflammatory agents, bactericides, ultraviolet absorbers, plant extracts extracts such as aloe extract, skin nutrients, anesthetics, anti-acne agents, antipruritics, analgesics, antidermatitis agents, antihyperkeratolytic agents, anti-dry skin agents, antipsoriatic agents, antiaging agents, antiwrinkle agents, antiseborrheic agents, wound-healing agents, corticosteroids, and hormones. The selection and quantity of these external use agents fall within the scope of professional literacy and routine techniques of those skilled in the art.

[0058] According to the present invention, the food product can be used as a food additive, added by the conventional method in the preparation of the raw material, or added during the preparation of food, and prepared with any edible material into food products for human and non-human animals.

[0059] According to the present invention, types of food products include, but not limited to, beverages, fermented foods, bakery products, health foods, and dietary supplements.

Example 1

[0060] 1.1 Preparation of Fermentation Product of Punica granatum as Food Product

[0061] First, the Punica granatum juice and water were mixed at a ratio of 1:5 to 1:10 (w/w), and extracted at 50 C.-100 C. for 0.5-3 hours to obtain a Punica granatum extract. The Punica granatum extract was cooled to room temperature for subsequent three-stage fermentation. The three-stage fermentation is that the Punica granatum extract was sequentially inoculated with 0.01-0.5% Saccharomyces cerevisiae BCRC 20271 and fermented at 25-35 C. for 1-2 days; 0.01-0.25% Lactobacillus plantarum TCI028 (BCRC 910805) and fermented at 25-35 C. for 1-3 days; 1-20% Acetobacter aceti BCRC 11688 (the above strains were all purchased from the Biosource Collection and Research Center (BCRC) of the Food Industry Research and Development Institute (FIRDI), Taiwan) and fermented at 25-35 C. for 14-21 days. Thereafter, the obtained mixture was concentrated under reduced pressure at 45 C. to 70 C., and filtered through a 200 to 400-mesh strainer. 0.5-1.5% citric acid and 40-70% isomaltooligosaccharide were added to adjust the format, and then sterilized to obtain the fermentation product of Punica granatum as a food product (i.e., a second fermentation product of Punica granatum).

1.2 Preparation of Fermentation Product of Punica granatum as Cosmetic Composition

[0062] First, the Punica granatum juice and water were mixed at a ratio of 1:5 to 1:10 (w/w), and extracted at 50 C.-100 C. for 0.5-3 hours to obtain a Punica granatum extract. The Punica granatum extract was cooled to room temperature for subsequent fermentation. The fermentation is that the Punica granatum extract was sequentially inoculated with 0.01-0.5% Saccharomyces cerevisiae BCRC 20271 and fermented for 1-2 days; 0.01-0.25% Lactobacillus plantarum TCI028 (BCRC 910805) and fermented for 1-3 days. Thereafter, the obtained mixture was concentrated under reduced pressure at 45 C. to 70 C., and filtered through a filter bag having a pore size of 0.5 to 20 m. The obtained filtrate was sterilized at 90 to 120 C. for 30 to 120 minutes, and then 0.5 to 1.5% phenoxyethanol (as a preservative) was added to obtain the fermentation product of Punica granatum as a cosmetic composition (i.e., a first fermentation product of Punica granatum).

Example 2

[0063] Total Polyphenol Content Detection of Fermentation Product of Punica granatum

[0064] First, a standard solution was prepared. 10 g of gallic acid was dissolved in water and a volume of 10 mL was added to the volumetric flask. 0 L/mL, 20 L/mL, 40 L/mL, 60 L/mL, 80 L/mL, and 100 L/mL standard solutions were prepared, respectively, and 100 L of each standard solution was added to a 10 mL centrifuge tube. Thereafter, 500 L of Folin-Ciocalteu's phenol reagent was added, mixed and let stand for 3 minutes, and 400 L of 7.5% sodium carbonate was added, mixed and let stand for 30 minutes. 200 L of each reaction solution was transferred to a 96-well plate, and the absorbance was measured at 750 nm.

[0065] In addition, the fermentation product of Punica granatum as the food product obtained in Example 1 was used as an experimental group, and the Punica granatum extract was used as a comparative group. The experimental group and the comparative group were diluted with water, respectively, and a volume of 100 mL was added to an eppendorf tube. Thereafter, 500 L of Folin-Ciocalteu's phenol reagent was added, mixed and let stand for 3 minutes, and 400 L of 7.5% sodium carbonate was added, mixed and let stand for 30 minutes. 200 L of each reaction solution was transferred to a 96-well plate, and the absorbance was measured at 750 nm. The result of this example is shown in FIG. 1.

[0066] FIG. 1 is a schematic diagram showing the total polyphenol content detection of the fermentation product of Punica granatum of the present invention. As shown in FIG. 1, compared with the comparative group, the total polyphenol content of the experimental group is significantly increased (by 2.6-fold). The result of Example 2 indicates that the fermentation product of Punica granatum of the present invention releases a large amount of total polyphenols.

Example 3

Antiglycative Activity Analysis of Fermentation Product of Punica Granatum

[0067] First, the fermentation product of Punica granatum as the food product obtained in Example 1 was used as an experimental group, and the Punica granatum extract was used as a comparative group. 0.25 mL of the appropriately diluted samples of the experimental group and the comparative group were taken, respectively, and 0.25 mL of bovine serum albumin (BSA) (60 mg/mL BSA containing 0.06% NaN.sub.3 was prepared with 200 mM sodium phosphate buffer (pH 7.4)) solution and a fructose solution (1.5 M D-fructose in 200 mM sodium phosphate buffer) were added and mixed evenly. Subsequently, the volume of 0.1 mL was taken to measure the fluorescence value using the excitation light at 360 nm and the emission light at 460 nm, and it is the zero point before the reaction. A volume of 0.45 mL was taken and cultured at 50 C. for 24 hours, and then a volume of 0.1 mL was taken to measure the fluorescence value, which is the end point of the reaction. The control group was replaced with an equal amount of sample dissolution solvent, and an equal amount of 3 mM aminoguanidine (AG) was used as a positive control group. The antiglycative activity (%) was calculated by the following formula (1):

[00001]$\begin{array}{cc}\mathrm{Antiglycative}.Math..Math.\mathrm{activity}.Math..Math.\left(\%\right)=\left[1-\frac{\mathrm{Fluorescence}.Math..Math.{\mathrm{sample}}_{24.Math.\mathrm{hr}}-\mathrm{Fluorescence}.Math..Math.{\mathrm{sample}}_{0.Math.\mathrm{hr}})}{\mathrm{Fluorescence}.Math..Math.{\mathrm{control}}_{24.Math.\mathrm{hr}}-\mathrm{Fluorescence}.Math..Math.{\mathrm{control}}_{0.Math.\mathrm{hr}}}\right]100.Math.\%.& \left(1\right)\end{array}$

[0068] The result of this example is shown in FIG. 2. FIG. 2 is a schematic diagram showing the antiglycative activity analysis of the fermentation product of Punica granatum of the present invention. As shown in FIG. 2, compared with the comparative group, the antiglycative activity of the experimental group is significantly increased (by 35%). The result of Example 3 indicates that the fermentation product of Punica granatum of the present invention has excellent antiglycative activity.

Example 4

[0069] Evaluation of Effect of Fermentation Product of Punica granatum on Resisting and Defending Against UVA

[0070] First, the human skin fibroblast CCD-966Sk (ATCC CRL-1881) was cultured in minimum essential medium supplemented with 10% fetal bovine serum (FBS), 1% penicillin/streptomycin and 1 mM sodium pyruvate (Gibco). 200 L of the medium was added to each well of a 96-well culture plate to have 510.sup.3 human skin fibroblasts per well. After 24 hours of incubation at 37 C., the medium was removed.

[0071] Thereafter, four groups of human skin fibroblasts (i.e., an experimental group, a comparative group, a UVA group and a control group) were prepared. The cells in the experimental group, the comparative group and the UVA group were irradiated with UVA for 1 hour at a dose of 15 J/cm.sup.2 using a UV irradiation chamber, which caused a lethal dose 50% (LD.sub.50), indicating that radiation dose of 50% cell death. 0.5% fermentation product of Punica granatum as the food product was added to the cells in the experimental group, 0.5% Punica granatum extract was added to the cells in the comparative group, and the cells in the UVA group were left untreated. The cells in the control group were not irradiated with UVA.

[0072] After cell cultures in each group were cultured in a 37 C. incubator for 24 hours, 15 L of 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, 4 mg/mL in PBS) was added per well, followed by culturing at 37 C. for 4 hours. Thereafter, the medium in each well was removed, 50 L of DMSO (ECHO/DA1101-000000-72EC) was added to each well to decompose the formazan crystal, and then the plate was placed in a shaker, followed by incubation for 10 minutes. The absorbance at 570 nm (OD.sub.570) in each well was measured using an ELISA reader (BioTek).

[0073] The cell viability (%) was calculated by substituting the absorbance (OD.sub.570) into the following formula (2):

Cell viability (%)=(OD.sub.570 of each group/OD.sub.570 of control group)100%(2).

[0074] Statistically significant differences between each group were determined by the Student's t-test. The result of this example is shown in FIG. 3.

[0075] FIG. 3 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on the ability to resist and defend against UVA. As shown in FIG. 3, compared with the control group, the cell viability (%) of the UVA group is reduced, indicating that irradiation of UVA to human skin fibroblasts causes cell death. Compared with the UVA group and the comparative group, the cell viability (%) of the experimental group is significantly increased (the cell viability of the experimental group is increased by 12% compared with that of the UVA group). The result of Example 4 indicates that the fermentation product of Punica granatum of the present invention has the effect on resisting and defending against UVA.

Example 5

[0076] Evaluation of Effect of Fermentation Product of Punica granatum on Inhibition of Melanogenesis

[0077] First, the mouse skin melanoma cell line B16F10 (ATCC CRL-6475) was cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 1% penicillin/streptavidin (Gibco) and 10% FBS (Gibco). 3 mL of the medium was added to each well of a 6-well culture plate to have 1.510.sup.5 B16F10 cells per well. After 24 hours of incubation at 37 C., the medium was removed.

[0078] Thereafter, three groups of B16F10 cells (i.e., an experimental group, a comparative group and a control group) were prepared. 0.5% fermentation product of Punica granatum as the food product (containing 3 mL of DMEM) was added to the cells in the experimental group, 2% Punica granatum extract (containing 3 mL of DMEM) was added to the cells in the comparative group, and DMEM was added to the cells in the control group.

[0079] After cell cultures in each group were cultured at 37 C. for 48 hours, the medium was removed and washed twice with 1PBS (Gibco). Trypsin was added to treat the cells for 3 minutes and the suspended cells were collected in a 15 mL centrifuge tube, followed by spinning at 400g/5 minutes to precipitate the cells. After rinsing twice with 1PBS, the cell pellet was resuspended with 200 L of 1PBS. The cell solution was placed in liquid nitrogen for 10 minutes, and then left standing at room temperature for 30 minutes for thawing. After thawing was complete, rotation was performed at 12,000g for 30 minutes, and the supernatant was removed and 120 L of 1 N NaOH (in ddH.sub.2O). After mixing evenly, the mixture was left standing in a dry bath at 60 C. for 1 hour. Thereafter, 100 L of the mixture was taken into a 96-well culture plate, and the absorbance at 450 nm (OD.sub.450) in each well was measured using an ELISA reader.

[0080] The melanin content (%) was calculated by substituting the absorbance (OD.sub.450) into the following formula (3):

Melanin content (%)=(OD.sub.450 of each group/OD.sub.450 of control group)100%(3).

[0081] Statistically significant differences between each group were determined by the Student's t-test. The result of this example is shown in FIG. 4.

[0082] FIG. 4 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on inhibiting melanin production. As shown in FIG. 4, compared with the control group and the comparative group, the melanin content of the experimental group is significantly reduced (compared with the control group, the melanin content of the experimental group is reduced by 20%). The result of Example 5 indicates that the fermentation product of Punica granatum of the present invention has the effect on inhibiting melanin production.

Example 6

[0083] Evaluation of Effect of Fermentation Product of Punica granatum on Anti-Inflammation

[0084] First, the mouse macrophage RAW 264.7 (ATCC TIB-71) was cultured in 90% DMEM supplemented with 10% FBS (Gibco), 1% penicillin/streptomycin (Gibco) and 4 mM L-glutamine (Gibco). 200 L of the medium was added to each well of a 96-well culture plate to have 2.510.sup.4 cells per well. After incubating for 24 hours in a constant temperature incubator at 37 C., 5% CO.sub.2, the medium was removed.

[0085] Thereafter, four groups of RAW 264.7 cells (i.e., an experimental group, a comparative group, an LPS group and a control group) were prepared. 200 ng/mL lipopolysaccharide (LPS)(Sigma; SI-L2880-25MG) was added to the cells in the LPS group, the comparative group and the experimental group to induce the inflammatory reaction. 1 mg/mL fermentation product of Punica granatum as the food product was added to the cells in the experimental group, 1% Punica granatum extract was added to the cells in the comparative group, the cells in the LPS group were left untreated, and the cells in the control group were not added with LPS and left untreated. The LPS group, the experimental group and the comparative group were prepared in a medium containing no FBS, and one sample was subjected to four repetitions.

[0086] After cell cultures in each group were reacted for 24 hours, 150 L of the culture solution was taken out from each well and placed in a new 96-well culture plate, followed by adding 130 L of secondary water. Thereafter, the Griess reagent kit (Life technologies; 1445263) was used to prepare the Griffith reagent (the ratio of reagent A to reagent B was 1:1), and 20 L of the Griffith reagent was incubated with the medium in the 96-well culture plate for 30 minutes in the dark. The absorbance at 548 nm (OD.sub.548) in each well was measured using a microplate reader. In particular, the higher the absorbance, the higher the concentration of NO. Statistically significant differences between each group were determined by the Student's t-test. The result of this example is shown in FIG. 5.

[0087] FIG. 5 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on anti-inflammation. As shown in FIG. 5, compared with the comparative group, the inflammation level of the LPS group is increased, indicating that LPS induces an inflammatory response in RAW 264.7 cells. Compared with the LPS group and the comparative group, the inflammation level of the experimental group is significantly reduced (compared with the LPS group, the inflammation level of the experimental group is reduced by 43%). The result of Example 6 indicates that the fermentation product of Punica granatum of the present invention has the anti-inflammatory effect.

Example 7

[0088] Evaluation of Effect of Fermentation Product of Punica granatum on Enhancing Skin Firmness

[0089] First, the human skin fibroblast CCD-966Sk (BCRC 60153) was cultured in Eagle minimum essential medium (EMEM), formulated in Earle's Balanced Salt Solution (Earle's BSS), supplemented with 0.1 mM non-essential amino acid, 1.5 g/L sodium bicarbonate, 1 mM sodium pyruvate (90%) and 10% FBS (Gibco). The medium was added to each well of a 24-well culture plate to have 210.sup.5 cells per mL of medium per well.

[0090] Thereafter, three groups of human skin fibroblasts (i.e., an experimental group, a comparative group, and a control group) were prepared. 0.5% fermentation product of Punica granatum as the cosmetic composition according to Example 1.2 was added to the cells in the experimental group, 0.5% Punica granatum extract was added to the cells in the comparative group, and the cells in the control group were left untreated. 0.66 volumes of a well-mixed cell suspension (experimental variable) was added to a sterile tube, and 0.33 volumes of a 3 mg/mL collagen solution was added to the cell suspension. The appropriate volume of 1M NaOH was quickly added, and the solution was mixed up and down 3 times, wherein the least amount of NaOH needed to turn the phenol red media indicator a light pink color will produce the most rigid collagen gels. 500 L of the mixture was immediately transferred to a 1.9-cm.sup.2 well to allow gels to solidify and cover at room temperature for 20 minutes.

[0091] Subsequently, a minimum of an equal volume (500 L) of culture media (experimental variable) was gently added to each well, and the gel was dissociated from its mold by gently running the tip of a 200-L pipet tip along gel edges being careful not to shear or tear gels. The gels were resuspended by gently pulling the edges of the gel away from the mold using the pipet tip, and the plate was gently swirled to make sure that gel was free from the plate. Thereafter, the 24-well plate was replaced into an incubator at 37 C., humidified 5% CO.sub.2.

[0092] At predetermined time-points, the 24-well plate was removed from the incubator for image acquisition. The 24-well plate was placed on top of a lightbox, a digital camera was used at a fixed distance above the gels, and an image was obtained at each of the time-points. The gels were returned to the incubator. Subsequently, images can be analyzed with ImageJ software, the outline of each collagen gel was traced and the surface area was calculated according to ImageJ software instructions, followed by reporting the surface area at each time point as a percentage of initial gel surface area. The result of this example is shown in FIG. 6.

[0093] FIG. 6 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on elevating the degree of skin firmness. As shown in FIG. 6, compared with the control group and the comparative group, the collagen density (%) of the experimental group is significantly increased (compared with the control group, the collagen density of the experimental group is increased by 25%). The result of Example 7 indicates that the fermentation product of Punica granatum of the present invention has the effect on enhancing the skin firmness by increasing the collagen density.

Example 8

[0094] Evaluation of Effect of Fermentation Product of Punica granatum on Regulating Gene Expression Related to Skin Elasticity

[0095] In this example, the fermentation product of Punica granatum was investigated whether it can achieve the effect on enhancing skin elasticity by regulating the gene expression related to skin elasticity.

[0096] First, the human skin fibroblast CCD-966Sk was cultured in the MEM medium supplemented with 10% FBS, 1 mM sodium pyruvate and 1% penicillin/streptomycin. The concentration was 210.sup.5 cells/well, followed by incubation at 37 C. for 24 hours, and the medium was removed.

[0097] Thereafter, three groups of the cultured cells (i.e., a control group, a comparative group, and an experimental group) were prepared. 0.25% fermentation product of Punica granatum as the cosmetic composition according to Example 1.2 was added to the cells in the experimental group, 0.25% Punica granatum extract was added to the cells in the comparative group, and the cells in the control group were left untreated. Subsequently, the cell cultures in each group were harvested and subjected to gene expression analysis.

[0098] In this example, genes related to skin elasticity include the matrix metalloproteinase 2 (MMP2) gene, the tissue inhibitor of matrix metalloproteinase 1 (TIMP1) gene, and the collagen type IV alpha 4 chain (COL4A4) gene.

[0099] RNA extraction was performed using an RNA extraction kit (Geneaid). 2,000 ng of the RNA in each group thus obtained was taken and the extracted RNA was reverse transcribed into cDNA by SuperScript III reverse transcriptase (Invitrogen). The cDNA was used as a template, primer pairs for amplification of target genes, including MMP2, TIMP1, COL4A4, and GAPDH (as internal control) were used, and their nucleotide sequences are shown in Table 1. The quantification of target genes was measured by quantitative real-time PCR using KAPA CYBR FAST qPCR kit (2) (KAPA Biosystems) carried out in ABI Step One Plus Real-Time PCR system (ABI). The melting curves of the PCR product were analyzed during the quantitative real-time PCR.

TABLE-US-00001 TABLE1 Target SEQID Primer gene NO.# name Sequence(5 .fwdarw. 3) MMP2 SEQID MMP2-F GATACCCCTTTGACGGTAAGGA NO.1 SEQID MMP2-R CCTTCTCCCAAGGTCCATAGC NO.2 TIMP1 SEQID TIMP1-F AGAGTGTCTGCGGATACTTCC NO.3 SEQID TIMP1-R CCAACAGTGTAGGTCTTGGTG NO.4 GAPDH SEQID GAPDH-F CTGGGCTACACTGAGCACC NO.5 SEQID GAPDH-R AAGTGGTCGTTGAGGGCAATG NO.6 COL4A4 SEQID COL4A4-F AGATAAGGGTCCAACTGGTGT NO.7 SEQID COL4A4-R ACCTTTAACGGCACCTAAAATGA NO.8

[0100] The relative quantification of gene expression was determined by using the 2.sup.Ct method. The relative fold change was calculated using cycle threshold (C.sub.T) of GAPDH as internal control and the mock group as reference genes following the formula:

C.sub.T=C.sub.T.sub.target/retC.sub.T.sub.internal control

C.sub.T=C.sub.T.sub.targetC.sub.T.sub.ref.

Fold change=2.sup.C.sup.T mean

[0101] For instance, the C.sub.T of COL4A4 was calculated by subtraction of C.sub.T of COL4A4 and C.sub.T of GAPDH. Then the C.sub.T of COL4A4 was the difference of C.sub.T of the test sample and mock. Finally, the relative fold of COL4A4 of the test sample is 2 to the power of minus average of C.sub.T. The standard deviation of the relative fold change was calculated by STDEV in Excel. The expression level of the target gene in the control group was used as a comparative standard of 1. The statistical significance was performed by using the single-tailed Student's t-test in Excel. The results of this example are shown in FIGS. 7-9.

[0102] FIG. 7 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on regulating the expression of MMP2 gene. FIG. 8 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on regulating the expression of TIMP1 gene. FIG. 9 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on regulating the expression of COL4A4 gene. As shown in FIG. 7, regarding the MMP2 gene, the relative expression ratio of the experimental group is significantly lower than that of the control group and the comparative group (the relative expression ratio of the experimental group is reduced by 42% compared with that of the control group), indicating that the fermentation product of Punica granatum of the present invention can prevent collagen from being degraded by inhibiting the expression level of the MMP2 gene. As shown in FIG. 8, regarding the TIMP1 gene, compared with the control group and the comparative group, the relative expression ratio of the experimental group is significantly increased (compared with the control group, the relative expression ratio of the experimental group is increased by 39%), indicating that the fermentation product of Punica granatum of the present invention can inhibit collagen decomposing gene activity by increasing the expression level of the TIMP1 gene. As shown in FIG. 9, regarding the COL4A4 gene, compared with the control group and the comparative group, the relative expression ratio of the experimental group is significantly increased (compared with the control group, the relative expression ratio of the experimental group is increased by 17 folds), indicating that the fermentation product of Punica granatum of the present invention can promote collagen production by increasing the expression level of the COL4A4 gene. The result of Example 8 indicates that the fermentation product of Punica granatum of the present invention can achieve the effect on enhancing skin elasticity by regulating the gene expression related to skin elasticity.

Example 9

[0103] Human Body Function Test of Fermentation Product of Punica granatum as Food Product

[0104] In this example, the fermentation product of Punica granatum as the food product according to Example 1.1 was used to examine whether it has the effect on improving the human skin.

[0105] First, eight 25-year-old to 45-year-old office workers were recruited, and each subject was asked to orally drink 10 mL of 15-30% fermentation product of Punica granatum as the food product every day for 8 weeks. The test items include melanin content, red pigment content, and improving percentage of skin firmness before and after drinking, and the tests were performed using the VISIA Complexion Analysis System (Canfield Scientific, USA). The results of this example are shown in FIGS. 10-12.

[0106] FIG. 10 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on inhibiting melanin production in humans. FIG. 11 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on reducing the production of red pigment in humans FIG. 12 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on improving the firmness of human skin. As shown in FIG. 10, compared with before drinking (week 0), the subjects have a significant decrease in melanin content at week 8 after drinking (compared with week 0, the melanin content of the subjects is reduced by 4.1% at week 8 after drinking). As shown in FIG. 11, compared with before drinking (week 0), the subjects have a significant decrease in red pigment content at week 8 after drinking (compared with week 0, the red pigment content of the subjects is reduced by 10.3% at week 8 after drinking). As shown in FIG. 12, compared with before drinking (week 0), the improving percentage of skin firmness of the subjects measured at week 8 after drinking is increased (compared with week 0, the improving percentage of skin firmness of the subjects measured at week 8 after drinking is increased by 22.2%). The result of Example 9 indicates that the fermentation product of Punica granatum as the food product has the effect on improving the human skin.

Example 10

[0107] Human Body Function Test of Fermentation Product of Punica granatum as Cosmetic Composition

[0108] In this example, the fermentation product of Punica granatum as the cosmetic composition according to Example 1.2 was used to examine whether it has the effect on improving the human skin.

[0109] First, 8 subjects were recruited, the left face of each subject was used as a control group, and the right face was used as an experimental group. After cleaning the face every morning and evening, the placebo was applied to the skin of the control group, and 5-15% fermentation product of Punica granatum as the cosmetic composition was applied to the skin of the experimental group. The massage was promoted by a slight massage on the fingertips, and the test was performed before use (week 0) and at week 2 and week 4 after use. The test items include collagen density, skin looseness and skin wrinkles, and the tests were performed using the VISIA Complexion Analysis System (Canfield Scientific, USA). The results of this example are shown in FIGS. 13-15.

[0110] FIG. 13 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on increasing the human collagen density. FIG. 14 is an image drawing showing the effect of the fermentation product of Punica granatum of the present invention on increasing the human collagen density. FIG. 15 is a schematic diagram showing the effect of the fermentation product of Punica granatum of the present invention on improving the firmness of human skin. As shown in FIG. 13, compared with week 0, the skin collagen density of the experimental group is increased significantly with time, while the control group is not. Compared with week 2, the skin collagen density of the experimental group is increased by 11.6% at week 2 after use, and the skin collagen density of the experimental group is increased by 19.6% at week 4 after use. As shown in FIG. 14, compared with week 0, the skin collagen density of the experimental group is increased with time. The less black part in FIG. 14, the higher the collagen density. As shown in FIG. 15, compared with week 0, the skin firmness of the experimental group is increased significantly with time, while the control group is not. Compared with week 0, the skin firmness of the experimental group is increased by 11.6% at week after use, and the skin firmness of the experimental group is increased by 15% at week 4 after use. The result of Example 10 indicates that the fermentation product of Punica granatum as the cosmetic composition has the effect on improving the human skin.

[0111] In summary, the fermentation product of Punica granatum has the effect on regulating the expression of the MMP gene, the TIMP gene and the COL4A4 gene, releasing total polyphenols of the Punica granatum by the microbial fermentation process, increasing the antioxidant and skin care functions, promoting collagen production, reducing pigment production and accumulation, enhancing skin firmness, improving skin darkness, anti-aging and smoothing wrinkles.

[0112] Although the present invention has been described with reference to the preferred embodiments, it will be apparent to those skilled in the art that a variety of modifications and changes in form and detail may be made without departing from the scope of the present invention defined by the appended claims.