In vivo synthesis of sialylated compounds

Abstract

The present invention is in the technical field of synthetic biology and metabolic engineering. More particularly, the present invention is in the technical field of fermentation of metabolically engineered microorganisms. The present invention describes engineered microorganisms able to synthesize sialylated compounds via an intracellular biosynthesis route. These microorganisms can dephosphorylate N-acetylglucosamine-6-phosphate to N-acetylglucosamine and convert the N-acetylglucosamine to N-acetylmannosamine. These microorganisms also have the ability to convert N-acetylmannosamine to N-acetyl-neuraminate. Furthermore, the present invention provides a method for the large scale in vivo synthesis of sialylated compounds, by culturing a microorganism in a culture medium, optionally comprising an exogenous precursor such as, but not limited to lactose, lactoNbiose, N-acetyllactosamine and/or an aglycon, wherein said microorganism intracellularly dephosphorylates N-acetylglucosamine-6-phosphate to N-acetylglucosamine, converts N-acetylglucosamine to N-acetylmannosamine and convert the latter further to N-acetyl-neuraminate.

Claims

1. A method for the production of a sialylated compound in a microorganism, the method consisting essentially of: culturing a microorganism in a culture medium, said culture medium comprising an exogenous precursor, wherein said microorganism comprises at least one nucleic acid encoding a phosphatase, at least one nucleic acid encoding an N-acetylmannosamine epimerase; and at least one nucleic acid encoding a sialic acid synthase, and wherein said microorganism is unable to i) convert N-acetylglucosamine-6-P to glucosamine-6-P, ii) convert N-acetyl-glucosamine to N-acetyl-glucosamine-6-P, and iii) convert N-acetyl-neuraminate to N-acetyl-mannosamine; and increasing expression in said microorganism of a nucleic acid encoding a HAD-alike phosphatase, wherein said HAD-alike phosphatase comprises: at least one of the following motifs: Motif 1: hDxDx[TV] (SEQ ID NO: 73], or Motif 2: [GSTDE] [DSEN]x(1-2)[hP]x(1-2)[DGTS] (SEQ ID NOs: 74, 75, 76, 77) wherein h means a hydrophobic amino acid (A, I, L, M, F, V, P, G) and x can be any distinct amino acid; or any one of SEQ ID NOs: 43, 44, 45, 46, 47, 48, 50, 51, 52, 54, 55, or 57.

2. The method according to claim 1, wherein said expression is effected by the action of a constitutive promoter.

3. The method according to claim 1, wherein said sialylated compound is selected from the group consisting of N-acetylneuramic acid, sialylated oligosaccharide, sialylated lipid, sialylated protein, and sialylated aglycon.

4. The method according to claim 3, wherein said sialylated compound is N-acetylneuraminic acid or is a sialylated oligosaccharide selected from the group consisting of sialyllactose and disialyl lacto-N-tetrose.

5. The method according to claim 1 wherein said sialylated compound is a sialylated lacto-N-triose, lacto-N-tetraose or a lacto-N-neotetraose, and wherein said microorganism further comprises the activity of a galactosyltransferase.

6. The method according to claim 5 wherein said microorganism is unable to express the genes coding for either of UDP sugar hydrolase or galactose-1-phosphate uridylyltransferase.

7. The method according to claim 1, wherein said microorganism produces less than 50% of an amount of extracellular N-acetylglucosamine than sialylated compound.

8. The method according to claim 1 for producing a sialylated oligosaccharide, comprising: a) culturing a microorganism wherein said microorganism produces internally, activated N-acetylneauraminate as a donor substrate for a sialyltransferase; and b) culturing said microorganism in a culture medium wherein said exogenous precursor is selected from the group consisting of lactose, N-acetyllactosamine, lacto-N-biose, galactose, beta-galactoside, and alpha-galactoside, wherein active uptake into the microorganism of said exogenous precursor occurs and wherein said exogenous precursor is the acceptor substrate for said sialyltransferase for producing the sialylated oligosaccharide.

9. The method according to claim 1, wherein any one or more of the N-acetylmannosamine epimerase and the sialic acid synthase is overexpressed in the microorganism.

10. The method according to claim 1, wherein any one or more of the N-acetylmannosamine epimerase and the sialic acid synthase is introduced and expressed in the microorganism.

11. The method according to claim 1, wherein said microorganism is an Escherichia coli strain.

12. The method according to claim 1, wherein said microorganism is a yeast.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows an exemplary pathway as used in example 2 for the production of sialic acid according to the present invention. FIG. 1A shows the pathway without all KO and overexpression signs. FIG. 1B shows the pathway as used in example 2 with the knock-out indicated with a cross and overexpression with an upgoing arrow next to the indicated enzyme.

(2) FIG. 2 shows the production results of the Escherichia coli strain capable of producing sialic acid as described in example 2.

(3) FIG. 3 shows examples of different sialylated compounds which can be produced in the method of the present invention.

(4) FIG. 4 shows the optical density and sialic acid production of strains supplemented with the indicated phosphatases.

(5) FIG. 5 shows the growth rates of strains supplemented with the indicated phosphatases.

(6) FIG. 6 shows the parts of an alignment of the phosphatases tested in the examples.

Example 1: Materials and Methods

(7) Method and Materials Escherichia coli

(8) Media

(9) Three different media were used, namely a rich Luria Broth (LB), a minimal medium for shake flask (MMsf) and a minimal medium for fermentation (MMf). Both minimal media use a trace element mix.

(10) Trace element mix consisted of 3.6 g/L FeCl2.4H20, 5 g/L CaCl2.2H20, 1.3 g/L MnCl2.2H20, 0.38 g/L CuCl2.2H20, 0.5 g/L CoCl2.6H20, 0.94 g/L ZnCl2, 0.0311 g/L H3B04, 0.4 g/L Na2EDTA.2H20 and 1.01 g/L thiamine.HCl. The molybdate solution contained 0.967 g/L Na2Mo04.2H20. The selenium solution contained 42 g/L Se02.

(11) The Luria Broth (LB) medium consisted of 1% tryptone peptone (Difco, Erembodegem, Belgium), 0.5% yeast extract (Difco) and 0.5% sodium chloride (VWR, Leuven, Belgium).

(12) Luria Broth agar (LBA) plates consisted of the LB media, with 12 g/L agar (Difco, Erembodegem, Belgium) added.

(13) Minimal medium for shake flask experiments (MMsf) contained 2.00 g/L NH4Cl, 5.00 g/L (NH4)2S04, 2.993 g/L KH2PO4, 7.315 g/L K2HP04, 8.372 g/L MOPS, 0.5 g/L NaCl, 0.5 g/L MgSO4.7H20. A carbon source chosen from, but not limited to glucose, fructose, maltose, glycerol and maltotriose, was used. The concentration was default 15 g/L, but this was subject to change depending on the experiment. 1 mL/L trace element mix, 100 μL/L molybdate solution, and 1 mL/L selenium solution. The medium was set to a pH of 7 with 1M KOH. Depending on the experiment lactose could be added as a precursor.

(14) The minimal medium for fermentations contained 6.75 g/L NH4Cl, 1.25 g/L (NH4)2S04, 1.15 g/L KH2PO4 (low phosphate medium) or 2.93 g/L KH2PO4 and 7.31 g/L KH2PO4 (high phosphate medium), 0.5 g/L NaCl, 0.5 g/L MgSO4.7H20, a carbon source including but not limited to glucose, sucrose, fructose, maltose, glycerol and maltotriose, 1 mL/L trace element mix, 100 μL/L molybdate solution, and 1 mL/L selenium solution with the same composition as described above.

(15) Complex medium, e.g. LB, was sterilized by autoclaving (121° C., 21) and minimal medium (MMsf and MMf) by filtration (0.22 μm Sartorius). If necessary the medium was made selective by adding an antibiotic (e.g. ampicillin (100 mg/L), chloramphenicol (20 mg/L), carbenicillin (100 mg/L), spectinomycin (40 mg/L) and/or kanamycin (50 mg/L)).

(16) Strains

(17) Escherichia coli MG1655 [lambda.sup.−, F.sup.−, rph-1] was obtained from Coli Genetic Stock Center (US), CGSC Strain #: 7740 in March 2007. Mutant strains were constructed using the homologous recombination, as described by Datsenko and Wanner (PNAS 97 (2000), 6640-6645).

(18) Plasmids

(19) pKD46 (Red helper plasmid, Ampicillin resistance), pKD3 (contains an FRT-flanked chloramphenicol resistance (cat) gene), pKD4 (contains an FRT-flanked kanamycin resistance (kan) gene), and pCP20 (expresses FLP recombinase activity) plasmids were obtained from Prof. R. Cunin (Vrije Universiteit Brussel, Belgium in 2007).

(20) Plasmid pCX-CjneuB was constructed using Gibson assembly. The gene CjneuB1 was expressed using the expression vector as described by Aerts et. al (Eng. Life Sci. 2011, 11, No. 1, 10-19).

(21) Plasmid pCX-CjneuB-NmneuA-Pdbst was constructed using Gibson assembly. The genes CjneuB1, NmneuA and Pdbst were expressed using the expression vector as described by Aerts et. al (Eng. Life Sci. 2011, 11, No. 1, 10-19).

(22) Plasmids for phosphatase expression were constructed using Golden Gate assembly. The phosphatases (EcAphA, EcCof, EcHisB, EcOtsB, EcSurE, EcYaed, EcYcjU, EcYedP, EcYfbT, EcYidA, EcYigB, EcYihX, EcYniC, EcYqaB, EcYrbL and PsMupP) were expressed using promoters apFAB87 and apFAB346 and UTRs gene10_SD2-junction_HisHA and UTR1 AATTCGCCGGAGGGATATTAAAAtgaatggaaaattgAAACATCTTAATCATGCTAAGGAGGTTTTCTAATG (SEQ ID NO: 41). All promoters and UTRs except UTR1 are described by Mutalik et. al (Nat. Methods 2013, No. 10, 354-360). Also phosphatases EcAppA, EcGph, EcSerB, EcNagD, EcYbhA, EcYbiV, EcYbjL, EcYfbR, EcYieH, EcYjgL, Ec YjjG, EcYrfG, EcYbiU, ScDOG1 and BsAraL are expressed using the same promoters and UTRs.

(23) Plasmid pBR322-NmneuB was constructed using a pBR322 vector via Golden Gate assembly. The promoter and UTR used for the expression of NmNeuB are promoter apFAB299 and UTR galE_SD2-junction_BCD12. Plasmid pSC101-NmneuA-Pdbst was constructed using a pSC101 vector via Golden Gate assembly. The promoters and UTRs used for the expression of NmneuA are promoter apFAB37 and UTR galE_SD2-junction_BCD18. The promoters and UTRs used for the expression of Pdbst are promoter apFAB339 and UTR galE_SD2-junction_BCD12. All promoters and UTRs are described by Mutalik et. al (Nat. Methods 2013, No. 10, 354-360).

(24) Plasmids were maintained in the host E. coli DH5alpha (F, phi80dlacZdeltaM15, delta(lacZYA-argF) U169, deoR, recA1, endA1, hsdR17(rk.sup.−, mk.sup.+), phoA, supE44, lambda, thi-1, gyrA96, relA1). Bought from Invitrogen.

(25) Gene Disruptions

(26) Gene disruptions as well as gene introductions were performed using the technique published by Datsenko and Wanner (PNAS 97 (2000), 6640-6645). This technique is based on antibiotic selection after homologous recombination performed by lambda Red recombinase. Subsequent catalysis of a flippase recombinase ensures removal of the antibiotic selection cassette in the final production strain.

(27) In Table A the necessary primers for the construction of the gene disruption cassette are listed.

(28) TABLE-US-00002 TABLE A Lists of primers to construct disruption cassette for the target gene. Gene target Fw primer Rv primer lacZYA GCTGAACTTGTAGGCCTGATAAGCGCA GCGCAACGCAATTAATGTGAGTTAGCT GCGTATCAGGCAATTTTTATAATCTTCAT CACTCATTAGGCACCCCAGGCTTCGCCT TTAAATGGCGCGC (SEQ ID NO: 1) ACCTGTGACGGAAG (SEQ ID NO: 2) nagABCDE CGCTTAAAGATGCCTAATCCGCCAACGG GGCGTTTGTCATCAGAGCCAACCACGT CTTACATTTTACTTATTGAGGTGAATAGT CCGCAGACGTGGTTGCTATCATATGAAT GTAGGCTGGAGCTGCTTC (SEQ ID NO: ATCCTCCTTAG (SEQ ID NO: 4) 3) nanATEK TAATGCGCCGCCAGTAAATCAACATGAA CCAACAACAAGCACTGGATAAAGCGAG ATGCCGCTGGCTCCGTGTAGGCTGGAG TCTGCGTCGCCTGGTTCAGTTCACATAT CTGCTTC (SEQ ID NO: 5) GAATATCCTCCTTAG (SEQ ID NO: 6) manXYZ AAAATACATCTGGCACGTTGAGGTGTTA CCTCCAGATAAAAAAACGGGGCCAAAA ACGATAATAAAGGAGGTAGCAAGTGTA GGCCCCGGTAGTGTACAACAGTCCATA GGCTGGAGCTGCTTC (SEQ ID NO: 7) TGAATATCCTCCTTAG (SEQ ID NO: 8)

(29) For the genomic integration of the necessary genes into the production hosts genome based on the same technique used for the gene disruption, discussed before, with specific alterations to the disruption cassette. Between a homology site and the FRT site of the disruption cassette, the to be integrated constructed is located. This allows for elegant integration of the constructed in the region dictated by the homology sites.

(30) Using this workflow, a direct gene disruption and genomic integration is possible. Primers that were used for target integration are at specific sites are listed in Table B.

(31) TABLE-US-00003 TABLE B Primers used for genomic integration Integration location Fw primer Rv primer nagABCDE GTTTGGCGTTTGTCATCAGAGCCAA TTGTCATTGTTGGATGCGACGCTCAA CCACGTCCGCAGACGTGGTTGCTAT GCGTCGCATCAGGCATAAAGCAGAC GTGTAGGCTGGAGCTGCTTC (SEQ TTAAGCGACTTCATTCACC (SEQ ID ID NO: 9) NO: 10) nanATEK CATGGCGGTAATGCGCCGCCAGTA CCAACAACAAGCACTGGATAAAGCG AATCAACATGAAATGCCGCTGGCTC AGTCTGCGTCGCCTGGTTCAGTTCAC CGTGTAGGCTGGAGCTGCTTC (SEQ TTAAGCGACTTCATTCACC (SEQ ID ID NO: 11) NO: 12) manXYZ AAAATACATCTGGCACGTTGAGGTG CCTCCAGATAAAAAAACGGGGCCAA TTAACGATAATAAAGGAGGTAGCA AAGGCCCCGGTAGTGTACAACAGTC AGTGTAGGCTGGAGCTGCTTC (SEQ CTTAAGCGACTTCATTCACC (SEQ ID ID NO: 13) NO: 14) lacZYA GCGCAACGCAATTAATGTGAGTTAG GCTGAACTTGTAGGCCTGATAAGCG CTCACTCATTAGGCACCCCAGGCTT CAGCGTATCAGGCAATTTTTATAATC GTGTAGGCTGGAGCTGCTTC(SEQ TTAAGCGACTTCATTCACC(SEQ ID ID NO: 15) NO: 16) atpl-gidB CAAAAAGCGGTCAAATTATACGGTG ATAACGTGGCTTTTTTTGGTAAGCAG CGCCCCCGTGATTTCAAACAATAAG AAAATAAGTCATTAGTGAAAATATCT GTGTAGGCTGGAGCTGCTTC (SEQ TAAGCGACTTCATTCACC (SEQ ID ID NO: 17) NO: 18)

(32) Clones carrying the temperature sensitive pKD46 helper plasmid were grown in 10 mL LB media with ampicillin (100 mg/L) and L-arabinose (10 mM) at 30° C. to an OD.sub.600nm of 0.6. The cells were made electro competent by sequential washing, once with 50 mL, and once with 1 mL ice-cold deionized water. Next, the cells were resuspended in 50 μL of ice-cold water. Finally, 10-100 ng of disruption/integration cassette was added to 50 μL of the washed cell solution for electroporation. Electroporation was performed using a Gene Pulser (trademark of BioRad) (600 Ohm 25 μFD, and 250 V).

(33) After electroporation, cells were resuscitated in 1 mL LB media for 1 h at 37° C., and finally plated out onto LB-agar containing 25 mg/L of chloramphenicol or 50 mg/L of kanamycin to select antibiotic resistant transformants. The selected mutants were verified by PCR with primers upstream and downstream of the modified region and were subsequently grown on LB-agar at 42° C. for the loss of the pKD46 helper plasmid. The mutants were finally tested for ampicillin sensitivity.

(34) The selected mutants (chloramphenicol or kanamycin resistant) were transformed with pCP20 plasmid, which is an ampicillin and chloramphenicol resistant plasmid that shows temperature-sensitive replication and thermal induction of FLP synthesis. The ampicillin-resistant transformants were selected at 30° C., after which a few were colony purified in LB at 42° C. and then tested for loss of all antibiotic resistances and thus also of the FLP helper plasmid. The gene disruptions and/or gene integration are checked with control primers and sequenced. These primers are listed in Table C.

(35) TABLE-US-00004 TABLE C Primers to validate either gene disruption and/or genomic integration for specific gene targets. Gene targets Fw primer Rv primer lacZYA CAGGTTTCCCGACTGGAAAG (SEQ TGTGCGTCGTTGGGCTGATG (SEQ ID NO: 19) ID NO: 20) nagABCDE CGCTTGTCATTGTTGGATGC (SEQ GCTGACAAAGTGCGATTTGTTC (SEQ ID NO: 21) ID NO: 22) nanATEK GTCGCCCTGTAATTCGTAAC (SEQ CTTTCGGTCAGACCACCAAC (SEQ ID ID NO: 23) NO: 24) manXYZ ACGCCTCTGATTTGGCAAAG (SEQ AGCCAGTGCGCTTAATAACC (SEQ ID ID NO: 25) NO: 26) atpl-gidB GCTGAACAGCAATCCACTTG (SEQ TGAACGATATGGTGAGCTGG (SEQ ID NO: 27) ID NO: 28)

(36) Heterologous and Homologous Expression

(37) Genes that needed to be expressed, be it from a plasmid or from the genome were synthetically synthetized with one of the following companies: DNA2.0, Gen9 or IDT.

(38) Escherichia coli native genes, as e.g., phosphatases, were picked from the E. coli K-12 MG1655 genome. The origin of other genes are indicated in the relevant table.

(39) Expression could be further facilitated by optimizing the codon usage to the codon usage of the expression host. Gene were optimized using the tools of the supplier.

(40) Cultivation Conditions

(41) A preculture of 96 well microtiter plate experiments was started from single colony on a LB plate, in 175 μL and was incubated for 8 h at 37° C. on an orbital shaker at 800 rpm. This culture was used as inoculum for a 96 well microtiter plate, with 175 μL MMsf medium by diluting 300×. These cultures in turn, were used as a preculture for the final experiment in a 96 well plate, again by diluting 300×. The 96 well plate can either be microtiter plate, with a culture volume of 175 μL or a 24 well deepwell plate with a culture volume of 3 mL.

(42) A preculture for shake flask experiments was started from a single colony on a LB-plate, in 5 mL LB medium and was incubated for 8 h at 37° C. on an orbital shaker at 200 rpm. From this culture, 1 mL was transferred to 100 mL minimal medium (MMsf) in a 500 mL shake flask and incubated at 37° C. on an orbital shaker at 200 rpm. This setup is used for shake flask experiments.

(43) A shake flask experiment grown for 16 h could also be used as an inoculum for a bioreactor. 4% of this cell solution was to inoculate a 2 L Biostat Dcu-B with a 4 L working volume, controlled by MFCS control software (Sartorius Stedim Biotech, Melsungen, Germany). Culturing condition were set to 37° C., 800 rpm stirring, and a gas flow rate of 1.5 L/min. The pH was controlled at 7 using 0.5 M H2S04 and 25% NH.sub.4OH. The exhaust gas was cooled. 10% solution of silicone antifoaming agent was added when foaming raised during the fermentation (approximately 10 6 L). The use of an inducer is not required as all genes are constitutively expressed.

(44) Material and Methods Saccharomyces cerevisae

(45) Media

(46) Strains are grown on Synthetic Defined yeast medium with Complete Supplement Mixture (SD CSM) or CSM drop-out (SD CSM-Ura) containing 6.7 g/L Yeast Nitrogen Base without amino acids (YNB w/o AA, Difco), 20 g/L agar (Difco) (solid cultures), 22 g/L glucose monohydrate or 20 g/L lactose and 0.79 g/L CSM or 0.77 g/L CSM-Ura (MP Biomedicals).

(47) Strains

(48) Saccharomyces cerevisiae BY4742 created by Bachmann et al. (Yeast (1998) 14:115-32) was used available in the Euroscarf culture collection. All mutant strains were created by homologous recombination or plasmid transformation using the method of Gietz (Yeast 11:355-360, 1995). Kluyveromyces marxianus lactis is available at the LMG culture collection (Ghent, Belgium).

(49) Plasmids

(50) Yeast expression plasmid p2a_2μ_sia_GFA1 (Chan 2013 (Plasmid 70 (2013) 2-17)) was used for expression of foreign genes in Saccharomyces cerevisae. This plasmid contains an ampicillin resistance gene and a bacterial origin of replication to allow for selection and maintenance in E. coli. The plasmid further contains the 2p yeast ori and the Ura3 selection marker for selection and maintenance in yeast. Finally, the plasmid can contain a beta-galactosidase expression cassette. Next, this plasmid also contains a N-acetylglucosamine-2-epimerase (for example from Bacteroides ovatus (BoAGE)) and a sialic acid synthase (for example from Campylobacter jejuni (CjneuB)). Finally, it also contains the fructose-6-P-aminotransferase from Saccharomyces cerevisiae, ScGFA1.

(51) Yeast expression plasmid p2a_2μ_sia_glmS is based on p2a_2μ_sia but modified in a way that also glmS*54 (fructose-6-P-aminotransferase from Escherichia coli) is expressed.

(52) Yeast expression plasmids p2a_2μ_sia_glmS_phospha is based on p2a_2μ_sia_glmS but modified in a way that also EcAphA (SEQ ID NO: 42), EcCof (SEQ ID NO: 43), EcHisB (SEQ ID NO: 44), EcOtsB (SEQ ID NO: 45), EcSurE (SEQ ID NO: 46), EcYaed (SEQ ID NO: 47), EcYcjU (SEQ ID NO: 48), EcYedP (SEQ ID NO: 49), EcYfbT (SEQ ID NO: 50), EcYidA (SEQ ID NO: 51), EcYigB (SEQ ID NO: 52), EcYihX (SEQ ID NO: 53), EcYniC (SEQ ID NO: 54), EcYqaB (SEQ ID NO: 55), EcYrbL (SEQ ID NO: 56), PsMupP (SEQ ID NO: 57), EcAppA (SEQ ID NO: 58), EcGph (SEQ ID NO: 59), EcSerB (SEQ ID NO: 60), EcNagD (SEQ ID NO: 61), EcYbhA (SEQ ID NO: 62), EcYbiV (SEQ ID NO: 63), EcYbjL (SEQ ID NO: 64), EcYfbR (SEQ ID NO: 65), EcYieH (SEQ ID NO: 66), EcYjgL (SEQ ID NO: 67), Ec YjjG (SEQ ID NO: 68), EcYrfG (SEQ ID NO: 69), EcYbiU (SEQ ID NO: 70), ScDOG1 (SEQ ID NO: 71) and BsAraL (SEQ ID NO: 72) are expressed.

(53) Yeast expression plasmid p2a_21_SL-glmS is based on p2a_21_sia but modified in a way that also KILAC12 (lactose permease from Kluyveromyces lactis), NmneuA (CMP-sialic acid synthase from Neisseria meningitides) and Pdbst (sialyltransferase Photobacterium damselae) are expressed.

(54) Plasmids were maintained in the host E. coli DH5alpha (F, phi80dlacZdeltaM15, delta(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rk.sup.−, mk.sup.+), phoA, supE44, lambda, thi-1, gyrA96, relA1). Bought from Invitrogen.

(55) Gene Expression Promoters

(56) Genes are expressed using synthetic constitutive promoters, as described in by Blazeck (Biotechnology and Bioengineering, Vol. 109, No. 11, 2012).

(57) Heterologous and Homologous Expression

(58) Genes that needed to be expressed, be it from a plasmid or from the genome were synthetically synthetized with one of the following companies: DNA2.0, Gen9 or IDT

(59) Expression could be further facilitated by optimizing the codon usage to the codon usage of the expression host. Gene were optimized using the tools of the supplier.

(60) Cultivations Conditions

(61) In general, yeast strains were initially grown on SD CSM plates to obtain single colonies. These plates were grown for 2-3 days at 30° C.

(62) Starting from a single colony, a preculture was grown over night in 5 mL at 30° C., shaking at 200 rpm. Subsequent 500 mL shake flask experiments were inoculated with 2% of this preculture, in 100 mL media. These shake flasks were incubated at 30° C. with an orbital shaking of 200 rpm. The use of an inducer is not required as all genes are constitutively expressed.

(63) Material and Methods Bacillus subtilis

(64) Media

(65) Two different media are used, namely a rich Luria Broth (LB), a minimal medium for shake flask (MMsf). The minimal medium uses a trace element mix.

(66) Trace element mix consisted of 0.735 g/L CaCl2.2H20, 0.1 g/L MnCl2.2H20, 0.033 g/L CuCl2.2H20, 0.06 g/L CoCl2.6H20, 0.17 g/L ZnCl2, XX g/L H3B04, XX g/L Na2EDTA.2H20 and 0.06 g/L Na2Mo04. The Fe-citrate solution contained 0.135 g/L FeCl3.6H20, 1 g/L Na-Citrate (Hoch 1973 PMC1212887).

(67) The Luria Broth (LB) medium consisted of 1% tryptone peptone (Difco, Erembodegem, Belgium), 0.5% yeast extract (Difco) and 0.5% sodium chloride (VWR, Leuven, Belgium).

(68) Luria Broth agar (LBA) plates consisted of the LB media, with 12 g/L agar (Difco, Erembodegem, Belgium) added.

(69) Minimal medium for shake flask experiments (MMsf) contains 2 g/L (NH4)2S04, 7.5 g/L KH2P04, 17.5 g/L K2HP04, 1.25 g/L Na-Citrate, 0.25 g/L MgS04.7H20, 0.05 g/L tryptophan, from 10 up to 30 g/L glucose or another carbon source including but not limited to glucose, fructose, maltose, glycerol and maltotriose, 10 mL/L trace element mix, and 10 mL/L Fe-citrate solution. The medium was set to a pH of 7 with 1M KOH.

(70) Complex medium, e.g. LB, was sterilized by autoclaving (121° C., 21) and minimal medium (MMsf) by filtration (0.22 μm Sartorius). If necessary, the medium was made selective by adding an antibiotic (e.g. zeocin (20 mg/L)).

(71) Strains

(72) Bacillus subtilis 168, available at Bacillus Genetic Stock Center (Ohio, USA).

(73) Plasmids and Gene Overexpression

(74) Plasmids for gene deletion via Cre/lox are constructed as described by Yan et al. (Appl & environm microbial, sept 2008, p5556-5562).

(75) Expression vectors can be found at Mobitec (Germany), or at ATCC (ATCC® number 87056). The genes BsglmS, ScGNA1 and CjneuB are cloned in these expression vectors. A suitable promoter for expression can be derived from the part repository (iGem): sequence id: BBa_K143012, BBa_K823000, BBa_K823002 or BBa_K823003. Cloning can be performed using Gibson Assembly, Golden Gate assembly, Cliva assembly, LCR or restriction ligation.

(76) Plasmids are maintained in the host E. coli DH5alpha (F.sup.−, phi 80dlacZdeltaM15, delta(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rk.sup.−, mk.sup.+), phoA, supE44, lambda, thi-1, gyrA96, re/A1). Bought from Invitrogen.

(77) Gene Disruptions

(78) Disrupting of genes is done via homologous recombination with linear DNA and transformation via the electroporation as described by Xue et al. (J. microb. Meth. 34 (1999) 183-191). The method of gene knock-outs is described by Liu et al. (Metab. Engine. 24 (2014) 61-69). This method uses 1000 bp homologies up- and downstream of the target gene. The homologies to be used in this invention, are listed in table D. After the modification, the mutants are verified using primers upstream and downstream of the modified region. These primers are given in table E. Next, the modification is confirmed by sequencing (performed at LGC Genomics (LGC group, Germany)).

(79) TABLE-US-00005 TABLE D Gene to be disrupted Upstream homology Downstream homology nagA-nagB Gactgcaagatttcggcctgggcggacgggaat Aaggaacatgctgacttatgaatatcaataaaca cgtcagttttgtaatttctgtatcaatgattttcat atcgcctattccgatttactatcagattatggagca ggtctcttcctcaagtccgagccggtcgtattgct attaaaaacccaaattaagaacggagagctgcag tgccctgctcccagagttcaagattcatgacaat ccggatatgcctcttccttctgagcgcgaatatgcc cgtgattcgtttattgcttctgaccgcgccagcgc gaacaattcgggatcagccggatgacagttcgcc caaatagcgtcatcacattgataatgccaaggcc aggcgctttctaatttagttaatgaaggcttgctct cctgatctcaagaaggtgctcaattaattccgga atcgcctgaaagggcggggcacctttgtcagcaa gcgtttcccacaagagtatcctgatcctcctgccg gccaaaaatggaacaagcacttcaagggctgaca tatttcaacgcaatcatcggcaacaaggcgatgc agctttaccgaggatatgaaaagccgcgggatga cctcttttcacaagctctagcgctgtttcgctttttc caccgggcagcaggctcattgattatcagcttatt cgacgccgctttttcctgtgatcagcacgccgac gattcaactgaggagctcgcggctatattaggctg accatatatatcgacaagaacgccatgaattgct cgggcacccctcctctatccataaaatcactcggg gtggtaggcgccagcctgctctcaaggaagttgg tgcggctggcaaatgatattccgatggcgattgag ttaaacggcttgacagtcttgtcgttttcagcggc tcctcacatattccgtttgagcttgcgggtgaattg gatctgaggacaggcaccccatttttctcggagg aacgaatcgcattttcagtcgtcgatctatgatcat cgtcaatcagctcctgcgggatgggcatatctct attgaaaggtacaacagcataccgatttcccgtgc agaaagaataatagctggtgttacatcagtgcac aaaacaggagcttgagccaagcgctgccaccacg agagaatccattcgctgctttttctcctcttcagga gaagaagcgaatattcttggtattcaaaagggag agctgttcaaagaaagaaagctctgtttttccga cgcctgtcctattaattaaacgaacaacatatctgc gaagctgcacgcgctccctcgggtaatatgtaaa agaacggaactgcttttgagcatgcaaaatccgta atatccggcaatttcaatacctggtcttgataggt tacagaggcgaccgttatacatttgtccactatatg cactcattgtaatcgggcggttaattccttcttctc gatcgtctttcataaaaaaagcctccaacccttttt cgctgattaattccaaattgaactgttccattacg aaggattggagacatggcgaaaatcaaactggtc tcttttgtgcgaacctttgccacgatatgttcctcc tggtgccggacgatatgtttcttttttcgtcttgaac tgttccgggctgccccgagcttgctcacaatactt ttccagatcggtgatttcgttttgccgttaaaactgt tcattttatcactttcgggcttgaacctaaaacag cttccactataatgtaccaataataaacagactgc attttataaaaggggggaaaacacctcagctggt ggttcaagatgatcccagcggaattcagctgtgtc ctagatcactagtctgaaaaagagtaaaataaa cccgctcttcacttgctcccgttttccgagctcttca ggtattcaaattccagaaaggcggatcatct ttggtatatacgtta (SEQ ID NO: 34) (SEQ ID NO: 33) gamA Tggcggacatggaataaatcacaaacgacaaa Gtgacaccccctcaaagagatagacaagcaccat gatgacgccggcaagaatagagttaatcaaata atttgttatgaccaatttatgatacttgtcattacga gagcacgggcgcaacgaacaagaaagaaaact atttagcaccgcccttatcaaactgtcaatattaat caaccggttctgtaattccggtcagcatagatgt ttctgaaaatttgttataaaagaaggatacaaatc gagcgccgcagaaatcatcacgccggagatcat tttcatattgggagggcaaatggtattatggtctca ttttttcttttccggacgcgcggtatggataatggc atgaaaaagaacggattgcatacagaatgggga aagagcaacggccggcagacagaaaatcatgt gaatgaaatgacagctttatattctgttatcaagtt aagggaaatcccccatcataaagcgcccggctg taaaatcattgagttaattaaatcgggcaaatatc tcgggtctcccgcgaaaaaccttgtcaggtcgcc aggcgaatgatcagctgccgacggagagtgagtt ggttacggtgttgcctgttgatgggtctgtgtattc ttgcgaacaatatgatgtcagcagaacaactgtga tcccatcataaaatagaaaggcgtataaaaaat gactggctctgcagcagctagagcttgagggatat atgatgcaggccaaaaggaatcagcaaacgat attaaaagaattcaaggaaaagggacatttgtat agatcgttgcataaaagaacaggccgactgttg cggcggccaaaatacaaacgccgattccgcataa aatcggcaattaaactgctggctgcgttaattcc gattacgagctttgcagaacaaatgagaggacttc gttttggatcagcggccaaacgaatgagaaaat gttctgaatcaaaagtgcttgagcttgtggtgattc gacgccgatcaccaatgaactgacggaagtaat ctgccgatcattccatcgccgagcttttgaaaatga gatcgggacaaagcgttttccagagaaaaatcc aagagaatgaacctgtcaacaagcttgtcagagt aaggaccggatgcagctcgattgatgaaaatcg cagatacgccgagggggaacctttgcagtatcat cttatataaataggcggcgagaagcccgataat acctcatatattccctggaaggcggcaccggggct gattcctccgaaaacccccatatcaatcaggtgc ggcgcaggaggaatgcaccggctcgctgtttgaat tcggctccttcatacggaggctgaaggccgagta tgttaaggacaaaatacaatattgaaatcagcag attttcccatattgtcgagggtgacggttaaaatt gggcacggaatcgatcgaaccgattttaacggat aagtatccgatgacagcggcaagtccggctaca gaaacgatcagcggacacttattaaccaatgtcg ccttctccgccggctaatccgatcgcgaccccca gagcgcctgcgtttttatcagaatcccttacctatg cggcgaaaatcagcggaaggttatcgaatacaa ataaaaatgaagaagtggtggaatatgcgcaaat cgccgcccgcatcctttataatagggatgttcagt tattacacggggagaccgaacgaaattcaccgta aaatccttgtctccgaaacggagcaaaagacct gaacagtcatatcattcataaagcaatgtgttttaa gctgccggcaggacggcaaccggagtcatcaac gaagggaatggtggttctatgtttttatttacgaat gcgcggccaagctgctgcagaatttgaaatgcct ggaaaagtgctgtggggagcagt (SEQ ID NO: ttttaaacatgacagtctccttttattgtg (SEQ 36) ID NO: 35)

(80) TABLE-US-00006 TABLE E Target gene Fw primer Rv primer nagA- Tgtaatcgggcggttaattc Gccctttcaggcgatagag nagB (SEQ ID NO: 37) (SEQ ID NO: 38) gamA Acggcgaaaatcagcggaag Tcactctccgtcggcagctg (SEQ ID NO: 39) (SEQ ID NO: 40)

(81) Heterologous and Homologous Expression

(82) Genes that needed to be expressed, be it from a plasmid or from the genome were synthetically synthetized with one of the following companies: DNA2.0, Gen9 or IDT.

(83) Expression could be further facilitated by optimizing the codon usage to the codon usage of the expression host. Gene were optimized using the tools of the supplier.

(84) Cultivations Conditions

(85) A preculture, from a single colony on a LB-plate, in 5 mL LB medium was incubated for 8 h at 37° C. on an orbital shaker at 200 rpm. From this culture, 1 mL was transferred to 100 mL minimal medium (MMsf) in a 500 mL shake flask and incubated at 37° C. on an orbital shaker at 200 rpm. This setup is used for shake flask experiments. The use of an inducer is not required as all genes are constitutively expressed.

(86) Analytical Methods

(87) Optical Density

(88) Cell density of the culture was frequently monitored by measuring optical density at 600 nm (Implen Nanophotometer NP80, Westburg, Belgium). Cell dry weight was obtained by centrifugation (10 min, 5000 g, Legend X1R Thermo Scientific, Belgium) of 20 g reactor broth in pre-dried and weighted falcons. The pellets were subsequently washed once with 20 mL physiological solution (9 g/L NaCl) and dried at 70° C. to a constant weight. To be able to convert OD.sub.6oonm measurements to biomass concentrations, a correlation curve of the OD.sub.6oonm to the biomass concentration was made.

(89) Measurement of Cell Dry Weight

(90) From a broth sample, 4×10 g was transferred to centrifuge tubes, the cells were spun down (5000 g, 4° C., 5 min), and the cells were washed twice with 0.9% NaCl solution. The centrifuge tubes containing the cell pellets were dried in an oven at 70° C. for 48 h until constant weight. The cell dry weight was obtained gravimetrically; the tubes were cooled in a desiccator prior to weighing.

(91) Liquid Chromatography

(92) The concentration of carbohydrates like, but not limited to, glucose, fructose and lactose were determined with a Waters Acquity UPLC H-class system with an ELSD detector, using a Acquity UPLC BEH amide, 130 A, 1.7 μm, 2.1 mm×50 mm heated at 35° C., using a 75/25 acetonitrile/water solution with 0.2% triethylamine (0.130 mL/min) as mobile phase.

(93) Sialyllactose was quantified on the same machine, with the same column. The eluent however was modified to 75/25 acetonitrile/water solution with 1% formic acid. The flow rate was set to 0.130 mL/min and the column temperature to 35° C.

(94) Sialic acid was quantified on the same machine, using the REZEX ROA column (300×7.8 mm ID). The eluent is 0.08% acetic acid in water. The flow rate was set to 0.5 mL/min and the column temperature to 65° C. GlcNAc and ManNAc were also measured using this method.

(95) Growth Rate Measurement

(96) The maximal growth rate (μMax) was calculated based on the observed optical densities at 600 nm using the R package grofit.

Example 2: Production of Sialic Acid in Escherichia coli

(97) A first example provides an Escherichia coli strain capable of producing N-acetylneuraminate (sialic acid) (see FIG. 1B).

(98) A strain capable of accumulating glucosamine-6-phosphate using sucrose as a carbon source was further engineered to allow for N-acetylneuraminate production. The base strain overexpresses a sucrose phosphorylase from Bifidobacterium adolescentis (BaSP), a fructokinase from Zymomonas mobilis (Zmfrk), a mutant fructose-6-P-aminotransferase (EcglmS*54, as described by Deng et al. (Biochimie 88, 419-429 (2006))). To allow for gene sialic acid production the operons nagABCDE, nanATEK and manXYZ were disrupted. BaSP and Zmfrk were introduced at the location of nagABCDE and EcglmS*54 was introduced at the location of nanATEK. These modifications were done as described in example 1 and are based on the principle of Datsenko & Wanner (PNAS USA 97, 6640-6645 (2000)).

(99) In this strain, the biosynthetic pathway for producing sialic acid as described in this invention, was implemented by overexpressing a glucosamine-6-P-aminotransferase from Saccharomyces cerevisiae (ScGNA1), a N-acetylglucosamine-2-epimerase from Bacteroides ovatus (BoAGE) and a sialic acid synthase from Campylobacter jejuni (CjneuB). ScGNA1 and BoAGE were expressed on locations nagABCDE and manXYZ, respectively. CjneuB was expressed using the high copy plasmid pCX-CjneuB.

(100) The strain was cultured as described in example 1 (materials and methods). Briefly, a 5 mL LB preculture was inoculated and grown overnight at 37° C. This culture was used as inoculum in a shake flask experiment with 100 mL medium which contains 10 g/L sucrose and was made as described in example 1. Regular samples were taken and analyzed as described in example 1. The evolutions of the concentrations of biomass, sucrose and sialic acid are easily followed and an end concentration of 0.22 g/L N-acetylneuraminate was produced extracellularly, as can be seen in FIG. 2.

(101) The same organism also produces N-acetylneuraminate based on glucose, maltose or glycerol as carbon source.

Example 3: Production of 6-Sialyllactose in Escherichia coli

(102) Another example according to present invention is the use of the method and strains for the production of 6-sialyllactose.

(103) The strain of example 3 is a daughter strain of the strain used in example 2. The strain is further modified by overexpressing a lactose permease EclacY from Escherichia coli (as described and demonstrated in example 1 of WO 2016/075243 which is here also incorporated by reference), a CMP-sialic acid synthethase from Neisseria meningitides (NmneuA) and a sialyltransferase from Photobacterium damselae (Pdbst). On top of that lacZ is disrupted.

(104) The genes NmneuA and Pdbst, are expressed from a plasmid, together with CjneuB. This plasmid is pCX-CjneuB-NmneuA-Pdbst, and is made as described in example 1.

(105) Said strain is inoculated as a preculture consisting of 5 ml LB medium as described in example 1. After growing overnight at 37° C. in an incubator. 1% of this preculture is inoculated in a shake flask containing 100 ml medium (MMsf) containing 10 g/I sucrose as carbon source and 10 g/l lactose as precursor. The strain is grown for 300 h at 37° C.

(106) This strain produces quantities of 6-sialyllactose.

Example 4: Production of Sialic Acid in Saccharomyces cerevisiae Using Heterologous Fructose-6-P-aminotransferase

(107) Another example provides use of an eukaryotic organism, in the form of Saccharomyces cerevisae, for the invention. This method utilizing the pathway of the invention shall be obtained in Saccharomyces cerevisiae by introducing and expressing a N-acetylglucosamine-2-epimerase (for example from Bacteroides ovatus (BoAGE)) and a sialic acid synthase (for example from Campylobacter jejuni (CjneuB)).

(108) As starting point, a strain with increased metabolic flux towards N-acetylglucosamine-6-phosphate is needed. This is achieved by overexpressing the fructose-6-P-aminotransferase mutant from Escherichia coli (EcglmS*54).

(109) To create a N-acetylneuraminate producing Saccharomyces cerevisiae according to this invention, the genes are introduced via a 2-micron plasmid (Chan 2013 (Plasmid 70 (2013) 2-17)) and the genes are expressed using synthetic constitutive promoters (Blazeck 2012 (Biotechnology and Bioengineering, Vol. 109, No. 11)) as also described in example 1. The specific plasmid used in this embodiment is p2a_21_sia_glmS. This plasmid is introduced into Saccharomyces cerevisae using the transformation technique described by Gietz and Woods (2002, PMID 12073338) and a mutant strain is obtained

(110) Said strain is capable of converting fructose-6-phosphate into glucosamine-6-phosphate, followed by glucosamine-6-phosphate conversion in N-acetylglucosamine-6-phosphate. This N-acetylglucosamine-6-phosphate moiety is further converted to N-acetylglucosamine, said N-acetylglucosamine into N-acetylmannosamine and finally this N-acetylmannosamine is converted into N-acetylneuraminate.

(111) A preculture of said strain is made in 5 mL of the synthetic defined medium SD-CSM containing 22 g/L glucose and grown at 30° C. as described in example 1. This preculture is inoculated in 100 mL medium in a shakeflask with 10 g/L sucrose as sole carbon source and grown at 30° C. Regular samples are taken and the production of N-acetylneuraminate is measured as described in example 1. This strain and method produces quantities of N-acetylneuraminate.

(112) The same organism also produces N-acetylneuraminate based on glucose, maltose or glycerol as carbon source.

Example 5: Production of 6-Sialyllactose in Saccharomyces cerevisiae

(113) Another example provides use of an eukaryotic organism, in the form of Saccharomyces cerevisae, for the invention. This method utilizing the pathway of the invention shall be obtained in Saccharomyces cerevisiae by introducing and expressing a N-acetylglucosamine-2-epimerase (for example from Bacteroides ovatus (BoAGE)) and a sialic acid synthase (for example from Campylobacter jejuni (CjneuB)).

(114) On top of that, further modifications are made in order to produce 6sialyllactose. These modifications comprise the addition of a lactose permease, a CMP-sialic acid synthase and a sialyltransferase. The preferred lactose permease is the KILAC12 gene from Kluyveromyces lactis (WO 2016/075243). The preferred CMP-sialic acid synthase and the sialyltransferase are respectively NmneuA from Neisseria meningitides and Pdbst from Photobacterium damselae, as also described in example 3.

(115) As starting point, a strain with increased metabolic flux towards N-acetylglucosamine-6-phosphate is needed. This is achieved by overexpressing the fructose-6-P-aminotransferase mutant from Escherichia coli (EcglmS*54).

(116) To create a N-acetylneuraminate producing Saccharomyces cerevisiae according to this invention, the genes are introduced via a 2-micron plasmid (Chan 2013 (Plasmid 70 (2013) 2-17)) and the genes are expressed using synthetic constitutive promoters (Blazeck 2012 (Biotechnology and Bioengineering, Vol. 109, No. 11)) as also described in example 1. The specific plasmid used in this embodiment is p2a_2μ_sia_glmS. This plasmid is introduced into Saccharomyces cerevisae using the transformation technique described by Gietz and Woods (2002) and a mutant strain is obtained

(117) Said strain is capable of converting fructose-6-phosphate into glucosamine-6-phosphate, said glucosamine-6-phosphate into N-acetylglucosamine-6-phosphate, said N-acetylglucosamine-6-phosphate into N-acetylglucosamine, said N-acetylglucosamine into N-acetylmannosamine and finally said N-acetylmannosamine into N-acetylneuraminate. Said N-acetylmannosamine is then converted to CMP-sialic acid and transferred to lactose to obtain 6sialyllactose.

(118) A preculture of said strain is made in 5 mL of the synthetic defined medium SD-CSM containing 22 g/L glucose and grown at 30° C. as described in example 1. This preculture is inoculated in 100 mL medium in a shakeflask with 10 g/L sucrose as sole carbon source and grown at 30° C. Regular samples are taken and the production of N-acetylneuraminate is measured as described in example 1. This strain and method produces quantities of 6sialyllactose.

(119) The same organism also produces N-acetylneuraminate based on glucose, maltose or glycerol as carbon source.

Example 6: Production of Sialic Acid in Saccharomyces cerevisiae Using Autologous Fructose-6-P-Aminotransferase

(120) Another example provides use of an eukaryotic organism, in the form of Saccharomyces cerevisae, for the invention. This method utilizing the pathway of the invention shall be obtained in Saccharomyces cerevisiae by introducing and expressing a N-acetylglucosamine-2-epimerase (for example from Bacteroides ovatus (BoAGE)) and a sialic acid synthase (for example from Campylobacter jejuni (CjneuB)).

(121) As starting point, a strain with increased metabolic flux towards N-acetylglucosamine-6-phosphate is needed. This is achieved by overexpressing the native fructose-6-P-aminotransferase ScGFA1.

(122) To create a N-acetylneuraminate producing Saccharomyces cerevisiae according to this invention, the genes are introduced via a 2-micron plasmid (Chan 2013 (Plasmid 70 (2013) 2-17)) and the genes are expressed using synthetic constitutive promoters (Blazeck 2012 (Biotechnology and Bioengineering, Vol. 109, No. 11)) as also described in example 1. The specific plasmid used in this embodiment is p2a_2μ_sia_GFA1. This plasmid is introduced into Saccharomyces cerevisae using the transformation technique described by Gietz and Woods (2002) and a mutant strain is obtained

(123) Said strain is capable of converting fructose-6-phosphate into glucosamine-6-phosphate, said glucosamine-6-phosphate into N-acetylglucosamine-6-phosphate, said N-acetylglucosamine-6-phosphate into N-acetylglucosamine, said N-acetylglucosamine into N-acetylmannosamine and finally said N-acetylmannosamine into N-acetylneuraminate.

(124) A preculture of said strain is made in 5 mL of the synthetic defined medium SD-CSM containing 22 g/L glucose and grown at 30° C. as described in example 1. This preculture is inoculated in 100 mL medium in a shakeflask with 10 g/L sucrose as sole carbon source and grown at 30° C. Regular samples are taken and the production of N-acetylneuraminate is measured as described in example 1. This strain and method produces quantities of N-acetylneuraminate.

(125) The same organism also produces N-acetylneuraminate based on glucose, maltose or glycerol as carbon source.

Example 7: Production of Sialyllactoses and Other Sialylated Compounds

(126) In an alternative embodiment of example 3, the sialyltransferase is changed to another sialyltransferase with different activity. This can be an alpha-2,3-sialyltransferase alpha-2,6-sialyltransferase, an alpha-2,8-sialyltransferase or a combination thereof. These sialyltransferases are widely available in nature and well annotated.

(127) In this way, production of different sialyllactoses like for example 6-sialyllactose, 3-sialyllactose or a mixture thereof can be obtained.

(128) The strains are cultivated as stated in example 1 and example 3.

(129) The pathways created in examples 2 to 7 can also be combined with other pathways for the synthesis of larger oligosaccharides, e.g. sialyl-lacto-N-triose, sialyllacto-N-tetraose, disialyllactose-N-tetraose, sialyllacto-N-neotetraose, and disialyllactose-N-neotetraose. To this end, the transferases to synthetized these glycosidic bonds are co-expressed with the pathway genes to form CMP-sialic acid and the transferase (as described above) to sialylate said oligosaccharide.

(130) Examples of such sialyltransferases are ST6GaII, ST6GaII, ST3GaII until VI, ST6GalNAc I until VI and ST8Sia I until VI, as described by Datta (Current Drug Targets, 2009, 10, 483-498) and Harduin-Lepers (Biochimie 83 (2001) 727-737). Further examples originating from marine organisms are described by Yamamoto (Mar. Drugs 2010, 8, 2781-2794).

Example 8: Production of Sialylated Lacto-N-Neotetraose

(131) The aim of this experiment was to demonstrate the functionality of presented invention of the production of other sialylated oligosaccharides, in this case sialyltated lacto-N-neotetraose.

(132) A lacto-N-neotetraose producing strain was developed following the protocol described in example 1. For production, the expression of a N-acetylglucosaminyltransferase and a galactosyltransferase are needed, this is achieved by introduction of the genes NmlgtA and NmlgtB respectively, both from Neisseria meningitides. Next, the lactose importer EclacY from Escherichia coli is (as described and demonstrated in example 1 of WO 2016/075243 which is here also incorporated by reference). Finally, the genes ushA and galT are knocked out. In this way, a lacto-N-neotetraose producing strain is obtained.

(133) To be able to grow on lactose and produce N-acetylglucosamine-6-phosphate, a sucrose phosphorylase from Bifidobacterium adolescentis (BaSP), a fructokinase from Zymomonas mobilis (frk) and a mutant fructose-6-P-aminotransferase (EcglmS*54, as described by Deng et al (Biochimie 88, 419-429 (2006))) were overexpressed as described in example 1.

(134) In this strain, the method for producing sialic acid as described in this invention, was implemented by overexpressing a glucosamine-6-P-aminotransferase from Saccharomyces cerevisiae (ScGNA1), a N-acetylglucosamine-2-epimerase from Bacteroides ovatus (BoAGE) and a sialic acid synthase from Campylobacter jejuni (CjneuB). ScGNA1 and BoAGE are expressed on locations nagABCDE and manXYZ, respectively. CjneuB is expressed from plasmid pCX-CjneuB-NmneuA-Pdbst.

(135) Sialylation of the lacto-N-neotetraose moiety is performed by the conversion of sialic acid to CMP-salic acid by a CMP sialic acid synthethase, e.g. NmneuA from Neisseria meningtides, subsequently followed by a sialyl transferase, e.g. Pdbst, from Photobacterium damselae. These genes (NmneuA and Pdbst) are expressed from the high copy plasmid pCX-CjneuB-NmneuA-Pdbst.

(136) The strain is cultured as described in example 1 (materials and methods). Briefly, a 5 mL LB preculture is inoculated and grown overnight at 37° C. This culture was used as inoculum in a shake flask experiment with 100 mL medium which contains 10 g/L sucrose as carbon and energy source, 10 g/L lactose as precursor and was made according to the description in example 1. Regular samples are taken and analyzed. This strain produces quantities of sialylated lacto-N-neotetraose.

(137) Alternative glycosyltransferases are possible. If EcWgbO (from Escherichia coli 055:H7) is expressed instead of NmlgtB for example, production of sialylated lacto-N-tetraose is obtained.

Example 9: Production of Sialic Acid with Bacillus subtilis

(138) In another embodiment, this invention can be used for production of N-acetylneuraminate in Bacillus subtilis, yet another bacterial production host.

(139) A N-acetylneuraminate producing strain is obtained through this invention by starting with a strain, capable of overproducing glucosamine-6-phosphate intracellularly. For this, the native fructose-6-P-aminotransferase (BsglmS) is overexpressed. The following enzymatic activities are disrupted by knocking out the genes nagA, nagB and gamA: N-acetylglucosamine-6-phosphate deacetylase and glucosamine-6-phosphate isomerase.

(140) In this strain, the method for producing sialic acid as described in this invention, is implemented by overexpressing a glucosamine-6-P-aminotransferase from Saccharomyces cerevisiae (ScGNA1), a N-acetylglucosamine-2-epimerase from Bacteroides ovatus (BoAGE) and a sialic acid synthase from Campylobacter jejuni (CjneuB). These genes are introduced via a plasmid, as described in example 1.

(141) The strain is cultured as described in example 1 (materials and methods). Briefly, a 5 mL LB preculture is inoculated and grown overnight at 30° C. This culture is used as inoculum in a shake flask experiment with 100 mL medium which contains 10 g/L sucrose and is made according to the description in example 1. This strain produces quantities of N-acetylneuraminic acid.

Example 10: Fermentations of 6-Sialyllactose Producing Strain with No Excretion of GlcNAc, ManNAc or Sialic Acid

(142) Another example according to the present invention provides use of the method and strains for the production of 6-sialyllactose.

(143) An Escherichia coli strain capable of accumulating glucosamine-6-phosphate using sucrose as a carbon source was further engineered to allow for N-acetylneuraminate production. This base strain overexpresses a sucrose phosphorylase from Bifidobacterium adolescentis (BaSP), a fructokinase from Zymomonas mobilis (Zmfrk), a mutant fructose-6-P-aminotransferase (EcglmS*54, as described by Deng et al. (Biochimie 88, 419-429 (2006)). To allow for 6-sialyllactose production the operons nagABCDE, nanATEK and manXYZ were disrupted. BaSP and Zmfrk were introduced at the location of nagABCDE, EcglmS*54 was introduced at the location of nanATEK. These modifications were done as described in example 1 and are based on the principle of Datsenko & Wanner (PNAS USA 97, 6640-6645 (2000)).

(144) In this strain, the biosynthetic pathway for producing 6-sialyllactose as described in this invention, was implemented by overexpressing a glucosamine-6-P-aminotransferase from Saccharomyces cerevisiae (ScGNA1), a N-acetylglucosamine-2-epimerase from Bacteroides ovatus (BoAGE) and a sialic acid synthase from Neisseria meningitides (NmneuB). ScGNA1 and BoAGE were expressed on locations nagABCDE and manXYZ, respectively. NmNeuB was expressed using the high copy plasmid pBR322-NmNeuB. The strain is further modified by overexpressing a lactose permease EclacY from Escherichia coli (as described and demonstrated in example 1 of WO 2016/075243 which is here also incorporated by reference), a CMP-sialic acid synthethase from Neisseria meningitides (NmNeuA) and a sialyltransferase from Photobacterium damselae (Pdbst). On top of that, lacZ is disrupted. NmNeuA and Pdbst were expressed using the low copy plasmid pSC101-NmneuA-Pdbst.

(145) The strain was cultured in a bioreactor as described in example 1 (materials and methods). Briefly, a 5 mL LB preculture was inoculated and grown overnight at 37° C. This culture was used as inoculum in a shake flask experiment with 500 mL medium which contains 10 g/L sucrose and was made as described in example 1. This culture was used as inoculum in a 2 L bioreactor experiment. Regular samples were taken and analyzed as described in example 1. The final concentration of 6-sialyllactose was 30.5 g/L. No extracellular GlcNAc, ManNAc and sialic acid was detected during the fermentation and in the final broth.

(146) The same organism also produces 6-sialyllactose based on glucose, maltose or glycerol as carbon source.

Example 11: Effect of Phosphatase on Growth and Production of Sialic Acid

(147) A further example provides growth results and sialic acid production of several Escherichia coli strains capable of producing N-acetylneuraminate (sialic acid) wherein the strains are expressing an extra phosphatase as indicated hereunder.

(148) The base strain overexpresses a mutant fructose-6-P-aminotransferase (EcglmS*54, as described by Deng et al. (Biochimie 88, 419-429 (2006)), a glucosamine-6-P-aminotransferase from Saccharomyces cerevisiae (ScGNA1), a N-acetylglucosamine-2-epimerase from Bacteroides ovatus (BoAGE) and a sialic acid synthase from Campylobacter jejuni (CjneuB). To allow for gene sialic acid production the operons nagABCDE and nanATEK. The lacYZA operon was replaced by only a single gene operon, the native lacY, which is required for the production of sialyllactose as described in example 10. These modifications were done as described in example 1 and are based on the principle of Datsenko & Wanner (PNAS USA 97, 6640-6645 (2000)).

(149) This base strain was then supplemented with different phosphatase bearing plasmids for comparing the effect of the phosphatase on growth and sialic acid production. The base strain was used as blank in the comparison. These plasmids consisted of, besides the phosphatase and a promoter driving expression of the phosphatase, a pSC101 ori and a spectomycin resistance marker. The following phosphatases were expressed: EcAphA (SEQ ID NO: 42), EcCof (SEQ ID NO: 43), EcHisB (SEQ ID NO: 44), EcOtsB (SEQ ID NO: 45), EcSurE (SEQ ID NO: 46), EcYaed (SEQ ID NO: 47), EcYcjU (SEQ ID NO: 48), EcYedP (SEQ ID NO: 49), EcYfbT (SEQ ID NO: 50), EcYidA (SEQ ID NO: 51), EcYigB (SEQ ID NO: 52), EcYihX (SEQ ID NO: 53), EcYniC (SEQ ID NO: 54), EcYqaB (SEQ ID NO: 55), EcYrbL (SEQ ID NO: 56) and PsMupP (SEQ ID NO: 57). Other phosphatases that are expressed are EcAppA (SEQ ID NO: 58), EcGph (SEQ ID NO: 59), EcSerB (SEQ ID NO: 60), EcNagD (SEQ ID NO: 61), EcYbhA (SEQ ID NO: 62), EcYbiV (SEQ ID NO: 63), EcYbjL (SEQ ID NO: 64), EcYfbR (SEQ ID NO: 65), EcYieH (SEQ ID NO: 66), EcYjgL (SEQ ID NO: 67), Ec YjjG (SEQ ID NO: 68), EcYrfG (SEQ ID NO: 69), EcYbiU (SEQ ID NO: 70), ScDOG1 (SEQ ID NO: 71) and BsAraL (SEQ ID NO: 72).

(150) In a first experiment a subset of the above described strains was used. In a second experiment a second subset of the above described strains were tested.

(151) Each strain was cultured as described in example 1 (materials and methods). Briefly, the workflow consists of 3 growth steps: first growth on LB, followed by growth on MMsf with 15 g/L glycerol, and finally a growth stage using 15 g/L glycerol MMsf. The first step is performed in a 96 well plate, using 175 μL LB per well, and incubated overnight at 37° C. The second step is performed in a 96 well plate using 175 μL medium, incubated for 24 h at 37° C. The final growth step was performed in: i) in a 96 well plate using 175 μL medium, incubated at 37° C. to determine the μMax for the first experiment (see FIG. 5) and ii) in a 24 well deepwell plates using 3 mL do determine sialic acid production and optical densities for the second experiment (see FIG. 4).

(152) Reference table for FIGS. 4 and 5:

(153) TABLE-US-00007 label phosphatase SEQ ID NO Promotor blank NA NA NA 1 EcAphA 42 apFAB346 2 EcAphA 42 apFAB87 3 EcCof 43 apFAB87 4 EcCof 43 apFAB346 5 EcHisB 44 apFAB346 6 EcOtsB 45 apFAB346 7 EcSurE 46 apFAB346 8 EcSurE 46 apFAB87 9 EcYaed 47 apFAB346 10 EcYaed 47 apFAB87 11 EcYcjU 48 apFAB87 12 EcYedP 49 apFAB87 13 EcYfbT 50 apFAB87 14 EcYidA 51 apFAB346 15 EcYidA 51 apFAB87 16 EcYigB 52 apFAB346 17 EcYihX 53 apFAB346 18 EcYihX 53 apFAB87 19 EcYniC 54 apFAB346 20 EcYniC 54 apFAB87 21 EcYqaB 55 apFAB87 22 EcYqaB 55 apFAB346 23 EcYrbL 56 apFAB87 24 PsMupP 57 apFAB87

(154) Based on FIGS. 4 and 5 phosphatases enabling strains to grow better than the blank strain (no crippled growth) and producing more sialic acid than the blank strain, can be chosen.

(155) Based on the above, it was found that phosphatases comprising at least Motif 1 and Motif 2 provide a strain which is not crippled and produces more sialic acid than the blank strain.

Example 12: Identification of Further Sequences Related to the Phosphatases Used in the Methods of the Invention

(156) Sequences (polypeptides) related to SEQ ID NOs: 43, 44, 45, 47, 48, 49, 50, 51, 52, 54, 55 and 57 were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches. The output of the analysis was viewed by pairwise comparison, and ranked according to the probability score (E-value), where the score reflect the probability that a particular alignment occurs by chance (the lower the E-value, the more significant the hit). In addition to E-values, comparisons were also scored by percentage identity. Percentage identity refers to the number of identical amino acids between the two compared polypeptide sequences over a particular length. In some instances, the default parameters may be adjusted to modify the stringency of the search. For example the E-value may be increased to show less stringent matches. This way, short nearly exact matches may be identified.

(157) Table 1A to 1K provides a list of homologue polypeptide sequences related to SEQ ID NO: 43, 44, 45, 47, 48, 50, 51, 52, 54, 55 and 57, respectively.

(158) TABLE-US-00008 TABLE 1A Examples of polypeptides related to Ec Cof (SEQ ID NO: 43), showing sequence identity to SEQ ID 43: % identity (matgat) short genbank identifier SEQ ID NO 99.6 Shigella flexneri WP_095762248.1 78 99.3 Shigella boydii WP_095785299.1 79 98.2 Escherichia fergusonii WP_024256925.1 80 89.3 Staphylococcus aureus WP_094409981.1 81 89 Escherichia albertii WP_000113024.1 82 81.6 Citrobacter amalonaticus WP_046476411.1 83 81.6 Salmonella enterica WP_023234244.1 84 80.5 Escherichia coli WP_088543831.1 85

(159) TABLE-US-00009 TABLE 1B Examples of polypeptides related to Ec HisB (SEQ ID NO: 44), showing sequence identity to SEQ ID 44: % identity (matgat) short genbank identifier SEQ ID NO 99.4 Shigella flexneri K-315 EIQ21345.1 86 99.2 Escherichia albertii WP_059217413.1 87 98.9 Shigella flexneri WP_094085559.1 88 98.6 Shigella sonnei WP_077125326.1 89 98.6 Escherichia coli WP_088129012.1 90 98 Shigella dysenteriae WP_000080078.1 91 98 Escherichia marmotae WP_038355110.1 92 94.6 Salmonella bongori WP_000080052.1 93

(160) TABLE-US-00010 TABLE 1C Examples of polypeptides related to Ec OtsB (SEQ ID NO: 45), showing sequence identity to SEQ ID 45: % identity (matgat) short genbank identifier SEQ ID NO 99.6 Shigella sonnei WP_077124555.1 94 99.6 Escherichia coli WP_032172688.1 95 99.2 Shigella flexneri WP_064198868.1 96 85.7 Escherichia albertii WP_059227241.1 97 83.1 Escherichia fergusonii WP_000165652.1 98

(161) TABLE-US-00011 TABLE 1D Examples of polypeptides related to Ec Yaed (SEQ ID NO: 47), showing sequence identity to SEQ ID 47: % identity SEQ ID (matgat) short genbank identifier NO 99.5 Escherichia fergusonii WP_001140180.1 99 99.5 Shigella sonnei WP_047565591.1 100 99 Escherichia coli WP_061103769.1 101 95.8 Escherichia albertii WP_001140171.1 102 93.2 Kluyvera intermedia WP_047371746.1 103 93.2 Citrobacter koseri WP_047458784.1 104 89 Kosakonia arachidis WP_090122712.1 105 85.9 Kluyvera cryocrescensWP_061282459.1 106 85.9 Leclercia adecarboxylata WP_039030283.1 107

(162) TABLE-US-00012 TABLE 1E Examples of polypeptides related to Ec YcjUB (SEQ ID NO: 48), showing sequence identity to SEQ ID NO: 48: % identity (matgat) short genbank identifier SEQ ID NO 99.5 Shigella sonnei WP_094313132.1 108 97.7 Escherichia coli WP_000775764.1 109 95.4 Escherichia coli WP_032302947.1 110 92.7 Shigella flexneri OUZ88260.1 111

(163) TABLE-US-00013 TABLE 1F Examples of polypeptides related to Ec YfbT (SEQ ID NO: 50), showing sequence identity to SEQ ID NO: 50: % identity SEQ (matgat) short genbank identifier ID NO 99.1 Shigella sonnei WP_094323443.1 112 87.5 Citrobacter werkmanii NBRC 105721 GAL43238.1 113 86.6 Citrobacter freundii KGZ33467.1 114 86.6 Citrobacter amalonaticus Y19 AKE59306.1 115 85.6 Salmonella enterica WP_080095242.1 116 85.6 Escherichia fergusonii WP_001203376.1 117 85.6 Salmonella enterica subsp. enterica serovar 118 Hadar KKD79316.1

(164) TABLE-US-00014 TABLE 1G Examples of polypeptides related to Ec YidA (SEQ ID NO: 51), showing sequence identity to SEQ ID NO: 51: % identity SEQ ID (matgat) short genbank identifier NO 99.6 Escherichia coli WP_053263719.1 119 99.3 Escherichia fergusonii WP_000985562.1 120 99.3 Shigella sonnei WP_094337696.1 121 94.4 Trabulsiella guamensis WP_038161262.1 122 94.1 Citrobacter amalonaticus WP_061075826.1 123 93.7 Klebsiella pneumoniae WP_048288968.1 124 93.3 Trabulsiella odontotermitis WP_054178096.1 125 90 Enterobacter kobei WP_088221256.1 126

(165) TABLE-US-00015 TABLE 1H Examples of polypeptides related to Ec YigB (SEQ ID NO: 52), showing sequence identity to SEQ ID NO: 52: % identity (matgat) short genbank identifier SEQ ID NO 99.6 Shigella sonnei WP_094322240.1 127 93.7 Shigella sonnei WP_052962467.1 128 87 Salmonella enterica WP_079797638.1 129 85.7 Citrobacter braakii WP_080625916.1 130 81.9 Enterobacter hormaechei WP_047737367.1 131 81.1 Lelliottia amnigena WP_059180726.1 132 80.3 Leclercia adecarboxylata WP_039031210.1 133

(166) TABLE-US-00016 TABLE 1I Examples of polypeptides related to Ec YniC (SEQ ID NO: 54), showing sequence identity to SEQ ID NO: 54: % identity (matgat) short genbank identifier SEQ ID NO 85.6 Shigella flexneri 1235-66 EIQ75633.1 134 85.1 Kosakonia sacchari WP_074780431.1 135 85.1 Enterobacter mori WP_089599104.1 136 84.7 Lelliottia amnigena WP_064325804.1 137 84.7 Enterobacter sp. 638 WP_012017112.1 138 84.2 Kosakonia radicincitans WP_071920671.1 139 84.2 Salmonella enterica subsp. enterica serovar 140 Newport str. CDC 2010K-2159 AKD18194.1

(167) TABLE-US-00017 TABLE 1J Examples of polypeptides related to Ec YqaB (SEQ ID NO: 55), showing sequence identity to SEQ ID NO: 55: % identity (matgat) short genbank identifier SEQ ID NO 97.9 Shigella flexneri K-315 EIQ18779.1 141 93.6 Escherichia albertii WP_059215906.1 142 88.3 Salmonella enterica WP_079949947.1 143 85.6 Kluyvera intermedia WP_085006827.1 144 85.1 Trabulsiella odontotermitis WP_054177678.1 145 84.6 Yokenella regensburgei WP_006817298.1 146 84.6 Raoultella terrigena WP_045857711.1 147 83.5 Klebsiella pneumoniae WP_064190334.1 148

(168) TABLE-US-00018 TABLE 1K Examples of polypeptides related to Ps MupP (SEQ ID NO: 57), showing sequence identity to SEQ ID NO: 57: % identity (matgat) short genbank identifier SEQ ID NO 94.6 Pseudomonas putida group WP_062573193.1 149 94.6 Pseudomonas sp. GM84 WP_008090372.1 150 93.3 Pseudomonas entomophila 151 92.4 Pseudomonas vranovensis WP_028943668.1 152 83.9 Pseudomonas cannabina WP_055000929.1 153 93.3 Pseudomonas monteilii WP_060480519.1 154

(169) Sequences have been tentatively assembled and publicly disclosed by research institutions, such as The Institute for Genomic Research (TIGR; beginning with TA). The Eukaryotic Gene Orthologs (EGO) database may be used to identify such related sequences, either by keyword search or by using the BLAST algorithm with the nucleic acid sequence or polypeptide sequence of interest. Special nucleic acid sequence databases have been created for particular organisms, such as by the Joint Genome Institute.

Example 13: Identification of Domains and Motifs Comprised in Polypeptide Sequences Useful in Performing the Methods of the Invention

(170) The Integrated Resource of Protein Families, Domains and Sites (InterPro) database is an integrated interface for the commonly used signature databases for text- and sequence-based searches. The InterPro database combines these databases, which use different methodologies and varying degrees of biological information about well-characterized proteins to derive protein signatures. Collaborating databases include SWISS-PROT, PROSITE, TrEMBL, PRINTS, ProDom and Pfam, Smart and TIGRFAMs. Pfam is a large collection of multiple sequence alignments and hidden Markov models covering many common protein domains and families. Pfam is hosted at the Sanger Institute server in the United Kingdom. Interpro is hosted at the European Bioinformatics Institute in the United Kingdom.

(171) The results of the InterPro scan of the polypeptide sequences as represented by SEQ ID NOs: 43, 44, 45, 47, 48, 49, 50, 51, 52, 54 and 55 are presented in Table 2.

(172) TABLE-US-00019 TABLE 2 InterPro scan results (major accession numbers) of the polypeptide sequence as represented by SEQ ID NOs: 43, 44, 45, 47, 48, 49, 50, 51, 52, 54 and 55. Database Accession number Accession name Interpro IPR023214 HAD superfamily

(173) Alignment of the tested phosphatase polypeptides was done and FIG. 6 shows part of the alignment. Motif 1 and motif 2 are indicated with boxes. Alignment was made using clustalomega.

Example 14: Effect of Phosphatase on Growth and Production of Sialic Acid in Saccharomyces cerevisiae

(174) A further example of sialic acid production of several Saccharomyces cerevisiae strains capable of producing N-acetylneuraminate (sialic acid) wherein the strains are expressing an extra phosphatase as indicated hereunder.

(175) The strain used here is derived from the strain described in example 4. To enhance growth and production of sialic acid in Saccharomyces cerevisiae according to this invention, the phosphatase genes are introduced via a 2-micron plasmid (Chan 2013 (Plasmid 70 (2013) 2-17)) and the genes are expressed using synthetic constitutive promoters (Blazeck 2012 (Biotechnology and Bioengineering, Vol. 109, No. 11)) as also described in example 1. The specific plasmids used in this embodiment is p2a_2μ_sia_glmS-phospha. This plasmid based on the plasmid p2a_2μ_sia_glmS plasmid is described in example 1. It is introduced into Saccharomyces cerevisae using the transformation technique described by Gietz and Woods (2002, PMID 12073338) and a mutant strain is obtained. The effect of phosphatase expression on growth and production of sialic acid of these mutants are evaluated as described in example 11.

Example 15: Effect of Phosphatase on Growth and Production of Sialic Acid in Bacillus subtilis

(176) In another embodiment, this invention can be used to enhance growth and production of sialic acid in Bacillus subtilis, yet another bacterial production host.

(177) The strain used here is derived from the strain described in example 9. Additionally to the alterations described in example 9, phosphatase genes EcAphA (SEQ ID NO: 42), EcCof (SEQ ID NO: 43), EcHisB (SEQ ID NO: 44), EcOtsB (SEQ ID NO: 45), EcSurE (SEQ ID NO: 46), EcYaed (SEQ ID NO: 47), EcYcjU (SEQ ID NO: 48), EcYedP (SEQ ID NO: 49), EcYfbT (SEQ ID NO: 50), EcYidA (SEQ ID NO: 51), EcYigB (SEQ ID NO: 52), EcYihX (SEQ ID NO: 53), EcYniC (SEQ ID NO: 54), EcYqaB (SEQ ID NO: 55), EcYrbL (SEQ ID NO: 56), PsMupP (SEQ ID NO: 57), EcAppA (SEQ ID NO: 58), EcGph (SEQ ID NO: 59), EcSerB (SEQ ID NO: 60), EcNagD (SEQ ID NO: 61), EcYbhA (SEQ ID NO: 62), EcYbiV (SEQ ID NO: 63), EcYbjL (SEQ ID NO: 64), EcYfbR (SEQ ID NO: 65), EcYieH (SEQ ID NO: 66), EcYjgL (SEQ ID NO: 67), Ec YjjG (SEQ ID NO: 68), EcYrfG (SEQ ID NO: 69), EcYbiU (SEQ ID NO: 70), ScDOG1 (SEQ ID NO: 71) and BsAraL (SEQ ID NO: 72) are overexpressed on a plasmid, as described in example 1. Subsequently, this plasmid is introduced in Bacillus subtilis. The effect of phosphatase expression on growth and production of sialic acid of the created mutants are evaluated as described in example 11.