Method of production of 2,4-dihydroxybutyric acid

Abstract

A method of producing 2,4-dihydroxybutyric acid (2,4-DHB) by a synthetic pathway that includes transforming malate into 4-phospho-malate using a malate kinase, then transforming 4-phospho-malate into malate-4-semialdehyde using a malate semialdehyde dehydrogenase, and then transforming malate-4-semialdehyde into 2,4-DHB using a DHB dehydrogenase.

Claims

1. A malate kinase that transforms malate into 4-phospho-malate; the sequence of which is selected from the group consisting of SEQ ID NO: 39, 41, 43, and 45.

2. The malate kinase according to claim 1, wherein the malate kinase is set forth in SEQ ID NO: 39.

3. A method of producing 2,4-dihydroxybutyric acid (2,4-DHB), comprising: a first step of transforming malate into 4-phospho-malate using a malate kinase of claim 1, a second step of transforming 4-phospho-malate into malate-4-semialdehyde using a malate semialdehyde dehydrogenase selected from the group consisting of SEQ ID NO: 68, 54, 56, 58, 60, 62, 64, 66, and 231, and a third step of transforming malate-4-semialdehyde into 2,4DHB using a DHB dehydrogenase of SEQ ID NO: 81.

4. The method of claim 3, wherein the malate kinase is set forth in SEQ ID NO: 39.

5. The method according to claim 3, wherein the malate semialdehyde dehydrogenase is set forth in SEQ ID NO: 66.

6. The method of claim 3, wherein the malate semialdehyde dehydrogenase is set forth in SEQ ID NO: 68.

7. An isolated nucleic acid sequence encoding a malate kinase according to claim 1.

8. The isolated nucleic acid of claim 7, the sequence of which being selected from the group consisting of SEQ ID NO: 40, 42, and 44.

9. An expression vector comprising the nucleic acid according to claim 7.

10. A host microorganism expressing a malate kinase; wherein the host microorganism is transformed with the expression vector of claim 9.

11. The host microorganism according to claim 10, wherein the host microorganism is a bacterium, a yeast, or a fungus.

12. The host microorganism of claim 11, wherein the host microorganism is selected from the group consisting of Escherichia coli, Saccharomyces cerevisiae, Corynebacterium glutamicum, Zygosaccharomyces rouxii, and Aspergillus flavus.

13. A chimeric gene comprising at least, in the direction of transcription, functionally linked: a promoter regulatory sequence which is functional in a host organism, one or more isolated nucleic acid sequence encoding a malate kinase according to claim 1, and a terminator regulatory sequence which is functional in the host organism.

14. The chimeric gene of claim 13 comprising, in the direction of transcription, functionally linked: a promoter regulatory sequence which is functional in a host organism, a nucleic acid sequence encoding a malate semialdehyde dehydrogenase that transforms 4-phospho-malate into malate-4-semialdehyde, that has an enzyme that is an aspartate semialdehyde dehydrogenase, and the sequence being selected from the group consisting of SEQ ID NO: 54, 56, 58, 60, 62, 64, 66, and 231, and a terminator regulatory sequence that is functional in the host organism.

15. The chimeric gene of claim 14 having the sequence of SEQ ID NO: 229.

16. An expression vector comprising the chimeric gene according to claim 15.

17. A host microorganism, which is transformed with the expression vector of claim 16.

18. A process of production of 2,4-DHB comprising cultivating the host microorganism according to claim 17.

19. A method of producing 4-phospho-malate, comprising transforming malate by the maltase kinase according to claim 1.

20. A malate semialdehyde dehydrogenase that transforms 4-phospho-malate into malate-4-semialdehyde; the sequence of which is selected from the group consisting of SEQ ID NO: 54, 56, 58, 60, 62, 64, 66, and 231.

21. The malate semialdehyde dehydrogenase according to according to claim 20, wherein the malate semialdehyde dehydrogenase is set forth in SEQ ID NO: 66.

22. An isolated nucleic acid sequence encoding a malate semialdehyde dehydrogenase according to claim 20.

23. The isolated nucleic acid of claim 22, wherein the nucleic acid has a sequence selected from the group consisting of SEQ ID NO: 55, 57, 59, 61, 63, 65, and 230.

24. An expression vector comprising the nucleic acid according to claim 22.

25. A host microorganism expressing a malate semialdehyde dehydrogenase; wherein the host microorganism is transformed with the expression vector of claim 24.

26. The host microorganism according to claim 25, wherein the host microorganism is a bacterium, a yeast, or a fungus.

27. The host microorganism of claim 26, wherein the host microorganism is selected from the group consisting of Escherichia coli, Saccharomyces cerevisiae, Corynebacterium glutamicum, Zygosaccharomyces rouxii, and Aspergillus flavus.

28. A process of production of malate-4-semialdehyde comprising: cultivating the host microorganism according to claim 25 and expressing a malate semialdehyde dehydrogenase, and transforming 4-phospho-malate into malate-4-semialdehyde using the malate semialdehyde dehydrogenase.

29. A host microorganism, which is transformed with: an expression vector comprising an isolated nucleic acid sequence encoding a malate kinase that transforms malate into 4-phospho-malate, the sequence of which is selected from the group consisting of SEQ ID NO: 39, 41, 43, and 45; the expression vector of claim 24; and an expression vector comprising an isolated nucleic acid sequence encoding a DHB dehydrogenase that transforms malate-4-semialdehyde into 2,4-DHB, where the DHB dehydrogenase is set forth in SEQ ID NO: 81.

30. A process of production of 2,4-DHB comprising cultivating the host microorganism according to claim 29.

31. A method of producing malate-4-semialdehyde, comprising transforming 4-phospho-malate by the malate semialdehyde dehydrogenase according to claim 20.

32. A DHB dehydrogenase that transforms malate-4-semialdehyde into 2,4-DHB; wherein the DHB dehydrogenase is set forth in SEQ ID NO: 81.

33. An isolated nucleic acid sequence encoding DHB dehydrogenase according to claim 32.

34. The isolated nucleic acid of claim 33 the sequence of which being SEQ ID NO: 82.

35. An expression vector comprising the nucleic acid according to claim 33.

36. A host microorganism expressing a DHB dehydrogenase; wherein the host microorganism is transformed with the expression vector of claim 35.

37. The host microorganism according to claim 36, wherein the host microorganism is a bacterium, a yeast, or a fungus.

38. The host microorganism of claim 37, wherein the host microorganism is selected from the group consisting of Escherichia coli, Saccharomyces cerevisiae, Corynebacterium glutamicum, Zygosaccharomyces rouxii, and Aspergillus flavus.

39. A process of production of 2,4-DHB, comprising: cultivating the host microorganism according to claim 36 and expressing a DHB dehydrogenase, and transforming malate-4-semialdehyde into 2,4-DHB using the DHB dehydrogenase.

40. The process of production of 2,4-DHB according to claim 39, wherein the host microorganism is cultivated in a medium where malate, pyruvate, succinate, or fumarate is added.

41. The process of claim 40, wherein the culture medium further comprises another carbon source.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: (i) Reaction scheme that describes the conversion of (L)-malate into (L)-2,4-dihydroxybutyrate (DHB), and (ii) the analogy to the conversion of (L)-aspartate into (L)-homoserine.

(2) FIGS. 2A-2C: Alignment of amino acid sequences of aspartate kinases from different organisms. (Ec_AKIIIaspartate kinase III (SEQ ID NO: 4), LysC, of E. coli, Ec_AKI (SEQ ID NO: 87)aspartate kinase I, ThrA, of E. coli, Ec_AKII (SEQ ID NO: 88aspartate kinase II, MetL, of E. coli, MjMethanococcus jannaschii (SEQ ID NO: 89), TtThermus thermophilus (SEQ ID NO: 90), CgCorynebacterium glutamicum (SEQ ID NO: 91), AtArabidopsis thaliana (SEQ ID NO: 92), ScSaccharomyces cerevisiae. (SEQ ID NO: 93)) The figure was produced using ClustalW2 (Larkin et al., 2007).

(3) FIG. 3: Alignment of amino acid sequences of aspartate semialdehyde dehydrogenases from different organisms. (EcE. Coli (SEQ ID NO: 49), MjMethanococcus jannaschii (SEQ ID NO: 94), TtThermus thermophilus (SEQ ID NO: 95), BsBacillus subtilis (SEQ ID NO: 96), CgCorynebacterium glutamicum (SEQ ID NO: 97), AtArabidopsis thaliana (SEQ ID NO: 98), ScSaccharomyces cerevisiae. (SEQ ID NO: 99)) The figure was produced using ClustalW2 (Larkin et al., 2007).

(4) FIG. 4: GC chromatograms zooming on the region that corresponds to the retention time of DHB showing: (A) DHB standard (concentration=1 mM); (B) composition of Reaction A containing malate kinase (MK), malate semialdehyde dehydrogenase (MSA-Dh), and malate semialdehyde reductase (MSA-Red); (C) composition of control Reaction B (same as A but lacking MSA-Red); (D) composition of control Reaction C (same as A but lacking MSA-Dh).

(5) FIG. 5: Relative activities of purified LysC E119G, LysC E119G E250K, LysC E119G T344M, LysC E119G S345L, LysC E119G T344M, and LysC E119G T352I mutants with respect to lysine concentration in the reaction buffer.

EXAMPLES

Example 1

Test of Aspartate Kinases LysC and Hom3 from Escherichia coli and Saccharomyces cerevisiae, Respectively, for Aspartate and Malate Kinase Activity

(6) Construction of plasmids containing wild-type genes of aspartate kinase: The plasmid pLYSCwt was constructed by amplifying the lysC gene by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers .sup.5CACGAGGTACATATGTCTGAAATTGTTGTCTCC.sup.3 (SEQ ID NO: 1) and .sup.5CTTCCAGGGGATCCAGT-ATTTACTCAAAC.sup.3 (SEQ ID NO: 2) that introduce a NdeI and BamHI restriction sites upstream of the start codon and downstream of the stop codon, respectively. Genomic DNA from E. coli DH5a was used as the template. The PCR product was digested with NdeI and BamHI, ligated into the corresponding sites of the pET28a (Novagen) expression vector using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pAKIIIwt plasmid was isolated and shown by DNA sequencing to contain the full-length lysC gene having the correct sequence (SEQ ID NO: 3). The corresponding protein is represented by SEQ ID NO: 4.

(7) The plasmid pHOM3 wt was constructed by amplifying the HOM3 gene by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers .sup.5ATAATGCTAGCATGCCAATGGATTTCCAACC.sup.3 (SEQ ID NO: 5) and .sup.5TATAATGAATTCT-TAAATTCCAAGTCTTTTCAATTGTTC.sup.3 (SEQ ID NO: 6) that introduce a NheI and an EcoRI restriction sites upstream of the start codon and downstream of the stop codon, respectively. Genomic DNA from S. cerevisiae BY4741 wt was used as the template. The PCR product was digested with NheI and EcoRI, and ligated into the corresponding sites of the pET28a (Novagen) expression vector using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pHOM3 wt plasmid was isolated and shown by DNA sequencing to contain the full-length HOM3 gene having the correct sequence (SEQ ID NO: 7). The corresponding protein is represented by SEQ ID NO: 8.

(8) Expression of enzymes: E. coli BL21 D3 star cells were transformed with the appropriate plasmids. Enzymes with an N-terminal hexa-His tag were expressed in 250 mL LB cultures that were inoculated from an overnight culture at OD.sub.600 of 0.1 and grown to OD.sub.600 of 0.6 before protein expression was induced by addition of 1 mM isopropyl -D-1-thiogalactopyranoside (IPTG) to the culture medium. After 3 h of protein expression, cells were harvested by centrifugation at 13000 g for 10 min and stored at 20 C. until further analysis. Growth and protein expression were carried out at 37 C. Culture media contained 50 g/L kanamycin.

(9) Purification of enzymes: Frozen cell pellets of expression cultures were resuspended in 0.5 mL of breakage buffer (50 mM Hepes, 300 mM NaCl, pH 7.5) and broken open by four successive rounds of sonication (Bioblock Scientific, VibraCell 72437) with the power output set to 30%. Cell debris was removed by centrifuging the crude extracts for 15 min at 4 C. at 13000 g and retaining the clear supernatant. RNA and DNA were removed from the extracts by adding 15 mg/mL streptomycin (Sigma), centrifuging the samples at 13000 g for 10 min at 4 C. and retaining the supernatant. Clear protein extract was incubated for 1 h at 4 C. with 0.75 mL bed volumes of Talon Cobalt affinity resin (Clontech). The suspension was centrifuged at 700 g in a table top centrifuge and supernatant was removed. The resin was washed with 10 bed volumes of wash buffer (50 mM Hepes, 300 mM NaCl, 15 mM Imidazole, pH 7.5) before aspartate kinases were eluted with 0.5 mL of elution buffer (50 mM Hepes, 300 mM NaCl, 500 mM Imidazole, pH 7.5). Purity of eluted enzymes was verified by SDS-PAGE analysis.

(10) Enzymatic assay: Aspartate or malate kinase activities were assayed by coupling ADP production in the kinase reactions to NADH oxidation in the presence of phosphoenolpyruvate, pyruvate kinase, and lactate dehydrogenase.

(11) Reaction Scheme:

(12) Aspartate (or Malate) Kinase
aspartate (or malate)+ATP.fwdarw.4-phospho-(L)-aspartate (or 4-phospho-(L)-malate)+ADP

(13) Pyruvate Kinase
ADP+phosphoenolpyruvate.fwdarw.ATP+pyruvate

(14) Lactate Dehydrogenase
pyruvate+NADH.fwdarw.NAD.sup.++lactate

(15) The assay mixture contained 50 mM Hepes (pH 7.5), 50 mM KCl, 5 mM MgCl.sub.2, 0.24 mM NADH, 0.96 mM ATP, 0.96 mM PEP, 9 g/mL of lactate dehydrogenase (Sigma, L2500), 12.4 g/mL pyruvate kinase (Sigma, P1506), and appropriate amounts of purified aspartate (malate) kinase. Reactions were started by adding 50 mM (L)-aspartate or (L)-malate. Enzymatic assays were carried out at 30 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NADH at 340 nm in a microplate reader (BioRad 680XR).

(16) Hydroxamate assay: To verify phosphorylation of the substrate, i.e. formation of an acylphosphate anhydride, by wild-type or mutated aspartate kinases, the product of the kinase reaction was incubated with hydroxylamine to form the corresponding aspartate or malate hydroxamate derivative. The assay mixture contained 120 mM Hepes (pH 8), 200 mM KCl, 10 mM ATP, 200 mM hydroxylamine, 10 mM aspartate or malate, and appropriate amount of purified protein. The reaction was stopped after 30 min by addition of an equal volume of 1.7% (w/v) FeCl.sub.3 in 1 M hydrochloric acid. Formation of the hydroxamate-iron complex was verified by measuring its characteristic absorbance at 540 nm in a microtiter plate reader. Assay mixtures containing all components except for ATP were used as a blank.

(17) Results: Purified LysC (without His-tag, SEQ ID NO: 4) and Hom3 (without His-tag, SEQ ID NO:7) enzymes exhibited aspartate kinase activity but were not able to phosphorylate malate as verified by the hydroxamate assay (Keng & Viola, 1996). Maximum activities for LysC and Hom3 on aspartate were 4.5 mol/(min*mg.sub.prot) and 1.6 mol/(min*mg.sub.prot), respectively. The Km value for aspartate was estimated with the method of Eadie and Hofstee by measuring initial reaction rates (v) at different substrate concentrations (c) and by extracting the slope of the v versus v/c plot. The Km of purified His-tagged LysC was estimated around 0.6 mM showing that the His-tagged protein has the same substrate affinity as the non-tagged purified enzyme which was reported to be 0.6 mM (Marco-Marin et al., 2003).

Example 2

Site Directed Mutagenesis of Aspartate Kinase LysC from Escherichia coli and Test of Mutant Enzymes for Malate Kinase Activity

(18) Site-directed mutagenesis was carried out using the oligonucleotide pairs listed in Table 1 and the pLYSCwt (SEQ ID NO:3) plasmid as the template. Point mutations to change the amino acid sequence were introduced by PCR (Phusion 1 U, HF buffer 20% (v/v), dNTPs 2.5 mM, direct and reverse primers 1 M each, template plasmid 200 ng, water) using the oligonucleotide pair listed in Table 1. Plasmids created by PCR contained a new restriction site for Nco1 (introduced using silent mutations) in addition to the functional mutation to facilitate identification of mutated clones. The PCR products were digested by DpnI at 37 C. for 1 h to remove template DNA, and transformed into NEB 5-alpha competent E. coli cells (NEB). The mutated plasmids were identified by restriction site analysis and verified to carry the desired mutations by DNA sequencing.

(19) TABLE-US-00001 TABLE1 Oligonucleotidesusedtomutateaspartate kinaselysCfromE.coliinpositionE119. Mutation Sequence5-3 E119nnk GCTGGTCAGCCATGGCNNNCTGATGTCGACCCTGC (SEQIDNO:10) GCAGGGTCGACATCAGNNNGCCATGGCTGACCAGC (SEQIDNO:11)

(20) The sequence representing a mutation in position 119 can be represented by SEQ ID NO:9, wherein the residue in position 119 is X, X being anyone of the 19 naturally occurring amino acid (except glutamine).

(21) Mutant enzymes were expressed, purified and tested for aspartate and malate kinase activity as described in Example 1. Results are summarized in Table 2.

(22) TABLE-US-00002 TABLE 2 Characterization of mutant enzymes for malate kinase activities. Values correspond to the average from at least two independent experiments. Amino acid in position 119 Vmax Km (Corresponding SEQ ID NO:) [mol/(mg*min]] [mM]] C (SEQ ID NO:12) 0.97 19.7 G (SEQ ID NO:14) 0.49 16.0 N (SEQ ID NO:16) 0.13 27.1 P (SEQ ID NO: 18) 0.71 19.0 Q (SEQ ID NO:20) 0.01 39.9 S (SEQ ID NO:22) 0.83 15.7 T (SEQ ID NO:24) 0.33 26.8 V (SEQ ID NO:26) 0.29 39.7

(23) None of the mutants listed in Table 2 had activity on aspartate.

(24) The results show that aspartate kinase can be transformed into malate kinase by replacing the conserved glutamate at position 119 by cysteine, glycine, asparagine, proline, glutamine, serine, threonine, or valine.

(25) The corresponding nucleic acid sequences of the enzyme listed in Table 2 are SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 and SEQ ID NO:27.

Example 3

Construction of a Malate Kinase with Strongly Decreased Sensitivity for Inhibition by Lysine

(26) Site-directed mutagenesis was carried out using the oligonucleotide pairs listed in Table 3 and the pLYSC_E119G plasmid as the template (The pLYSC_E119G plasmid was obtained as described in Example 2 by introducing the following changes in the DNA sequence of the lysC gene: (SEQ ID NO: 15). Point mutations to change the amino acid sequences were introduced by PCR (Phusion 1U, HF buffer 20% (v/v), dNTPs 2.5 mM, direct and reverse primers 1 M each, template plasmid 200 ng, water) using the oligonucleotide pairs listed in Table 1. When possible, plasmids created by PCR contained new restriction sites (introduced using silent mutations) in addition to the functional mutation to facilitate identification of mutated clones. The PCR products were digested by DpnI at 37 C. for 1 h to remove template DNA, and transformed into NEB 5-alpha competent E. coli cells (NEB). The mutated plasmids were identified by restriction site analysis and verified to carry the desired mutations by DNA sequencing.

(27) TABLE-US-00003 TABLE3 Oligonucleotidesusedtomutatemalatekinase lysCE119GfromE.coli. Mutation Sequence5-3 E250K GCGTTTGCCGAAGCGGCAAAGATGGCCACTTTTG (SEQIDNO:28) CAAAAGTGGCCATCTTTGCCGCTTCGGCAAACGC (SEQIDNO:29) T344M GGTAGATCTAATCACCATGTCAGAAGTGAGCGTGG (SEQIDNO:30) CCACGCTCACTTCTGACATGGTGATTAGATCTACC (SEQIDNO:31) 5345L GGTAGATCTAATCACCACGTTAGAAGTGAGCGTGGC (SEQIDNO:32) GCCACGCTCACTTCTAACGTGGTGATTAGATCTACC (SEQIDNO:33) T344M GGTAGATCTAATCACCATGTCAGAAGTGAGCGTGG (SEQIDNO:34) CCACGCTCACTTCTGACATGGTGATTAGATCTACC (SEQIDNO:35) T352I GTCAGAAGTGAGCGTGGCATTAATTCTAGATACCAC (SEQIDNO:36) GTGGTATCTAGAATTAATGCCACGCTCACTTCTGAC (SEQIDNO:37)

(28) The nucleic acid sequence of the protein LysC E119G comprising an additional mutation corresponding to (i) the replacement of the glutamic acid in position 250 by a lysine is represented by SEQ ID NO: 38; its corresponding amino acid sequence is represented by SEQ ID NO: 39; (ii) the replacement of the threonine in position 344 by methionine is represented by SEQ ID NO: 40; its corresponding amino acid sequence is represented by SEQ ID NO: 41; (iii) the replacement of the threonine in position 352 by isoleucine is represented by SEQ ID NO: 42; its corresponding amino acid sequence is represented by SEQ ID NO: 43, (iv) the replacement of the serine in position 345 by leucine is represented by SEQ ID NO: 44; its corresponding amino acid sequence is represented by SEQ ID NO: 45.

(29) Expression and purification of enzymes: Protein expression for the His-tagged enzymes LysC E119G, LysC E119G E250K, LysC E119G T344M, LysC E119G S345L, LysC E119G T352I was carried out as described in Example 1.

(30) Enzymatic assay: Malate kinase activities were assayed as described in Example 1. Lysine concentration in the reaction buffer was varied.

(31) Results: The introduction of mutations E250K, T344M or S345L into LysC E119G renders the malate kinase activity largely insensitive to elevated lysine concentrations (See FIG. 4).

Example 4

Test of Aspartate Semialdehyde Dehydrogenases Asd from Escherichia coli for Aspartate and Malate Semialdehyde Dehydrogenase Activity

(32) Construction of Plasmids Containing Wild-Type Genes of Aspartate Semialdehyde Dehydrogenase: The plasmid pASDwt was constructed by amplifying the asd gene of E. coli by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers .sup.5ATAATGCTAGCATGAAAAATGTTGGTTTTATCGG.sup.3 (SEQ ID NO: 46) and .sup.5ATAATGGATCCTTACGCCAGTTGACGAAGC.sup.3 (SEQ ID NO: 47) that introduce a NheI and BamHI restriction site upstream of the start codon and downstream of the stop codon, respectively. Genomic DNA from E. coli DH5 was used as the template. The PCR product was digested with NheI and BamHI, ligated into the corresponding sites of the pET28a (Novagen) expression vector using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pASDwt plasmid was isolated and shown by DNA sequencing to contain the full-length asd gene having the correct sequence (SEQ ID NO: 48). The corresponding amino acid sequence of said enzyme is represented by SEQ ID NO: 49.

(33) Expression and purification of enzymes: Protein expression for the His-tagged enzymes Asd was carried out as described in Example 1.

(34) Enzymatic assay: Aspartate or malate semialdehyde dehydrogenase activities were assayed in the reverse biosynthetic direction by following the reduction of NADP during the oxidation of aspartate or malate semialdehyde to 4-phospho-(L)-aspartate or 4-phospho-(L)-malate, respectively (Roberts et al., 2003).
(L)-aspartate semialdehyde (or (L)-malate semialdehyde)+NADP+Pi.fwdarw.4-phospho-(L)-aspartate (or 4-phospho-(L)-malate)+NADPH

(35) The assay mixture contained 200 mM Hepes (pH 9), 50 mM K.sub.2HPO.sub.4, 0.25 mM NADP. Reactions were started by adding (L)-aspartate semialdehyde or (L)-malate semialdehyde. (L)-Aspartate semialdehyde was added in the form of L-aspartic acid -semialdehyde hydrate trifluoroacetate (maintained at pH3 to prevent degradation) which is a suitable substrate for enzymatic tests of homoserine dehydrogenase and aspartate semialdehyde dehysrogenase (Roberts et al., 2003). Unstable malate semialdehyde was produced freshly prior to the enzymatic tests by the deprotection of the stable malate semialdehyde derivative 2-[(4S)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl]acetaldehyde (DMODA). Malate semialdehyde was obtained by incubating DMODA in 2M hydrochloric acid for 15 min at 25 C., and evaporation of the released acetone (35 C., 50 mbar). The pH of the malate semialdehyde solution was fixed at 3 using sodium bicarbonate.

(36) Enzymatic assays were carried out in 96-well flat bottomed microtiter plates in a final volume of 250 L at 30 C. The reactions were followed by the characteristic absorption of NADPH at 340 nm in a microplate reader (BioRad 680XR).

(37) Results: His-tagged wild-type aspartate semialdehyde dehydrogenase, Asd, oxidised (L)-aspartate semialdehyde to 4-phospho-(L)-aspartate with a maximum specific activity of 160 mol/(min*mg.sub.prot). On (L)-malate semialdehyde the enzyme had an activity of 0.01 mol/(min*mg.sub.prot).

Example 5

Site Directed Mutagenesis of Aspartate Semialdehyde Dehydrogenase Asd from Escherichia coli and Test of Mutant Enzymes for Malate Semialdehyde Dehydrogenase Activity

(38) Point mutations in the amino acid sequence of Asd were introduced using the pASDwt plasmid as the template and following the protocol outlined in Example 2. The oligonucleotide pairs listed in Table 4 were used to mutate the glutamate residue in position 241 or the threonine residue in position 136. The mutated plasmids were identified by restriction site analysis and verified to carry the desired mutations by DNA sequencing.

(39) The Asd protein mutated in position 241 can be represented by SEQ ID NO: 68 wherein the residue in position 241 is X, X being anyone of the other 19 biologically occurring amino acid (except glutamine).

(40) TABLE-US-00004 TABLE4 Oligonucleotidesusedtomutate aspartatesemialdehydedehydrogenaseAsd fromE.coliinpositionE241andT136. Mutation Sequence5-3 E241nnn AGCTCGATAACGGTCAGAGTCGANNNGAGTGG AAAGGGCAGGCGG(SEQIDNO:50) CCGCCTGCCCTTTCCACTCNNNTCGACTCTGA CCGTTATCGAGCT(SEQIDNO:51) T136N TTTTGTTGGCGGTAACTGTAACGTGTCCCTGA TGTTG(SEQIDNO:52) CAACATCAGGGACACGTTACAGTTACCGCCAA CAAAA(SEQIDNO:53)

(41) Results: Activities and Km values of Asd mutated in position E241 are summarized in Table 5. Asd mutants where glutamate 241 was replaced by alanine, cysteine, glycine, histidine, isoleucine, methionine, or glutamine oxidised (L)-aspartate-4-semialdehyde to 4-phospho-(L)-aspartate with a significantly higher maximum specific activity than the wild-type enzyme. The double mutant Asd E241Q T136N (SEQ ID NO:231) had a maximum specific activity of 0.25 mol/(min*mg.sub.prot) and a Km of 0.25 mM.

(42) TABLE-US-00005 TABLE 5 Characterization of mutant enzymes for malate semialdehyde dehydrogenase activities. Values correspond to the average from at least two independent experiments. Amino acid in position 241 Vmax Km* (Corresponding SEQ ID NO:) [mol/(mg*min]] [mM] A (SEQ ID NO:54) 0.09 0.378 C (SEQ ID NO:56) 0.18 0.5 E (= wt) (SEQ ID NO:49) 0.01 G (SEQ ID NO:58) 0.09 0.18 H (SEQ ID NO:60) 0.10 0.8 I (SEQ ID NO:62) 0.10 0.23 M (SEQ ID NO:64) 0.15 0.43 Q (SEQ ID NO:66) 0.39 0.52 *Km values were only estimated for selected mutants

(43) The corresponding nucleic acids are represented by SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:48, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65 and SEQ ID NO:67.

(44) The double mutant Asd E241Q T136N has a nucleic acid sequence represented by SEQ ID NO: 230.

Example 6

Identification of a 2,4 DHB Dehydrogenase

(45) To identify a suitable 2,4 DHB dehydrogenase, beta-hydroxyacid dehydrogenases from different biological sources were tested for their ability to reduce malate semialdehyde. Among the tested enzymes were the methylbutyraldehyde reductase, Ypr1 (Ford & Ellis, 2002))(SEQ ID NO: 73 and SEQ ID NO: 74), from Saccharomyces cerevisiae; and the succinic semialdehyde reductase, Ms-Ssr from Metallosphaera sedula (Kockelkorn & Fuchs, 2009)(SEQ ID NO: 75 and SEQ ID NO: 76). The genes YPR1 and Ms-SSR were amplified using primers listed in Table 6 and cloned into vector pET28 (restriction enzymes see Table 3) yielding plasmids pYPR1 and pMs-SSR, respectively. The proteins were expressed and purified as described in Example 1.

(46) TABLE-US-00006 TABLE6 Primersandrestrictionenzymes usedtoclonecandidatebeta-hydroxyacid dehydrogenases Restriction Enzyme AccessionNo Primer5-3 enzymes Ms-SSR GI:146304190 TATAATGCTAGCATG NheI AAAGCTGCAGTACTT CA (SEQIDNO:69) TATAATGAATTCTTA EcoRI CGGGATTATGAGACT TC (SEQIDNO:70) YPR1 GI:6320576 TATAATGCTAGCATG NheI CCTGCTACGTTAAAG AA (SEQIDNO:71) TATAATGAGCTCTCA SacI TTGGAAAATTGGGAA GG (SEQIDNO:72)
Test for Malate Semialdehyde Reductase Activity:
Reaction:
(L)-Malate semialdehyde+NAD(P)H.fwdarw.(L)-2,4-dihydroxybutyric acid+NAD(P)

(47) The assay mixture contained 200 mM Hepes (pH 7.5), 50 mM KCl, 5 mM MgCl.sub.2, 0.24 mM NADH or NADPH, and appropriate amounts of purified enzyme. Reactions were started by adding 10 mM (L)-malate semialdehyde (malate semialdehyde was prepared freshly for each test, see Example 4). Enzymatic assays were carried out at 30 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NAD(P)H at 340 nm in a microplate reader (BioRad 680XR). Results are listed in Table 7.

(48) TABLE-US-00007 TABLE 7 Reducing activity of selected beta-hydroxyacid dehydrogenases on malate semialdehyde (Results represent the average of at least two independent experiments). Activity Activity on malate on malate semialdehyde semialdehyde (cofactor (cofactor NADH) NADPH) Reported [mol/ [mol/ Enzyme Origin function (min*mg_prot)] (min*mg_prot)] Ms-SSR M. sedula Succinic 4.9 4.9 (SEQ ID semialdehyde NO: 76) reductase YPR1 S. cerevisiae Methyl- nd 0.19 (SEQ ID butyraldehyde NO: 74) reductase

(49) The succinic semialdehyde dehydrogenase from M. sedula and the methylbutyraldehyde reductase from S. cerevisiae have malate semialdehyde reductase activity. The Km of Ms-SSR for malate semialdehyde was 1.1 mM.

Example 7

Site Directed Mutagenesis of Succinic Semialdehyde Reductase from M. sedula

(50) Site-directed mutagenesis was carried out using the oligonucleotide pairs listed in Table 8 and the pMs-SSR plasmid as the template. Point mutations to change the amino acid sequences were introduced by PCR (Phusion 1U, HF buffer 20% (v/v), dNTPs 2.5 mM, direct and reverse primers 1 M each, template plasmid 200 ng, water). When possible, plasmids created by PCR contained new restriction sites (introduced using silent mutations) in addition to the functional mutation to facilitate identification of mutated clones. The PCR products were digested by DpnI at 37 C. for 1 h to remove template DNA, and transformed into NEB 5-alpha competent E. coli cells (NEB). The mutated plasmids were identified by restriction site analysis and verified to carry the desired mutations by DNA sequencing. Table 9 summarizes kinetic parameters of the mutants. The results demonstrate that the double mutant Ms-SSR H39R N43H (SEQ ID NO: 81, SEQ ID NO: 82) has improved affinity for malate semialdehyde when compared to the wild type enzyme.

(51) TABLE-US-00008 TABLE8 PrimerpairsusedtomutateM.sedula succinicsemialdehydereductase(Ms-SSR) Restriction Mutation Primer5-3 enzymes H39R gtcaaggcaaccggtctctg NheI tcgctccgacgtcaatg (SEQIDNO:77) cattgacgtcggagcgacag agaccggttgccttgac (SEQIDNO:78) N43H ggctctgtcactccgacgta NheI catgtctttgaggggaaaac (SEQIDNO:79) gttttcccctcaaagacatg tacgtcggagtgacagagcc (SEQIDNO:80)

(52) TABLE-US-00009 TABLE 9 Summary of kinetic parameters of M. sedula succinic semialdehyde reductase (Ms-SSR) mutants (Results represent the average of at least two independent experiments). Maximum activity Km Mutant [mol/(min* mg.sub.prot)] [mmol/L] Wild type ((SEQ ID NO: 76) 4.9 1.1 H39R (SEQ ID NO:225) 1.7 0.5 N43H (SEQ ID NO:227) 4.3 2.5 H39R N43H (SEQ ID NO: 81) 4.7 0.4

(53) The corresponding nucleic sequences are represented by SEQ ID NO: 224, SEQ ID NO: 226 and SEQ ID NO: 82.

Example 8

In vitro Production of DHB

(54) The enzymes malate kinase (LysC E119G, SEQ ID NO: 15), malate semialdehyde dehydrogenase (Asd E241Q; SEQ ID NO: 67), and malate semialdehyde reductase (Ms SSrR, SEQ ID NO: 76) were expressed and purified as described in Example 1. Production of DHB was demonstrated in vitro by adding 50 mM malate to a reaction mixture that contained 50 mM Hepes (pH 7.5), 50 mM KCl, 5 mM MgCl.sub.2, 1 mM NADPH, 180 g/mL of malate kinase (Lys E119G), 325 g/mL of malate semialdehyde dehydrogenase (Asd E241Q), and 130 g/mL of malate semialdehyde reductase (Ms_Ssr) (Reaction A). Control reactions contained all components but were lacking either malate semialdehyde reductase (Reaction B) or malate semialdehyde dehydrogenase (Reaction C). After 30 min of incubation at 30 C., the reaction mixture was analysed by gas chromatography [CPG Varian Series 430; equipped with FID detector; autosampler CP8400; splitless injector 1177 (230 C.); column: CP-WAX58/FFAP, 30 m0.53 mm, d.sub.f 0.50 m; and liner: Inlet Sleeve, gooseneck 6.578.54 mm GWOL (Varian). Carrier gas was nitrogen at a flow rate of 25 mL/min. Flame ionization was carried out using an air-hydrogen mixture (flow rates were 300 mL/min and 30 mL/min, respectively). Detector temperature was 240 C. Injected sample volume was 1 L. Temperature program is provided in Table 10.

(55) TABLE-US-00010 TABLE 10 Temperature program for analysis of reaction mixtures Column temperature Hold Gradient Runtime [ C.] [min] [ C./min] [min] 90 0 0 0 115 1.8 30 2.63 160 2 2 27.13 230 1 50 29.53

(56) DHB production was detected in reaction A (presence of all enzymes), but was absent in control reaction B and C (FIG. 5).

Example 9

Optimization of the Coding Sequence of M. sedula Succinic Semialdehyde Reductase for its Expression in E. coli

(57) The coding sequence of M. sedula succinic semialdehyde reductase including the mutations H39R and N43H was optimized for maximum expression in E. coli, using the GeneOptimizer software. The synthetic gene was produced by GeneArt Gene Synthesis (Invitrogen Life Technologie). NheI and EcoRI restriction sites were introduced upstream of the start codon and downstream of the stop codon, respectively, allowing direct cloning into pET28a+ (Novagen).

(58) The resulting pSSR-H39RN43H-opt plasmid was isolated and shown by DNA sequencing to contain the full-length M sedula SSR H39R N43H gene having the correct sequence (SEQ ID NO:228).

Example 10

Construction of a Plasmid that Facilitates the Simultaneous Expression of Malate Kinase (Mutant of the lysC Gene from E. coli), Malate Semialdehyde Dehydrogenase, (Mutant of the Asd Gene from E. coli), and DHB Dehydrogenase (Mutant of the M. sedula Succinic Semialdehyde Reductase Gene) Using E. coli as the Host Organism

(59) The plasmid pLYSC-E119G E250K (SEQ ID NO:38) was used as the backbone for the operon construction. A DNA fragment containing the pET28 (Novagen) ribosome binding site (rbs) and the coding region of ASD-E241Q was obtained by PCR (high fidelity polymerase Phusion (Finnzymes)) using pASD-E241Q (SEQ ID NO: 55 as the template, and the direct and reverse primers .sup.5ATAAGGATCCGTTTAACTTTAAGAAGGAGATATACCATGGG.sup.3 (SEQ ID NO: 83) and .sup.5ATAAGAATTCTTACGCCAGTTGACGAAG.sup.3 (SEQ ID NO: 84) that introduced a BamHI and a EcoRI restriction site upstream of the rbs and downstream of the stop codon, respectively. The PCR products were digested with BamHI and EcoRI, ligated into the corresponding sites of pLYSC-E119G E250K, using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pLYSC-E119G-E250K_ASD-E241Q plasmid was isolated and shown by DNA sequencing to have the correct sequence.

(60) A DNA fragment containing the pET28 ribosome binding site (rbs) and the coding region of the codon-optimized Ms-SSR-H39RN43H-opt was obtained by PCR using pSSR-H39RN43H-opt as the template, and the direct and reverse primers .sup.5ATAAGCGGCCGCGTTTAACTTTAAGAAGGAGATAT.sup.3 (SEQ ID NO:85) and .sup.5TATAAACTCGAGCTTACGGAATAATCAGG.sup.3 (SEQ ID NO: 86) that introduced a NotI and a PspXI restriction site upstream of the rbs and downstream of the stop codon, respectively. The PCR products were digested with NotI and PspXI, ligated into the corresponding sites of pLYSC-E119G-E250K_ASD-E241Q, using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pET28-DHB plasmid (SEQ ID NO: 229) was isolated and shown by DNA sequencing to have the correct sequence.

(61) The 5 upstream promoter region simultaneously regulating the expression of the three genes (ie T7 promoter in pET28-DHB) can be replaced with any other promoter, inducible or constitutive, by digesting pET28-DHB with SphI and XbaI and cloning another promoter region with suitable restriction sites. As an example for the use of an inducible promoter, the T7 promoter of the pET28-DHB backbone was replaced by the tac promoter whose characteristics allow for protein expression in the presence of glucose (de Boer et al., 1983). The tac promoter was obtained from plasmid pEXT20 (Dykxhoorn et al., 1996) by digesting the plasmid with SphI and XbaI. The DNA fragment containing the promoter was purified and cloned into the SphI/XbaI digested pET28-DHB plasmid. The resulting pTAC-DHB plasmid was isolated and shown by DNA sequencing to have the correct sequence.

(62) TABLE-US-00011 TABLE 11 List of plasmid constructed in this study Plasmid Regulation Features pET28-DHB T7 lysC-E119G-E250K, asd-E241Q, Ms_SSR- H39R-N43H codon optimized pTAC-DHB tac lysC-E119G-E250K, asd-E241Q, Ms_SSR- H39R-N43H codon optimized

Example 11

Construction of E. coli Strains to Optimise Carbon Flux Repartitioning and NADPH-cofactor Supply for Fermentative DHB Production

(63) Several genes were disrupted in E. coli strain MG1655 in order to optimise carbon flux repartitioning and cofactor supply for DHB production. Gene deletions were carried out using the lambda red recombinase method according to Datsenko et al. (Datsenko & Wanner, 2000).

(64) The deletion cassettes were prepared by PCR using high fidelity polymerase Phusion (Finnzymes), and the FRT-flanked kanamycin resistance gene (kan) of plasmid pKD4 as the template (Datsenko & Wanner, 2000). Sense primers contained sequences corresponding to the 5 end of each targeted gene (underlined) followed by 20 by corresponding to the FRT-kan-FRT cassette of pKD4. Anti-sense primers contained sequences corresponding to the 3 end region of each targeted gene (underlined) followed by 20 bp corresponding to the cassette. The primers are described in Table 12. PCR products were digested with DpnI and purified prior to transformation.

(65) E. coli MG1655 strain was rendered electro-competent by growing the cells to an OD.sub.600 of 0.6 in LB liquid medium at 37 C., concentrating the cells 100-fold and washing twice with ice-cold 10% glycerol. The cells were transformed with plasmid pKD46 (Datsenko & Wanner, 2000) by electroporation (2.5 kV, 200 , 25 F, in 2 mm gap cuvettes). Transformants were selected at 30 C. on ampicillin (100 g/mL) LB solid medium.

(66) Disruption cassettes were transformed into electro-competent E. coli strains harbouring the lambda Red recombinase-expressing plasmid pKD46. The cells were grown at 30 C. in liquid SOB medium containing ampicillin (100 g/mL). The lambda red recombinase system was induced by adding 10 mM arabinose when OD.sub.600 of the cultures reached 0.1. Cells were further grown to an OD.sub.600 of 0.6 before they were harvested by centrifugation, washed twice with ice-cold 10% glycerol, and transformed with the disruption cassette by electroporation. After an overnight phenotypic expression at 30 C. in LB liquid medium, cells were plated on solid LB medium containing 25 g/mL kanamycin. Transformants were selected after cultivation at 30 C.

(67) The gene replacement was verified by colony PCR using Crimson Taq polymerase (NEB). A first reaction was carried out with the flanking locus-specific primers (see tables 13) to verify simultaneous loss of the parental fragment and gain of the new mutant specific fragment. Two additional reactions were done by using nearby locus-specific primers with the respective common test primer k1 rev, or k2 for (see Table 13) within the FRT-kanamycin resistance cassette (sense locus primer/k1 rev and k2 for/reverse locus primer).

(68) The resistance gene (FRT-kan-FRT) was subsequently excised from the chromosome using the FLP recombinase-harbouring plasmid pCP20 (Cherepanov & Wackernagel, 1995) leaving a scar region containing one FRT site. pCP20 is an ampicillin and CmR plasmid that shows temperature-sensitive replication and thermal induction of FLP recombinase synthesis. Kanamycin resistant mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C. Transformants were then grown on solid LB medium at 37 C. and tested for loss of all antibiotic resistances. Excision of the FRT-kanamycin cassette was analysed by colony PCR using crimson taq polymerase and the flanking locus-specific primers (Table 13). Multiple deletions were obtained by repeating the above described steps.

(69) Strains carrying single or multiple deletions were rendered electro-competent as described above, transformed with the pTAC-DHB plasmid which allows for the IPTG-inducible expression of the DHB pathway enzymes (see Example 10), and selected on solid LB medium containing 50 g/mL kanamycin.

(70) The plasmid pACT3-pck harbouring the PEP carboxykinase encoding pck gene of E. coli was constructed by amplifying the pck coding sequence using genomic DNA from E. coli MG1655 as the template and the forward and reverse primers, respectively, .sup.5ATAATCCCGGGATGCGCGTTAACAATGGTTTGACC.sup.3 (SEQ ID NO: 100) and .sup.5ATAATTCTAGATTACAGTTTCGGACCAGCCG.sup.3 (SEQ ID NO: 101). The DNA fragment was digested with Xmal and XbaI, ligated into the corresponding sites of the pACT3 expression vector (Dykxhoorn et al., 1996) using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The transformants were selected on solid LB medium containing chloramphenicol (25 g/mL). The resulting plasmid was isolated and correct insertion of the pck gene was verified by sequencing. Plasmids pACT3-aceA, pACT3-ppc, pACT3-galP, pACT3-pykA and pACT3-pyc harbouring, respectively, aceA, ppc, galP, or pykA (all E. coli) or pycA from Lactococcus lactis were constructed analogously using the primers listed in Table 14.

(71) The above mentioned pACT3-derived plasmids and the pTAC-DHB plasmid were transformed into E. coli MG1655 mutants carrying combinations of the deletions listed in Table 12. Transformants containing both plasmids were selected on solid LB medium containing chloramphenicol (25 g/mL) and kanamycin (50 g/mL). Examples for constructed strains are listed in Table 15.

(72) TABLE-US-00012 TABLE12 Primersusedforgenedisruptions. Sequenceshomologoustotarget genesareunderlined. Gene Primer Sequence ldhA _ldhA_for Gaaggttgcgcctaca ctaagcatagttgttg atgagtgtaggctgga gctgcttc (SEQIDNO:102) _ldhA_rev Ttaaaccagttcgttc gggcaggtttcgcctt tttcatgggaattagc catggtcc (SEQIDNO:103) adhE _adhE_for Atggctgttactaatg tcgctgaacttaacgc actcgtagagcgtgtg taggctggagctgctt c (SEQIDNO:104) _adhE_rev Ttaagcggattttttc gcttttttctcagctt tagccggagcagccat atgaatatcctcctta g (SEQIDNO:105) ackA _ackA_for atgtcgagtaagttag tactggttctgaactg cggtagttcttcagtg taggctggagctgctt c (SEQIDNO:106) _ackA_rev tcaagcagtcaggcgg ctcgcatcttgcgcga taaccagttcttccat atgaatatcctcctta g (SEQIDNO:107) focA- _focA- ttactccgtatttgca pflB pflB_for taaaaaccatgcgagt tacgggcctataagtg taggctggagctgctt c (SEQIDNO:108) _focA- atagattgagtgaagg pflB_rev tacgagtaataacgtc ctgctgctgttctcat atgaatatcctcctta g (SEQIDNO:109) pta _pta_for gtgtcccgtattatta tgctgatccctaccgg aaccagcgtcggtgtg taggctggagctgctt c (SEQIDNO:110) _pta_rev ttactgctgctgtgca gactgaatcgcagtca gcgcgatggtgtacat atgaatatcctcctta g (SEQIDNO:111) poxB _poxB_for atgaaacaaacggttg cagcttatatcgccaa aacactcgaatcggtg taggctggagctgctt c (SEQIDNO:112) _poxB_rev ttaccttagccagttt gttttcgccagttcga tcacttcatcacccat atgaatatcctcctta g (SEQIDNO:113) sad _sad_for atgaccattactccgg caactcatgcaatttc gataaatcctgccgtg taggctggagctgctt c (SEQIDNO:114) _sad_rev tcagatccggtctttc cacaccgtctggatat tacagaattcgtgcat atgaatatcctcctta g (SEQIDNO:115) gabD _gabD_for atgaaacttaacgaca gtaacttattccgcca gcaggcgttgattgtg taggctggagctgctt c (SEQIDNO:116) _gabD_rev ttaaagaccgatgcac atatatttgatttcta agtaatcttcgatcat atgaatatcctcctta g (SEQIDNO:117) gadA _gadA_for atggaccagaagctgt taacggatttccgctc agaactactcgatgtg taggctggagctgctt c (SEQIDNO:118) _gadA_rev tcaggtgtgtttaaag ctgttctgctgggcaa taccctgcagtttcat atgaatatcctcctta g (SEQIDNO:119) gadB _gadB_for atggataagaagcaag taacggatttaaggtc ggaactactcgatgtg taggctggagctgctt c (SEQIDNO:120) _gadB_rev tcaggtatgtttaaag ctgttctgttgggcaa taccctgcagtttcat atgaatatcctcctta g (SEQIDNO:121) gadC _gadC_for atggctacatcagtac agacaggtaaagctaa gcagctcacattagtg taggctggagctgctt c (SEQIDNO:122) _gadC_rev ttagtgtttcttgtca ttcatcacaatatagt gtggtgaacgtgccat atgaatatcctcctta g (SEQIDNO:123) sfcA _sfcA_for atggaaccaaaaacaa aaaaacagcgttcgct ttatatcccttacgtg taggctggagctgctt c (SEQIDNO:124) _sfcA_rev ttagatggaggtacgg cggtagtcgcggtatt cggcttgccagaacat atgaatatcctcctta g (SEQIDNO:125) maeB _maeB_for atggatgaccagttaa aacaaagtgcacttga tttccataaatttgta taggctggagctgctt c (SEQIDNO:126) _maeB_rev ttacagcggttgggtt tgcgcttctaccacgg ccagcgccaccatcat atgaatatcctcctta g (SEQIDNO:127) ppc _ppc_for atgaacgaacaatatt ccgcattgcgtagtaa tgtcagtatgctcgtg taggctggagctgctt c (SEQIDNO:128) _ppc_rev ttagccggtattacgc atacctgccgcaatcc cggcaatagtgaccat atgaatatcctcctta g (SEQIDNO:129) pykA _pykA_for atgtccagaaggcttc gcagaacaaaaatcgt taccacgttaggcgtg taggctggagctgctt c (SEQIDNO:130) _pykA_rev ttactctaccgttaaa atacgcgtggtattag tagaacccacggtcat atgaatatcctcctta g (SEQIDNO:131) pykF _pykF_for atgaaaaagaccaaaa ttgtttgcaccatcgg accgaaaaccgaagtg taggctggagctgctt c (SEQIDNO:132) _pykF_rev ttacaggacgtgaaca gatgcggtgttagtag tgccgctcggtaccat atgaatatcctcctta g (SEQIDNO:133) mgsA _mgsA_for atggaactgacgactc gcactttacctgcgcg gaaacatattgcggtg taggctggagctgctt c (SEQIDNO:134) _mgsA_rev ttacttcagacggtcc gcgagataacgctgat aatcggggatcagcat atgaatatcctcctta g (SEQIDNO:135) iclR _iclR_for atggtcgcacccattc ccgcgaaacgcggcag aaaacccgccgttgtg taggctggagctactt c (SEQIDNO:136) _iclR_rev tcagcgcattccaccg tacgccagcgtcactt ccttcgccgctttcat atgaatatcctcctta g (SEQIDNO:137) icd _icd_for atggaaagtaaagtag ttgttccggcacaagg caagaagatcaccgtg taggctggagctgctt c (SEQIDNO:138) _icd_rev ttacatgttttcgatg atcgcgtcaccaaact ctgaacatttcagcat atgaatatcctcctta g (SEQIDNO:139) sucA _sucA_for atgcagaacagcgctt tgaaagcctggttgga ctcttcttacctcgtg taggctggagctgctt c (SEQIDNO:140) _sucA_rev ttattcgacgttcagc gcgtcattaaccagat cttgttgctgtttcat atgaatatcctcctta g (SEQIDNO:141) sucB _sucB_for atgagtagcgtagata ttctggtccctgacct gcctgaatccgtagtg taggctggagctgctt c (SEQIDNO:142) _sucB_rev ctacacgtccagcagc agacgcgtcggatctt ccagcaactctttcat atgaatatcctcctta g (SEQIDNO:143) frdA _frdA_for gtgcaaacctttcaag ccgatcttgccattgt aggcgccggtggcgtg taggctggagctgctt c (SEQIDNO:144) _frdA_rev tcagccattcgccttc tccttcttattggctg cttccgccttatccat atgaatatcctcctta g (SEQIDNO:145) frdB _frdB_for atggctgagatgaaaa acctgaaaattgaggt ggtgcgctataacgtg taggctggagctgctt c (SEQIDNO:146) _frdB_rev ttagcgtgatttcaaa atcgcaataagaaagt ctttcgaactttccat atgaatatcctcctta g (SEQIDNO:147) frdC _frdC_for atgacgactaaacgta aaccgtatgtacggcc aatgacgtccaccgtg taggctggagctgctt c (SEQIDNO:148) _frdC_rev ttaccagtacagggca acaaacaggattacga tggtggcaaccaccat atgaatatcctcctta g (SEQIDNO:149) frdD _frdD_for atgattaatccaaatc caaagcgttctgacga accggtattctgggtg taggctggagctgctt c (SEQIDNO:150) _frdD_rev ttagattgtaacgaca ccaatcagcgtgacaa ctgtcaggatagccat atgaatatcctcctta g (SEQIDNO:151) ptsG _ptsG_for atgtttaagaatgcat ttgctaacctgcaaaa ggtcggtaaatcggtg taggctggagctgctt c (SEQIDNO:152) _ptsG_rev ttagtggttacggatg tactcatccatctcgg ttttcaggttatccat atgaatatcctcctta g (SEQIDNO:153) ptsI _ptsI_for atgatttcaggcattt tagcatccccgggtat cgctttcggtaaagtg taggctggagctgctt c (SEQIDNO:154) _ptsI_rev ttagcaaattattttt tcttcaatgaacttgt taaccaacgtcatcat atgaatatcctcctta g (SEQIDNO:155)

(73) TABLE-US-00013 TABLE13 Primerpairsusedfor verificationofgenedisruptions Deleted Sequence(5-3) gene Forwardprimer Reverseprimer K2for/ cggtgccctgaatgaactgc cagtcatagccgaatagcct k1rev (SEQIDNO:156) (SEQIDNO:157) IdhA atacgtgtcccgagcggtag tacacatcccgccatcagca (SEQIDNO:158) (SEQIDNO:159) adhE gaagtaaacgggaaaatcaa agaagtggcataagaaaacg (SEQIDNO:160) (SEQIDNO:161) ackA ccattggctgaaaattacgc gttccattgcacggatcacg (SEQIDNO:162) (SEQIDNO:163) focA_ atgccgtagaagccgccagt tgttggtgcgcagctcgaag pflB (SEQIDNO:164) (SEQIDNO:165) pta gcaaatctggtttcatcaac tcccttgcacaaaacaaagt (SEQIDNO:166) (SEQIDNO:167) poxB ggatttggttctcgcataat agcattaacggtagggtcgt (SEQIDNO:168) (SEQIDNO:169) sad gctgattctcgcgaataaac aaaaacgttcttgcgcgtct (SEQIDNO:170) (SEQIDNO:171) gabD tctgtttgtcaccaccccgc aagccagcacctggaagcag (SEQIDNO:172) (SEQIDNO:173) gadA aagagctgccgcaggaggat gccgccctcttaagtcaaat (SEQIDNO:174) (SEQIDNO:175) gadB ggattttagcaatattcgct cctaatagcaggaagaagac (SEQIDNO:176) (SEQIDNO:177) gadC gctgaactgttgctggaaga ggcgtgcttttacaactaca (SEQIDNO:178) (SEQIDNO:179) sfcA tagtaaataacccaaccggc tcagtgagcgcagtgtttta (SEQIDNO:180) (SEQIDNO:181) maeB attaatggtgagagtttgga tgcttttttttattattcgc (SEQIDNO:182) (SEQIDNO:183) ppc gctttataaaagacgacgaa gtaacgacaattccttaagg (SEQIDNO:184) (SEQIDNO:185) pykA tttatatgcccatggtttct atctgttagaggcggatgat (SEQIDNO:186) (SEQIDNO:187) pykF ctggaacgttaaatctttga ccagtttagtagctttcatt (SEQIDNO:188) (SEQIDNO:189) iclR gatttgttcaacattaactc tgcgattaacagacaccctt atcgg (SEQIDNO:191) (SEQIDNO:190) mgsA tctcaggtgctcacagaaca tatggaagaggcgctactgc (SEQIDNO:192) (SEQIDNO:193) icd cgacctgctgcataaacacc tgaacgctaaggtgattgca (SEQIDNO:194) (SEQIDNO:195) sucA acgtagacaagagctcgcaa catcacgtacgactgcgtcg (SEQIDNO:196) (SEQIDNO:197) sucB tgcaactttgtgctgagcaa tatcgcttccgggcattgtc (SEQIDNO:198) (SEQIDNO:199) frdA aaatcgatctcgtcaaattt aggaaccacaaatcgccata cagac (SEQIDNO:201) (SEQIDNO:200) frdB gacgtgaagattactacgct agttcaatgctgaaccacac (SEQIDNO:202) (SEQIDNO:203) frdC tagccgcgaccacggtaaga cagcgcatcacccggaaaca aggag (SEQIDNO:205) (SEQIDNO:204) frdD atcgtgatcattaacctgat ttaccctgataaattaccgc (SEQIDNO:206) (SEQIDNO:207) ptsG ccatccgttgaatgagtttt tggtgttaactggcaaaatc (SEQIDNO:208) (SEQIDNO:209) ptsI gtgacttccaacggcaaaag ccgttggtttgatagcaata (SEQIDNO:210) (SEQIDNO:211)

(74) TABLE-US-00014 TABLE14 Primersusedforgeneoverexpression. Restrictionsitesusedforcloning intopACT3areunderlined. Gene Primer Linker Sequence Ec_pck Ec_pck_clon_for XmaI tataatcccgggatgc gcgttaacaatggttt gacc (SEQIDNO:212) Ec_pck_clon_rev XbaI tataattctagattac agtttcggaccagccg (SEQIDNO:213) Ec_ppc Ec_ppc_clon_for XmaI tataatcccgggatga acgaacaatattcc (SEQIDNO:214) Ec_ppc_clon_rev XbaI tataattctagattag ccggtattacgcat (SEQIDNO:215) Ec_pykA Ec_pykA_clon_for XmaI tataatcccgggatgt ccagaaggcttcgcag aaca (SEQIDNO:216) Ec_pykA_clon_rev XbaI tataattctagattac tctaccgttaaaatac (SEQIDNO:217) Ec_aceA Ec_aceA_clon_for XmaI tataatcccgggatga aaacccgtacacaaca aatt (SEQIDNO:218) Ec_aceA_clon_rev XbaI tataattctagattag aactgcgattcttcag (SEQIDNO:219) Ll_pycA Ll_pycA_clon_for XmaI tataatcccgggatga aaaaactactcgtcgc caat (SEQIDNO:220) Ll_pycA_clon_rev XbaI tataattctagattaa ttaatttcgattaaca (SEQIDNO:221) Ec_galP Ec_galP_clon_for XmaI tataatcccgggatgc ctgacgctaaaaaaca ggggcggt (SEQIDNO:222) Ec_galP_clon_rev XbaI tataattctagattaa tcgtgagcgcctattt c (SEQIDNO:223)

(75) TABLE-US-00015 TABLE 15 Examples of strains constructed for DHB production Strain Relevant genotype MG1655 Wild-type ECE1 pTAC-DHB ECE5 ldhA adhE pta-ack pTAC-DHB ECE6 ldhA adhE pta-ack pTAC-DHB pACT3-pck ECE7 ldhA adhE pta-ack pTAC-DHB pACT3-ppc ECE8 ldhA adhE pta-ack pTAC-DHB pACT3-pyc ECE10 ldhA adhE pta-ack poxB pTAC-DHB ECE11 ldhA adhE pta-ack poxB pTAC-DHB pACT3-pck ECE12 ldhA adhE pta-ack poxB pTAC-DHB pACT3-ppc ECE13 ldhA adhE pta-ack poxB pTAC-DHB pACT3-pyc ECE16 ldhA adhE pta-ack poxB mae1 sfcA pTAC-DHB pACT3-pck ECE17 ldhA adhE pta-ack poxB mae1 sfcA pTAC-DHB pACT3-ppc ECE18 ldhA adhE pta-ack poxB mae1 sfcA pTAC-DHB pACT3-pyc ECE21 ldhA adhE pta-ack poxB mae1 sfcA frdBC pTAC-DHB pACT3-pck ECE22 ldhA adhE pta-ack poxB mae1 sfcA frdBC pTAC-DHB pACT3-ppc ECE23 ldhA adhE pta-ack poxB mae1 sfcA frdBC pTAC-DHB pACT3-pyc ECE30 ldhA adhE pta-ack poxB mae1 sfcA frdBC ptsG pTAC-DHB pACT3-pck ECE31 ldhA adhE pta-ack poxB mae1 sfcA frdBC ptsG pTAC-DHB pACT3-ppc ECE32 ldhA adhE pta-ack poxB mae1 sfcA frdBC ptsG pTAC-DHB pACT3-pyc

Example 12

Production of 2,4-dihydroxybutyric Acid by Fermentation of Glucose

(76) Strains and cultivation conditions: Experiments were carried out with strain E. coli ECE1 co-expressing malate kinase, malate semialdehyde dehydrogenase and DHB dehydrogenase from the plasmid pTAC-DHB (see Example 11), and an isogenic control strain containing only the empty plasmid (i.e. the pTAC backbone without the coding sequences of the above mentioned enzymes). 1 Liter culture medium contained, 20 g glucose, 18 g Na.sub.2HPO.sub.4*12 H.sub.2O, 3 g KH.sub.2PO.sub.4, 0.5 g NaCl, 2 g NH.sub.4Cl, 0.5 g MgSO.sub.4*7 H.sub.2O, 0.015 CaCl.sub.2*2 H.sub.2O, 1 mL of 0.06 mol/L FeCl.sub.3 stock solution prepared in 100 times diluted concentrated HCl, 2 mL of 10 mM thiamine HCl stock solution, 20 g MOPS, 50 g kanamycin sulphate, and 1 mL of trace element solution (containing per liter: 0.04 g Na.sub.2EDTA*2H.sub.2O, 0.18 g CoCl.sub.2*6 H.sub.2O, ZnSO4*7 H.sub.2O, 0.04 g Na.sub.2MoO4*2 H.sub.2O, 0.01 g H.sub.3BO.sub.3, 0.12 g MnSO.sub.4*H.sub.2O, 0.12 g CuCl.sub.2*H2O.). pH was adjusted to 7 and medium was filter sterilized. All cultivations were carried out at 37 C. on an Infors rotary shaker running at 170 rpm. Overnight cultures (3 mL medium in test tube) were inoculated from glycerol stocks and used to adjust an initial OD.sub.600 of 0.05 in 100 mL growth cultures cultivated in 500 mL shake flasks. IPTG was added at a concentration of 1 mmol/L when OD.sub.600 in the growth cultures reached 0.2.

(77) Estimation of DHB concentration by LC-MS/MS analyses:

(78) Culture medium was separated from the cells by centrifugation (Beckmann-Coulter Allegra 21R, Rotor Beckmann S4180, 10 min, 4800 rpm). Clear supernatant was stored at 20 C. until further analysis. DHB content was quantified using an HPLC (Waters) equipped an ACQUITY UPLC BEH column (C18, 1.7 m, 1002.1 mm, Waters), coupled to a mass sensitive detector (TQ, Waters, ESI mode, capillary voltage: 2.5 kV, cone voltage 25 V, Extractor voltage: 3V, source temperature: 150 C., desolvation temperature: 450 C., cone gas flow: 50 L/h, desolvation gas flow: 750 L/h). Column temperature was held at 30 C. Mobile phase was a mixture of 88% of a 0.08% tetra-n-butylammonium hydroxide solution, and 12% acetonitrile. Flow rate was fixed at 0.4 mL/min. Injection volume of the samples was 5 L.

(79) Results:

(80) The DHB content of the culture medium of strain E. coli ECE1 and the control strain was estimated at 8 h and 24 h after inducing the expression of malate kinase, aspartate semialdehyde dehydrogenase, and DHB dehydrogenase by addition of IPTG. As can be seen in Table 16, the strain ECE1 which expressed the DHB pathway enzymes produced significantly higher amounts of DHB than the control strain demonstrating the possibility of the zymotic production of DHB via the metabolic pathway shown in FIG. 1 (i).

(81) TABLE-US-00016 TABLE 16 DHB concentration in the culture medium of E coli ECE1 and control strain DHB concentration [mg/L] Time [h] ECE1 control 8 0.80 0 24 2.53 0.24

REFERENCES

(82) Akita, O., Nishimori, C., Shimamoto, T., Fujii, T. & lefuji, H. (2000). Transport of pyruvate in Saccharomyces cerevisiae and cloning of the gene encoded pyruvate permease. Biosci Biotechnol Biochem 64, 980-984. Bailey, J. E. (1991). Toward a science of metabolic engineering. Science 252, 1668-1675. Camarasa, C., Bidard, F., Bony, M., Barre, P. & Dequin, S. (2001). Characterization of Schizosaccharomyces pombe malate permease by expression in Saccharomyces cerevisiae. Appl Environ Microbiol 67, 4144-4151. Cherepanov, P. P. & Wackernagel, W. (1995). Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158, 9-14. Datsenko, K. A. & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97, 6640-6645. Deck, P., Exner, K. & Buschhaus, B. (2008). Method for the production of D,L-hydroxy-4-alkylthio butyric acid. Edited by B. AG. Dykxhoorn, D. M., St Pierre, R. & Linn, T. (1996). A set of compatible tac promoter expression vectors. Gene 177, 133-136. Ford, G. & Ellis, E. M. (2002). Characterization of Ypr1p from Saccharomyces cerevisiae as a 2-methylbutyraldehyde reductase. Yeast 19, 1087-1096. Grobler, J., Bauer, F., Subden, R. E. & Van Vuuren, H. J. (1995). The mae1 gene of Schizosaccharomyces pombe encodes a permease for malate and other C4 dicarboxylic acids. Yeast 11, 1485-1491. Groeneveld, M., Weme, R. G., Duurkens, R. H. & Slotboom, D. J. (2010). Biochemical characterization of the C4-dicarboxylate transporter DctA from Bacillus subtilis. J Bacteriol 192, 2900-2907. James, C. L. & Viola, R. E. (2002). Production and characterization of bifunctional enzymes. Domain swapping to produce new bifunctional enzymes in the aspartate pathway. Biochemistry 41, 3720-3725. Jantama, K., Haupt, M. J., Svoronos, S. A., Zhang, X., Moore, J. C., Shanmugam, K. T. & Ingram, L. O. (2008a). Combining metabolic engineering and metabolic evolution to develop nonrecombinant strains of Escherichia coli C that produce succinate and malate. Biotechnol Bioeng 99, 1140-1153. Jantama, K., Zhang, X., Moore, J. C., Shanmugam, K. T., Svoronos, S. A. & Ingram, L. O. (2008b). Eliminating side products and increasing succinate yields in engineered strains of Escherichia coli C. Biotechnol Bioeng 101, 881-893. Keng, Y. F. & Viola, R. E. (1996). Specificity of aspartokinase III from Escherichia coli and an examination of important catalytic residues. Arch Biochem Biophys 335, 73-81. Kockelkorn, D. & Fuchs, G. (2009). Malonic semialdehyde reductase, succinic semialdehyde reductase, and succinyl-coenzyme A reductase from Metallosphaera sedula: enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in Sulfolobales. J Bacteriol 191, 6352-6362. Larkin, M. A., Blackshields, G., Brown, N. P. & other authors (2007). Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947-2948. Lin, H., Bennett, G. N. & San, K. Y. (2005). Metabolic engineering of aerobic succinate production systems in Escherichia coli to improve process productivity and achieve the maximum theoretical succinate yield. Metab Eng 7, 116-127. Marco-Marin, C., Ramon-Maiques, S., Tavarez, S. & Rubio, V. (2003). Site-directed mutagenesis of Escherichia coli acetylglutamate kinase and aspartokinase III probes the catalytic and substrate-binding mechanisms of these amino acid kinase family enzymes and allows three-dimensional modelling of aspartokinase. J Mol Biol 334, 459-476. Millard, C. S., Chao, Y. P., Liao, J. C. & Donnelly, M. I. (1996). Enhanced production of succinic acid by overexpression of phosphoenolpyruvate carboxylase in Escherichia coli. Appl Environ Microbiol 62, 1808-1810. Roberts, S. J., Morris, J. C., Dobson, R. C. & Gerrard, J. A. (2003). The preparation of (S)-aspartate semi-aldehyde appropriate for use in biochemical studies. Bioorg Med Chem Lett 13, 265-267. Rognstad, R. & Katz, J. (1979). Effects of 2,4-dihydroxybutyrate on lipogenesis in rat hepatocytes. J Biol Chem 254, 11969-11972. Sanchez, A. M., Bennett, G. N. & San, K. Y. (2005a). Novel pathway engineering design of the anaerobic central metabolic pathway in Escherichia coli to increase succinate yield and productivity. Metab Eng 7, 229-239. Sanchez, A. M., Bennett, G. N. & San, K. Y. (2005b). Efficient succinic acid production from glucose through overexpression of pyruvate carboxylase in an Escherichia coli alcohol dehydrogenase and lactate dehydrogenase mutant. Biotechnol Prog 21, 358-365. Sauer, U. & Eikmanns, B. J. (2005). The PEP-pyruvate-oxaloacetate node as the switch point for carbon flux distribution in bacteria. FEMS Microbiol Rev 29, 765-794. Shinka, T., Inoue, Y., Ohse, M., Ito, A., Ohfu, M., Hirose, S. & Kuhara, T. (2002). Rapid and sensitive detection of urinary 4-hydroxybutyric acid and its related compounds by gas chromatography-mass spectrometry in a patient with succinic semialdehyde dehydrogenase deficiency. J Chromatogr B Analyt Technol Biomed Life Sci 776, 57-63. Wang, Q., Ou, M. S., Kim, Y., Ingram, L. O. & Shanmugam, K. T. (2010). Metabolic flux control at the pyruvate node in an anaerobic Escherichia coli strain with an active pyruvate dehydrogenase. Appl Environ Microbiol 76, 2107-2114. Werpy, T. & Petersen, G. (2004). Top value added chemicals from biomass. Results of screening for potential candidates from sugars and synthesis gas. Washington, D.C.: dx.doi.org/10.2172/15008859. Zelle, R. M., de Hulster, E., van Winden, W. A. & other authors (2008). Malic acid production by Saccharomyces cerevisiae: engineering of pyruvate carboxylation, oxaloacetate reduction, and malate export. Appl Environ Microbiol 74, 2766-2777. Zelle, R. M., Trueheart, J., Harrison, J. C., Pronk, J. T. & van Maris, A. J. (2010). Phosphoenolpyruvate carboxykinase as the sole anaplerotic enzyme in Saccharomyces cerevisiae. Appl Environ Microbiol 76, 5383-5389. Zhang, X., Jantama, K., Moore, J. C., Jarboe, L. R., Shanmugam, K. T. & Ingram, L. O. (2009). Metabolic evolution of energy-conserving pathways for succinate production in Escherichia coli. Proc Natl Acad Sci USA 106, 20180-20185. Zhang, X., Wang, X., Shanmugam, K. T. & Ingram, L. O. (2011). L-malate production by metabolically engineered Escherichia coli. Appl Environ Microbiol 77, 427-434.