SCN9A ANTISENSE OLIGONUCLEOTIDES

20190218255 ยท 2019-07-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The current invention provides peptide nucleic acid derivatives targeting a part of the human SCN9A pre-mRNA. The peptide nucleic acid derivatives potently induce splice variants of the SCN9A mRNA in cells, and are useful to safely treat pains or conditions involving Na.sub.v1.7 activity.

    Claims

    1. A peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof: ##STR00014## wherein, n is an integer between 10 and 21; the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical; Z represents hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and, at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.

    2. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 10 and 21; the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent hydrido radical; X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical; Z represents hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least three of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV: ##STR00015## wherein, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; and, L.sub.1, L.sub.2 and L.sub.3 are a covalent linker represented by Formula V connecting the basic amino group to the nucleobase moiety responsible for nucleobase pairing: ##STR00016## wherein, Q.sub.1 and Q.sub.m are substituted or non-substituted methylene (CH.sub.2) radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen (O), sulfur (S), and substituted or non-substituted amino radical [N(H), or N(substituent)-]; and, m is an integer between 1 and 16.

    3. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 12 and 20; the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido [H], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, or substituted or non-substituted arylsulfonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are substituted or non-substituted methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen, and amino radical; and, m is an integer between 1 and 11.

    4. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 12 and 19; the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido [H], substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, or substituted or non-substituted alkylaminocarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and, m is an integer between 1 and 10.

    5. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 12 and 18; the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido [H], substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.3, and R.sub.5 are hydrido radical, and R.sub.2, R.sub.4, and R.sub.6 independently represent hydrido, or substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and, m is an integer between 1 and 10.

    6. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 12 and 16; the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido [H], substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and, m is an integer between 1 and 10.

    7. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 12 and 16; the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X is hydrido radical; Y represents substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical; L.sub.1 represents (CH.sub.2).sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.3, CH.sub.2O(CH.sub.2).sub.4, or CH.sub.2O(CH.sub.2).sub.5 with the right end being directly linked to the basic amino group; and, L.sub.2 and L.sub.3 are independently selected from (CH.sub.2).sub.2O(CH.sub.2).sub.2, (CH.sub.2).sub.3O(CH.sub.2).sub.2, (CH.sub.2).sub.2O(CH.sub.2).sub.3, (CH.sub.2).sub.2, (CH.sub.2).sub.3, (CH.sub.2).sub.4, (CH.sub.2).sub.5, (CH.sub.2).sub.6, (CH.sub.2).sub.7, and (CH.sub.2).sub.8 with the right end being directly linked to the basic amino group.

    8. The peptide nucleic acid derivative according to claim 1, which is selected from the group of peptide nucleic acid derivatives provided below, or a pharmaceutically acceptable salt thereof: TABLE-US-00007 (N.fwdarw.C)Fmoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-NH.sub.2; (N.fwdarw.C)Fethoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-NH.sub.2; (N.fwdarw.C)Piv-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A- NH.sub.2; (N.fwdarw.C)FAM-HEX-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A (5)A-NH.sub.2; (N.fwdarw.C)Acetyl-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-NH.sub.2; (N.fwdarw.C)Fethoc-Lys-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5) A-A(5)A-NH.sub.2; (N.fwdarw.C)H-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A- NH.sub.2; (N.fwdarw.C)Me-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A- NH.sub.2; (N.fwdarw.C)Benzyl-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-NH.sub.2; (N.fwdarw.C)Fethoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-Lys-NH.sub.2; (N.fwdarw.C)Fmoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) AC-A(5)A-NH.sub.2; (N.fwdarw.C)Fethoc-TA(5)C-GC(1O2)A-A(5)AA(5)-ACA(5)-A- NH.sub.2; (N.fwdarw.C)Fethoc-TA(6)C-GC(1O2)A-A(6)AA(6)-ACA(6)-A- NH.sub.2; (N.fwdarw.C)Fethoc-AC(1O2)T-TA(5)C-G(6)CA-A(5)AA(5)-AC (1O2)A-A(5)-NH.sub.2; (N.fwdarw.C)Fethoc-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (5)-ACA(5)-A-NH.sub.2; (N.fwdarw.C)Fethoc-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (5)-A-NH.sub.2; (N.fwdarw.C)Fethoc-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (2O2)-A-NH.sub.2; (N.fwdarw.C)Fethoc-Val-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A (5)AA(2O2)-A-NH.sub.2; (N.fwdarw.C)Fethoc-Gly-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A (5)AA(2O2)-A-NH.sub.2; (N.fwdarw.C)Fethoc-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (2O2)-A-Lys-NH.sub.2; (N.fwdarw.C)Piv-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA(5)- A-NH.sub.2; (N.fwdarw.C)Fethoc-Lys-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A (5)A-NH.sub.2; (N.fwdarw.C)Piv-Leu-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (2O2)-A-NH.sub.2; (N.fwdarw.C)Fethoc-A(5)GT-A(5)CT-TA(5)C-G(6)CA(5)-A-NH.sub.2; (N.fwdarw.C)Fethoc-Lys-A(5)TC(1O3)-A(5)CT-TA(5)C-GC(1O2) A-A(5)A-NH.sub.2; (N.fwdarw.C)Fethoc-Gly-A(5)TC(1O3)-A(5)CT-TA(5)C-GC(1O2) A-A(5)A-Arg-NH.sub.2; (N.fwdarw.C)H-CTT-A(5)CG(3)-C(1O2)AA(5)-AA(5)A-C(1O3)AA (5)-NH.sub.2; (N.fwdarw.C)Fethoc-CTT-A(5)CG(6)-C(1O2)AA(5)-AA(5)A-C (1O2)AA(5)-NH.sub.2; (N.fwdarw.C)Fethoc-CTT-A(5)CG(6)-C(1O2)TA(5)-AA(5)T-C (1O2)AA(5)-NH.sub.2; (N.fwdarw.C)Benzoyl-CTT-A(5)CG(2O2)-C(1O2)AA(5)-AA(5)A- C(1O5)AA(5)-NH.sub.2; (N.fwdarw.C)n-Propyl-CTT-A(5)CG(2O3)-C(1O2)AA(3)-AA(5) A-C(2O2)AA(5)-NH.sub.2; (N.fwdarw.C)p-Toluenesulfonyl-CTT-A(5)CG(6)-C(1O2)AA(8)- AA(5)A-C(1O2)AA(5)-NH.sub.2; (N.fwdarw.C)+N-(2-PhenylethyDaminolcarbonyl-CTT-A(5)CG (6)-C(1O2)AA(2O2)-AA(5)A-C(1O2)AA(5)-NH.sub.2; (N.fwdarw.C)Fethoc-Lys-Leu-CTT-A(5)CG(6)-C(1O2)AA(4)-AA (5)A-C(1O2)AA(5)-Lys-NH.sub.2; (N.fwdarw.C)N-Phenyl-N-Me-CTT-A(5)CG(6)-C(1O2)AA(5)-AA (5)A-C(1O2)AA(5)-Lys-NH.sub.2; (N.fwdarw.C)Fethoc-AA(5)G-TA(5)C-TTA(5)-CG(6)C-A(5)A- NH.sub.2; and, (N.fwdarw.C)Fethoc-AA(5)G-TA(5)C-TTA(5)-CG(6)C-A(5)A- Lys-NH.sub.2: wherein, A, G, T, and C are PNA monomers with a natural nucleobase of adenine, guanine, thymine, and cytosine, respectively; C(pOq), A(p), A(pOq), G(p), and G(pOq) are PNA monomers with an unnatural nucleobase represented by Formula VI, Formula VII, Formula VIII, Formula IX, and Formula X, respectively: ##STR00017## wherein, p and q are integers; and, the abbreviations for the N- and C-terminus substituents are as specifically described as follows: Fmoc- is the abbreviation for [(9-fluorenyl)methyloxy]carbonyl-; Fethoc- for [2-(9-fluorenyl)ethyl-1-oxy]carbonyl; Ac- for acetyl-; Benzoyl- for benzenecabonyl-; Piv- for pivalyl-; Me- for methyl-; n-Propyl- for 1-(n-propyl)-; H- for hydrido- group; p-Toluenesulfonyl for (4-methylbenzene)-1-sulfonyl-; -Lys- for amino acid residue lysine; Val- for amino acid residue valine; -Leu- for amino acid residue leucine; -Arg- for amino acid residue arginine; -Gly- for amino acid residue glycine; [N-(2-Phenylethyl)amino]carbonyl- for [N-1-(2-phenylethyl)amino]carbonyl-; Benzyl- for 1-(phenyl)methyl-; Phenyl- for phenyl-; Me- for methyl-; HEX- for 6-amino-1-hexanoyl-, FAM- for 5, or 6-fluorescein-carbonyl-(isomeric mixture),and NH.sub.2 for non-substituted -amino group.

    9. A method to treat pains or conditions involving Na.sub.v1.7 activity comprising administering the peptide nucleic acid derivative according to claim 1.

    10. A method to treat chronic pains comprising administering the peptide nucleic acid derivative according to claim 1.

    11. A method to treat neuropathic pains comprising administering the peptide nucleic acid derivative according to claim 1.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0058] FIGS. 1(A)-(C). Examples of natural and unnatural nucleobases selectable for the peptide nucleic acid derivative of Formula I.

    [0059] FIGS. 2(A)-(E). Examples of substituents selectable for the peptide nucleic acid derivative of Formula I.

    [0060] FIG. 3. Chemical structures for PNA monomers with natural or modified nucleobase.

    [0061] FIG. 4. Chemical structures for abbreviations of N- or C-terminus substituents.

    [0062] FIG. 5(A). Chemical structure for (N.fwdarw.C) Fethoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A-NH.sub.2.

    [0063] FIG. 5(B). Chemical structure for (N.fwdarw.C) Fethoc-AG(5)C-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA(202)-A-Lys-NH.sub.2.

    [0064] FIG. 6. Chemical structures for Fmoc-PNA monomers employed to synthesize the PNA derivatives of this invention.

    [0065] FIGS. 7(A) and (B) shows C.sub.18-reverse phase HPLC chromatograms of ASO 4 before and after HPLC purification, respectively.

    [0066] FIG. 8. ESI-TOF mass spectrum for ASO 4 after purification by C.sub.18-reverse phase chromatography.

    [0067] FIG. 9(A). Electrophoretic analysis of the SCN9A nested PCR products of PC3 cells treated with ASO 9 at 0 (negative control), 10, 100 or 1,000 zM.

    [0068] FIG. 9(B). Sanger sequencing data for the PCR product bands assigned to the skipping of exon 4 (top) and exons 4-5 (bottom), respectively. FIG. 9(B) discloses six nucleic acid sequences from top to bottom. The top three nucleic acid sequences are the same and set forth in SEQ ID NO: 21. The bottom three nucleic acid sequences are the same and set forth in SEQ ID NO: 22.

    [0069] FIG. 10(A). SCN9A nested qPCR data obtained with PC3 cells treated with ASO 9 at 0 (negative control), 10, 100 or 1,000 zM. (error bar by standard error)

    [0070] FIG. 10(B). CoroNa assay data obtained in PC3 cells treated with ASO 9 at 0 (negative control), 100 or 1,000 zM.

    [0071] FIG. 11(A). SCN9A nested qPCR data in PC3 cells treated with ASO 4 at 0 (negative control), 10, 100 or 1,000 zM. (error bar by standard error)

    [0072] FIG. 11(B). SCN9A nested qPCR data in PC3 cells treated with ASO 5 at 0 (negative control), 10, 100 or 1,000 zM. (error bar by standard error)

    [0073] FIG. 11(C). SCN9A nested qPCR data in PC3 cells treated with ASO 1 at 0 (negative control), 10, 100 or 1,000 zM. (error bar by standard error)

    [0074] FIG. 11(D). SCN9A nested qPCR data in PC3 cells treated with ASO 6 at 0 (negative control), 10 or 100 zM. (error bar by standard error)

    [0075] FIG. 11(E). SCN9A nested qPCR data in PC3 cells treated with ASO 10 at 0 (negative control), 10 or 100 zM. (error bar by standard error)

    [0076] FIG. 12(A). Traces of average intracellular fluorescence by CoroNa assay in PC3 cells following a 30 hour incubation with ASO 10 at 0 (negative control), 100 or 1,000 zM.

    [0077] FIG. 12(B). Traces of average intracellular fluorescence by CoroNa assay in PC3 cells following a 30 hour incubation with ASO 6 at 0 (negative control), 100 or 1,000 zM.

    [0078] FIG. 12(C). Traces of average intracellular fluorescence by CoroNa assay in PC3 cells following a 30 hour incubation with ASO 4 at 0 (negative control), 100 or 1,000 zM.

    [0079] FIG. 12(D). Traces of average intracellular fluorescence by CoroNa assay in PC3 cells following a 30 hour incubation with ASO 5 at 0 (negative control), 100 or 1,000 zM.

    [0080] FIG. 13. Reversal of the allodynia induced with SNL (L5 ligation with L6 cut) in SD rats subcutaneously administered with ASO 1 at 0 (negative control), 3 or 10 pmole/Kg. (error bar by standard error)

    [0081] FIG. 14. Reversal of the allodynia induced by DPNP in rats subcutaneously adminstered with ASO 5 at 0 (negative control), 0.01, 0.1, 1 or 10 pmole/Kg, or orally with pregabalin 30 mg/Kg (positive control). (error bar by standard error)

    [0082] FIG. 15. Reversal of the allodynia induced by DPNP in rats subcutaneously administered with ASO 9 or ASO 10 100 pmole/Kg, or vehicle only. (error bar by standard error)

    [0083] FIG. 16. Reversal of the allodynia induced by SNL (L5/L6 ligation) in SD rats subcutaneously receiving ASO 9 at 0 (negative control) or 100 pmole/Kg, TID (3 per day).

    [0084] FIG. 17: Pre-mRNA is processed into mRNA following deletion of introns by a series of complex reactions collectively called splicing.

    SUMMARY OF INVENTION

    [0085] The present invention provides a peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof:

    ##STR00007##

    [0086] wherein,

    [0087] n is an integer between 10 and 21;

    [0088] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA;

    [0089] the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches;

    [0090] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;

    [0091] X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical;

    [0092] Z represents hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;

    [0093] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and,

    [0094] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.

    [0095] The compound of Formula I induces alternative splicing of the human SCN9A pre-mRNA, yields SCN9A mRNA splice variant(s) lacking exon 4, and is useful to treat pains, or conditions involving Na.sub.v1.7 activity.

    DESCRIPTION OF INVENTION

    [0096] The present invention provides a peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof:

    ##STR00008##

    [0097] wherein,

    [0098] n is an integer between 10 and 21;

    [0099] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA;

    [0100] the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches;

    [0101] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;

    [0102] X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical;

    [0103] Z represents hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;

    [0104] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and,

    [0105] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.

    [0106] The compound of Formula I induces alternative splicing of the human SCN9A pre-mRNA, yields SCN9A mRNA splice variant(s) lacking exon 4, and is useful to treat pains, or conditions involving Na.sub.v1.7 activity.

    [0107] The description that n is an integer between 10 and 21 literally states that n is an integer selectable from a group of integers of 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20.

    [0108] The compound of Formula I tightly binds to the 5 splice site of exon 4 of the human SCN9A pre-mRNA transcribed from the human SCN9A gene of [NCBI Reference Sequence: NC_000002.12]. The 40-mer SCN9A pre-mRNA sequence consisting of a 20-mer from exon 4 and a 20-mer from intron 4 reads [(5.fwdarw.3) UUUGUCGUCAUUGUUUUUGC-GUAAGUACUUUCAGCUUUUU (SEQ ID NO: 3)], although the exon and intron number may vary depending on SCN9A mRNA transcripts. Provision of the 40-mer pre-mRNA sequence is to unequivocally define the target 5 splice within the human SCN9A pre-mRNA.

    [0109] The 40-mer pre-mRNA sequence may be alternatively expressed as [(5.fwdarw.3) UUUGUCGUCAUUGUUUUUGC|guaaguacuuucagcuuuuu (SEQ ID NO: 3)], wherein the exon and intron sequences are denoted with capital and small letters, respectively, and the junction between the exon and the intron is marked with |. Thus the 14-mer pre-mRNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] adopted to describe the compound of Formula I in this invention may be alternatively expressed as [(5.fwdarw.3) UUUUUGC|guaagua (SEQ ID NO: 2)].

    [0110] The compound of Formula I tightly binds to the target 5 splice site of exon 4 within the human SCN9A pre-mRNA, and interferes with the formation of splicesome early complex involving the compound's target exon. Since the compound of this invention sterically inhibits the formation of splicesome early complex involving exon 4, the SCN9A exon 4 is spliced out or deleted to yield an SCN9A mRNA splice variant or variants lacking exon 4. Consequently the compound of this invention is said to induce the skipping of the SCN9A exon 4. The resulting SCN9A mRNA splice variant(s) encodes Na.sub.v1.7 protein(s) lacking the Na.sub.v1.7 functional activity (i.e., sodium ion channel activity) expressed by the full-length Na.sub.v1.7 protein.

    [0111] The compound of Formula I tightly binds to the complementary DNA as exemplified in the prior art [PCT/KR2009/001256]. The duplex between the PNA derivative of Formula I and its full-length complementary DNA or RNA shows a T.sub.m value too high to be reliably determined in aqueous buffer. The buffer solution tends to boil off during a T.sub.m measurement. The PNA compound of Formula I still yields high T.sub.m values with complementary DNAs of shorter length, for example, 10-mer.

    [0112] Owing to the high binding affinity, the PNA derivative of this invention potently induces the skipping of SCN9A exon 4 in cells even with a complementary overlap of as small as 11-mer with the 5 splice site of exon 4.

    [0113] The compound of Formula I possesses a very strong affinity for the target SCN9A pre-mRNA sequence with full complementarity. Even in case the compound of Formula I has one or two mismatches with the target SCN9A pre-mRNA sequence, the PNA compound may still tightly bind to the target pre-mRNA sequence and interrupts the splicing process since the affinity between the compound of Formula I and the target SCN9A pre-mRNA sequence is strong enough despite the mismatch(es). For example, a 14-mer PNA derivative of Formula I possesses only a 12-mer complementary overlap with the 14-mer SCN9A pre-mRNA sequence of [(5.fwdarw.3) UUUUUGC|guaagua (SEQ ID NO: 2)] in this invention, and induces the skipping of the SCN9A exon 4 despite the two mismatches with the 14-mer sequence. Nevertheless, it would not be desired to have too many mismatches with the target pre-mRNA sequence in order to avoid a cross reactivity with pre-mRNA sequences from other gene(s).

    [0114] The chemical structures of natural or unnatural nucleobases in the PNA derivative of Formula I are exemplified in FIGS. 1(A)-(C). Natural (conventionally expressed as naturally occurring) or unnatural (conventionally expressed as naturally non-occurring) nucleobases of this invention comprise but are not limited to the nucleobases provided in FIGS. 1(A)-(C). Provision of such unnatural nucleobases is to illustrate the diversity of nucleobases allowable for the compound of Formula I, and therefore should not be interpreted to limit the scope of the present invention. A skilled person in the field may easily figure out that variations of unnatural nucleobases are possible for specific positions within the PNA compound of Formula I as long as such variations meet the conditions of complementarity with the target pre-mRNA sequence.

    [0115] The substituents adopted to describe the PNA derivative of Formula I are exemplified in FIGS. 2(A)-(E). FIG. 2(A) provides examples for substituted or non-substituted alkyl radicals. Substituted or non-substituted alkylacyl and substituted or non-substituted alkylacyl arylacyl radicals are exemplified in FIG. 2(B). FIG. 2(C) illustrates examples for substituted or non-substituted alkylamino, substituted or non-substituted arylamino, substituted or non-substituted aryl, substituted or non-substituted alkylsulfonyl or arylsulfonyl, and substituted or non-substituted alkylphosphonyl or arylphosphonyl radicals. FIG. 2(D) provides examples for substituted or non-substituted alkyloxycarbonyl or aryloxycarbonyl, substituted or non-substituted alkyl aminocarbonyl or arylaminocarbonyl radicals. In FIG. 2(E) are provided examples for substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, and substituted or non-substituted aryloxythiocarbonyl radicals. Provision of such exemplary substituents is to illustrate the diversity of substituents allowable for the compound of Formula I, and therefore should not be interpreted to limit the scope of the present invention. A skilled person in the field may easily figure out that the PNA oligonucleotide sequence is the overriding factor for the sequence specific binding of a PNA oligonucleotide to the target pre-mRNA sequence over substituents in the N-terminus or C-terminus.

    [0116] The PNA compound of Formula I possesses good cell permeability and can be readily delivered into cell if treated as naked oligonucleotide as exemplified in the prior art [PCT/KR2009/001256]. Thus the compound of this invention induces the skipping of exon 4 in the SCN9A pre-mRNA to yield SCN9A mRNA splice variant(s) lacking SCN9A exon 4 in cells treated with the compound of Formula I as naked oligonucleotide. Cells treated with the compound of Formula I as naked oligonucleotide express a lower level of the full length SCN9A mRNA, and therefore show a lower Na.sub.v1.7 functional activity than cells without the compound treatment.

    [0117] The compound of Formula I does not require an invasive formulation to increase systemic delivery to target tissue for the intended therapeutic or biological activity. Usually the compound of Formula I is dissolved in PBS (phosphate buffered saline) or saline, and systemically administered to elicit the desired therapeutic (i.e. analgesic) or biological activity in target cells (mostly neuronal cells). The compound of this invention does not need to be heavily or invasively formulated to elicit the systemic therapeutic activity.

    [0118] The compound of Formula I inhibits Na.sub.v1.7 expression in neuronal cells or tissues upon systemic administration as naked oligonucleotide. Thus the compound is useful to safely treat pains, or disorders involving excessive expression of Na.sub.v1.7.

    [0119] The PNA derivative of Formula I may be used as combined with a pharmaceutically acceptable acid or base including but not limited to sodium hydroxide, potassium hydroxide, hydrochloric acid, methanesulfonic acid, citric acid, trifluoroacetic acid, and so on.

    [0120] The PNA compound of Formula I or a pharmaceutically acceptable salt thereof can be administered to a subject in combination with a pharmaceutically acceptable adjuvant including but not limited to citric acid, hydrochloric acid, tartaric acid, stearic acid, polyethyleneglycol, polypropyleneglycol, ethanol, isopropanol, sodium bicarbonate, distilled water, preservative(s), and so on.

    [0121] The compound of the present invention can be systemically administered to a subject at a therapeutically or biologically effective dose of 1 nmole/Kg or less, which would vary depending on the dosing schedule, conditions or situations of the subject, and so on.

    [0122] Preferred is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:

    [0123] wherein,

    [0124] n is an integer between 10 and 21;

    [0125] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA;

    [0126] the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches;

    [0127] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent hydrido radical;

    [0128] X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical;

    [0129] Z represents hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;

    [0130] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;

    [0131] at least three of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV:

    ##STR00009##

    [0132] wherein,

    [0133] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; and,

    [0134] L.sub.1, L.sub.2 and L.sub.3 are a covalent linker represented by Formula V connecting the basic amino group to the nucleobase moiety responsible for nucleobase pairing:

    ##STR00010##

    [0135] wherein,

    [0136] Q.sub.1 and Q.sub.m are substituted or non-substituted methylene (CH.sub.2) radical, and Q.sub.m is directly linked to the basic amino group;

    [0137] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen (O), sulfur (S), and substituted or non-substituted amino radical [N(H), or N(substituent)-]; and,

    [0138] m is an integer between 1 and 16.

    [0139] Of interest is a PNA oligomer of Formula I, or a pharmaceutically acceptable salt thereof:

    [0140] wherein,

    [0141] n is an integer between 12 and 20;

    [0142] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA;

    [0143] the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches;

    [0144] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;

    [0145] X and Y independently represent hydrido [H], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, or substituted or non-substituted arylsulfonyl radical;

    [0146] Z represents substituted or non-substituted amino radical;

    [0147] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases;

    [0148] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;

    [0149] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;

    [0150] Q.sub.1 and Q.sub.m are substituted or non-substituted methylene radical, and Q.sub.m is directly linked to the basic amino group;

    [0151] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen, and amino radical; and,

    [0152] m is an integer between 1 and 11.

    [0153] Of particular interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:

    [0154] wherein,

    [0155] n is an integer between 12 and 19;

    [0156] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA;

    [0157] the compound of Formula I is fully complementary to the target pre-mRNA sequence;

    [0158] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;

    [0159] X and Y independently represent hydrido [H], substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, or substituted or non-substituted alkylaminocarbonyl radical;

    [0160] Z represents substituted or non-substituted amino radical;

    [0161] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases;

    [0162] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;

    [0163] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;

    [0164] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;

    [0165] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and,

    [0166] m is an integer between 1 and 10.

    [0167] Of high interest is a PNA oligomer of Formula I, or a pharmaceutically acceptable salt thereof:

    [0168] wherein,

    [0169] n is an integer between 12 and 18;

    [0170] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA;

    [0171] the compound of Formula I is fully complementary to the target pre-mRNA sequence;

    [0172] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;

    [0173] X and Y independently represent hydrido [H], substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical;

    [0174] Z represents substituted or non-substituted amino radical;

    [0175] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases;

    [0176] at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;

    [0177] R.sub.1, R.sub.3, and R.sub.5 are hydrido radical, and R.sub.2, R.sub.4, and R.sub.6 independently represent hydrido, or substituted or non-substituted alkyl radical;

    [0178] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;

    [0179] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and,

    [0180] m is an integer between 1 and 10.

    [0181] Of higher interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:

    [0182] wherein,

    [0183] n is an integer between 12 and 16;

    [0184] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA;

    [0185] the compound of Formula I is fully complementary to the target pre-mRNA sequence;

    [0186] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;

    [0187] X and Y independently represent hydrido [H], substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical;

    [0188] Z represents substituted or non-substituted amino radical;

    [0189] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases;

    [0190] at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;

    [0191] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical;

    [0192] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;

    [0193] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and,

    [0194] m is an integer between 1 and 10.

    [0195] Of highest interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:

    [0196] wherein,

    [0197] n is an integer between 12 and 16;

    [0198] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA;

    [0199] the compound of Formula I is fully complementary to the target pre-mRNA sequence;

    [0200] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;

    [0201] X is hydrido radical;

    [0202] Y represents substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical;

    [0203] Z represents substituted or non-substituted amino radical;

    [0204] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases;

    [0205] at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;

    [0206] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical;

    [0207] L.sub.1 represents (CH.sub.2).sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.3, CH.sub.2O(CH.sub.2).sub.4, or CH.sub.2O(CH.sub.2).sub.5 with the right end being directly linked to the basic amino group; and,

    [0208] L.sub.2 and L.sub.3 are independently selected from (CH.sub.2).sub.2O(CH.sub.2).sub.2, (CH.sub.2).sub.3O(CH.sub.2).sub.2, (CH.sub.2).sub.2O(CH.sub.2).sub.3, (CH.sub.2).sub.2, (CH.sub.2).sub.3, (CH.sub.2).sub.4, (CH.sub.2).sub.5, (CH.sub.2).sub.6, (CH.sub.2).sub.7, and (CH.sub.2).sub.8 with the right end being directly linked to the basic amino group.

    [0209] Of specific interest is a PNA derivative of Formula I which is selected from the group of compounds provided below, or a pharmaceutically acceptable salt thereof:

    TABLE-US-00001 (N.fwdarw.C)Fmoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-NH.sub.2; (N.fwdarw.C)Fethoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-NH.sub.2; (N.fwdarw.C)Piv-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A- NH.sub.2; (N.fwdarw.C)FAM-HEX-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A (5)A-NH.sub.2; (N.fwdarw.C)Acetyl-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-NH.sub.2; (N.fwdarw.C)Fethoc-Lys-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5) A-A(5)A-NH.sub.2; (N.fwdarw.C)H-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A- NH.sub.2; (N.fwdarw.C)Me-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A- NH.sub.2; (N.fwdarw.C)Benzyl-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-NH.sub.2; (N.fwdarw.C)Fethoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) A-Lys-NH.sub.2; (N.fwdarw.C)Fmoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5) AC-A(5)A-NH.sub.2; (N.fwdarw.C)Fethoc-TA(5)C-GC(1O2)A-A(5)AA(5)-ACA(5)-A- NH.sub.2; (N.fwdarw.C)Fethoc-TA(6)C-GC(1O2)A-A(6)AA(6)-ACA(6)-A- NH.sub.2; (N.fwdarw.C)Fethoc-AC(1O2)T-TA(5)C-G(6)CA-A(5)AA(5)-AC (1O2)A-A(5)-NH.sub.2; (N.fwdarw.C)Fethoc-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (5)-ACA(5)-A-NH.sub.2; (N.fwdarw.C)Fethoc-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (5)-A-NH.sub.2; (N.fwdarw.C)Fethoc-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (2O2)-A-NH.sub.2; (N.fwdarw.C)Fethoc-Val-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A (5)AA(2O2)-A-NH.sub.2; (N.fwdarw.C)Fethoc-Gly-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A (5)AA(2O2)-A-NH.sub.2; (N.fwdarw.C)Fethoc-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (2O2)-A-Lys-NH.sub.2; (N.fwdarw.C)Piv-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA(5)- A-NH.sub.2; (N.fwdarw.C)Fethoc-Lys-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A (5)A-NH.sub.2; (N.fwdarw.C)Piv-Leu-AG(5)T-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA (2O2)-A-NH.sub.2; (N.fwdarw.C)Fethoc-A(5)GT-A(5)CT-TA(5)C-G(6)CA(5)-A-NH.sub.2; (N.fwdarw.C)Fethoc-Lys-A(5)TC(1O3)-A(5)CT-TA(5)C-GC(1O2) A-A(5)A-NH.sub.2; (N.fwdarw.C)Fethoc-Gly-A(5)TC(1O3)-A(5)CT-TA(5)C-GC(1O2) A-A(5)A-Arg-NH.sub.2; (N.fwdarw.C)H-CTT-A(5)CG(3)-C(1O2)AA(5)-AA(5)A-C(1O3)AA (5)-NH.sub.2; (N.fwdarw.C)Fethoc-CTT-A(5)CG(6)-C(1O2)AA(5)-AA(5)A-C (1O2)AA(5)-NH.sub.2; (N.fwdarw.C)Fethoc-CTT-A(5)CG(6)-C(1O2)TA(5)-AA(5)T-C (1O2)AA(5)-NH.sub.2; (N.fwdarw.C)Benzoyl-CTT-A(5)CG(2O2)-C(1O2)AA(5)-AA(5)A- C(1O5)AA(5)-NH.sub.2; (N.fwdarw.C)n-Propyl-CTT-A(5)CG(2O3)-C(1O2)AA(3)-AA(5) A-C(2O2)AA(5)-NH.sub.2; (N.fwdarw.C)p-Toluenesulfonyl-CTT-A(5)CG(6)-C(1O2)AA(8)- AA(5)A-C(1O2)AA(5)-NH.sub.2; (N.fwdarw.C)+N-(2-PhenylethyDaminolcarbonyl-CTT-A(5)CG (6)-C(1O2)AA(2O2)-AA(5)A-C(1O2)AA(5)-NH.sub.2; (N.fwdarw.C)Fethoc-Lys-Leu-CTT-A(5)CG(6)-C(1O2)AA(4)-AA (5)A-C(1O2)AA(5)-Lys-NH.sub.2; (N.fwdarw.C)N-Phenyl-N-Me-CTT-A(5)CG(6)-C(1O2)AA(5)-AA (5)A-C(1O2)AA(5)-Lys-NH.sub.2; (N.fwdarw.C)Fethoc-AA(5)G-TA(5)C-TTA(5)-CG(6)C-A(5)A- NH.sub.2; and, (N.fwdarw.C)Fethoc-AA(5)G-TA(5)C-TTA(5)-CG(6)C-A(5)A- Lys-NH.sub.2:

    [0210] wherein,

    [0211] A, G, T, and C are PNA monomers with a natural nucleobase of adenine, guanine, thymine, and cytosine, respectively;

    [0212] C(pOq), A(p), A(pOq), G(p), and G(pOq) are PNA monomers with an unnatural nucleobase represented by Formula VI, Formula VII, Formula VIII, Formula IX, and Formula X, respectively;

    ##STR00011##

    [0213] wherein,

    [0214] p and q are integers; and,

    [0215] the abbreviations for the N- and C-terminus substituents are as specifically described as follows: Fmoc- is the abbreviation for [(9-fluorenyl)methyloxy]carbonyl-; Fethoc- for [2-(9-fluorenyl)ethyl-1-oxy]carbonyl; Ac- for acetyl-; Benzoyl- for benzenecabonyl-; Piv- for pivalyl-; Me- for methyl-; n-Propyl- for 1-(n-propyl)-; H- for hydrido- group; p-Toluenesulfonyl for (4-methylbenzene)-1-sulfonyl-; -Lys- for amino acid residue lysine; Val- for amino acid residue valine; -Leu- for amino acid residue leucine; -Arg- for amino acid residue arginine; -Gly- for amino acid residue glycine; [N-(2-Phenylethy)amino]carbonyl- for [N-1-(2-phenylethy)amino]carbonyl-; Benzyl- for 1-(phenyl)methyl-; Phenyl- for phenyl-; Me- for methyl-; HEX- for 6-amino-1-hexanoyl-, FAM- for 5, or 6-fluorescein-carbonyl-(isomeric mixture), and NH.sub.2 for non-substituted -amino group.

    [0216] FIG. 3 collectively provides the chemical structures for the PNA monomers abbreviated as A, G, T, C, C(pOq), A(p), A(pOq), G(p), and G(pOq). As discussed in the prior art [PCT/KR2009/001256], C(pOq) is regarded as a modified PNA monomer corresponding to cytosine due to its preferred hybridization to guanine. A(p) and A(pOq) are taken as modified PNA monomers acting as adenine for their tight affinity for thymine. Likewise G(p) and G(pOq) are considered to be modified PNA monomers equivalent to guanine owing to their productive base pairing with cytosine.

    [0217] FIG. 4 unequivocally illustrates the chemical structures for a variety of abbreviations for substituents used for diversifying the N-terminus or C-terminus of the PNA derivative of Formula I in this invention.

    [0218] In order to illustrate the abbreviations for the PNA derivatives in this invention, the chemical structure for a 14-mer PNA derivative abbreviated as (N.fwdarw.C) Fethoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A-NH.sub.2 is provided in FIG. 5(A). The 14-mer PNA sequence is equivalent to the DNA sequence of (5.fwdarw.3) TAA-ATA-CGC-AAA-AA (SEQ ID NO: 4) for complementary binding to the SCN9A pre-mRNA. The 14-mer PNA possesses a 12-mer complementary overlap within a 20-mer sequence of [(5.fwdarw.3) UUGUUUUUGC|guaaguacuu (SEQ ID NO: 5)] spanning the 5 splice site involving exon 4 within the human SCN9A pre-mRNA with the complementary base pairings marked bold and underlined as in [(5.fwdarw.3) UUGUUUUUGC|guaaguacuu (SEQ ID NO: 5)] along with the two mismatches in intron 4 marked with a quote notation ( ). Despite the two mismatches in intron 5, the 14-mer PNA meets the complementary overlap criteria for the compound of Formula I in this invention, i.e. the criteria provided below:

    [0219] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer RNA sequence of [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 2)] within the human SCN9A pre-mRNA, and the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches.

    [0220] As another illustration, the chemical structure for a 16-mer PNA derivative abbreviated as (N.fwdarw.C) Fethoc-AG(5)C-A(5)CT-TA(5)C-GC(1O2)A-A(5)AA(202)-A-Lys-NH.sub.2 is provided in FIG. 5(B). The 16-mer PNA sequence is equivalent to the DNA sequence of (5.fwdarw.3) AGC-ACT-TAC-GCA-AAA-A (SEQ ID NO: 6) for complementary binding to the SCN9A pre-mRNA. The 16-mer PNA has a 15-mer complementary overlap with the 20-mer pre-mRNA sequence of [(5.fwdarw.3) UUGUUUUUGC|guaaguacuu (SEQ ID NO: 5)] within the human SCN9A pre-mRNA with the complementary base pairings marked bold and underlined in [(5.fwdarw.3) UUGUUUUUGC|guaaguacuu (SEQ ID NO: 5)] along with the single mismatch in intron 4 marked with a quote notation ( ). This 16-mer PNA meets the complementary overlap criteria for the compound of Formula I in this invention despite the single mismatch in intron 5.

    [0221] A 16-mer PNA sequence of (N.fwdarw.C) Fethoc-AC(1O2)T-TA(5)C-G(6)CA-A(5)AA(5)-AC(1O2)A-A(5)-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) ACT-TAC-GCA-AAA-ACA-A (SEQ ID NO: 7) for complementary binding to the SCN9A pre-mRNA. This 16-mer PNA possesses full (i.e. 16-mer) complementary binding to the 20-mer SCN9A pre-mRNA sequence of [(5.fwdarw.3) UUGUUUUUGC|guaaguacuu (SEQ ID NO: 5)] with the complementary base pairings as marked bold and underlined in

    TABLE-US-00002 (SEQIDNO:5) [(5 .fwdarw. 3)UUGUUUUUGC|guaaguacuu].
    This 16-mer PNA meets the complementary overlap criteria for the compound of Formula I in this invention.

    [0222] A 17-mer PNA sequence of (N.fwdarw.C) Fethoc-TG(6)T-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) TGT-TAA-ATA-CGC-AAA-AA (SEQ ID NO: 8) for complementary binding to the SCN9A pre-mRNA. This 17-mer PNA has a 12-mer complementary overlap the 20-mer SCN9A pre-mRNA sequence of [(5.fwdarw.3) UUGUUUUUGC|guaaguacuu (SEQ ID NO: 5)] with the complementary base pairings marked bold and underlined in [(5.fwdarw.3) UUGUUUUUGC|guaaguacuu (SEQ ID NO: 5)] along with the five mismatches in intron 4 as marked with quote notations ( ). This 17-mer PNA doesn't meet the complementary overlap criteria for the compound of Formula I in this invention due to the five mismatches in intron 5, even though this 17-mer PNA possesses a 12-mer complementary overlap like the above-mentioned 14-mer PNA. Having too many mismatches for the oligomer length as with this 17-mer PNA potentially may elicit cross reactivity with pre-mRNA(s) other than the SCN9A pre-mRNA, and therefore needs to be avoided for safety concerns.

    DETAILED DESCRIPTION OF INVENTION

    General Procedures for Preparation of PNA Oligomers

    [0223] PNA oligomers were synthesized by solid phase peptide synthesis (SPPS) based on Fmoc-chemistry according to the method disclosed in the prior art [U.S. Pat. No. 6,133,444; WO96/40685] with minor but due modifications. The solid support employed in this study was H-Rink Amide-ChemMatrix purchased from PCAS BioMatrix Inc. (Quebec, Canada). Fmoc-PNA monomers with a modified nucleobase were synthesized as described in the prior art [PCT/KR 2009/001256] or with minor modifications. Such Fmoc-PNA monomers with a modified nucleobase and Fmoc-PNA monomers with a naturally occurring nucleobase were used to synthesize the PNA derivatives of the present invention. PNA oligomers were purified by C.sub.18-reverse phase HPLC (water/acetonitrile or water/methanol with 0.1% TFA) and characterized by mass spectrometry including ESI/TOF/MS.

    [0224] Scheme 1 illustrates a typical monomer elongation cycle adopted in the SPPS of this invention, and the synthetic details are provided as below. To a skilled person in the field, however, lots of minor variations are obviously possible in effectively running such SPPS reactions on an automatic peptide synthesizer or manual peptide synthesizer. Each reaction step in Scheme 1 is briefly provided as follows.

    ##STR00012##

    [0225] [Activation of H-Rink-ChemMatrix Resin] 0.01 mmol (ca 20 mg resin) of the ChemMatrix resin in 1.5 mL 20% piperidine/DMF was vortexed in a libra tube for 20 min, and the DeFmoc solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL methylene chloride (MC), 1.5 mL dimethylformamide (DMF), 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were subjected to coupling either with an Fmoc-PNA monomer or with an Fmoc-protected amino acid derivative.

    [0226] [DeFmoc] The resin was vortexed in 1.5 mL 20% piperidine/DMF for 7 min, and the DeFmoc solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were immediately subjected to coupling with an Fmoc-PNA monomer.

    [0227] [Coupling with Fmoc-PNA Monomer] The free amines on the solid support were coupled with an Fmoc-PNA monomer as follows. 0.04 mmol of PNA monomer, 0.05 mmol HBTU, and 10 mmol DIEA were incubated for 2 min in 1 mL anhydrous DMF, and added to the resin with free amines. The resin solution was vortexed for 1 hour and the reaction medium was filtered off. Then the resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The chemical structures of Fmoc-PNA monomers with a modified nucleobase used in this invention are provided in FIG. 6. The Fmoc-PNA monomers with a modified nucleobase are provided in FIG. 6 should be taken as examples, and therefore should not be taken to limit the scope of the present invention. A skilled person in the field may easily figure out a number of variations in Fmoc-PNA monomers to synthesize the PNA derivative of Formula I.

    [0228] [Capping] Following the coupling reaction, the unreacted free amines were capped by shaking for 5 min in 1.5 mL capping solution (5% acetic anhydride and 6% 2,6-lutidine in DMF). Then the capping solution was filtered off and washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC.

    [0229] [Introduction of Fethoc- Radical in N-Terminus] Fethoc- radical was introduced to the N-terminus by reacting the free amine on the resin with Fethoc-OSu under basic coupling conditions. The chemical structure of Fethoc-OSu [CAS No. 179337-69-0, C.sub.20H.sub.17NO.sub.5, MW 351.36] is provided as follows.

    ##STR00013##

    [0230] [Cleavage from Resin] PNA oligomers bound to the resin were cleaved from the resin by shaking for 3 hours in 1.5 mL cleavage solution (2.5% tri-isopropylsilane and 2.5% water in trifluoroacetic acid). The resin was filtered off and the filtrate was concentrated under reduced pressure. The resulting residue was triturated with diethylether and the resulting precipitate was collected by filtration for purification by reverse phase HPLC.

    [0231] [HPLC Analysis and Purification] Following a cleavage from resin, the crude product of a PNA derivative was purified by C.sub.18-reverse phase HPLC eluting water/acetonitrile or water/methanol (gradient method) containing 0.1% TFA. FIGS. 7(A) and 7(B) are exemplary HPLC chromatograms for ASO 4 before and after HPLC purification, respectively. The oligomer sequence of ASO 4 is as provided in Table 1.

    Synthetic Examples for PNA Derivatives of Formula I

    [0232] PNA derivatives in this invention were prepared according to the synthetic procedures provided above or with minor modifications. Table 1 provides examples of SCN9A ASOs targeting the 5 splice site of the human SCN9A exon 4 along with structural characterization data by mass spectrometry. Provision of the SCN9A ASOs as in Table 1 is to exemplify the PNA derivative of Formula I, and should not be interpreted to limit the scope of the present invention.

    TABLE-US-00003 TABLE1 SCN9AASOstargetingthe5 splicesiteof exon4 inthehumanSCN9Apre-mRNAalongwith structuralcharacterizationdataby massspectrometry. PNA ExactMass, Ex- m/z ample PNASequence(N.fwdarw. C) theor..sup.a obs..sup.b ASO Fmoc-TA(5)A-A(5)TA(5)-CGC 4640.19 4640.88 1 (1O2)-AA(5)A-A(5)A-NH.sub.2 ASO FAM-HEX-TA(5)A-A(5)TA(5)- 4887.24 4887.40 2 CGC(1O2)-AA(5)A-A(5)A-NH.sub.2 ASO Fmoc-TA(5)A-A(5)TA(5)-CTC 4613.17 4612.51 3 (1O2)-AA(5)A-A(5)A-NH.sub.2 ASO Fethoc-TA(5)A-A(5)TA(5)- 4652.20 4652.24 4 CGC(1O2)-AA(5)A-A(5)A-NH.sub.2 ASO Fethoc-TG(6)T-TA(5)A-A(5) 5574.61 5574.57 5 TA(5)-CGC(1O2)- AA(5)A-A(5)A-NH.sub.2 ASO Fethoc-TA(5)A-C(1O2)TA 4652.20 4652.24 6 (5)-CGA(5)-AA(5)A-A(5)A- NH.sub.2 ASO Fethoc-TA(5)C-GC(1O2)A- 4261.98 4262.00 7 A(5)AA(5)-ACA(5)-A-NH.sub.2 ASO Fethoc-TA(6)C-GC(1O2)A- 4318.05 4318.17 8 A(6)AA(6)-ACA(6)-A-NH.sub.2 ASO Fethoc-AC(1O2)T-TA(5)C- 5250.53 5250.46 9 G(6)CA-A(5)AA(5)-AC (1O2)A-A(5)-NH.sub.2 ASO Fmoc-TA(5)A-A(5)TA(5)- 5539.61 5539.57 10 CGC(1O2)-AA(5)A- A(5)AC-A(5)A-NH.sub.2 AOS Piv-TA(5)A-A(5)TA(5)-CGC 4500.17 4499.79 11 (1O2)-AA(5)A-A(5)A-NH2 ASO FAM-HEX-A(5)TA(5)-CGC 3970.82 3974.17 12 (1O2)-AA(5)A-A(5)A-NH.sub.2 ASO Fmoc-TA(6)A-A(5)TA(6)-CGC 5334.57 5335.59 13 (1O2)-AA(6)A-AA(6)C- A(6)-NH.sub.2 ASO Fethoc-CTT-A(5)CG(6)-C 4975.34 4975.34 14 (1O2)AA(5)-AA(5)A- C(1O2)AA(5)-NH.sub.2 ASO H-CTT-A(5)CG(3)-C(1O2) 4711.22 4711.25 15 AA(5)-AA(5)A-C(1O3)AA(5)- NH.sub.2 ASO Benzoyl-CTT-A(5)CG(2O2)- 4873.30 4873.32 16 C(1O2)AA(5)-AA(5)A- C(1O5)AA(5)-NH.sub.2 ASO n-Propyl-CTT-A(5)CG(2O3)- 4769.27 4769.30 17 C(1O2)AA(3)-AA(5)A- C(2O2)AA(5)-NH.sub.2 ASO p-Toluenesulfonyl-CTT-A 4935.32 4935.29 18 (5)CG(6)-C(1O2)AA(8)-AA (5)A-C(1O2)AA(5)-NH.sub.2 ASO [N-(2-Phenylethyl)amino] 4888.31 4888.32 19 carbonyl-CTT-A(5)CG(6)- C(1O2)AA(2O2)-AA(5)A- C(1O2)AA(5)-NH.sub.2 ASO Fethoc-CTT-A(5)CG(6)- 4957.32 4957.32 20 C(1O2)TA(5)-AA(5) T-C(1O2)AA(5)-NH.sub.2 ASO Fethoc-Lys-Leu-CTT-A(5) 5330.60 5330.60 21 CG(6)-C(1O2)AA(4)-AA(5) A-C(1O2)AA(5)-Lys-NH.sub.2 ASO N-Phenyl-N-Me-CTT-A(5) 4957.40 4957.42 22 CG(6)-C(1O2)AA(5)-AA(5) A-C(1O2)AA(5)-Lys-NH.sub.2 .sup.atheoretical exact mass, .sup.bobserved exact mass

    [0233] FIG. 7(A) is a HPLC chromatogram obtained with a crude product of ASO 4. The crude product was purified by Cis-reverse phase (RP) preparatory HPLC. FIG. 7(B) is a HPLC chromatogram for a purified product of ASO 4. The purity of ASO 4 improved markedly by the preparatory HPLC purification. FIG. 8 provides a ESI-TOF mass spectrum obtained with the purified product of ASO 4. Provision of the analysis data for ASO 4 is to illustrate how the PNA derivatives of Formula I were purified and identified in the present invention, and should not be interpreted to limit the scope of this invention.

    Binding Affinity with 10-Mer Complementary DNA

    [0234] PNA derivatives in Table 1 were evaluated for their binding affinity for 10-mer DNAs complementarily targeting either the N-terminal or the C-terminal. The binding affinity was assessed by T.sub.m value for the duplex between PNA and 10-mer complementary DNA. The duplex between PNA derivatives in Table 1 and fully complementary DNAs show T.sub.m values too high to be reliably determined in aqueous buffer solution, since the buffer solution tends to boil off during the T.sub.m measurement.

    [0235] T.sub.m values were determined on a UV/Vis spectrophotometer as follows. A mixed solution of 4 M PNA oligomer and 4 M complementary 10-mer DNA in 4 mL aqueous buffer (pH 7.16, 10 mM sodium phosphate, 100 mM NaCl) in 15 mL polypropylene falcon tube was incubated at 90 C. for a minute and slowly cooled down to ambient temperature. Then the solution was transferred into a 3 mL quartz UV cuvette equipped with an air-tight cap, and subjected to a T.sub.m measurement at 260 nm on a UV/Visible spectrophotometer as described in the prior art [PCT/KR2009/001256] or with minor modifications. The 10-mer complementary DNAs for T.sub.m measurement were purchased from Bioneer (www.bioneer.com, Dajeon, Republic of Korea) and used without further purification.

    [0236] Observed T.sub.m values of the PNA derivatives of Formula I are very high for a complementary binding to 10-mer DNA, and provided in Table 2. For example, ASO 10 showed a T.sub.m value of 74.0 C. for the duplex with the 10-mer complementary DNA targeting the N-terminal 10-mer in the PNA as marked bold and underlined in [(N.fwdarw.C) Fmoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)AC-A(5)A-NH.sub.2]. In the meantime, ASO 10 showed a T.sub.m of 68.6 C. for the duplex with the 10-mer complementary DNA targeting the C-terminal 10-mer in the PNA as marked bold and underlined in [(N.fwdarw.C) Fmoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)AC-A(5)A-NH.sub.2].

    TABLE-US-00004 TABLE 2 T.sub.m values between PNAs in Table and 10-mer complementary DNA targeting either the N-terminal or the C-terminal of PNA. T.sub.m Value, C. 10-mer DNA against 10-mer DNA against PNA N-Terminal C-Terminal ASO 5 63.5 71.6 ASO 9 65.0 64.6 ASO 10 74.0 68.6 ASO 14 76.0 77.0

    Examples for Biological Activities of PNA Derivatives of Formula I

    [0237] PNA derivatives of Formula I were evaluated for their biological activities in vitro and in vivo. The biological examples provided below are provided as examples to illustrate the biological profiles of such PNA derivatives of Formula I, and therefore should not be interpreted to limit the scope of the current invention.

    Example 1. Exon Skipping Induced by ASO 9 in PC3 Cells

    [0238] ASO 9 complementarily binds to the 16-mer pre-mRNA sequence as marked bald and underlined in a 30-mer sequence of

    TABLE-US-00005 (SEQIDNO:9) [(5 .fwdarw. 3)CGUCAUUGUUUUUGC|guaaguacuuucagc]
    spanning the junction of exon 4 and intron 4 within the human SCN9A pre-mRNA. ASO 9 possesses a 10-mer overlap with exon 4 and a 6-mer overlap with intron 4. Thus ASO 9 meets the complementary overlap criteria for the compound of Formula I in this invention

    [0239] Given that PC3 cells are known to abundantly express the human SCN9A mRNA [Br. J. Pharmacol. vol 156, 420-431 (2009)], ASO 9 was evaluated by SCN9A nested RT-PCR for its ability to induce the skipping of exon 4 of the human SCN9A pre-mRNA in PC3 cells as described below.

    [0240] [Cell Culture & ASO Treatment] PC3 cells (Cat. No. CRL-1435, ATCC) were grown in 60 mm culture dish containing 5 mL Ham's F-12K medium supplemented with 10% FBS, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate under 5% CO.sub.2 atmosphere at 37 C. Cells were then treated with ASO 9 at 0 (negative control), 10, 100 or 1,000 zM for 18 hours until an additional treatment with 100 g/mL cyclohexamide for another 6 hours in order to freeze the ribosomal translation.

    [0241] [RNA Extraction] Total RNA was extracted from cells using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions.

    [0242] [cDNA Synthesis by One Step RT-PCR] 200 ng of RNA template was used in a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) and a set of gene-specific primers [exon 2_forward: (5.fwdarw.3) CTTTCTCCTTTCAGTCCTCT (SEQ ID NO: 10), and exon 9_reverse: (5.fwdarw.3) CGTCT-GTTGGTAAAGGTTTT (SEQ ID NO: 11)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, followed by 40 cycles of 30 sec at 94 C., 30 sec at 55 C., and 2 min at 72 C.

    [0243] [Nested PCR Amplification] 1 L of cDNA solution (diluted by 100 times) was subjected to a 20 L PCR amplification by nested PCR (Cat. No. K2612, Bioneer) against a set of primers of [exon 3n_forward: (5.fwdarw.3) GGACCAAAAATGTCGAGTATTT (SEQ ID NO: 12), and exon 8_reverse: (5.fwdarw.3) GCTAAGAAGGCCCAGCTGAA (SEQ ID NO: 13)], which was designed to probe the skipping of exon 4. The employed cycle conditions were 95 C. for 5 min followed by 35 cycles of 30 sec at 95 C., 30 sec at 50 C., and 1 min at 72 C. The sequence of exon 3n_forward targets the junction of exon 3 and exon 5 to probe the deletion of exon 4.

    [0244] [Identification of Exon Skipping Products] The PCR products were subjected to electrophoretic separation on a 2% agarose gel. The bands of target size were collected and analyzed by Sanger Sequencing. The skipping of exon 4 was conspicuously strong in PC3 cells treated with 1 aM ASO 9, although the exon 4 skipping was visible too at 10 and 100 zM [cf. FIG. 9(A)]. The exon 4 skipping band was unequivocally confirmed by Sanger sequencing as provided in FIG. 9(B).

    Example 2. qPCR for SCN9A mRNA in PC3 Cells Treated with ASO 9

    [0245] ASO 9 was evaluated for its ability to induce changes in the expression level of the human SCN9A mRNA in PC3 cells by qPCR against exon-specific primers sets covering exons 4-6 as follows.

    [0246] [Cell Culture & ASO Treatment] PC3 cells grown in 60 mm culture dish containing 5 mL F-12K medium were incubated with ASO 9 at 0 (negative control), 10, 100 or 1,000 zM for 24 hours. (2 culture dishes per ASO concentration)

    [0247] [RNA Extraction] Total RNA was extracted using MiniBEST Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions.

    [0248] [cDNA Synthesis by One Step RT-PCR] 200 ng of RNA template was used for a 20 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) and against a set of exon-specific primers [exon 2 forward: (5.fwdarw.3) CTTTCTCCTTTCAGTCCTCT (SEQ ID NO: 10); and exon 9_reverse: (5.fwdarw.3) TTGCCTGGTTCTGTTCTT (SEQ ID NO: 14)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, followed by 15 cycles of 15 sec at 94 C., 30 sec at 55 C., and 2 min at 72 C.

    [0249] [Nested qPCR Amplification] The cDNA solutions were diluted by 50 times. 1 L of each diluted cDNA solution was subjected to a 20 L Real-Time PCR reaction against exon specific primers sets specified as follows: [exon 4_forward: (5.fwdarw.3) GTACACTTT-TACTGGAATATATAC (SEQ ID NO: 15); exon 4_reverse: (5.fwdarw.3) AATGACGACAAAATCCAGC (SEQ ID NO: 16); exon 5_forward: (5.fwdarw.3) GTATTTAACAGAATTTGTAAACCT (SEQ ID NO: 17); exon 5_reverse: (5.fwdarw.3) CTG-GGATTACAGAAATAGTTTTCA (SEQ ID NO: 18); exon 6_forward: (5.fwdarw.3) GAAGACAATTGTAGGGGC (SEQ ID NO: 19); exon 6_reverse: (5.fwdarw.3) GTCTTCTTCACTCTCTAGGG (SEQ ID NO: 20)]. The PCR reactions were probed by SYBR Green (Takara, Japan) according to the following cycle conditions: 95 C. for 30 sec followed by 40 cycles 5 sec at 95 C., and 30 sec at 60 C.

    [0250] [qPCR Results] Each exon level of the ASO treated cells was normalized against the exon level of the negative control cells (i.e. without ASO treatment). FIG. 10(A) summarizes the qPCR results. The expression levels of exons 4-6 significantly decreased by ca 70%, 40% and 2030% at 10, 100 and 1,000 zM, respectively. The dose response pattern could be an artifact possibly due to the exon intron circular RNA (EIciRNA) accumulated during the exon skipping by ASO 9. [Nature Struc. Mol. Biol. vol 22(3), 256-264 (2015)]

    Example 3. Inhibition of Sodium Current in PC3 Cells Treated with ASO 9

    [0251] Cellular sodium current is usually measured by patch clamp. As sodium ions enter cell, the intra-cellular sodium ion level increases. The intra-cellular sodium level can be probed using a sodium ion sensitive dye. CoroNa Green is a dye with a sodium ion chelator of crown ether type. Upon chelation of a sodium ion, CoroNa Green emits green fluorescence. CoroNa Green has been used to indirectly measure the intra-cellular sodium level. The sodium level measured by CoroNa Green was found to correlate well with the sodium ion current measured by sodium ion patch clamp. [Proc. Natl. Acad. Sci. USA vol 106(38), 16145-16150 (2009)]

    [0252] PC3 cells are known to abundantly express the human SCN9A mRNA and sodium current as well, although there are other SCN subtypes simultaneously expressed. [Br. J. Pharmacol. vol 156, 420-431 (2009)] Thus a down-regulation of the (functionally active) SCN9A mRNA may lead to a considerable reduction of the sodium ion current in PC3 cells, if the sodium ion current by the Na.sub.v1.7 sodium channel subtype occupies a marked portion of the total sodium ion current in PC3 cells. It is note that the SCN9A mRNA encodes the Na.sub.v1.7 sodium channel subtype.

    [0253] ASO 9 was evaluated for its ability to down-regulate sodium ion current in PC3 cells using CoroNa Green as briefly described below.

    [0254] [Cell Culture & ASO Treatment] PC3 cells were grown in 2 mL F-12K medium in 35 mm culture dish, and treated with ASO 9 at 0 zM (negative control), 100 zM or 1 aM.

    [0255] [CoroNa Assay] 30 hours later, the cells were washed with 2 mL HBSS (Hank's Balanced Salt Solution, Cat. Number 14025-092, Life Technologies), and then charged with 2 mL fresh HBSS. Then the cells were treated with 5 M CoroNa Green (Cat. Number C36676, Life Technologies) at 37 C. 30 min later, the cells were washed 2 times with 2 mL

    [0256] HBSS, and charged with 2 mL fresh HBSS. The culture dish was mounted on an Olympus fluorescence microscope equipped with a digital video camera to continuously capture the green fluorescence images of the cells. The cells were acutely treated with 100 mM NaCl, and then the changes in fluorescence cellular images were digitally recorded over a period of 3 min. There were about 4 cells per frame. The fluorescence intensities from each individual cell were traced at a resolution of second. The traces of the intracellular fluorescence intensities from individual cells were overlaid and averaged at each time point. The average of the traces from the individual cells of each ASO concentration was plotted as provided in FIG. 10(B) using ImageJ program (version 1.50i, NIH). The average fluorescence intensity trace was taken as the individual intra-cellular sodium concentration trace for the cells treated with ASO 9 at 0 (negative control), 100 or 1,000 zM.

    [0257] [CoroNa Assay Results] The observed traces of intra-cellular fluorescence intensity are summarized in FIG. 10(B). The fluorescence intensity trace for the cells treated with 1,000 zM ASO 9 runs lower than the trace for the cells without ASO treatment. The average fluorescence intensities at 100 sec were compared to estimate a sodium current change induced by ASO treatment. The average fluorescence intensity of the cells without ASO treatment was 81.86 (arbitrary unit) at 100 sec. In the meantime, the average fluorescence intensity of the cells treated with 1,000 zM ASO 9 was 51.47 (arbitrary unit) at 100 sec. Thus, a 30 hour incubation with 1,000 zM ASO 9 induced a significant reduction in the sodium channel activity by 37% (p-value=0.035 by student's t-test) in PC3 cells. Considering that PC3 cells express various subtypes of voltage-gated sodium channel (VGSC), the 37% decrease is taken as marked for the inhibition of Na.sub.v1.7 expression by ASO 9. There was no marked decrease in the sodium current in PC3 cells treated with 100 zM ASO 9.

    Example 4. qPCR Evaluation of SCN9A mRNA in PC3 Cells Treated with ASO 4

    [0258] ASO 4 is a 14-mer SCN9A ASO initially designed to complementarily target a 14-mer sequence spanning the junction of exon 4 and exon 5 in the human SCN9A mRNA. However, ASO 4 happens to complementarily overlap with a 12-mer pre-mRNA sequence as marked bald and underlined in the 30-mer 5 splice site sequence of [(5.fwdarw.3) CGUCAUUGUUUUUGC|guaaguacuuucagc (SEQ ID NO: 9)] spanning the junction of exon 4 and intron 4 within the human SCN9A pre-mRNA, although there are two mismatches with intron 5 as marked with a quote sign ( ). ASO 4 possesses a 7-mer overlap with exon 4 and a 5-mer overlap with intron 4. Thus ASO 4 meets the complementary overlap criteria for the compound of Formula I in this invention.

    [0259] ASO 4 was evaluated for its ability to inhibit the expression of the human SCN9A mRNA by qPCR against exon-specific primers sets covering exons 4-6 according to the procedures provided in Example 2 unless noted otherwise.

    [0260] [ASO Treatment] The concentration of ASO 4 in culture dish was 0 (negative control), 10, 100 or 1,000 zM. (2 culture dishes per dose)

    [0261] [qPCR Results] FIG. 11(A) provides the qPCR results obtained with PC3 cells treated with ASO 4. The expression levels of exons 4-6 significantly decreased by >70% in the PC3 cells treated with ASO 4 at 10 to 1,000 zM for 24 hours.

    Example 5. qPCR Evaluation of SCN9A mRNA in PC3 Cells Treated with ASO 5

    [0262] ASO 5 is a 17-mer SCN9A ASO initially designed to complementarily target a 17-mer sequence spanning the junction of exon 4 and exon 5 in the human SCN9A mRNA. However, ASO 5 happens to complementarily overlap with a 12-mer pre-mRNA sequence as marked bald and underlined in the 30-mer 5 splice site sequence of [(5.fwdarw.3) CGUCAUUGUUUUUGC|guaaguacuuucagc (SEQ ID NO: 9)] spanning the junction of exon 4 and intron 4 within the human SCN9A pre-mRNA, although there are five mismatches with intron 5 as marked with a quote sign ( ). ASO 5 possesses a 7-mer overlap with exon 4 and a 5-mer overlap with intron 4. Thus ASO 5 does not meet the complementary overlap criteria for the compound of Formula I in this invention due to the 5 mismatches, although ASO 5 and ASO 4 possess the same degree of complementary overlap with the SCN9A pre-mRNA.

    [0263] ASO 5 was evaluated for its ability to inhibit the expression of the human SCN9A mRNA (full length) by qPCR against exon-specific primers sets covering exons 4-6 according to the procedures provided in Example 2 unless noted otherwise.

    [0264] [qPCR Results] FIG. 11(B) provides the qPCR results obtained with PC3 cells treated with ASO 5. The expression levels of exons 4-6 significantly decreased by ca 80%, 50% and 70% in the PC3 cells treated with ASO 5 at 10 zM, 100 zM and 1 aM, respectively.

    [0265] Even though ASO 5 inhibited the expression of the full length SCN9A mRNA by qPCR, the five mismatches of ASO 5 against the SCN9A pre-mRNA is rather too much and increases the propensity of cross reactivity with other pre-mRNA(s).

    Example 6. qPCR Evaluation of SCN9A mRNA in PC3 Cells Treated with ASO 1

    [0266] ASO 1 is a 14-mer SCN9A ASO possessing the same oligonucleotide sequence as ASO 4, although the N-terminus substituent of Fethoc- radical in is replaced with Fmoc- radical in ASO 1. Thus ASO 1 meets the complementary overlap criteria for the compound of Formula I in the present invention.

    [0267] ASO 1 was evaluated for its ability to inhibit the expression of the human SCN9A mRNA (full length) by qPCR against exon-specific primers sets covering exons 4-6 according to the procedures provided in Example 2 unless noted otherwise.

    [0268] [qPCR Results] FIG. 11(C) provides the qPCR results obtained with PC3 cells treated with ASO 1. The expression levels of exons 4-6 significantly (student's t-test) decreased by ca 85%, 50% and 60% in the PC3 cells treated with ASO 1 at 10 zM, 100 zM and 1 aM, respectively.

    Example 7. qPCR Evaluation of SCN9A mRNA in PC3 Cells Treated with ASO 6

    [0269] ASO 6 is a 14-mer SCN9A ASO possessing a 11-mer complementary overlap with the SCN9A pre-mRNA as marked bald and underlined within the 30-mer 5 splice site sequence of [(5.fwdarw.3) CGUCAUUGUUUUUGC|guaaguacuuucagc (SEQ ID NO: 9)] spanning the junction of exon 4 and intron 4 within the human SCN9A pre-mRNA. ASO 6 possesses a 6-mer overlap with exon 4 and a 5-mer overlap with intron 4. Since ASO 6 possesses 3 mismatches against the human SCN9A pre-mRNA, ASO 6 does not meet the complementary overlap criteria for the compound of Formula I in this invention.

    [0270] ASO 6 was evaluated for its ability to inhibit the expression of the human SCN9A mRNA (full length) by qPCR against exon-specific primers sets covering exons 4-6 according to the procedures provided in Example 2 unless noted otherwise. It is noted that PC3 cells were incubated with ASO 6 at 0 (negative control), 10 zM and 100 zM.

    [0271] [qPCR Results] FIG. 11(D) provides the qPCR results obtained with PC3 cells treated with ASO 6. The expression levels of exons 4-6 significantly (student's t-test) decreased by ca 80% in the PC3 cells treated with ASO 6 at 10 zM and 100 zM.

    [0272] Although ASO 6 does not meet the complementary overlap criteria for the compound of Formula I in this invention due to the 3 mismatches, the qPCR data of ASO 6 suggests that even an 11-mer complementary overlap with the SCN9A pre-mRNA would be still strong enough to induce the exon skipping in PC3 cells.

    Example 8. qPCR Evaluation of SCN9A mRNA in PC3 Cells Treated with ASO 10

    [0273] ASO 10 is a 17-mer SCN9A ASO initially designed to complementarily target a 17-mer sequence spanning the junction of exon 4 and exon 5 in the human SCN9A mRNA. Nevertheless, ASO 10 happens to complementarily overlap with a 15-mer pre-mRNA sequence as marked bald and underlined in the 30-mer 5 splice site sequence of

    TABLE-US-00006 (SEQIDNO:9) [(5 .fwdarw. 3)CGUCAUUGUUUUUGC|guaaguacuuucagc]
    spanning the junction of exon 4 and intron 4 within the human SCN9A pre-mRNA, although there are two mismatches with intron 5 as marked with a quote sign ( ). ASO 10 possesses a 10-mer overlap with exon 4 and a 5-mer overlap with intron 4. Thus ASO 10 meets the complementary overlap criteria for the compound of Formula I in the present invention.

    [0274] ASO 10 was evaluated for its ability to inhibit the expression of the human SCN9A mRNA (full length) by qPCR against exon-specific primers sets covering exons 4-6 according to the procedures described in Example 2 unless noted otherwise. It is noted that PC3 cells were incubated with ASO 10 at 0 (negative control), 10 zM and 100 zM.

    [0275] [qPCR Results] FIG. 11(E) provides the qPCR results obtained with PC3 cells treated with ASO 10. The expression levels of exons 4-6 significantly (student's t-test) decreased by ca 60% and 80% in the PC3 cells treated with ASO 10 at 10 zM and 100 zM, respectively.

    Example 9. Inhibition of Sodium Current in PC3 Cells Treated with ASO 10

    [0276] ASO 10 was evaluated for its ability to inhibit the sodium current in PC3 cells using CoroNa Green according to the procedures described in Example 3 unless noted otherwise. [CoroNa Assay Results] The observed traces of average cellular fluorescence intensity are provided in FIG. 12(A). The average fluorescence intensity trace for the cells treated with 1,000 zM ASO 10 ran lower than that for the cells without ASO treatment. The average cellular fluorescence intensity of the cells without ASO treatment was 130.3 (arbitrary unit) at 100 sec. In the meantime, the average cellular fluorescence intensity of the cells treated with 1,000 zM ASO 10 was 89.7 (arbitrary unit) at 100 sec. Thus, a 30 hour incubation with 1,000 zM ASO 10 is estimated to have significantly (p<0.001) inhibited the sodium channel activity by 31% in PC3 cells. The decrease induced by 100 zM ASO 10 was 30% (p<0.001).

    Example 10. Inhibition of Sodium Current in PC3 Cells Treated with ASO 6

    [0277] ASO 6 was evaluated for its ability to down-regulate sodium current in PC3 cells using CoroNa Green according to the procedures provided in Example 3 unless noted otherwise.

    [0278] [CoroNa Assay Results] The observed traces of cellular fluorescence intensity are provided in FIG. 12(B). The fluorescence intensity traces for the cells treated with 100 and 1,000 zM ASO 6 were no different from the trace for the cells without ASO treatment. Thus, a 30 hour incubation with ASO 6 failed to induce a notable decrease in the sodium channel activity in PC3 cells.

    [0279] Although ASO 6 inhibited the expression of the full length SCN9A mRNA as provided in Example 7, ASO 6 failed to inhibit the sodium current in PC3 cells. ASO 6 may not tightly bind to the 5 splice site of exon 4 enough to induce the exon skipping owing to the three mismatches with the target pre-mRNA sequence.

    Example 11. Inhibition of Sodium Current in PC3 Cells Treated with ASO 4

    [0280] ASO 4 was evaluated for its ability to down-regulate sodium current in PC3 cells using CoroNa Green according to the procedures provided in Example 3 unless noted otherwise.

    [0281] [CoroNa Assay Results] The observed traces of cellular fluorescence intensity are provided in FIG. 12(C). The fluorescence intensity trace for the cells treated with 100 zM ASO 4 ran lower than that for the cells without ASO treatment. The average cellular fluorescence intensity of the cells without ASO treatment (i.e. negative control) was 89.3 (arbitrary unit) at 100 sec. In the meantime, the average cellular fluorescence intensity of the cells treated with 1,000 zM ASO 10 was 61.4 (arbitrary unit) at 100 sec. Thus, a 30 hour incubation with 1,000 zM ASO 4 is estimated to have significantly (p<0.01) decreased the sodium channel activity by 31% in PC3 cells. However, the decrease induced by 100 zM ASO 4 was only 18% without statistical significance.

    Example 12. Inhibition of Sodium Current in PC3 Cells Treated with ASO 5

    [0282] ASO 5 was evaluated for its ability to inhibit sodium current in PC3 cells using CoroNa Green according to the procedures provided in Example 3 unless noted otherwise.

    [0283] [CoroNa Assay Results] The observed traces of cellular fluorescence intensity are summarized in FIG. 12(D). The fluorescence intensity trace for the cells treated with 100 zM ASO 5 ran lower than the trace for the cells without ASO treatment. The average cellular fluorescence intensity of the cells without ASO treatment was 90.6 (arbitrary unit) at 100 sec. In the meantime, the average cellular fluorescence intensity of the cells treated with 100 zM ASO 5 was 60.8 (arbitrary unit) at 100 sec. Thus, a 30 hour incubation with 100 zM ASO 5 is estimated to have significantly (p<0.01) down-regulated the sodium channel activity by 33% in PC3 cells.

    [0284] As the concentration of ASO 5 was increased from 100 zM to 1,000 zM, however, the average cellular fluorescence intensity increased to 110.2 (arbitrary unit) at 100 sec. Thus, a 30 hour incubation with 1,000 zM ASO 5 is estimated to have significantly (p<0.05) increased the sodium channel activity by 22% in PC3 cells. The dose response pattern could be a result of transcription upregulation possibly due to the exon intron circular RNA (EIciRNA) accumulated during the exon skipping by ASO 5. [Nature Struc. Mol. Biol. vol 22(3), 256-264 (2015)]

    Example 13. L5 Ligation and L5/L6 Ligation in Spinal Nerve Ligation

    [0285] Spinal nerve ligation (SNL) induces neuropathy in DRG (dorsal root ganglia) and has been widely used as a model for neuropathic pains. [Pain vol 50(3), 355-363 (1992)] Depending on how spinal nerve bundle(s) is ligated, however, there can be several variations of SNL. The degree and duration of neuropathy in DRG appears to vary depending on how nerve bundles are ligated. [Pain vol 43(2), 205-218 (1990)] Of the two SNL variations performed for this invention, L5/L6 ligation (i.e. Method B) is considered to induce neuropathy more severe and persisting longer than L5 ligation with L6 cut (i.e. Method A).

    [0286] [Method A: L5 Ligation with L6 Cut] Male SD rats were anesthetized with zoletil/rompun. The L5 and L6 spinal nerve bundles (left side) were exposed and tightly ligated, and then the L6 nerve was cut. Finally the muscle and skin were closed and clipped according to due aseptic procedures.

    [0287] [Method B: L5/L6 Ligation] Male SD rats were anesthetized with zoletil/rompun. The L5 and L6 spinal nerve bundles (left side) were exposed and tightly ligated. Then the muscle and skin were closed and clipped according to due aseptic procedures.

    Example 14. Allodynia Scoring by Von Frey

    [0288] [Method A: Electronic Von Frey] Allodynia was scored by von Frey method using an electronic von Frey anesthesiometer [37450 Dynamic Plantar Aesthesiometer, Ugo Basile; or, Model Number 2390, IITC Inc. Life Sciences] as briefly described as follows: After stabilizing for less than 30 minutes each animal in a plastic cage customized for von Frey scoring, the ligated hindpaw (ligated side, left usually) of each animal was subjected to von Frey scoring 6 times with an interval of a few minutes between two neighboring rounds of scoring. The first round scores were discarded since the animals were considered not fully acclimated during the first round of scoring. Of the five remaining scores, the highest and lowest scores were excluded as outliers. Then the average of the remaining three scores was taken as the von Frey score for the animal.

    [0289] [Method B: Von Frey with Microfilaments (Touch Test)] Allodynia was scored with a set of microfilaments (Touch Test) according to the Up & Down method. [J Neurosci. Methods vol 53(1), 55-63 (1994)]

    Example 15. Reversal of Allodynia Induced with SNL by ASO 1

    [0290] ASO 1 was evaluated for its ability to reverse the allodynia elicited by SNL in rats as described below.

    [0291] [SNL Operation and Grouping] In Day 0, 30 male SD rats were subjected to SNL surgery of L5 ligation with L6 cut (Method A in Example 13). In Day 15, eighteen rats showing the lowest von Frey scores were selected and randomly assigned to three groups of the negative control (no ASO treatment), ASO 1 3 pmole/Kg, and ASO 1 10 pmole/Kg group (N=6 per group).

    [0292] [ASO Dosing and Von Frey Scoring] An aqueous stock solution of ASO 1 was serially diluted to 3 nM and 10 nM ASO 1 in PBS. Each diluted solution was subcutaneously administered to each rat of the ASO treatment groups at 1 mL/Kg in Days 16, 18, 20, 22, and 24. Von Frey scoring (by Electronic Von Frey: Method A in Example 14) was carried out in Days 20, 22. 24, 27, and 29. ASO was administered after von Frey scoring in Days 20, 22, and 24. Von Frey scores were evaluated by student's t-test for statistical significance against the negative control group.

    [0293] [Therapeutic Activity] FIG. 13 provides the observed von Frey scores. The average von Frey scores of the ASO treatment groups were significantly higher than the negative control group in Days 20, 22, 24 and 27. The therapeutic activity persisted at least three days post the final ASO dosing in Day 24. Thus the allodynia induced with L5 ligation was significantly reversed in rats subcutaneous administered with ASO 1 at 3 or 10 pmole/Kg.

    Example 16. Induction of Diabetes-Induced Peripheral Neuropathic Pain (DPNP)

    [0294] Peripheral neuropathic pain was induced in rats with type I diabetes as briefly described. Streptozotocin dissolved in citrate buffer (pH 6) was intra-peritoneally administered at 60 mg/Kg to male SD rats weighing ca 200 g. [J. Ethnopharmacol. vol 72(1-2), 69-76 (2000)] The degree of peripheral neuropathy was assessed by von Frey score. Animals showing low von Frey scores stably over days were selected for evaluation of the therapeutic activity of SCN9A ASOs.

    Example 17. Reversal of Allodynia by ASO 5 in Rats with DPNP

    [0295] ASO 5 was evaluated for its ability to reverse the allodynia induced by DPNP in rats as described below.

    [0296] [Induction of DPNP and Grouping] Type I diabetes was induced in Day 0 by an intraperitoneal administration of streptozotocin to male SD rats as described in Example 16. In Day 10, rats with DPNP were randomly grouped based on the von Frey scores of individual animals in Day 10 by Method B in Example 14. (Groups 16 and N=8 per group) The six groups are Group 1 for vehicle only (negative control), Group 2 for pregabalin 30 mg/Kg, Group 3 for ASO 5 0.01 pmole/Kg, Group 4 for ASO 5 0.1 pmole/Kg, Group 5 for ASO 5 1 pmole/Kg, and Group 6 for ASO 5 10 pmole/Kg.

    [0297] [ASO Treatment and von Frey Scoring] An aqueous stock solution of ASO 5 was serially diluted to 0.01, 0.1, 1 and 10 nM ASO 5 in DDW (deionized distilled water). ASO 5 was subcutaneously administered in Days 11, 13, 15, and 17. Pregabalin 30 mg/Kg was orally administered in Days 11 and 17 as the positive control. Von Frey scoring was carried out 2 hours post dose in Days 11, 13, 15, and 17 by Method B described in Example 14. Von Frey scoring was additionally performed in Day 20 to assess the duration of the therapeutic activity after the final dosing. Von Frey scores were evaluated for statistical significance by student's t-test against Group 1 (vehicle only, negative control).

    [0298] [Therapeutic Activity] The observed von Frey scores are summarized in FIG. 14. Of the ASO treatment groups, the allodynia was markedly (80%) and significantly reversed only in Group 6, i.e., ASO 5 10 pmole/Kg. It is interesting to note that the onset of the therapeutic activity was as fast as a few hours as observed in Day 11. The allodynia was comparably reversed in Group 6 (ASO 5 10 pmole/Kg) and Group 2 (pregabalin 30 mg/Kg) in Day 17. The therapeutic activity of Group 6 washed out almost completely in Day 20 (three days after the final dose in Day 17).

    Example 18. Reversal of Allodynia by ASO 9 and ASO 10 in Rats with DPNP

    [0299] ASO 9 and ASO 10 were evaluated for their ability to reverse the allodynia induced by DPNP in rats according to the procedures described in Example 17, unless noted otherwise.

    [0300] [Grouping] In Day 10, rats with DPNP were randomly assigned to three groups of the negative control (vehicle/DDW only), ASO 9 100 pmole/Kg and ASO 10 100 pmole/Kg (N=89 per group).

    [0301] [ASO Treatment and von Frey Scoring] Rats were subcutaneously administered with ASO 9, ASO 10 or vehicle in Days 11, 13, 15, 17 and 19. Von Frey scoring was performed 2 hours post dose in Days 11, 13, 15, 17 and 19. Von Frey scoring was additionally performed in Days 21 and 23 to assess the duration of the therapeutic activity after the final dosing. Statistical significance of daily von Frey scores was assessed by student's t-test against the negative control group.

    [0302] [Therapeutic Activity] The observed von Frey scores are summarized in FIG. 15. The allodynia was markedly and significantly reversed by ASO 9 and ASO 10. ASO 9 reversed the allodynia by ca 75% in Days 17 and 19. In case of ASO 10, the allodynia was gradually reversed to ca 60% in Day 19. ASO 9 possesses more complementary overlap with the SCN9A pre-mRNA than ASO 10, which could explain the difference in the therapeutic efficacy of the two ASOs. The therapeutic activity of the ASOs completely washed out in Day 21, i.e. 2 days after the final dosing, suggesting a pharmacodynamic half-life shorter than a few days.

    Example 19. Reversal of Allodynia Induced with SNL by ASO 9

    [0303] ASO 9 was evaluated for its ability to reverse the allodynia elicited by SNL in rats as described below.

    [0304] [SNL Operation and Grouping] In Day 0, male SD rats were subjected to SNL surgery of L5/L6 ligation (Method B in Example 13). In Day 21, 12 rats were selected based on the von Frey scores by electronic von Frey (Method A in Example 14), and randomly assigned to two groups of Negative Control (no ASO treatment) and ASO 9 100 pmole/Kg (N=6 per group).

    [0305] [ASO Dosing and Von Frey Scoring] An aqueous stock solution of ASO 9 was diluted to 100 nM ASO 9 in PBS. The ASO solution or PBS was subcutaneously administered to rats at 1 mL/Kg three times per day at 08:00H, 14:00H and 21:00H in Days 22, 23 and 24. Von Frey scoring was carried out at 20:00H in Days 22, 23 and 24 by Method A described in Example 14. Von Frey scores were evaluated by student's t-test for statistical significance between the two groups.

    [0306] [Therapeutic Activity] The observed von Frey scores are summarized in FIG. 16. The average von Frey scores of the ASO treatment group were significantly higher than the negative control group in Days 23 and 24. Thus subcutaneous TID administrations of ASO 9 at 100 pmole/Kg significantly reversed the allodynia induced with SNL (L5/L6 ligation) in rats.