Beta-galactosidase Mutant, and Preparation Method and Application Thereof
20190218536 ยท 2019-07-18
Inventors
Cpc classification
C12N9/2471
CHEMISTRY; METALLURGY
A23C9/1206
HUMAN NECESSITIES
A23L33/21
HUMAN NECESSITIES
C12Y302/01023
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention discloses a -galactosidase mutant, and a preparation method and application thereof, belonging to the fields of gene engineering and enzyme engineering. Amino acids of specific sites in the -galactosidase are mutated, the -galactosidase is transferred into a recombinant bacterium, and enzymatic transformation is performed under optimized conditions, so that the yield of galactooligosaccharide produced by the mutant reaches 59.8%, which is increased by about 70% as compared with that of wild enzyme, thereby implementing the increase of the galactooligosaccharide yield. The present invention has very high industrialized application value.
Claims
1. A -galactosidase mutant, comprising: an amino acid sequence with mutations selected from the group consisting of amino acid position 140, position 264, position 304 and position 806, wherein the mutations are relative to a parent amino acid sequence set forth in SEQ ID NO:2.
2. The mutant according to claim 1, wherein the mutations are selected from the group consisting of: mutation of asparagine (Asn) at amino acid position 140 to cysteine (Cys), wherein the mutant is named N140C, mutation of phenylalanine (Phe) at amino acid position 264 to tryptophan (Trp), wherein the mutant is named F264W, mutation of phenylalanine (Phe) at amino acid position 304 to glutamine (Gln), wherein the mutant is named F304Q; mutation of tryptophan (Trp) at amino acid position 806 to phenylalanine (Phe), wherein the mutant is named W806F, mutation of phenylalanine (Phe) at amino acid position 264to tryptophan (Trp) and mutation of asparagine (Asn) at amino acid position 14o to cysteine (Cys), wherein the mutant is named N140C/F264W, and mutation of asparagine (Asn) at amino acid position 140to cysteine (Cys) and mutation of tryptophan (Trp) at amino acid position 806 to phenylalanine (Phe), wherein the mutant is named N140C/W806F; and wherein the substitutions are relative to the parent amino acid sequence set forth in SEQ ID NO:2
3. A gene coding the mutant of claim 1.
4. A vector or recombinant cell carrying the gene of claim 3.
6. A construction method of a recombinant bacterium expressing the mutant of claim 1, comprising the following steps: (1) according to a predetermined mutant sites, designing mutagenic primers of site-directed mutagenesis, and performing site-directed mutagenesis by using a vector carrying a -galactosidase gene as a template to obtain a gene encoding a -galactosidase mutant; and constructing a mutant plasmid containing the gene encoding the -galactosidase mutant; (2) transforming the mutant plasmid into a host cell; and (3) selecting a positive clone, performing a fermentation culture, and performing centrifuging to obtain a supernate from the fermentation culture, wherein the supernate is a crude enzyme solution of the -galactosidase mutant.
6. The method according to claim 5, wherein the mutant plasmid is derived from a pET basedor pPIC9k plasmid.
7. A method for preparing galactooligosaccharide by using the -galactosidase mutant of claim 1, comprising the following steps: (1) by using lactose with a concentration of 400 g/L-600 g/L as a substrate, adding the -galactosidase mutant, and adding an acetic acid-sodium acetate buffer, with a pH of 4.5-5; (2) performing an enzymatic transformation in a shaking water bath, wherein a reaction temperature is 40-60 C.; and (3) performing a reaction for 5-36 hours.
8. The method according to claim 7, wherein an addition amount of the -galactosidase mutant is 2.5-5 U/mL.
Description
BRIEF DESCRIPTION OF FIGURES
[0026]
[0027]
DETAILED DESCRIPTION
[0028] BMGY liquid culture medium: YNB: 13.4 g/L; yeast extract: 10 g/L; peptone: 20 g/L; glycerol: 10 g/L; K.sub.2HPO.sub.4: 2.29 g/L; KH.sub.2PO.sub.4: 11.8 g/L; (NH.sub.4).sub.2SO.sub.4: 10 g/L;
[0029] BMMY liquid culture medium: YNB: 13.4 g/L; yeast extract: 10 g/L; peptone: 20 g/L; methanol: 40 g/L; K.sub.2HPO.sub.4: 2.29 g/L; KH.sub.2PO.sub.4: 11.8 g/L; (NH.sub.4).sub.2SO.sub.4: 10 g/L.
[0030] Enzyme activity measuring method:
[0031] -galactosidase activity analysis uses o-nitrophenyl--D-galactopyranoside (oNPG) as a substrate.
[0032] Prepare 20 mmol/L oNPG, take 100 L of a properly diluted fermentation solution or enzyme solution and 1800 L of 0.1 mol/L pH 4.5 sodium acetate buffer, hold at the temperature of 60 C. for 5 min, adding 100 L of the substrate, hold at the temperature of 60 C. for 10 min, immediately adding 1 mL of 1 mol/L precooled Na2CO3 solution to stop reaction and perform color development, and measure absorbance at 420 nm with a spectrophotometer.
[0033] Definition of enzyme activity unit: under the above analysis conditions, the amount of enzyme that catalytically produces 1 mol of oNP per minute is one activity unit.
[0034] Analysis of Galactooligosaccharide (GOS) Yield by HPLC Method
[0035] A 60% (W/V) lactose solution is prepared as a substrate, and certain amounts of wild enzyme and double-mutant enzyme solutions are added, so that the final enzyme activity of the wild type enzyme solution is 10 U/mL and the final enzyme activity of the mutant is 2.5 U/mL (the effect of the amount of enzyme added on the production of GOS was previously performed, and the above conditions were respectively the optimum amounts of enzyme added for the mutant and the wild type). The reaction is performed under the optimum temperature and pH conditions, wherein the reaction for the wild type is performed for 10 h (the time of the maximum yield of the wild type in a pre-experiment), and the reaction for the mutant is performed for 5 h (the time of the maximum yield of the mutant in the pre-experiment). The reaction solution is centrifuged at 12000 rpm for 10 min, and supernate is taken, filtered through a 0.22 nm ultrafiltration membrane to remove 20 uL and subjected to HPLC analysis.
[0036] In the reaction solution, the amounts of disaccharides, trisaccharides, tetrasaccharides and pentasaccharides in a product are analyzed by HPLC. Chromatographic conditions for measurement are: Agilent 1200 HPLC chromatograph, Agilent automatic sampler, chromatographic column Hi-Plex Na, (300*7.7 mm), and differential detector Agilent G1362A; a mobile phase is pure water, a flow rate is 0.3 mL/min, and column temperature is set at 80 C.
[0037] Chromatographic conditions for measuring disaccharides are: Agilent 1200 HPLC chromatograph, Agilent automatic sampler, chromatographic column NH2-50 4E (4.6 mm*250 mm), and differential detector Agilent G1362A; a mobile phase is a 78% (v/v) acetonitrile-water mixed solution, a flow rate is 0.8 mL/min, and column temperature is set at 35 C.
[0038] Measuring Method of Galactooligosaccharide Yield:
[0039] Yield (%)=(Mass of the galactooligosaccharide in product/Mass of all saccharides in product)100%
[0040] The galactooligosaccharide yield is the sum of transferred disaccharides, transferred trisaccharides and transferred tetrasaccharides.
EXAMPLE 1
Preparation of Single Mutant and Wild Enzyme
[0041] A -galactosidase gene (SEQ ID NO.1) is connected to pMD19-T simple to obtain an AorE/pMD19-T simple plasmid, and the AorE/pMD19-T simple plasmid used as a template is subjected to mutation by using Sac1m-F and Sac1m-R as primers. An above PCR product is subjected to Dpn1 digestion, and the obtained plasmid is transformed into an escherichia coli competent cell to obtain an AorE-M/pMD19-T simple plasmid.
[0042] Sac1m-F: TCCACAAGATCAGGGCTCTTGGTTTCAAC (mutant sites are underlined)
[0043] Sac1m-R: GTTGAAACCA AGAGCCCTGA TCTTGTGGA (mutant sites are underlined)Preparation of wild enzyme: Snab1 and Not1 double-enzyme digestion is performed on the AorE-M/pMD19-T simple plasmid and a pPIC9k vector, enzyme digestion products are connected by a T4 ligase, a connection product is transformed into an Escherichia coli JM109 competent cell, and bacterium picking is performed to extract a plasmid, wherein the plasmid is named AorE-M/pPIC9k.
[0044] 1.Preparation of recombinant bacterium pichia pastoris: the AorE-M/pPIC9k plasmid is electrically transformed into a KM71 yeast competent cell, wherein the recombinant bacterium is named AorE-M/pPIC9k-KM71.
[0045] 2.Preparation of single mutant: primers for N140C, F264W, F304Q and W806F mutations are respectively designed and synthesized, and the -galactosidase gene is subjected to site-directed mutagenesis.
[0046] PCR amplification of site-directed mutant coding gene: by using a rapid PCR technique, PCR is performed by using a vector AorE-M/pMD19-T simple carrying a gene coding wild type maltooligosyl trehalose synthase as a template to respectively obtain mutated plasmids. Mutagenic primers are as follows:
TABLE-US-00001 140m-F: CCGGTTCGTACATCTGTGCCGAGGTCTCA (mutantsitesareunderlined) 140m-R: TGAGACCTCGGCACAGATGTACGAACCGG (mutantsitesareunderlined) 806m-F: CTCGACGAGAATTTCACGGTCGGCGAGGA (mutantsitesareunderlined) 806m-R: TCCTCGCCGACCGTGAAATTCTCGTCGAG (mutantsitesareunderlined) 264m-F: AGCTATCCCCTCGGCTGGGATTGCGCAAACCCAT (mutantsitesareunderlined) 264m-R: ATGGGTTTGCGCAATCCCAGCCGAGGGGATAGCT (mutantsitesareunderlined) F304-Q: TCCAAGCGGGTGCTAATGACCCATGGGGTG (mutantsitesareunderlined) 264m-R: CACCCCATGGGTCATTAGCACCCGCTTGGA (mutantsitesareunderlined)
[0047] Sequencing is respectively performed to confirm whether the coding gene of the -galactosidase mutant is correct; Snab1 and Not1 double-enzyme digestion is performed on the plasmid carrying the mutant gene and the pPIC9k vector, enzyme digestion products are connected by a T4 ligase, a connection product is transformed into an escherichia coli JM109 competent cell, bacterium picking is performed to extract the plasmid, and the plasmid is transformed into a yeast KM71 cell to obtain recombinant bacteria AorE-M/pPIC9k-N140C, AorE-M/pPIC9k-F264W, AorE-M/pPIC9k-F3040 and AorE-M/pPIC9k-W806F capable of expressing the mutant gene.
EXAMPLE 2
Construction of Double Mutants
[0048] By using the plasmid of the mutant N140C constructed by the Example 1 as a template for double mutations, according to the primers of site-directed mutagenesis designed by the Example 1, site-directed mutagenesis is performed on the plasmid carrying the gene coding the mutant N140C by a rapid PCR technique to construct double mutants N140C/F264W and N140C/W806F. Sequencing is respectively performed to confirm whether a coding gene of the -galactosidase double mutants is correct; Snab1 and Not1 double-enzyme digestion is performed on the plasmid with a correct sequencing result and the pPIC9k vector, enzyme digestion products are connected by a T4 ligase, a connection product is transformed into an escherichia coli JM109 competent cell, bacterium picking is performed to extract the correct plasmid, and the plasmid is transformed into a yeast KM71 cell to obtain recombinant bacteria AorE-M/pPIC9k-N140C/F264W and AorE-M/pPIC9k-N140C/W806F capable of expressing the double mutant genes.
EXAMPLE 3
Preparation of Wild Bacterium and Mutant -Galactosidase Solutions
[0049] The recombinant bacteria AorE-M/pPIC9k/KM71, AorE-M/pPIC9k-N140C, AorE-M/pPIC9k-F264W, AorE-M/pPIC9k-F3040, AorE-M/pPIC9k-W806F, AorE-M/pPIC9k-N140C/F264W and AorE-M/pPIC9k-N140C/W806F are respectively transferred into the BMGY liquid culture medium, and are cultured at 30 C. for 24 h to obtain a bacteria solution. The bacteria solution is centrifuged, all thalli are transferred into 50 mL of the BMMY liquid culture medium, and cultured at 30 C. for 5 days, wherein methanol of which the final concentration is 0.75% is added every 24 h to perform induced enzyme production. A fermentation solution is centrifuged, and supernate is a crude enzyme solution.
[0050] After the enzyme activity of the crude enzyme solution is measured, ONPG hydrolase activities of the wild type -galactosidase (WT) and the mutant are listed in Table 1.
TABLE-US-00002 TABLE 1 Enzyme activities of wild type -galactosidase and mutant enzymes Enzyme Enzyme Activity (U/mL) WT 185.3 N140C 9.7 F264W 23.2 F304Q 37.5 W806F 161.2 N140C/F264W 19.3 N140C/W806F 32.1
[0051] It can be seen from Table 1 that the mutants have lower oNPG hydrolase activity than the wild type. In this experiment, the enzyme activity and the yield are not directly proportional, and the level of the hydrolase activity does not represent the level of the yield. The hydrolase activity is only used as a quantitative measure of the amount of enzyme added.
EXAMPLE 4
Optimum Temperature for Producing Galactooligosaccharide by Transforming Lactose by Using Mutant Enzyme
[0052] A 60% (W/V) lactose solution is prepared as a substrate, 60 g of lactose is dissolved in 50 mL of pH 4.5 50 mml/L acetic acid buffer, and the volume of the solution is made up to 100 mL. Certain amounts of the wild enzyme and the double-mutant enzyme solution are added, so that the final enzyme activity of the enzyme solution is 2.5 U/mL; the enzyme solution is subjected to reaction at different temperatures, wherein the reaction for the wild type is performed for 10 h, the reaction for the mutant is performed for 5 h, and the reaction time is determined by the pre-experiment; and the galactooligosaccharide yield is analyzed.
[0053] It can be seen from
EXAMPLE 5
Optimum pH for Producing Galactooligosaccharide by Transforming Lactose by Using Mutant Enzyme
[0054] A 60% (W/V) lactose solution is prepared as a substrate, 60 g of lactose is dissolved in 50 mL of 50 mml/L acetic acid buffers with different pH, and each solution is made up to 100 mL. Certain amounts of the wild enzyme and the double-mutant enzyme solution are added, so that the final enzyme activity of the enzyme solution is 2.5 U/mL. The reaction temperature of the wild type is 60 C., and the reaction temperature of the mutants is determined according to the optimum temperature in the Example 4, ranging from 40 to 60 C. The reaction for the wild type is performed for 10 h, and the reaction for the mutants is performed for 5 h, wherein the reaction time is determined by the pre-experiment; and the galactooligosaccharide yield is analyzed.
[0055] It can be seen from