Antibody or antigen binding fragment thereof for specifically recognizing B cell malignancy, chimeric antigen receptor comprising same and use thereof

Abstract

The present invention relates to a new antibody or an antigen binding fragment thereof for use in the treatment of cancer by targeting a B cell malignancy, a chimeric antigen receptor comprising the same, and a use of the same. The antibody of the present invention is an antibody for specifically binding to CD19 that is highly expressed in cancer cells (particularly, blood cancer), has very low homology to a CDR sequence thereof compared to a CDR sequence of a conventional CD19 target antibody so that the sequence thereof is unique, and specifically binds to an epitope that is different from a FMC63 antibody fragment binding to CD19 of the conventional art. A cell expressing the chimeric antigen receptor comprising an anti-CD19 antibody or the antigen binding fragment of the present invention induces immune cell activity in response to a positive cell line expressing CD19.

Claims

1. An anti-CD19 antibody or an antigen-binding fragment thereof, comprising the following: (i) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 3; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 6; (ii) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 3; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 40; (iii) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 3; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 41; (iv) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 30; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 36, and CDRL3 of SEQ ID NO: 40; (v) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 31; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 40; (vi) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 32; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 37, and CDRL3 of SEQ ID NO: 40; (vii) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 33; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 38, and CDRL3 of SEQ ID NO: 40; (viii) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 34; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 39, and CDRL3 of SEQ ID NO: 40; or (ix) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 35; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 40.

2. The anti-CD19 antibody or the antigen-binding fragment thereof as set forth in claim 1, wherein the heavy chain variable region and the light chain variable region comprises, respectively: (i) the sequences of SEQ ID NOS: 7 and 8; (ii) the sequences of SEQ ID NOS: 42 and 43; (iii) the sequences of SEQ ID NOS: 46 and 47; (iv) the sequences of SEQ ID NOS: 50 and 51; (v) the sequences of SEQ ID NOS: 54 and 55; (vi) the sequences of SEQ ID NOS: 58 and 59; (vii) the sequences of SEQ ID NOS: 62 and 63; (viii) the sequences of SEQ ID NOS: 66 and 67; or (ix) the sequences of SEQ ID NOS: 70 and 71.

3. A CD19-specific chimeric antigen receptor, comprising the following: (a) an extracellular domain comprising an anti-CD19 antibody or an antigen-binding fragment thereof; (b) a transmembrane domain; and (c) an intracellular signaling domain, wherein the anti-CD19 antibody or the antigen-binding fragment thereof comprises: (i) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 3; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 6; (ii) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 3; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 40; (iii) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 3; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 41; (iv) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 30; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 36, and CDRL3 of SEQ ID NO: 40; (v) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 31; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 40; (vi) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 32; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 37, and CDRL3 of SEQ ID NO: 40; (vii) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 33; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 38, and CDRL3 of SEQ ID NO: 40; (viii) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 34; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 39, and CDRL3 of SEQ ID NO: 40; or (ix) a heavy chain variable region comprising the following heavy chain complementarity determining region (CDR) amino acid sequences: CDRH1 of SEQ ID NO: 1, CDRH2 of SEQ ID NO: 2, and CDRH3 of SEQ ID NO: 35; and a light chain variable region comprising the following light chain CDR amino acid sequence: CDRL1 of SEQ ID NO: 4, CDRL2 of SEQ ID NO: 5, and CDRL3 of SEQ ID NO: 40.

4. The CD19-specific chimeric antigen receptor of claim 3, wherein the heavy chain variable region and the light chain variable region comprise, respectively, (i) the sequences of SEQ ID NOS: 7 and 8; (ii) the sequences of SEQ ID NOS: 42 and 43; (iii) the sequences of SEQ ID NOS: 46 and 47; (iv) the sequences of SEQ ID NOS: 50 and 51; (v) the sequences of SEQ ID NOS: 54 and 55; (vi) the sequences of SEQ ID NOS: 58 and 59; (vii) the sequences of SEQ ID NOS: 62 and 63; (viii) the sequences of SEQ ID NOS: 66 and 67; or (ix) the sequences of SEQ ID NOS: 70 and 71.

5. The CD19-specific chimeric antigen receptor of claim 3, wherein the transmembrane domain is a transmembrane domain of a protein selected from the group consisting of alpha, beta, or zeta chain of T-cell receptor, CD27, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD8a, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154.

6. The CD19-specific chimeric antigen receptor of claim 3, wherein the intracellular signaling domain is a CD3ζ (CD3 zeta) chain-derived domain.

7. The CD19-specific chimeric antigen receptor of claim 3, wherein the intracellular signaling domain further comprises a costimulatory molecule selected from the group consisting of OX40 (CD134), CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a/CD18), and 4-1 BB (CD137).

8. A pharmaceutical composition comprising an effector cell expressing the chimeric antigen receptor of claim 3 for treating a CD19 positive cell-associated disease, an autoimmune disease, or an inflammatory disease.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a graph illustrating the binding of CD19_12.18 antibody fragment to CD19-ECD protein as analyzed by ELISA.

(2) FIG. 2 shows histograms of binding affinity of CD19_12.18 antibody fragment for CD19-positve RaJi, RS4; 11 cells and CD19-negative Jurkat cells as measured by flow cytometry.

(3) FIG. 3 is a view illustrating comparison of epitopes between the developed antibody fragment and the FMC63 antibody fragment. For epitope comparison with FMC63, FMC63 and CD19-ECD proteins are immobilized to a sensor chip to which the CD19_12.18 antibody fragment of the present disclosure is then applied.

(4) FIG. 4 is a bar graph showing the identification of an epitope for the developed antibody fragments as measured by flow cytometry. The developed antibody fragments were applied to 293 cells in which mutant CD19 had been expressed through transient transfection, with FMC64 antibody serving as a control.

(5) FIG. 5 is a bar graph identifying the binding of FMC63 and the developed antibody fragments to the epitope reported for FMC63. Epitope identification was conducted with 293 cells in which mutant CD19 had been expressed through transient transfection.

(6) FIG. 6 is a bar graph showing activity of cytotoxic T cells expressing the chimeric antigen receptors conjugated with the antibody fragments of the present disclosure, as measured for secretion levels of interferon gamma.

(7) FIG. 7 is a plot showing cell binding potentials of antibody fragments developed through affinity improvement and humanization. CD19-positive RaJi cells were used for the analysis [unit: MFI (mean fluorescence intensity)].

(8) FIG. 8a is a bar graph showing activity of cytotoxic T cells expressing the chimeric antigen receptors conjugated with the antibody fragments of the present disclosure, as measured for secretion levels of interferon gamma. CD19-positive RaJi-Luc cells and cytotoxic T cells were co-cultured at a ratio of 1:5, followed by measuring levels of interferon gamma in the cell cultures.

(9) FIG. 8b shows cytotoxicity of cytotoxic T cells as measured for luciferase activity of RaJi-Luc cells surviving after co-culture with RaJi-Luc cells and cytotoxic T cells were co-cultured.

(10) FIG. 9 is a view showing configurations of 7 constructs in which the chimeric antigen receptor components hinge region, transmembrane domain, and costimulatory domain were modified to optimize the activity of the developed antibody fragments.

(11) FIG. 10 showing expression of the 7 modified chimeric antigen receptors as analyzed by flow cytometry. CD3 was used as a marker for analyzing the expression of the 7 modified chimeric antigen receptors in cytotoxic T cells.

(12) FIG. 11a is a bar graph showing activity of cytotoxic T cells expressing 7 chimeric antigen receptors as measured for levels of interferon gamma. CD19-positive RaJi cells and CD19-negative Jurkat cells were used as target cells and each co-cultured at a ratio of 1:5 with cytotoxic T cells, followed by measuring levels of interferon gamma.

(13) FIG. 11b is a plot showing activity of cytotoxic T cells as measured for luciferase activity of RaJi-Luc surviving after co-cultivation of RaJi-Luc cells and cytotoxic T cells.

(14) FIG. 12a shows results of the octet test to identify that CD19_1218, CD19_1218.81, CD_19_1218.81.79, and CD_19_1218.82 antibodies bind to epitope sites different from those to which FMC63 binds.

(15) FIG. 12b shows results of competition ELISA using CD19_1218 and CD19_1218.81 antibodies. Relative binding is given when absorbance upon the absence of the competitor (CD19-ECD-Ck alone) is set forth as 100%.

MODE FOR CARRYING OUT THE INVENTION

(16) A better understanding of the present disclosure may be obtained through the following examples which are set forth to illustrate, but are not to be construed as limiting the present disclosure.

EXAMPLES

Example 1: Development of Antibody to CD19

(17) For antibody development, an extracellular domain (ECD) of human CD19 protein was produced using animal cells. A DNA construct in a form where the C-terminal of ECD was conjugated to the hinge and Fc region (CH2-CH3) of human IgG1 (CD19-ECD-Fc) or to His tag (CD19-ECD-His) was cloned into pCEP4 (Invitrogen, Cat. No. V044-50), using the restriction enzymes Hind-III and BamH-I. Subsequently, the transient transfection of the cloned vector into FreeStyle 293F cells (Invitrogen, Cat. No. R790-07) was conducted using polyethyleneimine (Polyscience Inc., Cat. No. 23966), followed by purification from the cell culture with the aid of protein-A Ceramic HyperD F resin (PALL, Cat No. 20078-028) or Ni-NTA Superflow (Qiagen, Cat No. 30410). The purified protein was quantitated using Protein assay dye (Bio-Rad, Cat. No. 500-0006) and subjected to SDS-PAGE, followed by coomassie blue staining to determine concentration and purity. The CD19-ECD-His protein thus obtained was subcutaneously injected to chickens. From the immunized chicken, the spleen and the bursa were excised. Total RNA was extracted from the spleen and the bursa, using TRI reagent (Invitrogen, USA), and used to synthesis cDNA therefrom. A library of antibody fragments was constructed using well-known primers specific for variable regions of immunoglobulin heavy and light chains (see Table 1, Phage display: a laboratory manual, Carlos Barbas III, et al., Cold Spring Harbor Laboratory Press).

(18) TABLE-US-00001 TABLE 1 Primer Used for Construction of Antibody Fragment Library Primer Sense Antisense Primer for heavy 5′GGTCAGTCCTCTAGATCTTCCGG 5′CTGGCCGGCCTGGCC chain variable CGGTGGTGGCAGCTCCGGTGGTGG ACTAGTGGAGGAGACG region CGGTTCCGCCGTGACGTTGGACGA ATGACTTCGGTCC G 3′ (SEQ ID NO: 24) 3′ (SEQ ID NO: 25) Primer for light 5′GTGGCCCAGGCGGCCCTGACTCA 5′GGAAGATCTAGAGGA chain variable GCCGTCCTCGGTGTC 3′ (SEQ ID CTGACCTAGGACGGTC region NO: 26) AGG 3′ (SEQ ID NO: 27) Overlapping PCR 5′GAGGAGGAGGAGGAGGAGGTGG 5′GAGGAGGAGGAGGAG primer CCCAGGCGGCCCTGACTCAG GAGGAGCTGGCCGGCC 3′ (SEQ ID NO: 28) TGGCCACTAGTGGAGG 3′ (SEQ ID NO: 29)

(19) The chicken immune library thus constructed was subjected to phage bio-panning, with the CD19-ECD-Fc serving as an antigen. For use in bio-panning, the antibody library was obtained in a phage library form using VCSM13 helper phages. Up to four panning rounds were performed. For a panning strategy of enriching phages of high affinity, a lower amount of the antigen was used and a larger number of washing was conducted in a higher number of panning. The number of phages captured by the target antigen was tittered using ER2537 E. coli (New England Biolabs, Cat. No. 801-N) as follows. Binder phages obtained in each bio-panning round were eluted with glycine buffer at pH 2.2. The ER2537 E. coli was cultured overnight in SB (super broth) medium and then diluted by 1/200 in fresh SB medium before passage. Subsequently, an additional incubation for 3 hours at 37° C. reached a log phage. In a 1.5-ml tube, 100 μl of fresh ER2537 E. coli and 10 μl of diluted phages were mixed and incubated for 30 min before being spread on ampicillin-containing LB (lysogeny broth) agar plates. After incubation overnight at 37° C., the number of phages was measured by applying the number of colonies thus formed and the dilution factor.

(20) The binder phages obtained in each bio-panning round 2 were infected into ER2537 E. coli. While the bacteria were maintained in the colony form, ELISA was performed to examine binding to the antigen. To this end, first, the colonies obtained following phage infection were inoculated into SB medium and cultured until the OD.sub.600 reached 0.5. Subsequently, the cell culture was incubated at 30° C. in the presence of 0.5 mM IPTG while shaking so as to overexpress the antibody fragment proteins. Antibodies binding specifically to CD19 were selected by ELISA using CD19-ECD-Fc protein and by flow cytometry using Raji cells, which overexpress CD19. Through these methods, selection was made of CD19_12.18 that exhibited the highest binding affinity for human CD19. Amino acid sequences of the variable regions in the selected CD19_12.18 antibody are given in Table 2, below.

(21) TABLE-US-00002 TABLE 2 Amino Acid Sequence of CDR (Complementarity Determining Region) in CD19_12.18 Antibody classi- fication light chain heavy chain CDR1 SGGYSSYYG (SEQ ID NO: 4) SYDMG (SEQ ID NO: 1) CDR2 ESNKRPS (SEQ ID NO: 5) GIDDDGRYTSYGSAVDG (SEQ ID NO: 2) CDR3 GGWDSTHAGI (SEQ ID NO: 6) GNAGWIDA (SEQ ID NO: 3)

(22) In order to quantitatively analyze the affinity of the selected CD19_12.18 antibody, antibody fragments including the variable regions were produced using animal cells. A DNA construct in a form where the C-terminal of ECD was conjugated to the hinge and Fc region (CH2-CH3) of human IgG1 (CD19-ECD-Fc) or to His tag (CD19-ECD-His) was cloned into pCEP4 (Invitrogen, Cat. No. V044-50). Subsequently, the cloned vector was transiently transfected into FreeStyle™ 293F cells (Invitrogen, Cat. No. R790-07). From the cell culture, the antibody in the Fc fusion protein form (Anti-CD19 scFv-Fc) was obtained. ELISA was conducted using CD19-ECD kappa light chain fusion protein (CD19-ECD-Ck) as a coating antigen so as to measure the binding affinity of the selected antibody. The purified antibody fragment (Anti-CD19 scFv-Fc) was applied at various concentrations (50, 12.5, and 3.1 μg/mL) to CD19-ECD protein-coated plates. Following incubation with a secondary antibody (anti-human Fc HRP), color was developed with TMB. OD.sub.450 values were read on an ELISA reader (Victor X3 PerkinElmer) (FIG. 1). As shown in FIG. 1, CD19_12.18 antibody of the present disclosure was identified to bind specifically to CD19-ECD protein.

(23) In addition, CD19_12.18, which binds to CD19-ECD protein was examined for affinity for the CD19 positive cell lines RaJi and RS4; 11 and the CD19 negative cell line Jurkat. The CD19 positive cell lines RaJi and RS4; 11 and the CD19 negative cell line Jurkat were treated with the purified antibody fragment (Anti-CD19 scFv-Fc). The antibody fragments bound to the cell lines were stained with anti-human IgG-FITC. Antibody fragments bound to the cell lines were measured by flow cytometry (FIG. 2). As can be seen in FIG. 2, CD19_12.18 antibody of the present disclosure was identified to be an antibody binding specifically to CD19 positive cells.

Example 2: Comparison of Epitopes Between Developed Antibody Fragment and FMC63

(24) In order to examine whether the developed antibody has an epitope in common with FMC63, which is a mouse-derived CD19 antibody used in a chimeric antigen receptor (CAR) for treatment of B cell malignancy blood cancer, epitope binning was conducted using Octet system (Pall ForteBio). FMC63-Fc was fixed at a concentration of 10 μg/mL to AR2G sensor chip (Fortebio, Cat. No. 18-5092(tray), 18-5093(pack), 18-5094(case)) by an amine coupling method using EDC/NHS. The CD19-ECD kappa light chain fusion (CD19-ECD-Ck) was conjugated at a concentration of 10 μg/mL for 10 min to the FMC63-fixed sensor chip, followed by stabilizing the linkage between FMC63 and CD19-ECD for 5 min. Thereafter, CD19_12.18 antibody of the present disclosure or FMC63 was conjugated at a concentration of 10 μg/mL for 10 min, after which the linkage between the antigen and the antibody was stabilized for 10 min. Following fixation of FMC63, all the antibodies/antigen were diluted using kinetics buffer (Fortebio, cat No. 18-1092). The same buffer was also used for the stabilization step. In the case where the secondarily bound antibody further binds to the FMC63-bound CD19-ECD protein, the antibody can be construed to have no epitopes in common with FMC63. As shown in FIG. 3, FMC63 did not further bind whereas the CD19_12.18 antibody developed by the present inventors was observed to further bind to the FMC63-bound CD19-ECD. Therefore, CD19_12.18 antibody of the present disclosure is different from FMC63 antibody in terms of epitope.

Example 3: Identification of Epitope for the Developed Antibody

(25) In order to identify epitopes therefor, the developed antibody was analyzed for binding to various mutant CD19 proteins constructed, using flow cytometry. In brief, first, the expression of CD19 protein was identified. To this end, the GFP protein-coexpressing bi-cistronic expression system (mutant CD19-T2A-GFP) using T2A system was digested with ClaI/XhoI and ligated to the pLenti6-V5/DEST lentiviral vector (Invitrogen, USA). The constructs thus obtained were analyzed by base sequencing. An examination was made of the binding of the antibody to the CD19 by flow cytometry for the 293 cell line which had undergone transient transfection to express the full-length CD19 protein and then treated with the purified antibody fragment (Anti-CD19 scFv-Fc).

(26) To begin with, the developed antibody was measured for binding affinity for recombinant human CD19 (hCD19, UniProtKB: P15391, SEQ ID NO: 92) and cynomolgus monkey CD19 (cCD19, UniprotKB: G7Q0T7, SEQ ID NO: 93). Like FMC63, the developed antibody was observed to have no cross-reactivity with cCD19 cross-reactivity (FIG. 4). For use in investigating epitopes for the developed antibody, mutant CD19 (mtCD19) proteins were made by substituting amino acids at specific positions with corresponding amino acids in cynomolgus monkey CD19. With respect to 12 amino acid residues different between hCD19 and cCD19 in sites other than already reported epitope sites for FMC63, mutant CD19 proteins having the amino acid residues of cCD19 were developed, followed by analyzing binding affinity therefor. Binding to GFP-positive cells was analyzed on the basis of mean fluorescence intensity (MFI). Of the 12 mutants tested, six residues (T51V, S53C, E55D, L58F, K59E, and K63N) were observed to play an important role in binding between the developed antibody CD19_12.18 and hCD19. Inter alia, the three mutants (L58F, K59E, and K63N) were found to completely suppress the binding of CD19_12.18 to the CD19, revealing the residues as key residues essential for the epitope to which the developed antibody binds (FIG. 4). In contrast, FMC63 was observed to bind intactly to the six mutant hCD19 proteins, indicating that the mutations do not influence the overall structure of hCD19, but alter the epitopic sites to which CD19_12.18 bind.

(27) In addition, examination was made to see whether the antibody CD19_12.18 could bind to a mutant in which a site important for the binding of FMC63 thereto was mutated. In this regard, five mutants which had mutations made at sites important for the binding of FMC63 thereto were constructed (Sommermeyer D et al., Leukemia, 2017, 31(10):2191). As was consistent with the result of the reference document, it was observed that FMC63 exhibited altered binding affinity for only the mutant (H218R/KSS) in which the residue at position 218 was substituted with arginine and serine was inserted at position 224. In contrast, the developed antibody CD19_12.18 was observed to normally bind to the mutant, indicating that the antibody is different in epitope from FMC63 (FIG. 5).

Example 4: Preparation of Lentivirus Including Developed Antibody Fragment-Conjugated Chimeric Antigen Receptor

(28) A chimeric antigen receptor was developed on the basis of the developed antibody CD19_12.18. For the chimeric antigen receptor, codon optimization was made of a CD8 leader, scFv-type CD19_12.18, a hinge and transmembrane domain of CD8, a cytoplasmic domain of CD137, and a cytoplasmic domain of CD3 zeta and the sequence thus optimized was digested with SpeI/XhoI before insertion into pLenti6-V5/DEST lentiviral vector (Invitrogen, USA). The construct thus obtained (SEQ ID NO: 23) was identified by base sequencing.

(29) The prepared lentiviral construct was transduced, together with the plasmid pCMV-dR8.91 carrying viral coat protein VSV-G (vesicular stomatitis indiana virus G protein), gag, pol, and rev genes, into Lenti-X 293T cells (Takara Bio Inc., Japan). Transduction was performed using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's protocol. Seventy-two hours after transduction, a lentivirus containing culture medium was enriched by 10 fold through a centrifugal filter (Millipore, USA).

Example 5: Preparation of T Cell Displaying Developed Antibody Fragment-Bearing Chimeric Antigen Receptor

(30) Cytotoxic T cells on which CD19_12.18 antibody fragment (scFv)-bearing chimeric antigen receptors were displayed were prepared using the lentivirus obtained in Example 3.

(31) First, human naive T cells were isolated and stimulated with Dynabeads™ Human T-Activator CD3/CD28 (Thermofisher scientific, USA) for 24 hours. Thereafter, the lentivius was infected for 24 hours into the cells in the presence of polybrene (Sigma-Aldrich, USA). Then, the medium was exchanged with a medium containing IL-2 (Gibco, USA), followed by incubation at 37° C. in a 5% CO.sub.2 atmosphere.

(32) The T cells presenting the CD19_12.18-bearing chimeric antigen receptor on the surface thereof (CD19_12.18 CAR-T cells) were used in experiments within 24 hours after being prepared.

Example 6: Activity of Cytotoxic T Cell Presenting Developed Antibody Fragment-Bearing Chimeric Antigen Receptor on Surface Thereof

(33) The cytotoxic T cells presenting on the surface thereof the chimeric antigen receptor prepared in Example 4 (CD19_12.18 CAR-T cells) were used to examine whether the activation of the chimeric antigen receptor T cells is induced with the recognition of CD19 on cell surfaces.

(34) Briefly, the CD19-positive cell line RaJi and the CD19-negative cell line Jurkat E6.1 were separately cultured in RPMI-1640 supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. First, the CD19-positive or negative cells were seeded at a density of 3×10.sup.4 cells/well into round-bottom 96-well plates. After removal of the culture supernatant, the prepared chimeric antigen receptor T cells (CD19_12.18 CAR-T cells) were added at a predetermined rate per well and incubated at 37° C. for 24 hours in a 5% CO.sub.2 atmosphere. Interferon gamma secreted to the medium was quantitated using an ELISA kit according to the manufacturer's protocol. The results are shown in FIG. 6. In this regard, a group in which chimeric antigen receptor T cells were added to plates containing target cells (Effector T cell only) and a group in which no chimeric antigen receptor T cells were added to plates containing target cells (Target cell only) were used as controls.

(35) As can be seen in FIG. 6, significant increases in the secretion of interferon gamma were detected in the CD19_12.18 antibody fragment-bearing chimeric antigen receptor T cells of the present disclosure (CD19_12.18 CAR-T cells) and the CD19-positive cells (RaJi). Therefore, when recognizing CD19 on the CD19-positive cells (RaJi), the cytotoxic T cells (CD19_12.18 CAR-T cells) presenting the CD19_12.18 antibody fragment-bearing chimeric antigen receptor of the present disclosure on the surface thereof were induced to be activated.

Example 7: Improvement of Affinity of Developed Antibody Fragment and Development of Humanized Antibody

(36) In order to acquire antibody fragments superior to CD19_12.18 in terms of binding affinity for CD19, heavy chain and light chain libraries were combined to produce new sub libraries. To this end, oligonucleotides having NNK degenerate codons were employed, with 70% or more of the sequence of CD19_12.18 maintained. A nucleic acid sequence coding for the CD19_12.18 antibody fragment was used as a template DNA. Random codons were incorporated into six CDRs by PCR. The antibody fragment amplicons were purified using QIAquick Gel Extraction Kit (QIAGEN, USA). The antibody fragment amplicons were ligated to pComb3XSS vector after both were digested with sfi I. The resulting recombinant vector was transduced into ER2537 to construct phage libraries. Antibodies were selected using the phage libraries in the same manner as in Example 1.

(37) From the selected antibodies, humanized antibodies were developed by CDR grafting. For the human antibody to which the CDR of the developed antibody would be implanted, human germ line V and J genes similar to each other in view of base sequence were selected using IMGT/V-QUEST (Brochet, X. et al., Nucl Acids Res. 36:503-508(2008)). The developed humanized antibodies were produced in Fc tag forms, using FreeStyle™ 293F cells. IGHV3-74*01 and IGHJ5*01 were employed as V and J genes of the heavy chain, respectively. IGLV1-51*02 and IGLJ2*01 were employed as V and J genes of the light chain, respectively. Amino acid sequences of variable regions in heavy and light chains of the developed antibodies are given in Tables 3 and 4.

(38) TABLE-US-00003 TABLE 3 Amino Acid Sequence of Heavy Chain CDR Region of Antibody with Improved Affinity 1.sup.st Heavy 2.sup.nd Heavy 3.sup.Rd Heavy Antibody chain chain chain hzCD19_1218.81 SYDMG GIDDDGRYTSYGSAVDG GNAGWIDA (SEQ ID (SEQ ID NO: 2) (SEQ ID NO: 3) NO: 1) hzCD19_1218.82 SYDMG GIDDDGRYTSYGSAVDG GNAGWIDA (SEQ ID (SEQ ID NO: 2) (SEQ ID NO: 3) NO: 1) hzCD19_1218.81.12 SYDMG GIDDDGRYTSYGSAVDG GNAGWIST (SEQ (SEQ ID (SEQ ID NO: 2) ID NO: 30) NO: 1) hzCD19_1218.81.17 SYDMG GIDDDGRYTSYGSAVDG GNAGWIET (SEQ ID (SEQ ID (SEQ ID NO: 2) NO: 31) NO: 1) hzCD19_1218.81.52 SYDMG GIDDDGRYTSYGSAVDG GNAGWILT (SEQ ID (SEQ ID (SEQ ID NO: 2) NO: 32) NO: 1) hzCD19_1218.81.55 SYDMG GIDDDGRYTSYGSAVDG GNAGWIQN (SEQ (SEQ ID (SEQ ID NO: 2) ID NO: 33) NO: 1) hzCD19_1218.81.64 SYDMG GIDDDGRYTSYGSAVDG GNAGWIQT (SEQ ID (SEQ ID (SEQ ID NO: 2) NO: 34) NO: 1) hzCD19_1218.81.79 SYDMG GIDDDGRYTSYGSAVDG GNAGWIDH (SEQ ID (SEQ ID (SEQ ID NO: 2) NO: 35) NO: 1)

(39) TABLE-US-00004 TABLE 4 Amino Acid Sequence of Light Chain CDR Region of Antibody with Improved Affinity 1.sup.st Light 2.sup.nd Light 3.sup.rd Light Antibody chain chain chain hzCD19_1218.81 SGGYSSYYG ESNKRPS GGLTPTHAGI (SEQ ID (SEQ ID (SEQ ID NO: 5) NO: 40) NO: 4) hzCD19_1218.82 SGGYSSYYG ESNKRPS GQSTRTHAGI (SEQ ID (SEQ ID (SEQ ID NO: 5) NO: 41) NO: 4) hzCD19_1218.81.12 SGGYSSYYG ESDKRPA (SEQ ID NO: GGLTPTHAGI (SEQ ID 36) (SEQ ID NO: 40) NO: 4) hzCD19_1218.81.17 SGGYSSYYG ESNKRPS (SEQ ID  GGLTPTHAGI (SEQ ID NO: 5) (SEQ ID NO: 40) NO: 4) hzCD19_1218.81.52 SGGYSSYYG ETDKRPQ (SEQ ID NO: GGLTPTHAGI (SEQ ID 37) (SEQ ID NO: 40) NO: 4) hzCD19_1218.81.55 SGGYSSYYG ESGKRPA (SEQ ID NO: GGLTPTHAGI (SEQ ID 38) (SEQ ID NO: 40) NO: 4) hzCD19_1218.81.64 SGGYSSYYG ESQKRPL (SEQ ID NO: GGLTPTHAGI (SEQ ID 39) (SEQ ID NO: 40) NO: 4) hzCD19_1218.81.79 SGGYSSYYG ESNKRPS (SEQ ID  GGLTPTHAGI (SEQ ID NO: 5) (SEQ ID NO: 40) NO: 4)

(40) Following affinity improvement and humanization, the selected antibodies were assayed for binding affinity for the CD19-positive cell line RaJi. The CD19-positive cell line RaJi was incubated with various concentrations of purified antibody fragments, followed by staining with anti-human IgG-FITC. The antibody-bound RaJi cells were counted by flow cytometry (FIG. 7) and binding affinity was assayed by Graphpad Prism (Table 5). Through the assay, antibodies having higher binding potential than CD19_12.18 were secured.

(41) TABLE-US-00005 TABLE 5 Binding Potential of Affinity-Improved Antibody to RaJi Cell (EC.sub.50) Antibody EC.sub.50 (μg) CD19_12.18 0.213 hzCD19_1218.81 0.032 hzCD19_1218.82 0.078 hzCD19_1218.81.12 0.034 hzCD19_1218.81.17 0.038 hzCD19_1218.81.52 0.038 hzCD19_1218.81.55 0.059 hzCD19_1218.81.64 0.033 hzCD19_1218.81.79 0.030

Example 8: Preparation of Lentivirus Comprising Chimeric Antigen Receptor Conjugated with Affinity-Improved and Humanized Antibody Fragment

(42) Of the developed antibodies, three variants (hzCD19_1218.81, hzCD19_1218.82, and hzCD19_1218.81.79) different in affinity were used to develop chimeric antigen receptors. Fora chimeric antigen receptor, codon optimization was made of a CD8 leader, an scFv-type antibody, a hinge and transmembrane domain of CD8, a cytoplasmic domain of CD137, and a cytoplasmic domain of CD3 zeta by using GeneOptimizer (Invitrogen) algorithm. The optimized sequences were digested with SpeI/PacI and ligated to pLenti6.3/V5-TOPO lentiviral vector (Invitrogen, USA) in which the promotor had been modified into EF-1 alpha. The constructs thus obtained were identified by base sequencing.

(43) Each of the prepared lentiviral constructs was transduced, together with the plasmid pCMV-dR8.91 carrying viral coat protein VSV-G (vesicular stomatitis indiana virus G protein), gag, pol, and rev genes, into Lenti-X 293T cells (Takara Bio Inc., Japan). Transduction was performed using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's protocol. The cell culture containing lentivirus were enriched with Lenti-X concentrator (Takara Bio Inc., Japan) and stored.

Example 9: Preparation and Activity of Cytotoxic T Cell Presenting on Surface Thereof Chimeric Antigen Receptor Conjugated with Affinity-Improved and Humanized Antibody Fragment

(44) Cytotoxic T cells presenting the CD19_12.18 antibody fragment (scFv)-bearing chimeric antigen receptor on the surface thereof were prepared using the lentivirus obtained in Example 8 in the same manner as in Example 5. The cytotoxic T cells presenting the chimeric antigen receptor on the surface thereof were used to examine whether the activation of the chimeric antigen receptor T cells is induced with the recognition of CD19 on cell surfaces.

(45) Briefly, GFP-luciferase-expressing lentivirus was transduced into CD19-positive RaJi cells to construct RaJi-Luc cells which were then used in experiments. First, RaJi-Luc cells were seeded at a density of 3×10.sup.4 cells/well into round-bottom 96-well plates. To the RaJi-Luc cells (T)-seeded plates, the prepared cytotoxic T cells (E) were added at a predetermined treatment rate per well (T:E=1:2, 1:5, or 1:10), followed by incubation at 37° C. for 24 hours in a 5% CO.sub.2 atmosphere. Thereafter, interferon gamma secreted to the medium was quantitated using an ELISA kit according to the manufacturer's protocol. Toxicity of cytotoxic T cells was identified through luciferase measurement (Bio-Glo Luciferase assay system, Promega, USA).

(46) As can be seen in FIG. 8a, significant increases in the secretion of interferon gamma were detected in the experimental group treated with cytotoxic T cells (E) containing the antibody fragment of the present disclosure and the RaJi-Luc cells (T). After the cytotoxic T cells and RaJi-Luc cells were incubated together, luciferase was eluted by lysing the residual RaJi-Luc cells with 3× lysis buffer (75 mM Tris(pH 8.0), 30% glycerol, 3% Triton X100) and reacted with a substrate to examine the cytotoxic effect of the chimeric antigen receptor bearing the antibody fragment of the present disclosure. Percentages of lysis were determined relative to the signal detected in the well where only Raji-Luc cells were cultured. The chimeric antigen receptor T cells having the antibody fragment of the present disclosure increased in cytotoxicity with increasing of the treatment rate. Higher cytotoxic effects were detected in cytotoxic T cells having antibody fragments better in affinity than CD19_12.18 (FIG. 8b).

Example 10: Development of Chimeric Antigen Receptor Through Modification of Hinge Region, Transmembrane Domain, and Costimulatory Domain

(47) In order to optimize the activity of chimeric antigen receptors employing the developed antibody fragments, new chimeric antigen receptors (CAR2 to CAR7) were developed by modifying the constituents of chimeric antigen receptors, that is, hinge regions (CD8, CD28, and Fc), transmembrane domains (CD8, CD28, and ICOS), and costimulatory domains (CD137, CD28, ICOS, and CD3). As an antibody fragment binding to CD19 antigen, hzCD19_1218.81 was employed to identify activity (FIG. 9). For the chimeric antigen receptor in each of CAR1 to CAR7, digestion and ligation to pLenti6.3/V5-TOPO lentiviral vector (Invitrogen, USA) in which the promotor had been modified into EF-1 alpha were conducted in the same manner as in Example 8. The constructs thus obtained were identified by base sequencing. Amino acid and nucleotide sequences of the constructs of CAR1 to CAR7 are set forth as SEQ ID NOS: 74 to 87 in the appended sequence listing. Each of the developed constructs was used to prepare and enrich lentivirus according to the protocol of Example 8.

(48) The developed chimeric antigen receptors were analyzed for activity. In this regard, cytotoxic T cells were prepared in the same manner as in Example 4 and examined to see whether or not the activity of CD19-expressing cells was specifically induced.

(49) First, the obtained cytotoxic T cells were examined for CAR expression behavior. The expression of the chimeric antigen receptor was observed with the secondary antibody anti-human IgG FITC (Invitrogen, A11013) following primary binding of CD19-ECD. In this context, in order to examine whether the detected cells would be T cells or not, anti-human CD3 PE (Biolegend, 317308) was allowed to simultaneously participate in the binding, followed by flow cytometry. As a result of the assay, it was observed that the constructs (CAR2, CAR3) in which hinge region change occurred from CD8 to CD28 or Fc greatly decreased in CAR expression, compared to a construct employing a conventional CD8 hinge. In addition, the constructs in which the transmembrane domain and the costimulatory domain were changed were observed to decrease in CAR expression, compared to the case employing ICOS transmembrane domain and costimulatory domain (CAR5) (FIG. 10).

(50) The developed cytotoxic T cells were examined for activity in the same manner as in Example 8. CD19 positive RaJi-Luc cells and CD19 negative Jurkat cells were incubated, together with cytotoxic T cells, for 24 hours, and the cell cultures were measured for interferon gamma level and cytotoxicity. As shown in FIG. 11a, an increased level of interferon gamma was detected only in the group in which CD19 positive RaJi-Luc and cytotoxic T cells were co-cultured. Furthermore, construct CAR1, which showed the best expression among the CAR constructs used in the test, induced the highest interferon gamma secretion. Unlike interferon gamma secretion, cytotoxic effects were almost evenly high in all of the constructs CAR1, CAR4, CAR5, CARE (FIG. 11b).

Example 11: Analysis of Epitope for CD19_1218 and Affinity-Improved Antibody

(51) To analyze whether the CD19_1218 antibody and the affinity-improved and humanized antibodies therefrom developed in the present disclosure had an epitope in common with each other, epitope binning and competition ELISA were conducted. As described in Example 2, CD19-ECD protein was bound to FMC63 antibody-immobilized sensor chip to which FMC63, CD19_1218, hzCD19_1218.81, hzCD19_1218.81.79, and hzCD19_1218.82 antibodies were then further applied (FIG. 12a). FMC63 did not further bind to the chip whereas the four antibodies including CD19_1218 did. For competition ELISA, an ELISA plate was coated with CD19_1218.81-Fc antibody at a concentration of 2 μg/mL to which CD19-ECD-Ck (3 μg/mL) was added alone or in combination with CD19_1218-Fc antibody (300 μg/mL). Subsequently, the CD19_1218.81-Fc-bound CD19-ECD-Ck protein was quantitated using an anti-Ck-HRP antibody. The presence of CD19_1218 antibody suppressed the binding of CD19_1218.81-Fc to CD19-ECD-Ck protein (FIG. 12b). Taken together, the data obtained above demonstrate that the developed antibodies have an epitope in common with CD19_1218 antibody.

(52) This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted herewith as the sequence listing text file. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e).