Adenovirus armed with bispecific T cell activator

20240175052 ยท 2024-05-30

    Inventors

    Cpc classification

    International classification

    Abstract

    An adenovirus comprising a sequence of formula (I): 5ITR-B.sub.1-B.sub.A-B.sub.2-B.sub.X-B.sub.B-B.sub.Y-B.sub.3-3ITR (I) wherein B.sub.Y comprises a transgene cassette containing four transgenes, said genes encoding a FAP-Bispecific T cell activator, CXCL10, CXCL9, and IFN. The disclosure also extends to pharmaceutical composition comprising the virus, and use of the virus or formulation in treatment

    Claims

    1-20. (canceled)

    21. An adenovirus comprising a sequence of formula (I):
    5ITR-B.sub.1-B.sub.A-B.sub.2-B.sub.X-B.sub.B-B.sub.Y-B.sub.3-3ITR (I) wherein: B.sub.1 is a bond or comprises: E1A, E1B or E1A-E1B; B.sub.A comprises: E2B-L1-L2-L3-E2A-L4; B.sub.2 is a bond or comprises: E3; B.sub.X is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both; B.sub.B comprises: L5; B.sub.Y comprises: a transgene encoding a FAP-Bispecific T cell activator comprising: a) an anti-FAP binding domain comprising a VH domain comprising the sequence set forth in SEQ ID NO: 11 or a sequence at least 95% identical thereto, and/or a VL domain comprising the sequence set forth in SEQ ID NO: 10 or a sequence at least 95% identical thereto, and b) an anti-CD3 binding domain; and B.sub.3 is a bond or comprises: E4.

    22. The adenovirus of claim 21, wherein the anti-FAP binding domain and/or the anti-CD3 binding domain comprises a single chain variable fragment (scFv).

    23. The adenovirus of claim 21, wherein the anti-FAP binding domain comprises the sequence set forth in SEQ ID NO: 9 or a sequence at least 95% identical thereto.

    24. The adenovirus of claim 21, wherein the anti-CD3 binding domain is selective for CD3?, CD3? or CD3?.

    25. The adenovirus of claim 21, wherein the anti-CD3 binding domain is selective for CD3?.

    26. The adenovirus of claim 21, wherein the anti-CD3 binding domain comprises: a VH domain comprising a sequence selected from: the sequence set forth in positions 277-395 of SEQ ID NO: 75, the sequence set forth in SEQ ID NO: 6, and a sequence at least 95% identical to any one thereof; and/or a VL domain comprising a sequence selected from: the sequence set forth in positions 411-517 of SEQ ID NO: 75, the sequence set forth in SEQ ID NO: 7, and a sequence at least 95% identical to any one thereof.

    27. The adenovirus of claim 21, wherein the anti-CD3 binding domain comprises a sequence selected from: the sequence set forth in positions 277-517 of SEQ ID NO: 75, the sequence set forth in SEQ ID NO: 5, and a sequence at least 95% identical to any one thereof.

    28. The adenovirus of claim 21, wherein the FAP-Bispecific T cell activator comprises a sequence selected from SEQ ID NO: 75, SEQ ID NO: 76, and a sequence at least 95% identical to any one thereof.

    29. The adenovirus of claim 21, wherein the transgene encoding the FAP-Bispecific T cell activator comprises the sequence set forth in SEQ ID NO: 34 or a sequence at least 85% identical thereto.

    30. The adenovirus of claim 21, wherein B.sub.Y further comprises one or more additional transgenes.

    31. The adenovirus of claim 30, wherein the one or more additional transgenes are selected from Flt3L, MIP1?, IFN?, CXCL10, and CXCL9.

    32. The adenovirus of claim 31, wherein: a) Flt3L comprises the sequence set forth in SEQ ID NO: 96 or a sequence at least 95% identical thereto; b) MIP1? comprises the sequence set forth in SEQ ID NO: 97 or a sequence at least 95% identical thereto; c) IFN? comprises the sequence set forth in SEQ ID NO: 98 or a sequence at least 95% identical thereto; d) CXCL10 comprises the sequence set forth in SEQ ID NO: 100 or a sequence at least 95% identical thereto; and/or e) CXCL9 comprises the sequence set forth in SEQ ID NO: 99 or a sequence at least 95% identical thereto.

    33. The adenovirus of claim 30, wherein the one or more additional transgenes are selected from IFN?, CXCL10, and CXCL9.

    34. The adenovirus of claim 30, wherein the transgene encoding the FAP-Bispecific T cell activator and the one or more additional transgenes are operably linked.

    35. The adenovirus of claim 34, wherein the transgenes are separated by high efficiency self-cleavage peptides.

    36. The adenovirus of claim 35, wherein the self-cleavage peptides are selected from E2A, F2A, P2A and T2A.

    37. The adenovirus of claim 21, wherein the adenovirus is replication competent; the adenovirus is oncolytic; and/or the adenovirus has a hexon and fibre from Ad11.

    38. A composition comprising the adenovirus of claim 21 and a pharmaceutically acceptable carrier.

    39. A method of treatment comprising administering an effective amount of the adenovirus of claim 21 to a subject in need thereof.

    40. The method of claim 39, wherein the subject has cancer.

    Description

    DESCRIPTION OF THE FIGURES

    [0278] FIG. 1 Shows schematics of the NG-615, NG-640 and NG-641 transgene cassettes

    [0279] FIGS. 2A-2C: Virus genome replication in lung, breast and bladder carcinoma cell lines.

    [0280] A549 (2A), MDA-MB-453 (2B) and RT4 (2C) cell lines were treated with NG-617, NG-615, NG-640, NG-641 or enadenotucirev virus particles for up to 7 days. The amount of virus genome detected by qPCR was assessed at days 2, 3, 4 and 7 post treatment.

    [0281] FIGS. 3A-3B: Virus mediated oncolysis of lung carcinoma cells. A549 cells were treated with NG-617, NG-615, NG-640, NG-641 or enadenotucirev virus particles for up to 4 days. Cell viability was assessed throughout the culture using an xCelligence system (3A). The time at which 50% killing was observed (KT50) was determined for each virus treatment (3B).

    [0282] FIG. 4: NG-615 transgene expression in lung and bladder carcinoma cells. A549 (left panels) and RT4 cells (right panels) were treated with NG-615 or enadenotucirev virus particles or left uninfected for up to 7 days. The secretion of the Flt3 Ligand (A), MIP1? (B) and IFN? (C) was assessed in the cellular supernatants by ELISA. No transgene expression was detected in enadenotucirev treated or untreated control cells (data not shown).

    [0283] FIG. 5: NG-641 transgene expression in lung and bladder carcinoma cells. A549 (left panels) and RT4 cells (right panels) were treated with NG-641 or enadenotucirev virus particles or left uninfected for up to 7 days. The secretion of the CXCL9 (A), CXCL10 (B) or IFN? (C) was assessed in the cellular supernatants by ELISA. No transgene expression was detected in enadenotucirev treated or untreated control cells (data not shown)

    [0284] FIGS. 6A-6B: Expression of functional transgenes in lung carcinoma cells. A549 cells were treated with NG-615, NG-641 or enadenotucirev virus particles for up to 4 days. At day 4 post-treatment the level of functional IFN? (6A) or MIP1? (6B) transgenes being produced was assessed using cell-based reporter assays.

    [0285] FIG. 7: Expression of functional FAP-Bispecific T cell activator in lung carcinoma cells. A549 cells were treated with NG-615, NG-641 or enadenotucirev virus particles for up to 4 days. At days 2 (A), 3 (B) and 4 (C) post-treatment the expression level of functional FAP-Bispecific T cell activator in the cell supernatants was assessed by measuring activation of a Jurkat T cell line co-cultured with FAP expressing fibroblast cell line, MRC-5.

    [0286] FIG. 8A: Transgene encoded IFN? in supernatant from NG-641 infected A549 cells induces SEAP production by Jurkat Dual reporter cells. Jurkat-Dual reporter cells were treated with supernatant from an A549 cancer cell line either uninfected (UIC) or infected with enadenotucirev (EnAd) or NG-641 and the level of the secreted embryonic alkaline phosphatase (SEAP) reporter measured.

    [0287] FIG. 8B: Transgene encoded CXCL9/10 in supernatant from NG-641 infected A549 cells activates the GPCR pathway in PathHunter ?-Arrestin cells. PathHunter ?-Arrestin cells were treated with supernatant from an A549 cancer cell line either uninfected (UIC) or infected with enadenotucirev (EnAd) or NG-641 and CXCL9/10 specific induction of the G-protein coupled receptor (GPCR) pathway detected via luminescence.

    [0288] FIG. 9: Transgene encoded CXCL9/10 in supernatant from NG-641 infected A549 cells induces the downregulation of CXCR3 on the surface of activated T cells. Anti-CD3/CD28 activated human T cells were treated with supernatant from an A549 cancer cell line either uninfected (UIC) or infected with enadenotucirev (EnAd) or NG-641 and transgene CXCL9/10 induced downregulation of CXCR3 was measured by flow cytometry.

    [0289] FIGS. 10A-10B: Activation of endogenous tumour infiltrating T-cells in ex vivo cultures of primary human tumour samples inoculated with EnAd, NG-615, NG-617, NG-640 or NG-641, anti-CD3/28 or left uninfected (UIC) Levels of the virus transgene products IFNa and Flt3L are shown in 10A and levels of IFN?, TNF?, IL-17A, granzyme B and IL-13 are shown in 10B.

    [0290] FIGS. 11A-11D: Activation of surface marker expression and intracellular cytokines in endogenous tumour infiltrating T-cells in ex vivo cultures of a primary NSCLC tumour sample treated with EnAd, NG-617, NG-640 or NG-641 or left uninfected (UIC). Levels of CD4 and CD8 T-cells expressing CD25, CD69 and CD107a are shown in 11A & 11B, respectively. Levels of intracellular IFN? and TNF? expressed by CD4 and CD8 T-cells are shown in 11C & 11D, respectively.

    [0291] FIG. 12 Schematic representation of a Bispecific T cell activator antibody of the present disclosure comprising or lacking an optional decahistidine affinity tag. Ig SP: signal peptide; 10His: decahistidine affinity tag; L: GS linker; V.sub.L: variable light domain; V.sub.H variable heavy domain.

    [0292] FIG. 13 (A) dot blot showing the quantification of the recombinant Bispecific T cell activators. (B) shows a graph showing the ELISA results for FAP.

    [0293] FIGS. 14A-14C shows a graph showing the expression levels of CD69 (14A) and CD25 (14B) for T cells co-cultured alone or with NHDF cells in the presence of FAP Bispecific T cell activator and control Bispecific T cell activator measured using flow cytometry. (14C) graph shows the levels of IFN? expression for T cells co-cultured alone or with NHDF cells in the presence of FAP Bispecific T cell activator and control Bispecific T cell activator measured by intracellular cytokine staining

    [0294] FIG. 15 (A) graph showing the results of a LDH assay showing the cytoxicity of NHDF cells which have been co-cultured with T cells and FAP Bispecific T cell activator or control Bispecific T cell activator. (B) graph showing the results of a LDH assay showing the cytoxicity of BTC100 cells which have been co-cultured with T cells and FAP Bispecific T cell activator or control Bispecific T cell activator. (C) Images of NHDF cells after co-culture with T cells and FAP Bispecific T cell activator vs control Bispecific T cell activator.

    [0295] FIG. 16 Is a graph showing the % of cells expressing EpCAM and FAP across multiple cells and cell lines.

    [0296] FIGS. 17A-17C (17A) graph showing the NHDF dose response for FAP Bispecific T cell activator with increasing Bispecific T cell activator concentration. Graph (17B) & (17C) showing the results of a LDH assay showing the cytoxicity of DLD cells which have been co-cultured with T cells and EpCAM Bispecific T cell activator or control Bispecific T cell activator.

    [0297] FIGS. 18A-18B (18A) graph showing FAP expression in CHO cells determined by FAP or isotope control antibody and analysed by flow cytometry. (18B) shows a graph showing the results of a LDH assay showing the cytoxicity of CHO or CHO-FAP cells which have been co-cultured with T cells and FAP Bispecific T cell activator or control Bispecific T cell activator.

    [0298] FIG. 19 shows graphs showing T-cell activation (based on CD69 and CD25 expression levels) by CHO vs CHO-FAP cells, analysed using flow cytometry.

    [0299] FIG. 20 (A) graph showing the ability of FAP Bispecific T cell activator to activate CD4+ or CD8+ T-cells (based on CD69 and CD25 expression levels), analysed using flow cytometry. (B) graph showing the results of a LDH assay showing the cytoxicity of NHDF cells which have been co-cultured with CD4+ or CD8+ T cells and FAP Bispecific T cell activator or control Bispecific T cell activator.

    [0300] FIG. 21 (A) graph showing the number of CD3+ T cells from ascites cultured with control or FAP Bispecific T cell activator. (B) graph showing the CD25 expression levels of T cells from ascites cultured with control or FAP Bispecific T cell activator. (C) graph showing the number of FAP+ cells from ascites cultured with control or FAP Bispecific T cell activator.

    [0301] FIG. 22 (A) graph showing the quantification of the number of detected virus genomes per cell for NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 and EnAd. (B) graphs showing the oncolytic activity of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 or EnAd assessed by infection of A549 cells.

    [0302] FIGS. 23A-23B (23A) graphs showing T-cell activation (based on CD69 and CD25 expression levels) by NG-601, NG-602, NG-605 and NG-606 when co-cultured with CHO-FAP, analysed using flow cytometry. (23B) graphs showing T-cell activation (based on CD69 and CD25 expression levels) by NG-601, NG-602, NG-605 and NG-606 when co-cultured with CHO-EpCAM, analysed using flow cytometry.

    [0303] FIG. 24 shows graphs showing the results of experiments to determine the quantity of FAP Bispecific T cell activator produced from NG-605 and NG-606.

    [0304] FIG. 25 shows microscopy images of Ad293 cells infected with NG-607, NG-608, NG-609 and NG-610.

    [0305] FIGS. 26A-26B (26A) graph indicating the ability of NG-603, NG-604, NG-605, NG-606 and EnAd to kill NHDF cells, analysed using XCELLigence. (26B) graph indicating the ability of NG-603, NG-604, NG-605, NG-606 and EnAd to kill NHDF cells, analysed using an LDH assay.

    [0306] FIG. 27 shows graphs showing T-cell activation (based on CD69 and CD25 expression levels) by NG-603, NG-604, NG-605, NG-606 co-cultured with NHDF cells, SKOV and T cells, analysed using flow cytometry.

    [0307] FIG. 28 (A) graph showing T-cell activation (based on CD69 and CD25 expression levels) by NG-603, NG-604, NG-605, NG-606 co-cultured with NHDF and SKOV cells vs. SKOV alone, analysed using flow cytometry. (B) graph indicating the cytotoxicity of NHDF cells infected with NG-605 and NG-606, analysed using an LDH assay

    [0308] FIG. 29 shows still frame images from timelapse videos of lysis of NHDF cells by recombinant FAP Bispecific T cell activator, EnAd, NG-603 or NG-605.

    [0309] FIG. 30 shows still frame images from timelapse videos of lysis of NHDF cells by NG-607, NG-608, NG-609 or NG-610.

    [0310] FIG. 31 shows a graph indicating the cytotoxicity of DLD cells infected with EnAd, NG-601, NG-602, NG-603 and NG-604 in the presence of T cells or absence of T cells, analysed using an LDH assay.

    [0311] FIG. 32 (A) graph indicating the expression levels of CD25 on CD3+ T cells in ascites samples which were infected with viruses of the present disclosure. (B) graph indicating the number of FAP+ cells in ascites samples which were infected with viruses of the present disclosure.

    [0312] FIG. 33 shows a graph indicating the number of CD3+ T cells in ascites samples obtained from a cancer patient and infected with viruses of the present disclosure.

    [0313] FIG. 34 shows graphs indicating the CD25 expression levels on CD3+ T cells in ascites samples obtained from a cancer patient and infected with viruses of the present disclosure.

    [0314] FIG. 35 shows graphs indicating the number of FAP+ cells in ascites samples obtained from a cancer patient and infected with viruses of the present disclosure.

    [0315] FIG. 36 shows a comparison of activation of T-cell cytokine production by recombinant FAP Bispecific T cell activator protein in the presence of human fibroblasts and by polyclonal activation with anti-CD3/CD28 beads. (A) IFN? levels measured by ELISA. (B) Cytokine levels measured by cytokine bead array.

    [0316] FIG. 37 FAP-targeted Bispecific T cell activator induces T-cell degranulation and specific cytotoxicity of FAP+ cells

    [0317] (A) Degranulation of T-cells in culture with NHDF cells (5:1) and (B) Bispecific T cell activator-containing supernatants. Degranulation was assessed by externalisation of CD107a following 6 h culture with a CD 107a-specific antibody and measured by flow cytometry. CD3/CD28 Dynabeads were used as a positive control. (C) Cytotoxicity of NHDF cells after 24 h in co-culture with T-cells (1:5) and 10-fold serial dilutions of Bispecific T cell activator-containing supernantants. Cytotoxicity was assessed by release of LDH into culture supernatants. (D) Lysis of NHDF by LDH release (left) and CD25 induction on T-cells (right) was assessed after 24 h co-culture with PBMC-derived T-cells (1:5) from six healthy donors and Bispecific T cell activator-containing supernatants.

    [0318] FIG. 38 EnAd expressing FAP Bispecific T cell activator selectively kills FAP.sup.+ fibroblasts and decreases TGFb in peritoneal ascites samples

    [0319] (A, B) Number of of FAP.sup.+ fibroblasts (A) and EpCAM.sup.+ tumour cells (B) after 72 h culture with PBMC-derived T-cells and EnAd or recombinant viruses. Ascites cells were first isolated from three patients ascites and expanded ex vivo. Cell number was measured at 72 h post-infection by flow cytometry. (C) Induction of activation marker CD25 on PBMC-derived CD3 cells from (A) was measured at 72 h post-infection. (D) Levels of TGFb were measured by ELISA using supernatants harvested from (A).

    [0320] FIG. 39 shows the activation of endogenous tumor associated T-cells and associated killing of FAP+ cells in patient malignant ascites biopsy samples by FAP Bispecific T cell activator protein and EnAd-FAP Bispecific T cell activator viruses. (A) T cell activation measured by CD25 expression. (B) residual number of FAP+ cells measured by flow cytometry.

    [0321] FIG. 40 Effect of PD-L1 blocking antibodies on Bispecific T cell activator-mediated T cell activation in patient sample

    [0322] (A) Expression of PD1 by endogenous T cells and PD-L1 on FAP+ cells following their initial isolation from peritoneal ascites was assessed by flow cytometry. (B) Unpurified total cells from peritoneal ascites were incubated in 50% fluid from the same exudate in the presence of free Bispecific T cell activator, EnAd or recombinant virus, with or without anti-PD-L1 blocking antibody. After 2 days, the total cell population was harvested, and the number of CD25+ T-cells was quantified by flow cytometry. (C) Quantity of interferon gamma in culture supernatants from (B, D) measured by ELISA. (D) The number of residual FAP+ cells in (B) was measured using flow cytometry.

    [0323] FIG. 41 EnAd expressing Bispecific T cell activators activate and redirect T-cells from patient biopsy samples to lyse NHDF fibroblasts

    [0324] (A) The expression of PD-1 by endogenous T cells following isolation from healthy donors or malignant exudate cancer biopsy samples. PD-1 expression was measured by flow cytometry. (B) The proportion of CD3.sup.+ cells within the unpurified cell population of PBMC and cancer biopsy samples as measured by flow cytometry. (C) Levels of interferon gamma measured by ELISA in culture supernatants harvested from (B) at 120 h post-treatment. (D) Viability of NHDF fibroblasts were monitored in real time over 130 h by xCELLigence cytotoxicity assay in co-culture with PBMC or total cancer biopsy cells (1:5) and Bispecific T cell activator-containing supernatant.

    [0325] FIG. 42 shows the effect of immunosuppressive ascites fluid samples on FAP Bispecific T cell activator- and anti-CD3/CD28 bead-mediated activation of PBMC T-cells. (A) PBMC T cells activated with anti-CD3/Cd28 Dynabeads. (B) PBMC T cells activated with control or FAP Bispecific T cell activators in the presence of NHDF cells. NS: normal serum, A: peritoneal ascites.

    [0326] FIG. 43 FAP Bispecific T cell activator expressing EnAd polarises CD11b.sup.+ macrophage in patient ascites to a more inflammatory phenotype

    [0327] (A) Unpurified total cells from ascites sample were incubated in 50% ascites fluid in the presence of free Bispecific T cell activator or Bispecific T cell activator expressing virus. Interferon gamma treatment was used as a positive control. After 3 days, the total cell population was harvested and the induction of activation marker CD25 on CD3.sup.+ cells was measured by flow cytometry. (B) Levels of interferon gamma in culture supernatants from (A) were measured by ELISA. (C) At 3 days, the expression levels of CD68, CD86, CD206 and CD163 on CD11b+ cells from (A) were measured by flow cytometry. Representative flow cytometry spectra from triplicates is shown alongside the complete data set.

    [0328] FIG. 44 Characterisation of architecture and cellular composition of solid prostate tumour

    [0329] (A) EpCAM staining, (B) CD8 staining, (C) FAP staining. (D) Representative immunohistochemistry images of CD25 induction within prostate tumour slices following treatment with Bispecific T cell activator expressing viruses. Tumour cores were sliced at 300 uM thickness with a Leica vibratome, cultured and infected in inserts and harvested after 7 days treatment. (E) Levels of IFNg in tissue slice culture medium measured by ELISA. Supernatants were harvested from slices cultures of malignant and benign tissue at the specified time-point. (F) Levels of IL-2 in tissue culture medium of malignant and benign tissue measured by ELISA.

    [0330] FIG. 45 shows a schematic representation of the transgene cassette.

    [0331] FIG. 46 shows a graph indicating the number of viral genomes detected per cell in NG-611, NG-612 and NG-617 treated tumour cells.

    [0332] FIG. 47 shows the percentage of T cells expressing CD69 (a), CD25 (b) HLA-DR (c), CD40L (d) or cell surface CD107a (e) following co-culture with EpCam expressing SKOV cells and supernantants harvested from A549 cells at 24, 48 or 72 hrs post-treatment with NG-611 viurs particles compared to NG-612, enadenotucirev or untreated control supernatants.

    [0333] FIG. 48 shows the percentage of T cells expressing CD69 (a), CD25 (b) HLA-DR (c), CD40L (d) or cell surface CD107a (e) following co-culture with FAP expressing MRC-5 cells and supernatants harvested from A549 cells at 24, 48, or 72 hrs post-treatment with NG-612 virus particles compared to NG-611, enadenotucirev or untreated control supernatants.

    [0334] FIG. 49 shows the percentage of MRC-5 cells that express EpCAM and FAP

    [0335] FIGS. 50A-50B shows IFN? expression in the supernatants of T cell co-cultures with SKOV cells (50A) or MRC-5 cells (50B) incubated with supernatants harvested from A549 cells at 24, 48 or 72 hrs post-treatment with NG-611, NG-612 or enadenotucirev virus particles, or untreated control supernatants.

    [0336] FIG. 51 shows anti-tumour efficacy and immune activation of Bispecific T cell activator expressing viruses in vivo. (a) tumour volume in mice treated with saline, enadenotucirev or NG-611. (b) Ratio of CD8 to CD4 T cells in NG-611 treated tumours compared to enadenotucirev treated or untreated controls.

    [0337] FIG. 52 shows a graph indicating the number of viral genomes detected per cell in NG-612 and NG-615 treated tumour cells

    [0338] FIG. 53 shows the expression of IFN?, MIP1? and Flt3 L in the cellular supernatant of NG-615 vs the supernatant of enadenotucirev and untreated control tumour cells.

    [0339] FIG. 54 shows the number of T cells expressing CD69 (a), CD25 (b) HLA-DR (c), CD40L (d) or cell surface CD107a (e)) following co-culture with FAP expressing MRC-5 cells and supernantants harvested from A549 cells at 24, 48 or 72 hrs post-treatment with NG-615 viurs particles compared to NG-612, enadenotucirev or untreated control supernatants.

    [0340] FIG. 55 shows IFN? expression in the supernatants of T cell co-cultures with MRC-5 cells incubated with supernatants harvested from A549 cells at 24, 48 or 72 hrs post-treatment with NG-612, NG-615 or enadenotucirev virus particles, or untreated control supernatants.

    SEQUENCES

    [0341] SEQ ID NO: 1 Anti-FAP Bispecific T cell activator DNA coding sequence, with N-terminal signal sequence and C-terminal deca-His affinity tag [0342] SEQ ID NO: 2 Anti-FAP Bispecific T cell activator amino acid sequence, with N-terminal signal sequence and C-terminal deca-His affinity tag [0343] SEQ ID NO: 3: Control (Anti-FHA) Bispecific T cell activator DNA coding sequence, with N-terminal signal sequence and C-terminal deca-His affinity tag [0344] SEQ ID NO: 4: Control (Anti-FHA) Bispecific T cell activator amino acid sequence with N-terminal signal sequence and C-terminal deca-His affinity tag [0345] SEQ ID NO: 5: Anti-CD3 ScFv amino acid sequence [0346] SEQ ID NO: 6: Anti-CD3 VH [0347] SEQ ID NO: 7: Anti-CD3 VL [0348] SEQ ID NO: 8: Anti-CD3 ScFv linker sequence [0349] SEQ ID NO: 9: Anti-FAP ScFv [0350] SEQ ID NO: 10: Anti-FAP VL domain [0351] SEQ ID NO: 11: Anti-FAP VH domain [0352] SEQ ID NO: 12: Anti-FAP and Anti-EpCAM linker sequence [0353] SEQ ID NO: 13: Bispecific T cell activator leader sequence [0354] SEQ ID NO: 14: Control Bispecific T cell activator (Anti-FHA) [0355] SEQ ID NO: 15: Control (Anti-FHA) ScFv [0356] SEQ ID NO: 16: Control (Anti-FHA) VL [0357] SEQ ID NO: 17: Control (Anti-FHA) VH [0358] SEQ ID NO: 18: Control (Anti-FHA) ScFv linker sequence [0359] SEQ ID NO: 19: Deca-His Tag sequence [0360] SEQ ID NO: 20: FAP Bispecific T cell activator-P2A-RFP (ITALICS=leader, BOLD=furin cleavage site, UNDERLINE=P2A sequence, lower case=RFP) [0361] SEQ ID NO: 21: Control (Anti-FHA) Bispecific T cell activator-P2A-RFP (ITALICS=leader, BOLD=furin cleavage site, UNDERLINE=P2A sequence, lower case=RFP) [0362] SEQ ID NO: 22: Human FAP DNA coding sequence [0363] SEQ ID NO: 23: Human FAP amino acid sequence [0364] SEQ ID NO: 24: CMV promoter sequence [0365] SEQ ID NO: 25: SV40 late polyadenylation sequence [0366] SEQ ID NO: 26: NG-605 (EnAd-CMV-FAP Bispecific T cell activator) [0367] SEQ ID NO: 27: NG-606 (EnAd-SA-FAP Bispecific T cell activator) [0368] SEQ ID NO: 28 EnAd genome [0369] SEQ ID NO: 29 B.sub.X DNA sequence corresponding to and including bp 28166-28366 of the EnAd genome [0370] SEQ ID NO: 30 B.sub.Y DNA sequence corresponding to and including bp 29345-29379 of the EnAd genome [0371] SEQ ID NO: 31 HIS-Tag [0372] SEQ ID NO: 32 Splice acceptor sequence. [0373] SEQ ID NO: 33 SV40 poly Adenylation sequence [0374] SEQ ID NO: 34 FAP Bispecific T cell activator nucleic acid sequence (OKT3) [0375] SEQ ID NO: 35 FAP Bispecific T cell activator nucleic acid sequence (aCD3) [0376] SEQ ID NO: 36 NG-611 Transgene cassette [0377] SEQ ID NO: 37 NG-612 Transgene cassette [0378] SEQ ID NO: 38 NG-613 Transgene cassette [0379] SEQ ID NO: 39 Restriction site insert (B.sub.X) [0380] SEQ ID NO: 40 Restriction site insert (B.sub.Y) [0381] SEQ ID NO: 41 CMV promoter sequence [0382] SEQ ID NO: 42 PGK promoter sequence [0383] SEQ ID NO: 43 CBA promoter sequence [0384] SEQ ID NO: 44 short splice acceptor (SSA) DNA sequence [0385] SEQ ID NO: 45 splice acceptor (SA) DNA sequence [0386] SEQ ID NO: 46 branched splice acceptor (bSA) DNA sequence [0387] SEQ ID NO: 47 Kozak sequence (null sequence) [0388] SEQ ID NO: 48 Example of start codon [0389] SEQ ID NO: 49 Internal Ribosome Entry Sequence (IRES) [0390] SEQ ID NO: 50 P2A peptide [0391] SEQ ID NO: 51 F2A peptide [0392] SEQ ID NO: 52 E2A peptide [0393] SEQ ID NO: 53 T2A peptide [0394] SEQ ID NO: 54 polyadenylation (polyA) sequence [0395] SEQ ID NO: 55 Leader sequence [0396] SEQ ID NO: 56 Leader sequence [0397] SEQ ID NO: 57 IFN? amino acid sequence [0398] SEQ ID NO: 58 IFN? amino acid sequence [0399] SEQ ID NO: 59 TNF? amino acid sequence [0400] SEQ ID NO: 60 DNA sequence corresponding to E2B region of the EnAd genome (bp 10355-5068) [0401] SEQ ID NO: 61: Anti-FAP Bispecific T cell activator DNA coding sequence, with N-terminal signal sequence without C-terminal deca-His affinity tag [0402] SEQ ID NO: 62: Anti-FAP Bispecific T cell activator amino acid sequence, with N-terminal signal sequence without C-terminal deca-His affinity tag [0403] SEQ ID NO: 63: Control (Anti-FHA) Bispecific T cell activator DNA coding sequence, with N-terminal signal sequence without C-terminal deca-His affinity tag [0404] SEQ ID NO: 64: Control (Anti-FHA) Bispecific T cell activator amino acid sequence with N-terminal signal sequence without C-terminal deca-His affinity tag [0405] SEQ ID NO: 65: Control Bispecific T cell activator (Anti-FHA) without C-terminal deca-His affinity tag [0406] Q ID NO: 66: NG-605 (EnAd-CMV-FAP Bispecific T cell activator) without deca-His affinity tag [0407] SEQ ID NO: 67: NG-606 (EnAd-SA-FAP Bispecific T cell activator) without deca-His affinity tag [0408] SEQ ID NO: 68: FAP Bispecific T cell activator nucleic acid sequence (OKT3) [0409] SEQ ID NO: 69: FAP Bispecific T cell activator nucleic acid sequence (aCD3) [0410] SEQ ID NO: 70: NG-611 Transgene cassette [0411] SEQ ID NO: 71: NG-612 Transgene cassette [0412] SEQ ID NO: 72: NG-613 Transgene cassette [0413] SEQ ID NO: 73: NG-614 Transgene cassette [0414] SEQ ID NO: 74: NG-617 Transgene cassette [0415] SEQ ID NO: 75: FAP Bispecific T cell activator amino acid sequence (OKT3) [0416] SEQ ID NO: 76: FAP Bispecific T cell activator amino acid sequence (aCD3) [0417] SEQ ID NO: 77: NG-611 Genome [0418] SEQ ID NO: 78: NG-612 Genome [0419] SEQ ID NO: 79: NG-613 Genome [0420] SEQ ID NO: 80: NG-614 Genome [0421] SEQ ID NO: 81: NG-617 Genome [0422] SEQ ID NO: 82: NG-615 Genome [0423] SEQ ID NO: 83: NG-640 Genome [0424] SEQ ID NO: 84: NG-641 Genome [0425] SEQ ID NO: 85: Null sequence [0426] SEQ ID NO: 86: Flt3L nucleic acid sequence [0427] SEQ ID NO: 87: Null sequence [0428] SEQ ID NO: 88: MIP1? nucleic acid sequence [0429] SEQ ID NO: 89: Flexible linker sequence [0430] SEQ ID NO: 90: IFN? nucleic acid sequence [0431] SEQ ID NO: 91: CXCL10 nucleic acid sequence [0432] SEQ ID NO: 92: CXCL9 nucleic acid sequence [0433] SEQ ID NO: 93: NG-615 Transgene cassette [0434] SEQ ID NO: 94: NG-640 Transgene cassette [0435] SEQ ID NO: 95: NG-641 Transgene cassette [0436] SEQ ID NO: 96: FLT3L amino acid sequence [0437] SEQ ID NO: 97: MIP1? amino acid sequence [0438] SEQ ID NO: 98: IFN? amino acid sequence [0439] SEQ ID NO: 99: CXCL9 amino acid sequence [0440] SEQ ID NO: 100: CXCL10 amino acid sequence [0441] SEQ ID NO: 101: NG-618 Genome [0442] SEQ ID NO: 102: NG-618 FAP Bispecific T cell activator nucleic acid sequence [0443] SEQ ID NO: 103: NG-618 Transgene cassette [0444] SEQ ID NO: 104 to 277 are linker sequences [0445] SEQ ID NO: 278 NG-616 Genome [0446] SEQ ID NO: 279 to 281 are primers

    EXAMPLES

    Example 1

    [0447] Recombinant Bispecific T cell activators were designed and proteins produced as described in this example.

    1.1 Bispecific T Cell Activator Engineering

    [0448] Bispecific T cell activators are generated by joining two single chain antibody fragments (ScFv) of different specificities with a flexible Gly.sub.4Ser linker. ScFv's are created by the joining of V.sub.H and V.sub.L domains from parental monoclonal antibodies by a linker. Each Bispecific T cell activator was designed with an N-terminal signal sequence for mammalian secretion and a C-terminal decahistidine affinity tag for detection and purification. Bispecific T cell activators were engineered by standard DNA cloning techniques and inserted into protein expression vectors (FIG. 1).

    [0449] The anti-FAP Bispecific T cell activator was created de novo using the anti-FAP ScFv from patent WO2010037835A2 and the anti-CD3 ScFv from patent WO 2005040220 (SEQ ID 63 therein), with a signal sequence and affinity tag added.

    [0450] A control Bispecific T cell activator used the anti-FHA (filamentous haemagglutinin from Bordetella pertussis) ScFv from Hussein et al, 2007 (Hussein A H et al (2007) Construction and characterization of single-chain variable fragment antibodies directed against the Bordetella pertussis surface adhesins filamentous hemagglutinin and pertactin. Infect Immunity 75, 5476-5482) and the anti-CD3 ScFv from patent WO 2005040220 (SEQ ID NO: 63 therein), with a signal sequence and affinity tag added.

    1.2 Recombinant Bispecific T Cell Activator Production

    [0451] Recombinant Bispecific T cell activator proteins were produced by cloning the respective sequences into the pSF-CMV vector using a CMV promoter (SEQ ID NO: 24) to drive protein expression (FIG. 1). The concentration of plasmid DNA for plasmids, pSF-CMV-FAP Bispecific T cell activator and pSF-CMV-ControlBispecific T cell activator (Table 2), were measured via NanoDrop. Empty pSF-CMV vector is included as a negative control. 54.7 ?g of each was diluted with 4 mL OptiMEM. 109.2 ug PEI (linear, MW 25000, Polysciences, USA) were diluted in 4 mL OptiMEM medium and mixed with the 4 ml of diluted DNA to generate DNA-PEI complexes (DNA:PEI ratio of 1:2 (w/w)). After incubation at room temperature for 20 minutes, the complex mixture was topped up to 18 mL with OptiMEM and this transfection mixture was added to a T175 flask containing Ad293 cells at 90% confluency. After incubation of the cells with the transfection mix for 4 hrs at 37? C., 5% CO.sub.2, 30 mL of cell media (DMEM high glucose with glutamine supplemented, phenol red-free) was added to the cells and the flasks was incubated 37? C., 5% CO.sub.2 for 48 hours. Another flask of cells was transfected in parallel with pSF-CMV-GFP to ensure efficient transfection efficiency. In order to harvest secreted protein, the supernatant of transfected cells was collected and centrifuged at 350 g at 4? C. for 5 minutes to remove cell components (Allegra X-15R, Beckman Coulter). Supernatants were transferred to 10 k MWCO Amicon Ultra-15 Centrifugal Filter Units (Millipore). After spinning at 4750 rpm and 4? C., the volume of the retentate was adjusted with the flow through to obtain a 50-fold higher concentration. Aliquots of concentrated protein were stored at ?80? C.

    TABLE-US-00002 TABLE 2 p employed as a prefix in naming constructs indicates that the construct is a plasmid. Plasmid ID [plasmid DNA] ng/ml pSF-CMV-FAP Bispecific T cell activator 6700 pSF-CMV-Control Bispecific T cell activator 5300 pSF-Lenti-FAP 659.6

    1.3 Production of Viruses Expressing FAP-Bispecific T Cell Activators in Combination With Immunomodulatory Proteins

    [0452] Three viruses (NG-640, NG-641 and NG-615) were generated encoding a FAP targeting Bispecific T cell activator molecule and 2 or 3 immunomodulatory proteins (Table 1). NG-640 encodes three transgene proteins, the FAP-Bispecific T cell activator molecule and chemokines CXCL9 and CXCL10. NG-641 and NG-615 both encode four transgene proteins. NG-641 encodes the FAP-Bispecific T cell activator, chemokines CXCL9 and CXCL10 and the cytokine IFN? and NG-615 encodes the FAP-Bispecific T cell activator, the chemokine MIP1? and the cytokines FLT3 Ligand and IFN?. A virus was also generated encoding just the FAP-Bispecific T cell activator molecule (NG-617)

    TABLE-US-00003 TABLE 1 Virus ID Transgene Cassette NG-615 (SEQ ID NO: 1) SSA.sup.1-FAP Bispecific T cell activator.sup.2-E2A.sup.3-Flt3L.sup.4-P2A.sup.5-MIP1?.sup.6-T2A.sup.7-IFN?.sup.8-PA.sup.9 NG-640 (SEQ ID NO: 2) SSA.sup.1-FAP Bispecific T cell activator.sup.2-P2A.sup.5-CXCL10.sup.10-T2A.sup.7-CXCL9.sup.11-PA.sup.9 NG-641 (SEQ ID NO: 3) SSA.sup.1-FAP Bispecific T cell activator.sup.2-P2A.sup.5-CXCL10.sup.10-T2A.sup.7-CXCL9.sup.11-E2A.sup.3-IFN?.sup.8-PA.sup.9 NG-617 (SEQ ID NO: 4) SSA.sup.1-FAP Bispecific T cell activator.sup.2-PA.sup.9

    [0453] In each transgene cassette, the cDNA encoding the Bispecific T cell activator and other immune modulatory proteins was flanked at the 5 end with a short splice acceptor sequence (SSA, CAGG) and at the 3 end with a SV40 late poly(A) sequence (PA, SEQUENCE ID NO: 25). cDNA sequences for each transgene were separated using 2A high efficiency self-cleavable peptide sequences (P2A, T2A, E2A, SEQUENCE ID NO: 50, 53 and 52).

    Virus Production

    [0454] The plasmid pEnAd2.4 was used to generate the plasmids pNG-615, pNG-640 and pNG-641 by direct insertion of synthesised transgene cassettes (SEQ ID NOs: 93, 94 and 95, respectively). NG-615 contains four transgenes encoding for a FAP-targeting Bispecific T cell activator (SEQ ID NO: 102), Flt3L (SEQ ID NO. 86), MIP1? (SEQ ID NO. 88) and IFN? (SEQ ID NO. 90). NG-640 and NG-641 encode for a FAP targeting Bispecific T cell activator (SEQ ID NO. 102), CXCL9 (SEQ ID NO. 92) and CXCL10 (SEQ ID NO. 91), NG-641 also contains a fourth transgene encoding IFN? (SEQ ID NO. 90). Schematics of the transgene cassettes are shown in FIG. 1. Construction of plasmid DNA was confirmed by restriction analysis and DNA sequencing.

    [0455] The plasmids, pNG-615, pNG-640 and pNG-641, were linearized by restriction digest with the enzyme AscI to produce the virus genomes. The viruses were amplified and purified according to the methods given below.

    [0456] Digested DNA was purified by phenol/chloroform extraction and precipitated for 16 hrs, ?20? C. in 300 ?l>95% molecular biology grade ethanol and 10 ?l 3M Sodium Acetate. The precipitated DNA was pelleted by centrifuging at 14000 rpm, 5 mins and was washed in 500 ?l 70% ethanol, before centrifuging again, 14000 rpm, 5 mins. The clean DNA pellet was air dried, resuspended in 500 ?l OptiMEM containing 15 ?l lipofectamine transfection reagent and incubated for 30 mins, RT. The transfection mixture was then added drop wise to a T-25 flask containing 293 cells grown to 70% confluency. After incubation of the cells with the transfection mix for 2 hrs at 37? C., 5% CO.sub.2 4 mls of cell media (DMEM high glucose with glutamine supplemented with 2% FBS) was added to the cells and the flasks was incubated 37? C., 5% CO.sub.2.

    [0457] The transfected 293 cells were monitored every 24 hrs and were supplemented with additional media every 48-72 hrs. The production of virus was monitored by observation of a significant cytopathic effect (CPE) in the cell monolayer. Once extensive CPE was observed the virus was harvested from 293 cells by three freeze-thaw cycles. The harvested viruses were used to re-infect 293 cells in order to amplify the virus stocks. Viable virus production during amplification was confirmed by observation of significant CPE in the cell monolayer. Once CPE was observed the virus was harvested from 293 cells by three freeze-thaw cycles. The amplified stocks of viruses were used for further amplification before the viruses were purified by double caesium chloride banding to produce purified virus stocks.

    Example 2: Analysis of Virus Replication and Oncolytic Activity

    Virus Replication

    [0458] Lung (A549), breast (MDA-MB-453) or bladder (RT4) carcinoma cell lines inoculated for 72 hrs with 1 ppc NG-615, NG-640, NG-641, NG-617, enadenotucirev (EnAd) or left uninfected were used for quantification of viral DNA by qPCR. Cell supernatants were collected and clarified by centrifuging for 5 mins, 1200 rpm. 50 ?L of supernatant was used for DNA analysis.

    [0459] DNA was extracted from the supernatant sample using the Qiagen DNeasy kit, according to the manufacturer's protocol. A standard curve using EnAd virus particles (2.5e10-2.5e5vp) was also prepared and extracted using the DNeasy kit. Each extracted sample or standard was analysed by qPCR using a virus gene specific primer-probe set to the early gene E3. Quantification of the number of detected virus genomes per cell demonstrated viral replication in A549, MDA-MB-453 and RT4 for all viruses tested (NG-617, NG-615, NG-640 and NG-641) (FIGS. 2A-2C). Viral replication was similar for all viruses and was equivalent to that of the parental EnAd virus. No virus genomes could be detected in uninfected cells.

    Oncolytic Activity

    [0460] Lung (A549) carcinoma cells inoculated with 100 ppc NG-615, NG-640, NG-641, NG-617, EnAd or left uninfected were monitored using a xCELLigence Real Time Cell Analyzer (RTCA). Cell proliferation was monitored every 60 minutes for up to 96 hours. Oncolysis of the cells was assessed by calculating the Killing Time 50 (KT50) which is the time point when 50% lysis is reached (FIGS. 3A-3B). These data showed an equivalent KT50 across all viruses tested including the parental EnAd virus. No oncolytic effect was observed on untreated cells.

    [0461] Collectively these data indicate that inclusion of a Bispecific T cell activator and either two or three immunomodulatory transgenes does not significantly impact the replicative or oncolytic activity of the EnAd virus.

    Example 3: Analysis of Virus Mediated Transgene Expression Recombinant Bispecific T Cell Activator Detection

    [0462] To detect the Bispecific T cell activator, the C-terminal decahistidine affinity tag can be probed with an anti-His antibody using the technique of western blotting. Protein samples were adjusted with lysis buffer to a final volume of 15 ?L including 2.5 ?L 6? Laemmli SDS Sample Buffer which contains ?-mercaptoethanol and SDS. Samples were incubated for 5 minutes at 95? C. to denature proteins and loaded onto 15-well 10% precast polyacrylamide gels (Mini-PROTEAN TGX Precast Gels, BioRad, UK). Gels were run at 180 V for 45 minutes in 1? running buffer within a Mini-PROTEAN Tetra System (BioRad, UK). Proteins from the SDS gels were transferred onto nitrocellulose membranes by wet electroblotting at 300 mA and 4? C. for 90 minutes in 1? transfer buffer within a Mini Trans-Blot Cell (BioRad, UK). Transfer was performed in presence of an ice pack to limit heat. The nitrocellulose membrane was then blocked with 5% milk in PBS-T on a shaker for 1 hour at room temperature, and probed with anti-His (C-term) antibody (mouse ?-6?His, clone 3D5, Invitrogen, UK, #46-0693), diluted 1:5000 in PBS/5% milk. After incubation on a shaker overnight at 4? C., the membrane was washed and probed with HRP-labelled polyclonal secondary ?-mouse-immunoglobulin-antibody (1:10.000 in PBS/5% milk, Dako, #P0161) for 1 hour at room temperature. For visualization, SuperSignal West Dura Extended Duration Substrate (Thermo Fisher Scientific, UK) was applied, following manufacturer's instructions and exposed to X-ray film and developed in an automatic film processor. The results demonstrated the expression and secretion of Bispecific T cell activator protein from Ad293 cells transfected with the Bispecific T cell activator expression plasmids, but not the parental vector.

    Recombinant Bispecific T Cell Activator Quantification

    [0463] To measure the quantity of recombinant Bispecific T cell activator protein, the technique of dot blot was used to compare the Bispecific T cell activator signal to a His-tagged (C-term 10His) protein standard (10?His-tagged human Cathepsin D, Biolegend, #556704). Two-fold serial dilutions of Bispecific T cell activator samples and protein standard were prepared, and 1.5 uL of each directly applied to a nitrocellulose membrane and air-dried for 20 minutes. The blocking and staining protocol described above for western blotting was then performed. The molar concentration of the protein standard was adjusted to represent a Bispecific T cell activator concentration of 250 ?g/mL. The results (FIG. 13, panel A) demonstrated the expression and secretion of Bispecific T cell activator protein from Ad293 cells transfected with the Bispecific T cell activator expression plasmids.

    FAP Binding ELISA

    [0464] The FAP-binding activity of the FAP Bispecific T cell activator and control (anti-FHA) Bispecific T cell activator (SEQ ID NOs: 2 and 4) secreted from cells transfected with pSF-CMV-FAP Bispecific T cell activator or pSF-CMV-Control Bispecific T cell activator was assessed by enzyme-linked immunosorbent assay (ELISA). Empty pSF-CMV vector supernatants were included as a negative control. ELISA plates (Nunc Immuno MaxiSorp 96 well microplate) were prepared by coating overnight at 4? C. with human FAP/seprase protein (100 ng/well, Sino Biological Inc, 10464-H07H-10) in PBS buffer. Plates were washed between all subsequent binding steps with PBS 0.05% Tween 20. The plates were blocked for 1 hour at room temperature with 5% BSA in PBS 0.05% Tween 20. Aliquots of Bispecific T cell activator protein, or protein harvested from empty pSF-CMV vector-transfected wells, were diluted 10-fold into PBS/5% BSA/0.05% Tween 20. All samples were added to the FAP coated plates and incubated for 2 hr at room temperature. The detection antibody, anti-His (C-term) antibody (mouse anti-6?His, clone 3D5, Invitrogen, UK, #46-0693), was diluted 1:1000 and applied for 1 hour at room temperature. HRP conjugated anti-mouse-Fc (1:1000 in PBS/5% milk, Dako) was then applied for 1 hr at room temperature before HRP detection was performed with HRP substrate solution 3.3.5.5-teramethylethylenediamine (TMB, Thermo-Fisher). Stop solution was used for terminating the reaction and the developed colour was measured at 450 nm on a plate reader. Absorbance at 450 nm was plotted for FAP Bispecific T cell activator, control Bispecific T cell activator and empty vector supernatants, demonstrating specific binding of the FAP Bispecific T cell activator to FAP protein. The results (FIG. 13, panel B) show the specific binding of the FAP Bispecific T cell activator and not control Bispecific T cell activator to recombinant FAP protein.

    Transgene Expression Assessed by ELISA

    [0465] Expression of the chemokine or cytokine transgenes, IFN?, MIP1?, FLT3L, CXCL10 and CXCL9 were assessed using ELISAs. A549 and RT4 carcinoma cell lines were inoculated with 1 ppc NG-615, NG-640, NG-641, NG-617, EnAd or left uninfected for up to 7 days. At 4 days and 7 days post inoculation cellular supernatants were clarified and assessed for transgene expression by ELISA.

    [0466] IFN? ELISA was carried out using the Verikine Human IFN alpha Kit (Pbl assay science), MIP1? ELISA was carried out using the Human CCL3 Quantikine ELISA kit (R & D systems), Flt3L ELISA was carried out using the Flt3L human ELISA kit (Abcam), CXCL9 ELISA was carried out using the CXCL9 human ELISA kit (Abcam) and CXCL10 ELISA was carried out using the CXCL10 human ELISA kit (Abcam). All assays were carried out according to the manufacturers' protocol.

    [0467] The concentrations of secreted IFN?, MIP?, FLt3L, CXCL9 and CXCL10 were determined by interpolating from the standard curves. IFN?, MIP1? and Flt3L expression could be detected in the cellular supernatant of NG-615 treated cells, IFN?, CXCL9 and CXCL10 could be detected in supernatants of NG-641 treated cells and CXCL9 and CXCL10 could be detected in the supernatants of NG-640 treated cells (FIGS. 4 and 5). No chemokine or cytokine transgene expression was detected in EnAd treated or untreated control cells.

    Functional Transgene Expression Assessed by Cell-Based Reporter Assay

    [0468] The expression of functional FAP-Bispecific T cell activator and IFN? transgenes were assessed in assays using a Jurkat-Dual reporter cell line (Invivogen). This is a human immortalized T lymphocyte cell line (Jurkat) transformed by the stable integration of two inducible reporter constructs. One of the inducible reporter constructs enables IFN-? activation of the interferon regulatory factor (IRF) pathway to be studied through the secretion and activity of secreted embryonic alkaline phosphatase (SEAP, while the second is an NF-KB responsive secreted luciferase reporter that is active by signalling through the T-cell receptor. Activity of SEAP is proportional to the level of IFN-? present in the supernatant and can be measured by detecting the SEAP induced degradation of the substrate Quanti-Blue?. The expression of functional MIP1? was assessed using a CCR5 reporter cell line (CHO-K1 CCR5 ?-arrestin, Invivogen). A549 carcinoma cell lines were inoculated with 1 ppc NG-615, NG-640, NG-641, NG-617, EnAd or left uninfected. At 2, 3, or 4 days post-inoculation cellular supernatants were collected and clarified for analysis.

    [0469] To assess IFN? function 20 ?L of each supernatant, diluted 1:10, 1:50 or 1:250 in culture media, was added to Jurkat Dual cells (2?10.sup.5 cells/well) and incubated for 16-20 hours. The supernatants were then harvested from the plates and treated with 200 ?L Quanti-Blue? reagent for 1 hour. The plates were analysed using a microplate reader measuring absorbance (Abs) at 640 nm. Responses demonstrating the presence of functional IFN? could be detected in supernatants from NG-615 and NG-641 treated carcinoma cells but not NG-640, NG-617, EnAd treated or uninfected controls (FIG. 6A). The level of functional IFN? detected was at similar levels in NG-615 and NG-641 treated supernatants.

    [0470] To assess MIP1? function CCR5 reporter cells were seeded (5?10.sup.3 cells/well) and incubated for 20-24 hours. 5 ?L of supernatant from the treated tumour cells was then added to each well and incubated for 90 minutes. Luciferase reporter activity was then detected using a detection solution and quantification on a luminescence plate reader. Responses demonstrating the presence of functional MIP1? were detected in supernatants from NG-615 treated carcinoma cells and supernatants from cells treated with a positive control virus known to express MIP1?, NG-347 (FIG. 6B).

    [0471] To assess FAP-Bispecific T cell activator function MRC-5 lung fibroblast cells (which express FAP on their cell membrane) were seeded (2?10.sup.4 cells/well) and incubated for 4 hours to allow cells to adhere to the plates. Jurkat-Dual cells (2?10.sup.5 cells/well) were then added to the wells along with 20 ?L of supernatant from the treated tumour cells. The plates were incubated for 16-20 hours. Supernatants were then harvested and treated with 50 ?L Quanti-Luc reagent before immediately reading the plates on a plate reader to detect luciferase activity. Responses demonstrating the presence of functional FAP-Bispecific T cell activator were detected in the supernatants of NG-617, NG-615, NG-640 and NG-641 treated carcinoma cells but not EnAd treated or untreated control supernatants (FIG. 7). Surprisingly, given the similar levels of IFN? produced by NG-615 and NG-641, supernatants from NG-615 treated cells had significantly lower levels of functional FAP-Bispecific T cell activator expression when compared to all other Bispecific T cell activator expressing viruses tested, including the other virus containing 4 transgenes, NG-641.

    Example 2

    [0472] The functional activities of recombinant Bispecific T cell activator proteins were assessed in a number of different assays prior to constructing Bispecific T cell activator transgene-bearing EnAd viruses.

    Isolation of Human Peripheral Blood Mononuclear Cells (PBMCs)

    [0473] Human PBMCs were isolated by density gradient centrifugation either from fresh human blood samples of healthy donors or from whole blood leukocyte cones, obtained from the NHS Blood and Transplant UK in Oxford. In either case, the samples were diluted 1:2 with PBS and 25 mL of this mixture was layered onto 13 mL Ficoll (1.079 g/mL, Ficoll-Paque Plus, GE Healthcare) in a 50 mL Falcon tube. Samples were centrifuged (Allegra X-15R, Beckman Coulter) at 1600 rpm for 30 minutes at 22? C. with the lowest deceleration setting to preserve phase separation. After centrifugation, 4 layers could be observed which included a plasma layer at the top, followed by an interface containing PBMCs, a Ficoll layer and a layer of red blood cells and granulocytes at the bottom. The PBMCs were collected using a Pasteur pipette and washed twice with PBS (1200 rpm for 10 minutes at room temperature) and re-suspended in RPMI medium supplemented with 10% FBS.

    Isolation of CD3-Positive T-Cells

    [0474] CD3-positive (CD3.sup.+) T-cells were extracted from PBMCs by depletion of non-CD3 cells using a Pan T Cell Isolation Kit (Miltenyi Biotec, #130-096-535), according to the manufacturer's protocol.

    Processing Primary Ascites Samples

    [0475] Primary human ascites samples were received from the oncology ward of the Churchill Hospital (Oxford University Hospitals) from patients with multiple indications, including but not limited to ovarian, pancreatic, breast and gastric cancer. Upon receipt, cellular and fluid fractions were separated, with aliquots of fluid frozen at ?20? C. for storage and future analysis. The cellular fraction was treated with red blood cell lysis buffer (Roche, #11814389001) to remove red blood cells, following the manufacturer's instructions. Cell types present in each sample was determined by staining for EpCAM, EGFR, FAP, CD45, CD11b, CD56, CD3, CD4, CD8, PD1 and CTLA4 and analysed by flow cytometry. Cells were then used fresh for ex vivo T-cell activation and target cell lysis experiments. In some cases, the cells were passaged in DMEM supplemented with 10% FBS for use in later experiments.

    Cell Line Maintenance

    [0476] All cell lines were maintained in DMEM (Sigma-Aldrich, UK) or RPMI medium (Sigma-Aldrich, UK) as specified in Table 3, supplemented with 10% (v/v) foetal bovine serum (FBS, Gibco?) and 1% (v/v) Penicillin/Streptomycin (10 mg/mL, Sigma-Aldrich, UK), in a humidified incubator (MCO-17AIC, Sanyo) at 37? C. and 5% CO.sub.2, unless otherwise specified. Cells were split every 2 to 3 days before reaching confluency by enzymatic dissociation with Trypsin/EDTA (0.05% trypsin 0.02% EDTA, Sigma-Aldrich, UK). In this process, culture medium was aspirated and cells were washed with 15 ml of PBS and subsequently cells were treated with 2 mL of Trypsin/EDTA for 2-10 minutes at 37? C. Trypsin was neutralized with 10 mL of DMEM containing 10% FBS and a portion of the cells was transferred into new flasks containing fresh medium. For routine cell culture, media was supplemented with 10% FBS, for infections and virus plasmid transfections with 2% FBS and for recombinant Bispecific T cell activator plasmid transfections with no FBS supplement.

    TABLE-US-00004 TABLE 3 Culturing Cell line Origin of cells Media Source Ascites-derived cell Human primary ascites DMEM NHS Blood & lines Transplant UK BTC100 Human primary lung cancer- DMEM University of associated fibroblasts (CAF) Oxford CHO-K1 Chinese hamster ovary, RPMI ATCC adherent CHO-K1 stable cell Chinese hamster ovary, RPMI lines adherent DLD1 Human colorectal RPMI ATCC adenocarcinoma HEK 293A Human embryonic kidney, DMEM ATCC adherent HEK 293A stable cell Human embryonic kidney, DMEM lines adherent HEK 293T Human embryonic kidney, DMEM ATCC adherent MCF-7 Human, mammary gland, breast, DMEM ATCC adherent Normal human Normal adult human primary DMEM ATCC dermal fibroblasts dermal fibroblasts (NHDF) SKOV3 Human ovarian DMEM ATCC adenocarcinoma

    Statistics

    [0477] In cases where two conditions were being compared, statistical analyses were performed using a t-test. In all other cases, statistical analyses were performed by using a One-way ANOVA.

    Characterisation of Human T-Cell Activation by Recombinant FAP Bispecific T Cell Activator

    [0478] The ability of the FAP Bispecific T cell activator to induce T-cell activation in the presence or absence of normal human dermal fibroblast (NHDF) cells was compared. Human CD3.sup.+ T-cells (70,000 cells per well in 96-well U-bottom plates) were co-cultured alone or with NHDF cells (10:1 T:NHDF) in the presence of media alone or 300 ng/mL FAP or control Bispecific T cell activator. Cells were co-cultured for 24 hours at 37? C. and subsequently harvested with enzyme-free cell dissociation buffer (Thermo, #13151014). The expression levels of CD69 (FIG. 14A) and CD25 (FIG. 14B) on CD45.sup.+ T-cells were then analysed by antibody staining and flow cytometry and represented as geometric mean fluorescence (gMFI) values. Plate-immobilised anti-CD3 antibody (7.5 ?g/mL) was used as positive control for T cell activation. The FAP Bispecific T cell activator selectively induced the expression of activation markers CD69 and CD25 on T-cells, indicating that it was able to activate T cells.

    [0479] In a second similar experiment, T-cells were assessed by intracellular cytokine staining 6 hr after co-culture with NHDF cells (200,000 CD3.sup.+ cells plus 40,000 NHDF in wells of a 96-well plate) and 300 ng/mL FAP or control Bispecific T cell activator. CD45.sup.+ T-cells were intracellularly stained for IFN? expression with Brefeldin A added into the culture medium 5 hours before harvest. As a positive control, T-cells were stimulated with soluble PMA (10 ng/ml) and ionomycin (1 ?g/mL). The results shown in FIG. 14C indicate that the FAP Bispecific T cell activator in the presence of NHDF resulted in a significantly higher number of IFN? expressing T-cells compared to the control Bispecific T cell activator.

    Example 4

    [0480] To further evaluate the functionality of the IFN? produced from the transgene in NG-641, Jurkat-Dual? cells were treated with supernatants from A549 tumor cells either uninfected or infected with 10 particles per cell (ppc) of enadenotucirev (EnAd) or NG-641 for 3 days. To demonstrate the secretion of SEAP was IFN? specific, IFN? was blocked by incubating IFN? specific antibodies with the A549 supernatants for 30 mins prior to the treatment of the Jurkat-Dual reporter cell linean isotype control antibody was included as a negative control. The data (FIG. 8A) show that the activity of the NG-641 treated tumour cell supernatant in the Jurkat Dual reporter assay is inhibited by the anti-IFN? antibody and not the isotype control and is thus mediated by IFN?. A different reporter assay system was used to evaluate the functionality of the CXCL9 and CXCL10 chemokine transgenes in NG-641. This assay used a PathHunter ?-arrestin reporter cell line expressing CXCR3, the receptor for both chemokines (Eurofins). GPCR activation following CXCL9/10 binding to CXCR3 expressed by these cells leads to ?-arrestin recruitment to the receptor that is measured using a gain-of-signal assay based on Enzyme Fragment Complementation (EFC) technology. PathHunter ?-arrestin CXCR3 reporter cells were treated with supernatants from A549 tumor cells either uninfected or infected with 10 particles per cell (ppc) of EnAd or NG-641 for 3 days. The concentration of CXCL9/10 in the supernatant is proportional to the luminescence in the assay. To demonstrate that the GPCR activation was CXCL9/10 specific, CXCL9 and CXCL10 were blocked by incubating CXCL9/10 specific antibodies with the A549 supernatants for 30 mins prior to the treatment of the PathHunter ?-arrestin cells. The data shown in FIG. 8B show increased activity of the CXCR3 reporter cells in the presence of supernatants from NG-641 treated tumour cells compared to EnAd or uninfected controls, and that this increase is blocked by the antibodies to CXCL9/10.

    [0481] As an alternative measure of chemokine functionality, the ability of chemokines to down-regulate the cell surface expression of their specific receptors was used as the basis of an assay, evaluating levels of CXCR3 receptor on anti-CD3/CD28 activated human T cells. A549 tumor cells were either uninfected or infected with 1 viral particles per cell (ppc) of enadenotucirev (EnAd) or NG-641 for 7 days and supernatants collected. Activated T cells were then treated with the supernatants for 30 minutes and levels of CXCR3 measured via flow cytometry, with data plotted as mean fluorescent intensity (MFI). To demonstrate that the downregulation of cell surface CXCR3 was CXCL9/10 specific, CXCL9 and CXCL10 were blocked by incubating CXCL9/10 specific antibodies with the A549 tumor cell supernatants for 30 mins prior to the treatment of the activated T cells. The data shown in FIG. 9 show a selective down-regulation of CXCR3 expression on both CD4 and CD8 T-cells induced by supernatants from NG-641 infected A549 tumour cells, and this effect was abolished by pre-treatment with anti-CXCL9/10 antibodies.

    Example 5: Functional Activity of FAP-Bispecific T Cell Activator Expressing Viruses in Ex Vivo Human Tumor Cell Cultures

    [0482] Samples of freshly excised human tumours, from planned surgical excisions, provided via a biobank under full ethical approval, were initially minced with scissors and a scalpel and then single cell suspensions were generated using a GentleMACs tissue dissociator (Miltenyi Biotec). These unseparated cell preparations were found to comprise tumour cells, fibroblasts and different immune cells, including T-cells, and were used to evaluate the ability of viruses to infect the primary tumour cells, produce their encoded transgenes and activate the tumour infiltrating T-cells also present in the cultures. Cells were resuspended in culture media consisting of Ham's F-12 Nutrient Mix, GlutaMAX? Supplement (Gibco), 1? Insulin-Transferrin-Selenium-Ethanolamine (ITS-X) (Gibco), Amphotericin B 2.5 mg/mL (Gibco?), Penicillin 100 units/mL, Streptomycin 100 mg/mL, Sodium Pyruvate and 10% FBS, and plated at ?1?10.sup.6 cells/ml in either 96 well plates (0.25 ml final volume) or 24 well plates (0.5 ml final volume). They were inoculated with EnAd, NG-615, NG-617, NG-640 or NG-641 at 1000 ppc, or left untreated (UIC). As a positive T-cell activation control, some wells were also stimulated with anti-CD3 and anti-CD28 antibodies each at 2 ?g/ml. Cells were cultured in duplicate wells for 72 h, then supernatants were collected and levels of different cytokines produced were measured using multi-cytokine fluorescent bead-based kits (LEGENDplex?) and a flow cytometer. Three non-small cell lung carcinoma (NSCLC) samples (T016, T017, T024), one renal cell carcinoma (RCC) and one colorectal (CRC) liver metastasis sample were tested. In line with the transgene expression data in FIGS. 4, 5, 6A, and 6B, IFN? was produced selectively in cultures treated with NG-615 and NG-641 (FIG. 10A). Flt3 ligand (FLT3L) was readily detected following NG-615 treatment but only very low levels were detected with other viruses, and these levels were similar to those induced by activating T-cells with anti-CD3/28 indicating that the Flt3L in NG-615 cultures was the transgene product. The results for other cytokines showed that, as with the tumour cell line inoculation study described in Example 3 (FIG. 7), NG-615 inoculation lead to much lower levels of T-cell activation than the other FAP-Bispecific T cell activator encoding viruses NG-617, NG-640 and the other 4-transgene-bearing virus NG-641, as shown for IFN?, TNF?, IL-17, Granzyme B and IL-13 in FIG. 10B.

    [0483] Activation of the endogenous tumour T-cells in an excised NSCLC tumour cell culture was also measured by flow cytometry, assessing levels of the T-cell activation markers CD25, CD69 and CD107a as well as intracellular cytokine (IFN? and TNF?) expression by both CD4 and CD8 T-cells after 3 days of culture. As shown in FIG. 11A-11D, EnAd had little effect on either activation markers or cytokine expression, whereas NG-617, NG-640 and NG-641 treatments all led to upregulation of all these measured of T-cell activation. The similar levels of activation seen with the FAP-Bispecific T cell activator-bearing viruses is in line with the cytokine data described above (FIG. 10B)

    Example 6

    [0484] In this example, the ability of recombinant FAP Bispecific T cell activator-activated T-cells to induce death of the fibroblast target cells was evaluated.

    FAP Bispecific T Cell Activator Induces T Cell-Mediated Lysis of FAP-Positive Cell Lines and Primary Cells

    [0485] NHDF (7,000 cells) were co-cultured with 70,000 T-cells in wells of a U-bottom 96 well plate in the presence of media alone or 300 ng/ml of control or FAP Bispecific T cell activator. After 24 hours of co-culture, supernatants were harvested and cytotoxicity determined by LDH assay following the manufacturer's instructions. The results are in FIG. 15, panel A show that the FAP Bispecific T cell activator significantly increased lysis of NHDF cells.

    [0486] In a similar experiment, 7,000 primary lung fibroblast cells (BTC100) were co-cultured with 70,000 CD3.sup.+ T-cells with or without 300 ng/ml of control or FAP Bispecific T cell activator. After 24 hours of co-culture, supernatants were harvested and cytotoxicity determined by LDH assay. The results in FIG. 15, panels B & C show that the FAP Bispecific T cell activator significantly increased lysis of primary human cancer associated fibroblast (CAF) cells. Expression of FAP by these and other patient-derived cell lines is shown in FIG. 16.

    [0487] The dose-response relationship for FAP Bispecific T cell activator-mediated cell lysis was evaluated by co-culturing 8,000 NHDF cells with 40,000 T-cells and Bispecific T cell activator concentrations ranging from 2?10.sup.3 to 2?10.sup.?2 ng/mL. After co-culture for 24 hours at 37? C., an LDH assay was performed on supernatants to determine target cell cytotoxicity. Dose response curves were fitted using a four parameter non-linear fit model integrated into GraphPad Prism, generating an EC50 value for the FAP Bispecific T cell activator of 3.2 ng/ml. The results (FIG. 17A) show a dose-dependent relationship between FAP Bispecific T cell activator concentration and cytotoxicity as measured by LDH assay (shown as Abs.sub.490).

    Example 7

    [0488] Stable FAP expressing CHO and Ad293 cell lines were generated as a means to demonstrate the FAP antigen specificity of the FAP Bispecific T cell activator by comparing to parental untransfected cells.

    Generation of FAP-Expressing Stable-Transfected Cell Lines

    [0489] The protein sequence of the FAP gene was obtained from the NCBI database (SEQ ID 23), reverse transcribed to generate a DNA coding sequence that was synthesised by Oxford Genetics Ltd (Oxford, UK). The FAP gene was cloned into pSF-Lenti vector by standard cloning techniques producing the pSF-Lenti-FAP vector. HEK293T cells were transfected with the lentivirus FAP expression vector alongside pSF-CMV-HIV-Gag-Pol, pSF-CMV-VSV-G, pSF-CMV-HIV-Rev. Lipofectamine 2000 was used as a transfection reagent and was added to the vector DNA at a DNA:lipofectamine ratio of 1:2, and incubated with the cells at 37? C. Supernatant containing lentivirus was harvested 48 hours later and mixed with polybrene (final concentration, 8 ?g/mL). The Lentivirus/polybrene mixture was added to seeded Ad293 or CHO cells and incubated at 37? C. On day 4, the supernatant was exchanged for media containing puromycin (2 ?g/mL for Ad293 and 7.5 ?g/mL for CHO). Stable variants were then clonally selected and FAP expression of the parental cell lines or stable-transfected variant was determined by staining with FAP or isotope control antibody and analysed by flow cytometry (FIG. 18A).

    FAP Bispecific T Cell Activator-Mediated Target Cell Lysis is Specific to FAP-Expressing Cells

    [0490] CHO or CHO-FAP cells (7,000 cells) were co-cultured alone or with human T-cells (70,000) in the presence of media alone or 2 ?g/mL control or FAP Bispecific T cell activator in wells of a U-bottom 96-well plate. After 24 hours incubation, supernatants were harvested and target cell cytotoxicity measured by LDH cytotoxicity assay as described in example 4 (FIG. 18B). T-cell activation was also determined by analysing the expression levels of CD69 and CD25 via flow cytometry (FIG. 19). Cytotoxicity was only observed when CHO-FAP cells were cultured with T-cells and FAP Bispecific T cell activator. This indicates that FAP Bispecific T cell activator mediated T-cell activation and target cell lysis is highly specific and limited to FAP-expressing cells, and not the FAP-negative parental cell line.

    Example 8

    [0491] In a further experiment, the ability of the recombinant FAP Bispecific T cell activator protein to activate CD4 or CD8 T-cells and the ability of each of these T-cell subsets to lyse NHDF cells was assessed. CD3.sup.+ T-cells (35,000) were co-cultured with 7,000 NHDF cells in the presence of 300 ng/ml control or FAP Bispecific T cell activator in wells of a U-bottom 96 well plate, and incubated at 37? C. for 24 hours. Cells were harvested and stained with antibodies to CD4 or CD8 and CD69 and CD25, and analysed by flow cytometry. The results (FIG. 20, panel A) demonstrated that the FAP Bispecific T cell activator induced an increase in activation markers CD69 and CD25 in both CD4.sup.+ and CD8.sup.+ T-cells.

    [0492] In a similar experiment, the ability of each T-cell subset (CD4 and CD8) to kill target cells was assessed. CD4.sup.+ T-cells were extracted from CD3-purified cells by positive selection using a CD4 T Cell Isolation Kit (Miltenyi Biotec, #130-045-101), according to the manufacturer's protocol, with the CD8 cells within non-isolated flow-through. In wells of a U-bottom 96-well plate, 7,000 NHDF were co-cultured with 35,000 CD4.sup.+ or CD8.sup.+ T-cells together with 300 ng/ml of control or FAP Bispecific T cell activator and incubated at 37? C. After 24 hours, supernatants were harvested and target cell cytotoxicity measured by LDH cytotoxicity assay. The results (FIG. 20, panel B) show that the FAP Bispecific T cell activator induced both CD4.sup.+ and CD8.sup.+ T-cells to kill NHDF cells.

    Example 9

    Characterising FAP Bispecific T Cell Activator-Mediated Activation of Autologous Tumour-Associated Lymphocytes From Primary Malignant Ascites

    [0493] To evaluate the activity of Bispecific T cell activator proteins using cancer patient derived cells, samples of primary malignant ascetic fluids containing both CD3.sup.+ T-cells and FAP.sup.+ cells were obtained for testing. Unpurified ascites cells (therefore unchanged from when received) were seeded at 250,000 cells per well of a U-bottom 96-well plate in either 100% ascites fluid or medium supplemented with 1% human serum in the presence of 500 ng/mL control or FAP Bispecific T cell activator. Untreated wells served as negative controls. After incubation at 37? C. for 5 days, the total cell population was harvested and the numbers of CD3.sup.+ T-cells (FIG. 21, panel A) and expression levels of CD25 on CD3.sup.+ T-cells were determined (FIG. 21, panel B). Total cell numbers per well were determined using precision counting beads. The results demonstrate that the FAP Bispecific T cell activator resulted in significant increase in T-cell activation of the tumour-associated T-cells from cancer patients.

    [0494] As an extension of the experiment above, replicate wells were harvested and the number of FAP.sup.+ cells determined by flow cytometry (FIG. 21, panel C). Total cell numbers per well were determined using precision counting beads. The results show that the FAP Bispecific T cell activator resulted in a significant decrease in numbers of autologous FAP-expressing cells in the ascites sample.

    Example 10

    [0495] Recombinant Bispecific T cell activator-expressing EnAd viruses were engineered, produced and purified using the methods described below.

    Generation of Bispecific T Cell Activator-Expressing Enadenotucirev

    [0496] EnAd is a replication competent chimeric group B adenovirus that contains frequent non-homologous nucleotide substitutions of Ad3 for Ad11p in the E2B region, a nearly complete E3 deletion and a smaller E4 deletion mapped to E4orf4 (Kuhn et al, Directed evolution generates a novel oncolytic virus for the treatment of colon cancer, PLOS One, 2008 Jun. 18; 3(6): e2409).

    [0497] The plasmid pEnAd2.4 was used to generate the plasmids ppEnAd2.4-CMV-FAP Bispecific T cell activator, pEnAd2.4-SA-FAP Bispecific T cell activator, pEnAd2.4-CMV-ControlBispecific T cell activator, pEnAd2.4-SA-Control Bispecific T cell activator (Table 4) by direct insertion of a cassette encoding the FAP Bispecific T cell activator (SEQ ID NO: 1) or Control Bispecific T cell activator (SEQ ID NO: 3). The transgene cassette contained a 5 short splice acceptor sequence CAGG or an exogenous CMV promoter (SEQ ID NO: 24), the EpCAM, FAP or control Bispecific T cell activator cDNA sequence and a 3 polyadenylation sequence (SEQ ID NO: 25). Construction of the plasmid was confirmed by DNA sequencing. The exogenous CMV promoter is constitutively active and thus leads to early expression of transgenes. The splice acceptor sequence drives expression under the control of the viral major late promoter and leads to later transgene expression following initiation of virus genome replication.

    TABLE-US-00005 TABLE 4 [plasmid DNA] Plasmid ID ng/ml pEnAd2.4-CMV-FAP Bispecific T cell activator 1322.8 pEnAd2.4-SA-FAP Bispecific T cell activator 3918.3 pEnAd2.4-CMV-Control Bispecific T cell activator 189.1 pEnAd2.4-SA-Control Bispecific T cell activator 236.2 pEnAd2.4-CMV-FAP Bispecific T cell activator-RFP 1599 pEnAd2.4-SA-FAP Bispecific T cell activator-RFP 1872 pEnAd2.4-CMV-Control Bispecific T cell activator-RFP 1294 pEnAd2.4-SA-Control Bispecific T cell activator-RFP 2082
    Virus Production and characterisation

    [0498] The plasmids EnAd2.4-CMV-EpCAM Bispecific T cell activator, pEnAd2.4-SA-EpCAM Bispecific T cell activator, pEnAd2.4-CMV-FAP Bispecific T cell activator, pEnAd2.4-SA-FAPBispecific T cell activator, pEnAd2.4-CMV-ControlBispecific T cell activator, pEnAd2.4-SA-ControlBispecific T cell activator were linearised by restriction digestion with the enzyme AscI to produce the liner virus genome. Digested DNA was purified by isopropanol extraction and precipitated for 16 hrs, ?20? C. in 300 ?l>95% molecular biology grade ethanol and 10 ?l 3M Sodium Acetate. The precipitated DNA was pelleted by centrifuging at 14000 rpm, 5 mins and was washed in 500 ?l 70% ethanol, before centrifuging again, 14000 rpm, 5 mins. The clean DNA pellet was air dried and resuspended in 100 ?L water. 6.25 ?g DNA was mixed with 15.6 ?L lipofectamine transfection reagent in OptiMEM and incubated for 20 mins, RT. The transfection mixture was then added to a T-25 flask containing Ad293 cells grown to 80% confluency. After incubation of the cells with the transfection mix for 4 hrs at 37? C., 5% CO.sub.2 4 mls of cell media (DMEM high glucose with glutamine supplemented with 10% FBS) was added to the cells and the flasks was incubated 37? C., 5% CO.sub.2. The transfected Ad293 cells were monitored every 24 hrs and were supplemented with additional media every 48-72 hrs. The production of virus was monitored by observation of a significant cytopathic effect (CPE) in the cell monolayer. Once extensive CPE was observed the virus was harvested from Ad293 cells by three freeze-thaw cycles. Single virus clones were selected by serial diluting harvested lysate and re-infecting Ad293 cells, and harvesting wells containing single plaques. Serial infections of Ad293 cells were performed once an infection had reached full CPE in order to amplify the virus stocks. Viable virus production during amplification was confirmed by observation of significant CPE in the cell monolayer.

    Virus Purification

    [0499] Once potent virus stocks were amplified the viruses were purified by double caesium chloride density gradient centrifugation (banding) to produce, NG-603, NG-604, NG-605 and NG-606 virus stocks. These stocks were titred by micoBCA assay (Life Technologies), following manufacturer's instructions (Table 5).

    TABLE-US-00006 TABLE 5 Virus Genome TCID50/ EnAd ID NG ID NO: SEQ ID vp/rnL mL EnAd-CMV-Control Bispecific T cell activator NG-603 1.42607 ? 10.sup.12 5.01 ? 10.sup.10 EnAd-SA-Control Bispecific T cell activator NG-604 3.31073 ? 10.sup.12 2.00 ? 10.sup.11 EnAd-CMV-FAP Bispecific T cell activator NG-605 SEQ ID NO: 26 1.64653 ? 10.sup.12 1.58 ? 10.sup.11 EnAd-SA-FAP Bispecific T cell activator NG-606 SEQ ID NO: 27 1.28148 ? 10.sup.12 3.98 ? 10.sup.10 EnAd-CMV-Control Bispecific T cell activator-P2A-RFP NG-607 5.963 ? 10.sup.12 1.26 ? 10.sup.9 EnAd-SA-Control Bispecific T cell activator-P2A-RFP NG-608 1.51848 ? 10.sup.12 6.31 ? 10.sup.9 EnAd-CMV-FAP Bispecific T cell activator-P2A-RFP NG-609 1.57517 ? 10.sup.12 7.94 ? 10.sup.9 EnAd-SA-FAP Bispecific T cell activator-P2A-RFP NG-610 7.74881 ? 10.sup.11 5.01 ? 10.sup.10

    Example 11

    [0500] The activities of NG-601, NG-602, NG-603, NG-604, NG-605 and NG-606 viruses were characterised using the methods described below.

    Characterisation of Bispecific T Cell Activator Encoding EnAd Activity Compared to EnAd in Carcinoma Cell Lines

    [0501] The ability NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 or EnAd to replicate was analysed by infection of A549 lung carcinoma cells and assessed by qPCR. A549 cells were seeded in wells of a 24-well plate at a cell density of 2?10.sup.5 cells/well. Plates were incubated for 18 hrs, 37? C., 5% CO.sub.2, before cells were either infected with 100 virus particles per cell (ppc) or were left uninfected. Wells were harvested 24, 48 or 72 hrs post infection and DNA purified using PureLink genomic DNA mini kit (Invitrogen) according to the manufacturer's protocol. Total viral genomes were quantified by qPCR with each extracted sample or standard using an EnAd hexon gene specific primer-probe set in the reaction mix detailed in Table 6. qPCR was performed as per the programme in Table 7.

    TABLE-US-00007 TABLE 6 Reagent Volume/well (?l) 2 ? qPCRBIO Probe Mix (PCRBiosystems) 10 EnAd Forward primer 0.08 EnAd Reverse primer 0.08 EnAd Probe 0.8 NFW 4.04 Sample 5 Well Volume 20

    TABLE-US-00008 TABLE 7 No. Temperature Duration Cycles (? C.) (secs) 1 95 120 40 95 5 60-65 20-30

    [0502] Quantification of the number of detected virus genomes per cell demonstrated that NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 and EnAd virus replication were comparable in the A549 cell line (FIG. 22, panel A).

    [0503] Oncolytic activity of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 or EnAd was assessed by infection of A549 (FIG. 22, panel B). A549 cells were seeded in 96-well plate at a cell density of 1.5?10.sup.4 cells/well. Plates were incubated for 18 hrs, 37? C., 5% CO.sub.2, before cells were infected with increasing ppc of virus (5-fold serial dilution, 4.1?10.sup.?7 to 5000 virus ppc) or were left uninfected. A549 cytotoxicity was measured on day 5 by CellTiter 96? AQueous One Solution Cell Proliferation Assay (MTS) (Promega, #G3582). Dose response curves were fitted using a four parameter non-linear fit model integrated into GraphPad Prism. IC50 values generated for each virus demonstrated that the oncolytic activities of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 and EnAd was comparable for each virus.

    Confirmation of Functional Bispecific T Cell Activator Transgene Expression From NG-603, NG-604, NG-605, NG-606

    [0504] To determine whether the viruses NG-601, NG-602, NG-605, NG-606 produced functional Bispecific T cell activators, T-cell activation assays using CHO, CHO-EpCAM and CHO-FAP cell lines as target cells were performed. 10,000 target cells were co-cultured with 50,000 CD3.sup.+ T-cells in wells of a U-bottom 96-well plate with Ad293 viral supernatants diluted 100-fold in culture medium and incubated for 24 hrs, 37? C., 5% CO.sub.2. T-cells were harvested and stained with antibodies specific for CD25 and CD69 and analysed by flow cytometry. The results (FIGS. 23A and 23B) indicated that the viruses NG-601 and NG-602 expressed a functional Bispecific T cell activator transgene that activated T cells when co-cultured with CHO-EpCAM cells, and NG-605 and NG-606 expressed a functional Bispecific T cell activator transgene that activated T cells when co-cultured with CHO-FAP cells, but not when co-cultured with CHO cells.

    Quantification of Bispecific T Cell Activator Expression in a Colon Carcinoma Cell Line

    [0505] The quantity of Bispecific T cell activator expression by NG-601, NG-602, NG-605, NG-606 infection of the human colon carcinoma cell line DLD was assessed. DLD cells were seeded in 6 well culture plates at a density of 1.2?10.sup.6 cells per well. 18 hrs post-seeding, DLD cells were infected with EnAd, NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 at 100 ppc. Cells were cultured for 72 hrs before the supernatants were collected from the wells and centrifuged for 5 mins, 1200 rpm to remove cell debris. The clarified supernatants were then used for a killing assay, with cytotoxicity compared to a standard curve generated with a recombinant Bispecific T cell activator of known concentration, allowing determination of quantity of Bispecific T cell activator in viral supernatants.

    [0506] To determine the quantity of FAP Bispecific T cell activator produced from NG-605 and NG-606, a cytotoxicity assay was performed in which 8,000 NHDF were co-cultured with 40,000 CD3.sup.+ T-cells and DLD viral supernatants diluted 1 in 10.sup.3, 1 in 10.sup.4 and 1 in 10.sup.5. A standard curve was generated by incubating NHDF and CD3.sup.+ T-cells with FAP or control Bispecific T cell activator at 10-fold serial dilutions from 3333 to 3.33?10.sup.?4 ng/?L. Supernatants were harvested 24 hour post-treatment and cytotoxicity measured by LDH assay. Quantity of Bispecific T cell activator expressed was determined by comparing cytotoxicity of viral supernatants to that of the recombinant Bispecific T cell activator standard curve. The results (FIG. 24) indicated that the viruses NG-605 and NG-606 produced 9.8 and 49.2 ?g FAP Bispecific T cell activator per million DLD cells, respectively.

    Example 12

    [0507] In addition to encoding a FAP or Control Bispecific T cell activator, the NG-607, NG-608, NG-609, NG-610 viruses also carry a red fluorescent protein (RFP) transgene for visualization of infected cells using fluorescent microscopy methods (SEQ ID NOS: 20 & 21 Table 4). The functional activities of these viruses were characterised using the methods described below.

    Confirmation of Transgene Expression from NG-607, NG-608, NG-609, NG-610

    [0508] The ability of viruses NG-607, NG-608, NG-609 and NG-610 to produce their Bispecific T cell activator transgene was assessed by infection of Ad293 cells. Ad293 cells were plated in a 6-well plate at 1?10.sup.6 cells/well. Plates were incubated for 24 hrs, 37? C., 5% CO.sub.2, before cells were infected with viruses at 100 ppc or were left uninfected. At 48 hours post-infection, plaques were irradiated with a fluorescent mercury lamp and photographed (FIGS. 18A-18B). The results suggested that the viruses NG-607, NG-608, NG-609 and NG-610 express the RFP transgene.

    Example 13

    [0509] In the next series of experiments, the ability of EnAd and FAP or control Bispecific T cell activator viruses NG-603, NG-604, NG-605, NG-606, NG-607, NG-608, NG-609, NG-610 to kill target cells, including tumour cells and fibroblasts, was evaluated.

    [0510] In the first study, the ability of EnAd to kill DLD cells was assessed using xCELLigence technology. DLD cells were plated in a 48-well E-plate at 1.2?10.sup.4 cells/well and incubated for 18 hrs, 37? C., 5% CO.sub.2, before cells were either infected with 100 EnAd ppc or were left uninfected. XCELLigence was used to measure target cell cytotoxicity every 15 minutes over an 8 day incubation period.

    [0511] In a similar experiment, the ability of NG-603, NG-604, NG-605, NG-606 and EnAd to kill NHDF cells was assessed in co-culture with SKOV tumour cells and CD3.sup.+ T-cells using xCELLigence. NHDF cells and SKOV cells were seeded in a 48-well E-plate at 4?10.sup.3 and 1?10.sup.3 cells/well, respectively. Plates were incubated for 18 hrs, 37? C., 5% CO.sub.2, before cells were either infected with 100 ppc of EnAd, of NG-603, NG-604, NG-605 or NG-606 or were left uninfected. After 2 hour incubation, 37,500 CD3.sup.+ T-cells were added to each well. xCELLigence was used to measure target cell cytotoxicity every 15 minutes. The results (FIG. 26A) demonstrate that the FAP Bispecific T cell activator-expressing viruses NG-605 and NG606, but not EnAd or control Bispecific T cell activator-expressing viruses NG-603 and NG-604, were able to induce lysis of NHDF cells, with kinetics dependent on the promoter used for Bispecific T cell activator expression (faster with CMV promoter).

    [0512] In a similar experiment, the ability of NG-603, NG-604, NG-605, NG-606 and EnAd to kill NHDF cells, was assessed in co-culture with SKOV and CD3.sup.+ T-cells using LDH cytotoxicity assay. NHDF cells and SKOV cells were seeded in a 96-well U-bottom plate at 8?10.sup.3 and 2?10.sup.3 cells/well, respectively, and either infected with 100 ppc of EnAd, of NG-603, NG-604, NG-605 or NG-606 or were left uninfected. After 2 hour incubation, 75,000 CD3.sup.+ T-cells were added to each well and plates were incubated at 37? C., 5% CO.sub.2. Supernatants were harvested at 0, 24, 48 and 96 hours post-treatment and cytotoxicity measured by LDH cytotoxicity assay. The results (FIG. 26B) demonstrate that the FAP Bispecific T cell activator-expressing viruses NG-605 and NG606, but not EnAd or control Bispecific T cell activator-expressing viruses NG-603 and NG-604, were able to induce lysis of NHDF cells, with kinetics dependent on the promoter used for Bispecific T cell activator expression.

    [0513] As an extension of the LDH experiment above, the cells were also harvested at 0, 24, 48 and 96 hours post-treatment, stained with antibodies for CD45, CD69 and CD25 and analysed by flow cytometry. The results (FIG. 27) demonstrate that the FAP Bispecific T cell activator-expressing viruses NG-605 and NG-606, but not EnAd or control Bispecific T cell activator-expressing viruses NG-603 and NG-604, were able to induce T-cell activation, with kinetics dependent on the promoter used for Bispecific T cell activator expression.

    [0514] In a similar experiment, the dependence on FAP to induce FAP Bispecific T cell activator-mediated T-cell activation was evaluated. In a 96-well U-bottom plate, SKOV cells were seeded at 2?10.sup.3 cells/well alone or in combination with NHDF cells at 8?10.sup.3 cells/well. Viral particles were added to each well at 100 ppc, and plates incubated at 37? C., 5% CO.sub.2. After two hours, 75,000 CD3.sup.+ T-cells were added and plates incubated further. At 96-hours post-infection, cells were harvested and stained for CD45 and CD25 and analysed by flow cytometry (FIG. 28, panel A). The results demonstrate that the FAP Bispecific T cell activator-expressing viruses NG-605 and NG-606, only induced T-cell activation in the presence of FAP-positive NHDF cells.

    [0515] In a similar experiment, the specificity of promoter (CMV or virus MLP/SA)-driven Bispecific T cell activator expression in NG-605 and NG-606 was investigated further. In a 96-well U-bottom plate, NHDF cells were seeded at 4?10.sup.3 cells/well. 100 viral particles per cell were added to each well, and plates incubated at 37? C., 5% CO.sub.2. After two hours, 40,000 CD3 cells were added and plates incubated further. At 72-hours post-infection, supernatants were harvested and cytotoxicity measured by LDH cytotoxicity assay. The results (FIG. 28, panel B) demonstrate that the CMV-driven virus NG-605, but not SA-driven NG-606, was able to mediate killing of NHDF cells upon infection of NHDF cells alone.

    [0516] The results indicate that NG-605 and NG-606 were both able to induce T cell activation and target cell lysis, although the kinetic profile was slightly different depending on the promoter used.

    [0517] Timelapse videos were obtained to observe viral or T cell-mediated lysis of target cells by recombinant FAP Bispecific T cell activator, EnAd, NG-603 or NG-605. NHDF cells were stained with CellTracker Orange CMTMR Dye (Life Tech, #C2927) and CD3.sup.+ T-cells were stained with CellTrace Violet Cell Proliferation Kit (Life Tech, #C34557) following manufacturer's protocols. Dyed NHDF were plated in a 24-well plate at 7.5?10.sup.3 cells/well in co-culture with 1.35?10.sup.4 DLD or SKOV tumour cells. Plates were incubated for 18 hrs, 37? C., 5% CO.sub.2. Cells were then treated with 300 ng/ml FAP Bispecific T cell activator or infected with 100 ppc of EnAd, NG-603, and NG-605 or left untreated. After two hours incubation, 100,000 dyed CD3.sup.+ T-cells were added to necessary wells, in addition to 1.5 ?M CellEvent Caspase 3-7 reagent (Life Tech, #C10423). Videos were obtained on a Nikon TE 2000-E Eclipse inverted microscope, with images captured every 15 minutes for 96 hours. Frames from the videos are shown in FIG. 29. The results show that the recombinant FAP Bispecific T cell activator and NG-605, but not EnAd or NG-603, were able to induce rapid lysis of NHDF cells.

    [0518] In a similar experiment, NHDF cells were stained with CellTracker Green CMFDA Dye (Life Tech, #C2925) and CD3.sup.+ T-cells were stained with CellTrace Violet Cell Proliferation Kit (Life Tech, #C34557) following manufacturer's protocols. Dyed NHDF were plated in a 24-well plate at 7.5?10.sup.3 cells/well in co-culture with 1.35?10.sup.4 DLD or SKOV tumour cells. Plates were incubated for 18 hrs, 37? C., 5% CO.sub.2. Cells were then infected with 100 ppc of NG-607, NG-608, NG-609 or NG-610 or left uninfected. After two hours incubation, 100,000 dyed CD3.sup.+ T-cells were added to necessary wells. Videos were obtained on a Nikon TE 2000-E Eclipse inverted microscope, with images captured every 15 minutes for 96 hours. Frames from the videos are shown in FIG. 30. The results show that all viruses lead to tumour cell infection (RFP, red fluorescence, positive), but only NG-609 and NG-610 were able to induce rapid lysis of the co-cultured NHDF cells.

    Example 14

    [0519] In this example, the activation of autologous tumour-associated lymphocytes from FAP.sup.+ primary malignant ascites from cancer patients by EnAd, NG-603, NG-604, NG-605 and NG-606 was evaluated. Patient samples considered suitable for further analysis were those containing CD3.sup.+ T-cells and FAP.sup.+ cells.

    [0520] In the first experiment, unpurified (therefore unchanged from when received) ascites cells from a patient were seeded at 250,000 cells per well of a U-bottom 96-well plate in 100% ascites fluid. Cells were infected with viruses at 100 ppc, with untreated wells serving as negative controls. EnAd-CMV-GFP and EnAd-SA-GFP were also included in the experiment as a reporter to determine infection and late stage viral gene expression, respectively, with micrographs. After incubation at 37? C. for 5 days, the total cell population was harvested and the expression level of CD25 on CD3.sup.+ T-cells (FIG. 32, panel A) was determined. Total cell numbers per well were determined using precision counting beads. The results demonstrate that the FAP Bispecific T cell activator viruses NG-605 and NG-606 resulted in significant increases in T-cell activation of tumour-associated lymphocytes.

    [0521] As an extension of the experiment above, replicate wells were harvested and the number of endogenous FAP.sup.+ cells determined by flow cytometry. Total cell numbers per well were determined using precision counting beads. The results (FIG. 40, panel B) show that NG-605 and NG-606 resulted in a significant decrease in numbers of autologous FAP-expressing cells in the ascites samples, suggesting some FAP.sup.+ cells had been killed by the activated T-cells.

    [0522] In a second experiment, unpurified (therefore unchanged from when received) ascites cells from a cancer patient were seeded at 250,000 cells per well of a U-bottom 96-well plate in either 100% ascites fluid or medium supplemented with 1% human serum. Cells were infected with viruses at 100 ppc, with untreated wells serving as negative controls. EnAd-CMV-GFP and EnAd-SA-GFP were also included as a reporter to determine infection and late stage viral gene expression, respectively, with micrographs. After incubation at 37? C. for 5 days, the total cell population was harvested and the number of CD3.sup.+ T-cells (FIG. 33) and expression level of CD25 on CD3.sup.+ T-cells (FIG. 34) was determined. Total cell numbers per well were determined using precision counting beads. The results demonstrate that for this patient recombinant FAP Bispecific T cell activator and NG-605, but not NG-606, resulted in significant increase in T-cell activation of tumour-associated lymphocytes in media. Neither virus led to activation in ascites fluid.

    [0523] As an extension of the experiment above, replicate wells were harvested and the number of FAP.sup.+ cells was determined by flow cytometry (FIG. 35). Total cell numbers per well were determined using precision counting beads. The results demonstrate that recombinant FAP Bispecific T cell activator and NG-605, but not NG-606, resulted in a significant decrease in numbers of autologous FAP-expressing cells in media. Neither virus led to a reduction in FAP.sup.+ cells in ascites fluid.

    Example 15Discussion

    [0524] Oncolytic viruses offer an intriguing new strategy to combine several therapeutic modalities within a single targeted, self-amplifying, agent (Keller & Bell, 2016; Seymour & Fisher, 2016). As they replicate selectively within cancer cells and spread from cell to cell, some oncolytic viruses are thought to mediate cell death by non-apoptotic death pathways (Ingemarsdotter et al, 2010; Li et al, 2013), as part of the process allowing virus particles to escape from dying cells. EnAd, in particular, kills cells by a pro-inflammatory process known as oncosis or ischemic cell death (Dyer, 2017). This non-apoptotic death mechanism causes release of several pro-inflammatory cellular components, such as ATP, HMGB1 and exposure of calreticulin (known as damage-associated molecular patterns, DAMPs)(Weerasinghe & Buja, 2012), and is likely pivotal to the ability of the virus to promote an effective anticancer immune response. In addition to the consequences of direct lysis, however, viruses offer the potential to encode and express other anticancer biologics, obviating delivery challenges and ensuring the biologic achieves its highest concentration within the tumour microenvironment. Imlygic encodes GM-CSF, however the potential for arming viruses is virtually limitless and provides many exciting opportunities to design multimodal therapeutic strategies with additive or synergistic anticancer effects (de Gruijl et al, 2015; Hermiston & Kuhn, 2002).

    [0525] Encoding Bispecific T cell activators within oncolytic viruses provides a powerful means to activate tumour infiltrating lymphocytes to become cytotoxic and lyse antigen-positive target cells, providing a completely separate therapeutic modality from the effects of direct viral lysis. In this study we have shown that Bispecific T cell activator-targeted cytotoxicity is fully antigen-specific, can be Mediated by both CD4 and CD8 T cells (Brischwein et al, 2006) and can be incorporated into an oncolytic adenovirus and expressed only in cells that allow virus replication. In addition, the current study shows, for the first time, that endogenous T cells within liquid cancer biopsies can be activated by Bispecific T cell activators and virus-encoded Bispecific T cell activators and can kill endogenous tumour cells without any additional stimulation or reversal of immune suppression. Importantly, this can happen even in the primary fluids that comprise the microenvironment of peritoneal ascites or pleural effusions, as surrogates for the immune suppressive microenvironment of solid tumours.

    [0526] Arming oncolytic viruses to express Bispecific T cell activators combines two quite distinct therapeutic mechanisms, with the former providing lytic death of tumour cells that are permissive for virus infection, and the latter targeting T cell cytotoxicity via a specific, chosen, antigen. This provides considerable flexibility in the design of a therapeutic approach, perhaps using the Bispecific T cell activators to deliver cytotoxicity to tumour-associated cells that are relatively resistant to kill by the virus directly. For example, while we have exemplified the technology here using a Bispecific T cell activator that recognises a carcinoma-associated antigen (EpCAM), it is also possible to use the Bispecific T cell activator approach to target cytotoxicity to tumour-associated fibroblasts or other stromal cells. Indeed, even when the targets for Bispecific T cell activator-recognition are not restricted to expression in the tumour microenvironment, by linking Bispecific T cell activator production to virus replication allows expression of the Bispecific T cell activator to be spatially restricted to the tumour, minimising systemic toxicities. This is important, as Bispecific T cell activators administered intravenously show relatively short circulation kinetics (Klinger et al, 2012) and are often associated with considerable on-target off-tumour toxicities (Teachey et al, 2013).

    [0527] The possibility to encode Bispecific T cell activators within oncolytic viruses has been previously explored using an oncolytic vaccinia virus with an Ephrin A2-targeting Bispecific T cell activator. This agent showed that the Ephrin Bispecific T cell activator could mediate activation of PBMCs and antigen-targeted killing of tumour cells both in vitro and in vivo. Intriguingly, although the Bispecific T cell activator could activate T cells it did not lead to T cell proliferation without the addition of exogenous IL-2, whereas the Bispecific T cell activator used in the current study led to extensive proliferation both of PBMC in vitro and of tumour-associated lymphocytes using the clinical biopsy samples ex vivo.

    [0528] We believe that the differences observed may reflect the different Bispecific T cell activator design, the different oncolytic virus used or perhaps depend on the antigen density giving sufficient crosslinking of CD3 on the T cells.

    [0529] One central aim of oncolytic virus therapy is to create an anticancer T cell response that recognises patient specific neoantigens as well as public tumour associated antigens. Lytic viruses may do this by stimulating improved antigen presentation by lysing tumour cells in the context of DAMPs alongside virus-related pathogen-associated molecular patterns (PAMPs). Immunohistochemical staining of resected colon tumours, following intravenous delivery of EnAd, suggest the virus promotes a strong influx of CD8+ T cells into tumour tissue (Garcia-Carbonero, 2017). However, while this is potentially a very powerful approach, adaptive T cell responses are ultimately dependent on the expression of MHC class I antigens by tumour cells, to allow targeted killing. Loss of MHC expression is a well documented immune evasion strategy for tumours (Garrido et al, 2016). It is noteworthy that both cytotoxic strategies that are immediately engaged by Bispecific T cell activator-armed oncolytic viruses operate independently of MHC class I by the tumour cells, and therefore can be employed to kill cancer cells even when tumour cells have lost MHC expression.

    [0530] The present study thus demonstrates that encoding Bispecific T cell activators within EnAd provides a particularly promising strategy to achieve targeted expression in disseminated tumours, exploiting the known blood-stability and systemic bioavailability of the virus, which has now been studied in several early phase clinical trials. Notably, in a study where the virus is given intravenously a few days prior to resection of primary colon cancer, subsequent immunohistological assessment of tumour sections showed that the virus had reached to regions through the tumours and gave strong intranuclear hexon signals, indicating successful infection and virus replication selectively in tumour cells. This confirms preclinical data (Di et al, 2014; Illingworth, 2017) indicating that this virus is stable in 100% human blood and should be capable of tumourtargeted infection of disseminated and metastatic malignancies in human patients.

    [0531] Bispecific T cell activators could be encoded by EnAd without any loss of oncolytic virulence, reflecting the considerable transgene packaging capacity of the virus. The presence of the transgene will not affect the physicochemical properties of the virus particles, hence the modified viruses should exhibit exactly the same clinical pharmacokinetics as the parental agent, and should be capable of expressing the encoded Bispecific T cell activator selectively within tumours throughout the body. This provides an exciting and potentially very effective new approach to systemically targeted cancer immunotherapy that should now be prioritised for clinical assessment.

    Example 16

    Immunosuppression of Human T-Cell Activation and Target Cell Cytotoxicity by Patient Malignant Exudate Fluids

    [0532] Malignant exudates represent an environment of potential immune tolerance with suppressed immune responses commonly observed in patients with late-stage metastatic cancer. The quantity of IL-10, considered to be an anti-inflammatory cytokine, was measured in normal serum or patient malignant exudate fluids (A, peritoneal ascites; P, pleural effusion) using Human IL-10 ELISA MAX kit (Biolegend, 430604). IL-10 levels in the exudates (88.1-633.4 pg/mL) were far in excess of those measured in normal serum (7.2-10 pg/mL).

    [0533] The ability of CD3/CD28 beads (Gibco, 11161D) to activate PBMC T-cells in the presence of normal serum, ascites or pleural fluid was investigated. Human PBMC T-cells (100,000 cells per well in 96 well plate) were treated with CD3/CD28 beads (following manufacturers instructions) in normal serum or patient exudate fluid (50%). T-cells were left untreated in each fluid as negative control. After 24 hours of culture, cells were harvested and the expression levels of CD69 and CD25 on CD3+ T-cells were then analysed by antibody staining and flow cytometry represented as percentage of dual positive (CD69+CD25+ cells). In normal serum the anti-CD3/CD28 beads gave approximately 60% of T cells dual positive for both CD25 and CD69, whereas the presence of ascites fluid attenuated T cell activation in 6/12 fluids.

    [0534] In a similar experiment, 100,000 T-cells were treated with CD3/CD28 beads in the presence of normal serum, ascites or pleural fluid (50%). Anti-CD107a or isotype control antibody were added directly to culture medium. After 1 hour, monensin was added (BD Golgistop, BD Biosciences) according to manufacturers instructions. After 5 further hours, cells were harvested and analysed by flow cytometry to determine degranulation. In normal serum the anti-CD3/CD28 beads gave approximately 22.5% of T cells degranulated, whereas the presence of ascites fluid attenuated T cell activation in 10/12 fluids. The level of degranulation was significantly correlative (Pearson co-efficient, r=?0.7645; p=0.0038) with quantity of IL-10 in each fluid.

    [0535] In a similar experiment, 75,000 T-cells were co-cultured with 15,000 SKOV3 and EpCAM in the presence of normal serum, ascites or pleural fluid (50%). T-cells were treated with control Bispecific T cell activator in each fluid as negative control. After 24 hours of culture, cells were harvested and the expression levels of CD69 and CD25 on CD3+ T-cells were then analysed by antibody staining and flow cytometry represented as percentage of dual positive (CD69+CD25+ cells). In normal serum the EpCAM Bispecific T cell activator gave approximately 67.6% of T cells dual positive for both CD25 and CD69, whereas the presence of ascites fluid attenuated T cell activation in 0/12 fluids, and slightly induced activation in 4/10 fluids.

    [0536] In a similar experiment, 75,000 T-cells were co-cultured with 15,000 SKOV3 and EpCAM in the presence of normal serum, ascites or pleural fluid (50%). T-cells were treated with control Bispecific T cell activator in each fluid as negative control. Anti-CD107a or isotype control antibody were added directly to culture medium. After 1 hour, monensin was added (BD Golgistop, BD Biosciences) according to manufacturers instructions. After 5 further hours, cells were harvested and analysed by flow cytometry to determine degranulation. In normal serum the EpCAM Bispecific T cell activator beads gave approximately 41.4% of T cells degranulated, whereas the presence of ascites fluid attenuated T cell activation in 2/12 fluids.

    [0537] The ability of EnAd-SA-EpCAM Bispecific T cell activator and EnAd-SA-Control Bispecific T cell activator to induce T cell-mediated target cell lysis in malignant exudate fluids was assessed using xCELLigence technology. SKOV cells were plated in 48-well E-plate at 1e4 cells/well respectively. Plates were incubated for 18 hrs, 37? C., 5% CO2, before cells were either infected with 100 virus particles per cell (ppc) or were left uninfected. After two hours, PBMC T-cells (5:1) in normal serum or patient exudate fluid (final, 50%) were added. xCELLigence was used to measure target cell cytotoxicity every 10 minutes. The results suggest that Bispecific T cell activator-mediated SKOV3 lysis by T-cells is independent of fluid used.

    [0538] Unpurified ascites cells (therefore unchanged from when received) are seeded at 100,000 cells per well of a flat-bottom 96-well plate in RPMI media or ascites fluid. Cells were treated with EpCAM or control Bispecific T cell activator, with untreated wells serving as a negative control. After incubation at 37 C for 24 hours, cells were harvested, and the expression level of CD25 and CD69 on CD3 cells determined. The results demonstrate that EpCAM Bispecific T cell activator resulted in significant increase in T-cell activation (CD69/CD25 dual positive) of tumour-associated lymphocytes, slightly increased by ascites fluid.

    [0539] In a similar experiment, unpurified ascites cells (therefore unchanged from when received) are seeded at 100,000 cells per well of a flat-bottom 96-well plate in RPMI media or ascites fluid. Cells were treated with EpCAM, control Bispecific T cell activator or recombinant Bispecific T cell activator viruses (100 vp/cell), with untreated wells serving as a negative control. After incubation at 37 C for 5 days, the total cell population was harvested, and the number of CD3+ cells and expression level of CD25 on CD3 cells determined and the number of endogenous EpCaM+ cells determined by flow cytometry. Total cell numbers per well were determined using precision counting beads. The results demonstrate that EpCAM Bispecific T cell activator and EnAd expressing EpCAM Bispecific T cell activator resulted in significant increase in T-cell activation (CD3 number, CD25) of tumour-associated lymphocytes and cytotoxicity of EpCAM+ cells in both RPMI media and ascites fluid.

    [0540] As an extension of the experiment above, six more patient exudate samples (for a total of 7) were treated identically in ascites fluid and number of CD3+, CD25 expression of T-cells and number of EpCAM+ cells determined by flow cytometry. The results show that EpCAM Bispecific T cell activator and EnAd expressing EpCAM Bispecific T cell activator resulted in significant increase in T-cell activation (CD3 number, CD25) of tumour-associated lymphocytes and cytotoxicity of EpCAM+ cells reproducibly in a range of exudate biopsy samples.

    Example 17

    FAP Bispecific T Cell Activator Mediate Activation of T-Cells and Killing of FAP+ Cells by Different Donor T-Cells

    [0541] In other experiments, methods described in Example 2 were used to further evaluate the T-cell activating properties of recombinant FAP Bispecific T cell activator protein tested in co-cultures of NHDF and T-cells, comparing to control Bispecific T cell activator and polyclonal T-cell activation using anti-CD3/CD28 Dynabeads.

    [0542] Supernatants taken after 24 hours of culture were tested by ELISA for IFN? (FIG. 36, panel A) and by cytokine bead array (LEGENDplex human T helper cytokine panel, BioLegend #74001) for a panel of cytokines (FIG. 36, panel B). The control Bispecific T cell activator induced no significant change in any cytokine, however the FAP-Bispecific T cell activator led to strong increases in gamma interferon, IL-2, TNF?, IL-17 and IL-10, consistent with different subsets of T-cells being stimulated, and production of IFN? was far greater than that triggered by anti-CD3/CD28.

    [0543] Stimulation with the FAP Bispecific T cell activator, but not control Bispecific T cell activator, in the presence of NHDF cells also induced rapid degranulation (within 6 hr) of T-cells, both CD4+ and CD8+ subsets, as determined by the externalisation of CD107a/LAMP1 on the T-cell surface (as assessed by flow cytometry), which is strongly correlative with their ability to kill target cells (FIG. 37, panels A and B). This induction of degranulation by the FAP Bispecific T cell activator translated to potent fibroblast lysis (FIG. 37, panel C), as measured by LDH release after 24 h co-culture with PBMC T-cells (EC.sub.50 of ?2.5 ng/ml) with induced T-cell activation and cytotoxicity observed using 6/6 donor T-cells (FIG. 37, panel D). No cytotoxicity was induced by the control Bispecific T cell activator, consistent with T-cells remaining in an inactivated state.

    Example 18

    Effect of FAP Bispecific T Cell Activator and EnAd-FAP Bispecific T Cell Activator Viruses on Cells in Primary Malignant Ascites Samples From Different Ancer Patients

    [0544] As a follow-on to studies described in Example 16, fresh primary malignant peritoneal ascites from further cancer patients were obtained for study of EnAd FAP Bispecific T cell activator virus activities. Three patient samples containing both EpCAM.sup.+ tumour cells and FAP.sup.+ fibroblasts were expanded ex vivo, and the mixed (adherent) cell populations were cultured with PBMC-derived T-cells and unmodified or Bispecific T cell activator expressing EnAd viruses. After 72 h, total cells were harvested and the number of FAP.sup.+ (FIG. 38, panel A) and EpCAM.sup.+ cells (FIG. 38, panel B) determined by flow cytometry. Additionally, the activation status of T-cells (by CD25 expression) was measured (FIG. 38, panel C). Infection with both EnAd-CMV-FAP Bispecific T cell activator and EnAd-SA-FAP Bispecific T cell activator induced T-cell activation and FAP.sup.+ cell depletion in all patient samples, with no significant change in levels of EpCAM+ tumour cells. Parental EnAd or the control viruses induced no observable T cell activation, with FAP.sup.+ cell numbers remaining similar to the uninfected control.

    [0545] Importantly, this depletion in FAP+ fibroblasts consistenly led to a strong reduction in levels of the immunosuppressive cytokine TGF? detected in supernatants (FIG. 38, panel D). In a second series of experiments, total (and unpurified) cells from five patient biopsy samples were evaluated to assess the activity of endogenous tumour-associated T-cells in the samples. Cells were plated in 50% ascites fluid and treated with recombinant control or FAP Bispecific T cell activator proteins, or 100 vp/cell of EnAd or EnAd-Bispecific T cell activator viruses. After 5 days incubation, T-cell activation (by CD25 expression) and residual number of FAP.sup.+ cells was measured by flow cytometry (FIG. 39, panels A&B). In all 3 patient samples, recombinant FAP-Bispecific T cell activator and EnAd-CMV-FAP Bispecific T cell activator induced strong T-cell activation, with up to ?80% of patient-derived T-cells activated, which caused a marked depletion FAP.sup.+ fibroblasts. Interestingly, EnAd-SA-FAP-Bispecific T cell activator induced CD25 expression in ? samples, with no observable activation or FAP.sup.+ cell depletion in patient 1. This is probably due to insufficient tumour cells being present for infection by the virus and production of Bispecific T cell activator protein (no EpCAM.sup.+ tumour cells were detected in this sample by flow cytometry), consistent with the requirement for tumour cells for MLP (SA)-driven transgene expression (this likely also explains the lack of T-cell activation and FAP+ cell depletion by EnAd-SA-FAP-Bispecific T cell activator virus with the patient ascites sample illustrated in FIGS. 42-44). Collectively, the data shows that EnAd expressing FAP-Bispecific T cell activator can, following infection of tumor cells, reproducibly lead to activation of tumour-associated T-cells to kill endogenous fibroblasts.

    [0546] Another experiment investigated whether FAP-Bispecific T cell activator activity could be improved by blocking the PD-1 checkpoint, using a patient biopsy sample in which T-cells were 73.6% PD-1 positive and FAP.sup.+ cells were 62.9% PDL1-positive (FIG. 40, panel A). Co-cultures similar to those described above were set up in the presence or absence of a purified blocking mouse IgG2b antibody to human PDL1 (BioLegend, clone 29E.2A3) at a final concentration of 2.5 ?g/mL. After 2 days of culture, total cells were harvested and residual FAP+ cells and T-cell activation was measured. The inclusion of the blocking anti-PDL1 antibody led to a modest increase in CD25 induction (FIG. 40, panel B) and a two-fold higher IFN? production (FIG. 40, panel C), without altering the depletion of FAP+ cells (FIG. 40, panel D) with near complete lysis by day 2 in either setting.

    [0547] Tumour-associated lymphocytes (TALs) isolated from ovarian cancer patient ascites are reported to have enriched expression of PD-1 and impaired effector functionsincluding cytotoxicity and IFN? production. Consistent with this, PD-1 expression was 2-fold higher on CD3.sup.+ cells from six cancer patient ascites biopsies than on those in peripheral blood mononuclear cells (PBMCs) from three healthy donors (FIG. 41, panel A). To evaluate the functionality of the T-cells within these cancer biopsy samples, NHDF cells and unpurified PBMC or ascites cells (the % CD3+ cells for each of the samples is shown in FIG. 41, panel B) were co-cultured with control or FAP Bispecific T cell activator-containing supernatants, and supernatants were harvested 5 days later and tested for IFN? by ELISA (FIG. 41, panel C). No IFN? was induced by the control Bispecific T cell activator. Three of the ascites cell samples produced IFN? at a similar level to that of the PBMC samples, while the other three had an attenuated response to the FAP Bispecific T cell activator. We next investigate the ability of these T-cells to induce Bispecific T cell activator-mediated lysis of the NHDF cells. NHDF were plated, and PBMC or ascites cells added along with Bispecific T cell activator-containing supernatants and the viability of cells in the culture monitored in real-time using the xCELLigence cytotoxicity assay system. Despite the variability in IFN? production, all ascites samples induced full cytotoxicity of NHDF cells when added with the FAP Bispecific T cell activator, with an overall similar rate of Bispecific T cell activator-mediated NHDF lysis to that seen with when effected by PBMCs (FIG. 41, panel D).

    [0548] To investigate whether the FAP Bispecific T cell activator can mediate T-cell activation in the presence patient malignant exudate samples (all at 50%), PBMC T-cells were activated with control or FAP Bispecific T cell activators in the presence of NHDF cells, or activated with anti-CD3/CD28 Dynabeads, either in 50% normal human serum (NS) or different (cell-free) malignant exudate samples. Whereas in normal serum 74% of T-cells were activated (dual-positive for both CD25 and CD69) at 24 h following stimulation with the anti-CD3/CD28 beads, 3/5 tested ascites fluid significantly attenuated T-cell activation compared to the response in NS (FIG. 42, panel A). However, when PBMCs were cultured with NHDF and stimulated with the FAP Bispecific T cell activator, there was no observable suppression of T-cell activation in the presence of any of the exudate fluids (FIG. 42, panel B), demonstrating that the FAP Bispecific T cell activator can overcome immunosuppressive mechanisms to activate T-cells.

    Example 19

    EnAd-FAP Bispecific T Cell Activator-Mediated Oncolysis and T Cell Stimulation Polarise CD11b+ TAMs in Patient Ascites to a More Activated Phenotype

    [0549] To investigate whether the production of Th1 cytokines, including IFN?, TNF? and IL-2, by FAP Bispecific T cell activator-mediated activation of T-cells, and the subsequent elimination of FAP.sup.+ fibroblasts (and associated reduction in TGF?1 was associated other shifts in the tumour microenvironment from immunosuppressive and pro-oncogenic towards anti-tumour activity, the effect on tumour-associated macrophages (TAMs) in an unseparated ascites cell sample was evaluated. Total unpurified patient ascites cells were plated in 50% ascites fluid and treated with free control or FAP Bispecific T cell activator or infected with EnAd-SA-control Bispecific T cell activator or EnAd-SA-FAP Bispecific T cell activator virus (at 100 vp/cell). In parallel, some cells were treated in with IFN? to induce an activated CD11b myeloid cell phenotype. After 3 days incubation, the activation status of T-cells was first measured; CD25+ cells measured by flow cytometry and IFN? secretion by ELISA.

    [0550] Treatment with FAP Bispecific T cell activator and EnAd-SA-FAP Bispecific T cell activator led to approximately 60% of CD3.sup.+ T-cells becoming CD25+ (FIG. 43, panel A) and large quantities of IFN? in culture supernatants (FIG. 43, panel B). No increase above background by the control Bispecific T cell activator or control virus was observed for CD25 expression or IFN?. To evaluate TAM polarisation, the expression levels of CD64 and CD86 (M1 or activated macrophage markers) and CD206 and CD163 (M2 or TAM markers) were measured on CD11b+ cells by flow cytometry (FIG. 43, panel C). Treatment with free FAP Bispecific T cell activator or EnAd expressing FAP Bispecific T cell activator induce a more activated phenotype, manifested by significant increases in CD64 expression, and strong decreases CD206 and CD 163similar to that observed when IFN? was spiked into the cultures.

    [0551] While treatment with free FAP Bispecific T cell activator or control virus induced no clear change in CD86 above background in this experiment, the EnAd expressing FAP Bispecific T cell activator induced a large increase in CD86 expression, indicating that EnAd virus infection and FAP Bispecific T cell activator activity may synergize to activate primary myeloid cells within a suppressive tumour microenvironment such as the malignant ascetic fluid samples tested here. In this study, IFN? treatment induced a modest decrease in CD86, indicating that the strong increase in CD86 observed by EnAd-SA-FAP Bispecific T cell activator may be via an IFN?-independent mechanism.

    Example 20

    EnAd-FAP Bispecific T Cell Activator Activates Tumour-Infiltrating Lymphocytes and Induces Cytotoxicity in Solid Prostate Tumour Biopsies Ex Vivo

    [0552] Tissue slice cultures provide one of the most realistic preclinical models of diverse tissues, organs and tumours. To evaluate the activity of the FAP Bispecific T cell activator expressing viruses in this highly clinically-relevant setting, several paired punch biopsies of malignant and benign prostate tissue from resected human prostates were studies. At initial screening, prostate tissue was reproducibly shown to have circular rings of EpCAM+ tumour cells (FIG. 44, panel A) interspersed between large regions of stroma containing scattered CD8 T-cells (FIG. 44, panel B). FAP staining was found on fibroblasts adjacent to tumour regions (FIG. 44, panel C).

    [0553] Cores were sliced by a vibratome to 300um thickness and slice cultures established in the presence of virus (1.5e9 vp/slice), or left uninfected. After 7 days, slices were fixed, paraffin-embedded, sectioned and T-cell activation status was assessed by immunohistochemistry (IHC) by staining for CD25 expression (FIG. 44, panel D). Only samples receiving EnAd-CMV-FAP Bispecific T cell activator or EnAd-SA-FAP Bispecific T cell activator showed activation of tumour-infiltrating T-cells, manifest by strong CD25 staining. Neither untreated or control virus-treated had detectable CD25-positive cells. Supernatants from these slice cultures taken at 4 and 7 days post-infection were tested for IFN? and IL-2 by ELISA, with increases in IFN? detected from malignant, but not benign, prostate slice cultures infected with either FAP Bispecific T cell activator virus (FIG. 44, panel E) and IL-2 detected in cultures with EnAd-SA-FAP Bispecific T cell activator virus (FIG. 44, panel F). The EnAd-SA-FAP Bispecific T cell activator induced higher quantities of IFN?, which were detectable earlier, than the CMV-driven FAP Bispecific T cell activator virus.

    Example 21Further EnAd Viruses Expressing FAP Bispecific T Cell Activators

    [0554] Five viruses (NG-611, NG-612, NG-613, NG-614, NG-617) were generated that encode a single Bispecific T cell activator (Table 8).

    TABLE-US-00009 TABLE 8 Virus ID Transgene Cassette NG-612 (SEQ ID NO: 78 SSA.sup.1-FAP Bispecific T cell activator.sup.5-His.sup.3-PA.sup.4 NG-613 (SEQ ID NO: 79) SA.sup.6-FAP Bispecific T cell activator.sup.5-His.sup.3-PA.sup.4 NG-614 (SEQ ID NO: 73) SA.sup.6-FAP Bispecific T cell activator.sup.7-His.sup.3-PA.sup.4 NG-617 (SEQ ID NO: 81) SSA.sup.1-FAP Bispecific T cell activator.sup.5-PA.sup.4

    [0555] In each transgene cassette, the cDNA encoding the Bispecific T cell activator was flanked at the 5 end with either a short splice acceptor sequence (SSA, CAGG) or a longer splice acceptor sequence (SA, SEQUENCE ID NO: 45). At the 3 end of the Bispecific T cell activator, a SV40 late poly(A) sequence (PA, SEQUENCE ID NO: 54) was encoded preceded by either a Histidine tag (HIS)or no tag. In viruses NG-611, NG-612, NG-613 and NG-617 the anti-CD3 portion of the Bispecific T cell activator molecule used a single chain variant of the mouse anti-human CD3& monoclonal antibody OKT3.

    Virus Production

    [0556] The plasmid pEnAd2.4 was used to gerneate the plasmids pNG-611, pNG-612, pNG-613, pNG-614 and pNG-617 by direct insertion of synthesised transgene cassettes (SEQ ID NOs: 70-74, respectively). The pNG-612, pNG-613 and pNG-617 transgene cassettes encode a FAP targeting Bispecific T cell activator of SEQ ID NO. 75 and the pNG-614 transgene cassette encodes a FAP targeting Bispecific T cell activator of SEQ ID NO. 76. A schematic of the transgene cassette is shown in FIG. 45. Construction of plasmid DNA was confirmed by restriction analysis and DNA sequencing.

    [0557] The plasmids, pNG-611, pNG-612, pNG-613, pNG-614 and pNG-617, were linearised by restriction digest with the enzyme AscI to produce the virus genomes. The viruses were amplified and purified according to methods given below.

    [0558] Digested DNA was purified by phenol/chloroform extraction and precipitated for 16 hrs, ?20? C. in 300 ?l>95% molecular biology grade ethanol and 10 ?l 3M Sodium Acetate. The precipitated DNA was pelleted by centrifuging at 14000 rpm, 5 mins and was washed in 500 ?l 70% ethanol, before centrifuging again, 14000 rpm, 5 mins. The clean DNA pellet was air dried, resuspended in 500 ?l OptiMEM containing 15 ?l lipofectamine transfection reagent and incubated for 30 mins, RT. The transfection mixture was then added drop wise to a T-25 flask containing 293 cells grown to 70% confluency. After incubation of the cells with the transfection mix for 2 hrs at 37? C., 5% CO.sub.2 4 mls of cell media (DMEM high glucose with glutamine supplemented with 2% FBS) was added to the cells and the flasks was incubated 37? C., 5% CO.sub.2.

    [0559] The transfected 293 cells were monitored every 24 hrs and were supplemented with additional media every 48-72 hrs. The production of virus was monitored by observation of a significant cytopathic effect (CPE) in the cell monolayer. Once extensive CPE was observed the virus was harvested from 293 cells by three freeze-thaw cycles. The harvested viruses were used to re-infect 293 cells in order to amplify the virus stocks. Viable virus production during amplification was confirmed by observation of significant CPE in the cell monolayer. Once CPE was observed the virus was harvested from 293 cells by three freeze-thaw cycles. The amplified stocks of viruses were used for further amplification before the viruses were purified by double caesium chloride banding to produce purified virus stocks.

    Virus Activity Assessed by qPCR

    [0560] A549 cells, either infected for 72 hrs with 1ppc NG-611, NG-612, NG-617, enadenotucirev or left uninfected, were used for quantification of viral DNA by qPCR. Cell supernatants were collected and clarified by centrifuging for 5 mins, 1200 rpm. DNA was extracted from 45 ?L of supernatant using the Qiagen DNeasy kit, according to the manufacturer's protocol. A standard curve using enadenotucirev virus particles (2.5e10-2.5e5vp) was also prepared and extracted using the DNeasy kit. Each extracted sample or standard was analysed by qPCR using a virus gene specific primer-probe set to the early gene E3.

    [0561] Quantification of the number of detected virus genomes per cell demonstrated that NG-611, NG-612, and NG-617 showed significant genome replication in A549 cell lines (FIG. 46). This was similar for all viruses tested including the parental virus enadenotucirev, indicating that inclusion of the Bispecific T cell activator transgene does not impact virus replicative activity. No virus genomes could be detected in uninfected cells (data not shown).

    T Cell Activation and Degranulation Mediated by Bispecific T Cell Activator Expressing Viruses.

    Carcinoma Cell Infection

    [0562] A549 cells were seeded into 24 well plates at a density of 2.5e5 cells/well. Plates were incubated for 4 hrs, 37? C., 5% CO.sub.2, before cells were either infected with 1 ppc of NG-611, NG-612, enadenotucirev or were left uninfected. At 24, 48 or 72 hrs post-infection supernatants were harvested from the cells, clarified by centrifuging for 5 mins, 1200 rpm and snap frozen.

    T Cell Assay

    [0563] FAP expressing lung fibroblast cell lines MRC-5, or EpCam expressing ovarian carcinoma cells, SKOV3 were seeded into 48 well plates at densities of 5.7e4 cells/well and 1.2e5 cells/well, respectively. Plates were incubated for 4 hrs, 37? C., 5% CO.sub.2, before media was replaced with 150 ?L/well of thawed supernatant harvested from the A549 plates. Purified CD3 T cells isolated form human PBMC donors were then also added to the plates to give a ratio of T cells to MRC-5 or SKOV3 of 2 to 1. The co-cultures were incubated for 16 hrs, 37? C., 5% CO.sub.2 before cellular supernatants were collected for ELISA analysis and T cells harvested for flow cytometry analysis. Culture media containing non-adherent cells was removed from co-culture wells and centrifuged (300?g). The supernatant was carefully removed, diluted 1 in 2 with PBS 5% BSA and stored for ELISA analysis. The adherent cell monolayers were washed once with PBS and then detached using trypsin. The trypsin was inactivated using 10% FBS RPMI media and the cells were added to the cell pellets that had been collected from the culture supernatants. The cells were centrifuged (300?g), the supernatant discarded and the cell pellet washed in 200 ?L of PBS. The cells were centrifuged again then resuspended in 50 ?L of PBS containing Live/Dead Aqua (Life tech) for 15 minutes at RT. The cells were washed once in FACs buffer before staining with panels of directly conjugated antibodies: anti-CD3 conjugated to AF700; anti-CD25 conjugated to BV421; anti-HLA-DR conjugated to PE/CY5; anti-CD40L conjugated to BV605; anti-CD69 conjugated to PE and anti-CD107a conjugated to FITC. A sample of cells from each co-culture condition was also stained with relevant isotype control antibodies. All staining was carried out in FACs buffer in a total volume of 50 ?L/well for 15 minutes, 4?C. Cells were then washed twice with FACs buffer (200uL) before resuspension in 200 ?L of FACs buffer and analysis by Flow cytometry (Attune).

    Upregulation of T Cell Activation Markers

    [0564] Flow cytometry analysis of T cell activation was assessed by expression of the T cell activation markers CD25, CD69, HLA-DR and CD40L or the T cell degranulation marker, CD107a on live, single cells. These data showed that when co-cultured with EpCam.sup.+ SKOV3 cells the number of T cells expressing CD25, CD69, HLA-DR, CD40L or cell surface CD107a was significantly increased when NG-611 supernantants were added to the cells compared to NG-612, enadenotucirev or untreated control supernatants (FIG. 47). For all these markers little T cell activation was stimulated by supernatants from A549 cells infected for 24 hrs however, by 48 hrs post-infection, supernatants stimulated significant T cell activation across all markers. This was also the case at 72 hrs post-infection.

    [0565] When co-cultured with FAP.sup.+ MRC-5 cells the number of T cells expressing CD25, CD69, HLA-DR, CD40L or cell surface CD 107a was significantly increased when NG-612 supernantants were added to the cells compared to NG-611, enadenotucirev or untreated control supernatants (FIG. 48). Some T cell activation could also be observed with the NG-611 virus, which was likely due to low but detectable expression of EpCam (?5%) on the MRC-5 cell lines engaging the EpCam Bispecific T cell activator expressed by the NG-611 virus (FIG. 49). For all these markers, little T cell activation was stimulated by supernatants from A549 cells infected for 24 hrs however, by 48 hrs post-infection, supernatants stimulated significant T cell activation across all markers. CD25 and CD69 markers were also upregulated following incubation with supernatants harvested 72 hrs post-infection, however, activation markers, HLA-DR, CD40L and CD107a were detected at lower levels with supernatants harvested 72 hrs post-infection than 48 hrs post-infection. This could be due to high levels of Bispecific T cell activator present at this later stage of infection leading to rapid and potent T cell activation that means the effector functions need to measured at timepoints earlier than 16 hrs post-incubation with the supernatants.

    [0566] For detection of IFN? expression, co-culture supernatants were diluted into 5% BSA/PBS assay buffer (in a range of 1:10 to 1:1000) and ELISA was carried out using the Human IFN gamma Quantikine ELISA kit (R&D systems) according to the manufacturer's protocol. The concentration of secreted IFN? was determined by interpolating from the standard curve. Expression of IFN? could only be detected in the supernatants of co-cultures using NG-611 on SKOV3 cells FIG. 50A) or NG-611, NG-612 on MRC-5 cells (FIG. 50B).

    Example 22 Immune Activation and Anti-Tumour Efficacy of Bispecific T Cell Activator Expressing Viruses In Vivo

    [0567] NSG mice humanised CD34+ haematopoietic stem cells (from Jackson Labs) were implanted with HCT116 tumour cells subcutaneously on both flanks at 18 weeks post engraftment. Once tumours reached 80-400 mm.sup.3 mice were grouped such that each treatment arm had an equivalent distribution of tumour volumes, 7 mice per group. Mice were injected intratumourally with either saline, enadenotucirev or NG-611 at 5?10.sup.9 particles per injection, 2 injections per tumour. Tumours on both flanks were treated. Tumour volume was measured 3-4 times per week and demonstrated that NG-611 treatment resulted in a significant anti-tumour response out to 20 days post-dosing compared to enadenotucirev or untreated controls (FIG. 51, panel a). After the 20 days post-dosing one tumour from 4 mice in each group was processed for flow cytometry while remaining tumours were frozen on dry ice.

    Flow cytometry

    [0568] Tumour samples were mechanically disaggregated immediately following resection in a small volume of RPMI media. Disaggregated tumours were then passed through a 70 ?m cell strainer and centrifuged at 300 g for 10 minutes. Cell pellets were resuspended in 100 ?L of PBS containing Live/Dead Aqua (Life tech) for 15 minutes on ice. The cells were washed once in FACs buffer (5% BSA PBS) before staining with a panel of directly conjugated antibodies: anti-CD8 (RPA-T8, AF700); anti-CD4 (RPA-T4, PE); anti-CD45 (2D1, APC-Fire 750); anti-CD3 (OKT3, PerCP-Cy5.5); anti-CD25 (M-A251, PE-Dazzle 594); anti-CD69 (FN50, APC); anti-HLA-DR (L243, BV605); anti-CD107a (H4A3, FITC). A pool of tumour cell suspensions was also stained with relevant isotype control antibodies. All staining was carried out in FACs buffer in a total volume of 50 ?L/well for 20 minutes at 4? C. Cells were washed three times with FACs buffer (200 ?L) before resuspension in 200 ?L of FACs buffer and analysis by Flow cytometry (Attune). FACs analysis demonstrated that the ratio of CD8 to CD4 T cells in the tumour was significantly increased in NG-611 treated tumours compared to enadenotucirev treated or untreated controls (FIG. 51, panel b).

    Example 23EnAd Viruses Co-Expressing FAP Bispecific T Cell Activators and Immune-Modulatory Cytokines and Chemokines

    [0569] Three viruses (NG-615, NG-640 and NG-641) were generated that encoded a FAP Bispecific T cell activator and immunomodulatory proteins (Table 9).

    TABLE-US-00010 TABLE 9 Virus ID Transgene Cassette NG-615 (SEQ ID NO: 82) SSA.sup.1-FAP Bispecific T cell activator.sup.2-E2A.sup.3-Flt3L.sup.4-P2A.sup.5-MIP1?.sup.6-T2A.sup.7-IFN?.sup.8-PA.sup.9 NG-640 (SEQ ID NO: 83) SSA.sup.1-FAP Bispecific T cell activator.sup.2-P2A.sup.5-CXCL10.sup.10-T2A.sup.7-CXCL9.sup.11-PA.sup.6 NG-641 (SEQ ID NO: 84) SSA.sup.1-FAP Bispecific T cell activator.sup.5-P2A.sup.5-CXCL10.sup.10-T2A.sup.7-CXCL9.sup.11-E2A.sup.3-IFN?.sup.8-PA.sup.6 NG-615 (SEQ ID NO: 278) SA.sup.12-FAP Bispecific T cell activator.sup.2-E2A.sup.3-Flt3L.sup.4-P2A.sup.5-MIP1?.sup.6-T2A.sup.7-IFN?.sup.8-PA.sup.9

    Virus Production

    [0570] The plasmid pEnAd2.4 was used to gerneate the plasmids pNG-615, pNG-616, pNG-640 and pNG-641 by direct insertion of synthesised transgene cassettes (SEQ ID NOs: 93-95, respectively). NG-615 and NG-616 contain four transgenes encoding for a FAP-targeting Bispecific T cell activator (SEQ ID NO: 75), Flt3L (SEQ ID NO. 96), MIP1? SEQ ID NO. 97) and IFN? (SEQ ID NO. 98). NG-640 and NG-641 encode for a FAP targeting Bispecific T cell activator (SEQ ID NO. 75), CXCL9 (SEQ ID NO. 99) and CXCL10 (SEQ ID NO. 100), NG-641 also contains a fourth transgene encoding IFN? (SEQ ID NO. 98). Construction of plasmid DNA was confirmed by restriction analysis and DNA sequencing.

    [0571] The plasmids, pNG-615, pNG-616, pNG-640 and pNG-641, were linearised by restriction digest with the enzyme AscI to produce the virus genomes. The viruses were amplified and purified according to methods detailed in Example 33.

    Virus Activity Assessed by qPCR and Transgene ELISA

    Carcinoma Cell Infection

    [0572] A549 cells either infected for 72 hrs with 1 ppc NG-615, enadenotucirev or left uninfected were used for quantification of viral DNA by qPCR and analysis of transgene expression by ELISA. Cell supernatants were collected and clarified by centrifuging for 5 mins, 1200 rpm. 45 ?L of supernatant was used for DNA analysis and the remaining supernatant was used for ELISA.

    qPCR

    [0573] DNA was extracted from the supernatant sample using the Qiagen DNeasy kit, according to the manufacturer's protocol. A standard curve using enadenotucirev virus particles (2.5e10-2.5e5vp) was also prepared and extracted using the DNeasy kit Each extracted sample or standard was analysed by qPCR using a virus gene specific primer-probe set to the early gene E3. Quantification of the number of detected virus genomes per cell demonstrated that NG-615 showed significant genome replication in A549 cell lines at a level similar to that of the parental virus enadenotucirev (FIG. 52). These data indicated that inclusion of the Bispecific T cell activator and three immunomodulatory transgenes does not significantly impact virus replicative activity. No virus genomes could be detected in uninfected cells.

    ELISA

    [0574] IFN? ELISA was carried out using the Verikine Human IFN alpha Kit (Pbl assay science), MIP1? ELISA was carried out using the Human CCL3 Quantikine ELISA kit (R & D systems) and Flt3L ELISA was carried out using the Flt3L human ELISA kit (Abcam). All assays were carried out according to the manufacturers' protocol.

    [0575] The concentrations of secreted IFN?, MIP? or FLt3L were determined by interpolating from the standard curves. IFN?, MIP1? and Flt3 L expression could be detected in the cellular supernatant of NG-615 but not enadenotucirev or untreated control cells (FIG. 53).

    T Cell Activation and Degranulation Mediated by Bispecific T Cell Activator Expressing Viruses.

    Carcinoma Cell Infection

    [0576] A549 cells were seeded into 24 well plates at a density of 2.5e5 cells/well. Plates were incubated for 4 hrs, 37? C., 5% CO.sub.2, before cells were either infected with 1 ppc of NG-612, NG-615, enadenotucirev or were left uninfected. At 24, 48 or 72 hrs post-infection supernatants were harvested from the cells, clarified by centrifuging for 5 mins, 1200 rpm and snap frozen.

    T Cell Assay

    [0577] FAP expressing lung fibroblast cell lines MRC-5 were seeded into 48 well plates at a density of 5.7e4 cells/well. Plates were incubated for 4 hrs, 37?C, 5% CO2, before media was replaced with 150 ?L/well of thawed supernatant harvested from the A549 plates. Purified CD3 T cells isolated form human PBMC donors were then also added to the plates to give a ratio of T cells to MRC-5 of 2 to 1. The co-cultures were incubated for 16 hrs, 37? C., 5% CO.sub.2 before cellular supernatants were collected for ELISA analysis and T cells harvested for flow cytometry analysis according to the methods detailed in Example 29.

    Upregulation of T Cell Activation Markers

    [0578] Flow cytometry analysis of T cell activation was assessed by expression of the T cell activation markers CD25, CD69, HLA-DR and CD40L or the T cell degranulation marker, CD107a on live, CD3.sup.+, single cells. These data showed that when co-cultured with FAP.sup.+ MRC-5 cells the number of T cells expressing CD25, CD69, HLA-DR, CD40L or CD 107a was significantly increased when NG-615 or 612 supernantants were added to the cells compared to enadenotucirev or untreated control supernatants (FIG. 54).

    Secretion of the Stimulatory Cytokine IFN?

    [0579] For detection of IFN? expression, co-culture supernatants were diluted into 5% BSA/PBS assay buffer (in a range of 1:10 to 1:1000) and ELISA was carried out using the Human IFN gamma Quantikine kit (RandD Systems) according to the manufacturer's protocol. The concentration of secreted IFN? was determined by interpolating from the standard curve. Expression of IFN? could only be detected in the supernatants of co-cultures using NG-612 or NG-615 infected A549 supernatants (FIG. 55).

    TABLE-US-00011 SEQIDNO:95 TransgenecassetteforNG-641 CAGGCCCACCATGGGCTGGAGCTGCATCATCTTGTTCCTGGTCGCAACTG CTACCGGAGTCCATTCGGACATCGTCATGACCCAAAGCCCTGACTCGCTC GCTGTGTCACTGGGAGAGCGGGCGACTATCAACTGCAAATCATCCCAGAG CCTGCTGTATTCACGCAATCAGAAAAACTACCTGGCCTGGTATCAGCAGA AGCCGGGCCAGCCTCCCAAGCTGCTGATCTTCTGGGCCTCCACCCGCGAA AGCGGCGTGCCGGACCGCTTCAGCGGAAGCGGATTCGGAACTGACTTTAC TCTGACCATTAGCTCCTTGCAGGCGGAGGACGTGGCCGTCTACTACTGCC AGCAGTATTTCTCCTATCCGCTCACCTTTGGGCAAGGCACCAAGGTGGAG ATTAAGGGAGGGGGCGGCAGCGGGGGAGGCGGCAGCGGCGGCGGGGGATC GCAGGTCCAGCTCGTCCAATCCGGAGCCGAAGTCAAGAAGCCGGGAGCGT CGGTCAAGGTCAGCTGCAAAACTTCGCGCTACACCTTCACTGAGTACACG ATCCACTGGGTCCGCCAGGCGCCCGGCCAGCGGCTGGAGTGGATCGGCGG GATCAACCCAAACAACGGAATCCCAAATTACAATCAGAAATTTAAAGGGC GGGTGACTATCACCGTGGATACCTCGGCCTCCACGGCGTACATGGAGCTC TCATCACTCAGATCGGAGGACACCGCGGTCTATTACTGCGCCCGCCGCCG GATCGCTTATGGATACGATGAAGGACATGCGATGGATTACTGGGGCCAGG GCACCCTCGTCACGGTGTCGTCAGGAGGCGGCGGTTCACAGGTGCAGCTG CAGCAGTCTGGGGCTGAACTGGCAAGACCTGGGGCCTCAGTGAAGATGTC CTGCAAGGCTTCTGGCTACACCTTTACTAGGTACACGATGCACTGGGTAA AACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGC CGTGGTTATACTAATTACAATCAGAAGTTCAAGGACAAGGCCACATTGAC TACAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACAT CTGAGGACTCTGCAGTCTATTACTGTGCAAGATATTATGATGATCATTAC TGCCTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGGTGG CGGTGGCTCGGGCGGTGGTGGATCTGGTGGCGGCGGATCTGATATCGTGC TCACTCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGTCACC ATGACCTGCAGTGCCAGCTCAAGTGTAAGTTACATGAACTGGTACCAGCA GAAGTCAGGCACCTCCCCCAAAAGATGGATTTATGACACATCCAAACTGG CTTCTGGAGTCCCTGCTCACTTCAGGGGCAGTGGGTCTGGGACCTCTTAC TCTCTCACAATCAGCGGCATGGAGGCTGAAGATGCTGCCACTTATTACTG CCAGCAGTGGAGTAGTAACCCATTCACGTTCGGCTCGGGGACAAAGTTGG AAATAAACCGGGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCT GGAGACGTGGAGGAGAACCCTGGACCTAATCAAACTGCCATTCTGATTTG CTGCCTTATCTTTCTGACTCTAAGTGGCATTCAAGGAGTACCTCTCTCTA GAACTGTACGCTGTACCTGCATCAGCATTAGTAATCAACCTGTTAATCCA AGGTCTTTAGAAAAACTTGAAATTATTCCTGCAAGCCAATTTTGTCCACG TGTTGAGATCATTGCTACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGA ATCCAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGTTAGCAAGGAA AGGTCTAAAAGATCTCCTGGAAGCGGAGAGGGCAGAGGAAGTCTGCTAAC ATGCGGTGACGTCGAGGAGAATCCTGGACCTAAGAAAAGTGGTGTTCTTT TCCTCTTGGGCATCATCTTGCTGGTTCTGATTGGAGTGCAAGGAACCCCA GTAGTGAGAAAGGGTCGCTGTTCCTGCATCAGCACCAACCAAGGGACTAT CCACCTACAATCCTTGAAAGACCTTAAACAATTTGCCCCAAGCCCTTCCT GCGAGAAAATTGAAATCATTGCTACACTGAAGAATGGAGTTCAAACATGT CTAAACCCAGATTCAGCAGATGTGAAGGAACTGATTAAAAAGTGGGAGAA ACAGGTCAGCCAAAAGAAAAAGCAAAAGAATGGGAAAAAACATCAAAAAA AGAAAGTTCTGAAAGTTCGAAAATCTCAACGTTCTCGTCAAAAGAAGACT ACAGGAAGCGGACAGTGTACTAATTATGCTCTCTTGAAATTGGCTGGAGA TGTTGAGAGCAACCCTGGACCTGCCTTGACCTTTGCTTTACTGGTGGCCC TCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGATCTGCCT CAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGAT GAGGAGAATCTCTCTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGAT TTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCT GTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGA CTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAATTCTACACTGAAC TCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGG GTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAA ATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTT GTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCA ACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAATAAGCTAGCTTGACTGA CTGAGATACAGCGTACCTTCAGCTCACAGACATGATAAGATACATTGATG AGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGT GAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAA ACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGG AGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAGT CGTCAGCTAT