Hydroxyacyl-coenzyme A dehydrogenase gene, an acyl-coenzyme A thiolase gene, genetically engineered strains and a use thereof

10351891 ยท 2019-07-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a hydroxyacyl-coenzyme A dehydrogenase gene, an acyl-coenzyme A thiolase gene, genetically engineered strains and a use thereof. The hydroxyacyl-coenzyme A dehydrogenase gene encodes a protein (i) or (ii) as follows: (i) having an amino acid sequence according to SEQ ID NO 2; (ii) derived by substituting, deleting or inserting one or more amino acids in the amino acid sequence defined by (i) and having the same function as that of the protein of (i). The present invention constructs genetically engineered Mycobacterium strains lacking of a hydroxyacyl-coenzyme A dehydrogenase gene or an acyl-coenzyme A thiolase gene, which are used in the preparation of steroidal compounds, such as 1,4-BNA, 4-BNA, 9-OH-BNA, etc. Further, the invention improves the production efficiency and product quality of steroidal drug, improves the utilization of drug precursors, reduces the production costs, and provides the advantages of mild reaction conditions, environmentally friendly, and high economic and social benefits.

Claims

1. A method of preparing steroidal compounds, comprising the steps of: providing a Mycobacterium NwIB-00 having hydroxyacyl-coenzyme A dehydrogenase gene and acyl-coenzyme A thiolase gene, said hydroxyacyl-coenzyme A dehydrogenase gene encodes a protein having an amino acid sequence according to SEQ ID NO 2, and said acyl-coenzyme A thiolase gene encodes a protein having an amino acid sequence according to SEQ ID NO 4; and constructing six different genetically engineered Mycobacterium neoaurum strains NwIB-X01, NwIB-X02, NwIB-X03, NwIB-X04, NwIB-X05 and NwIB-X06 from the Mycobacterium NwIB-00 by the method of gene knockout, and culturing the six different genetically engineered Mycobacterium neoaurum strains to transform and degrade sterol to produce the steroidal compounds as follows: NwIB-X01 lacking hydroxyacyl-coenzyme A dehydrogenase gene (hsd4A) and 3-ketosteriod-9-hydroxylase (kshA1) produces 1,4-BNA and 4-BNA; NwIB-X02 lacking hsd4A and 3-ketosteroid-.sup.1-dehydrogenase gene (kstd1) and kshA1 produces 1,4-BNA and 4-BNA; NwIB-X03 lacking hsd4A and kshA1 and kstd1 and kstd2 and kstd3 produces 4-BNA and 9-OH-BNA; NwIB-X04 lacking hsd4A and kstd1 produces 9-OH-BNA and 9-OH-AD; NwIB-X05 lacking hsd4A and kstd1 and kstd2 and kstd3 produces 9-OH-BNA; and NwIB-X06 lacking kshA1 and acyl-coenzyme A thiolase gene (fadA5) produces 1,4-BNA and 4-BNA.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows schematic diagram of equation and key enzymes of microbial degradation of sterols for preparing 4-BNA, 1,4-BNA, 9-OH-BNA.

(2) FIG. 2 shows a hydroxyacyl-coenzyme A dehydrogenase (hsd4A)-deficient strain is obtained through two-step screening of Mycobacterium transformants by the application of existing screening techniques, wherein M is the DNA standard marker; DCO is the amplification result of screened strain with deleted hsd4A gene by double exchange; and wt is the PCR amplification result of origin strain with the same primers.

(3) FIG. 3 shows an acyl-coenzyme A thiolase (fadA5)-deficient strain is obtained through two-step screening of Mycobacterium transformants by the application of existing screening techniques, wherein M is the DNA standard marker; DCO is the amplification result of screened strain with deleted hsd4A gene by double exchange; and wt is the PCR amplification result of origin strain with the same primers.

(4) FIG. 4 is a thin layer chromatogram (TLC) of the transformation results of phytosterols by Mycobacterium NwIB-00.

(5) FIG. 5 is a thin layer chromatogram (TLC) of the transformation results of phytosterols by the hydroxylase coenzyme A dehydrogenase gene-deficient strain, and the acyl-coenzyme A thiolase gene-deficient strain.

(6) FIG. 6 is a high performance liquid chromatogram of the transformation results of phytosterols by the hydroxylase coenzyme A dehydrogenase gene-deficient strain, and the acyl-coenzyme A thiolase gene-deficient strain.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

(7) In order to better understand the present invention, the invention is further described in connection with following specific embodiments. It should be understood that the following examples are intended to illustrate the invention and are not intended to limit the scope of the invention.

(8) The experimental methods, if no specific condition is indicated, in the following examples, are generally carried out according to conventional conditions, as described in Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).

(9) The gene manipulation technique employed in the present invention is mainly an unlabeled enzyme function inactivation technique. The unlabeled enzyme function inactivation technology mainly comprises: non-resistant markers in-frame deletion of hydroxyacyl-coenzyme A dehydrogenase gene or acyl-coenzyme A thiolase gene.

(10) The Escherichia coli DH5a and pMD19-T vectors used in the examples of the present invention were purchased from Novagen Corporation and the primers were synthesized by Takara Corporation.

(11) The steroidal substrate used in the present invention is 3-alcohol-5-ene-steroids, only for example, sterols as a class of 3-alcohol-5-ene-steroids. The sterols are usually derived from plants and animals, such as cholesterol and phytosterols, wherein the cholesterol can be derived from animal fats, and the phytosterols are available in a variety of sources, such as deodorant distillate from vegetable oil processing, and tall oil from the pulp and paper industry. The phytosterols are generally a mixture, usually contain sitosterol, stigmasterol, campesterol and brassicasterol. Some of the sterols may also be derived from microorganisms, such as, ergosterol and the like.

(12) The Mycobacteria referred to in the present invention are non-pathogenic fast growing Mycobacteria. In order to better understand the present invention, a standard strain NwIB-00 (Accession No. as follows: ATCC 25795) of Mycobacterium neoaurum is used as a specific embodiment for further illustration. It should be understood that the following examples are intended to illustrate the invention and are not intended to limit the scope of the invention.

Example 1 Construction of Engineered Strains by Deleting Bydroxyacyl-Coenzyme A Dehydrogenase Gene or Acyl-Coenzyme A Thiolase Gene Based on Mycobacterium NwIB-00

(13) In the present example, the main technical means and method of homologous recombination and double exchange knockout used in Mycobacteria are described by taking the knockout of the hydroxyacyl-coenzyme A dehydrogenase gene as an example, and the knockout of the acyl-coenzyme A thiolase gene is completed by the same method. There are a variety of methods for Mycobacterium gene knockout, and the method of gene knockout is not limited here. A gene knockout method developed by Professor Tanya Parish is used as an example here to illustrate the target gene knockout (Bhavna G Gordhan And Tanya Parish. Gene replacement using pretreated DNA. Mycobacterium tuberculosis protocols. 2001, pp 77-92).

(14) Mycobacterium hydroxy-coenzyme A dehydrogenase gene knockout plasmid is constructed, and then is electro-transformed into Mycobacterium. Screening is carried out with kanamycin and hygromycin, and then re-screened with sucrose plate to obtain gene knockout recombinants. The recombinants are validated by PCR. The present invention is directed to one or more genes knockout of the hydroxyacyl-coenzyme A dehydrogenase gene, the 3-ketosteroid-9-hydroxylase gene, the 3-ketosteroid-.sup.1-dehydrogenase gene, and the acyl-coenzyme A thiolase gene from Mycobacterium NwIB-00, to obtain six different Mycobacterium strains, named in turn, NwIB-X01, NwIB-X02, NwIB-X03, NwIB-X04, NwIB-X05, NwIB-X06.

(15) Among them, the NwIB-X01 strain is obtained by the knockout of the 3-ketosteroid-9-hydroxylase gene (kshA1) and the hydroxyacyl-coenzyme A dehydrogenase gene (hsd4A) (there is no order for knockout) from the NwIB-00 strain, which cannot degrade the steroidal mother nucleus, that is to say, one 3-ketosteroid-9-hydroxylase gene and one hydroxyacyl-coenzyme A dehydrogenase gene, i.e., kshA1+hsd4A are knocked out.

(16) NwIB-X02 strain is obtained by the knock out of the 3-ketosteroid-.sup.1-dehydrogenase gene from the NwIB-X01 strain, that is to say, one 3-ketosteroid-9-hydroxylase gene, one hydroxyacyl-coenzyme A hydrogenase gene, and one 3-ketosteroid-.sup.1-dehydrogenase gene (kstd1), i.e., kshA1+hsd4A+kstd1 are knocked out.

(17) NwIB-X03 strain is a derivative of NwIB-X02 and is obtained on the basis of the NwIB-X02 strain by the knockout of other two 3-ketosteroid-.sup.1-dehydrogenase genes, that is to say, one 3-ketosteroid-9-hydroxylase gene, one hydroxyacyl-coenzyme A dehydrogenase gene, and three 3-ketosteroid-.sup.1-dehydrogenase genes, i.e., kshA1+hsd4A+kstd1+kstd2+kstd3 are knocked out.

(18) NwIB-X04 strain is obtained by the knockout of the 3-ketosteroid-.sup.1-dehydrogenase gene and the hydroxyacyl-coenzyme A dehydrogenase gene from the NwIB-00 strain (there is no order for knockout), that is to say, one hydroxyacyl-coenzyme A dehydrogenase gene, and one 3-ketosteroid-.sup.1-dehydrogenase gene, i.e., hsd4A+kstd1 are knocked out.

(19) NwIB-X05 strain is a derivative of NwIB-X04 and is obtained by the knockout of other two 3-ketosteroid-.sup.1-dehydrogenase genes from the NwIB-X04 strain, that is to say, one hydroxy-coenzyme A dehydrogenase gene, and three 3-ketosteroid-1-dehydrogenase genes, i.e., hsd4A+kstd1+kstd2+kstd3 are knocked out.

(20) NwIB-X06 strain is obtained by the knockout of the 3-ketosteroid-9-hydroxylase gene and the acyl-coenzyme A thiolase gene from the NwIB-00 strain, that is to say, one 3-ketosteroid-9-hydroxylase gene and one acyl-coenzyme A thiolase gene, i.e., kshA1+fadA5 are knocked out.

(21) Wherein, the sequence and knockout method for the 3-ketosteroid-9-hydroxylase gene (kshA1) can be specifically found in the patent specification of Application CN200910051613.7, which will not be described here.

(22) Among them, these three kinds of 3-ketosteroid-.sup.1-dehydrogenase (kstd1, kstd2, kstd3) are isozyme having similar sequence, and the sequence and knockout method can be found in the patent specification of Application CN200910051615.6, which will not be described here.

(23) 1.1 The Acquisition of Upstream and Downstream Sequences Adjacent to Hydroxyacyl-Coenzyme A Dehydrogenase Gene and the Construction of Knockout Plasmid

(24) The whole genome of Mycobacterium NwIB-00 was sequenced and annotated. Then the complete reading frame sequence of hydroxyacyl-coenzyme A dehydrogenase gene was founded in combination with the reported gene cluster information of similar strains. The upstream and downstream sequences adjacent to hydroxyacyl-coenzyme A dehydrogenase gene were obtained. Based on the upstream and downstream sequences, the upstream and downstream primers for the knockout of the hydroxyacyl-coenzyme A dehydrogenase gene were designed using the software Oligo 6.0 and Primer 5.0 as follows:

(25) TABLE-US-00001 SEQIDNO.5 Q-hsd4A-uF: TATACTGCAGTATCGGCTGCGCCGAGACCAGTGCGA SEQIDNO.6 Q-hsd4A-uR: TCGCGAATTCCACGACGGCAACCTTTCCGGACAGG SEQIDNO.7 Q-hsd4A-dF: GCGCGAATTCAACGGGCAGCTGTTCATCGTGTACG SEQIDNO.8 Q-hsd4A-dR: CGCGAAGCTTTCAGGATGGTCAACCCGTTGATGAA

(26) The upstream and downstream fragments of the hydroxyacyl-coenzyme A dehydrogenase gene were obtained by PCR amplification using the M. neoaurum NwIB-00 genome as template. The upstream and downstream genes of the target gene were respectively cloned into pMD19-T vector, and then digested with PstI, EcoRI, EcoRI, HindIII respectively, and the digested products were ligated to the corresponding digested Mycobacterium gene knockout plasmid pNL. The above mentioned plasmid and pGOAL19 plasmid were digested with PacI and connected non-directionally to construct the gene knockout plasmid QC-hsd4A.

(27) 1.2 The Acquisition of Upstream and Downstream Sequences Adjacent to Acyl-Coenzyme A Thiolase Gene and the Construction of Knockout Plasmid

(28) According to the method of Example 1.1, the upstream and downstream primers for knockout of the acyl-coenzyme A thiolase gene (fadA5) were designed as follows:

(29) TABLE-US-00002 SEQIDNO.9 Q-fadA5-uF: GCGCaagcttGTTCCTTCTTGTAGAGCTCCCACTG SEQIDNO.10 Q-fadA5-uR: TATAgaattcGTACTGGGTGACGCAGCCGCCGATG SEQIDNO.11 Q-fadA5-dF: GCGCgaattcGACATGGACAAGGTCAACGTCAACG SEQIDNO.12 Q-fadA5-dR: TATAgcggccgcGGTCGCAGATCAGGATCGGGATCTT

(30) The upstream and downstream fragments of the acyl-coenzyme A thiolase gene were obtained by PCR amplification using the NwIB-00 genome as template. The upstream and downstream genes of the target gene were respectively cloned into pMD19-T vector, and then digested with HindIII, EcoRI, EcoRI, NotI respectively, and the digested products were ligated to the corresponding digested Mycobacterium gene knockout plasmid p2NIL. The above mentioned plasmid and pGOAL19 plasmid were digested with PacI and connected non-directionally to construct the gene knockout plasmid QC-fadA5.

(31) 1.3 Transformation of the Knockout Plasmid into Mycobacterium Competent Cells

(32) Mycobacterium competent preparation: a first grade seed was incubated to OD 0.5-1.5, 5%-10% was transferred into second grade seed; after 14-24 h, adding 2% glycine to continue culture for about 24 h. The cells were collected by centrifugation and washed with 10% glycerol four times to suspend and then centrifuged. Finally, 1 ml of glycerol were added to the suspend cells and stored separately.

(33) Electro-transformation: 10 l of the above mentioned plasmid treated by alkali was added to 100 l of the competent cells for 15 min and the shock conditions were as follows: 2.5 kv/cm, 25 F, 20 ms.

(34) 1.4 Screening and Validation of Recombinants

(35) The electro-transformation product was added to medium for renewing culture about 3-24 h, and then coated on solid medium (ingredient: hyg 50 g/ml, Kn 20 g/ml, X-gal 50 g/ml) at 30 C. for 3-7 days. Colonies with blue spot were picked out for PCR validation. The verified single cross over (SCO) recombinants were coated on 2% sucrose plate and cultured at 30 C. for 3-7 days. The white colonies were picked out and verified by PCR.

(36) Confirmation of recombinants: including PCR validation of single cross over recombinants and double cross over recombinants, and the principle of validation is described in the above cited literature. The hydroxyacyl-coenzyme A dehydrogenase gene knockout validation primers are shown as below:

(37) TABLE-US-00003 SEQIDNO.13 Q-hsd4A-YZ-F: ACGTAGAAGTCGACCGTGACCGCTG SEQIDNO.14 Q-hsd4A-YZ-R: TAGTCGGCCCGGACCGGTGAATATG

(38) The results of the validation are as shown in FIG. 2. As to the strain that has not been successfully knocked out the hydroxyacyl-coenzyme A dehydrogenase gene, only a band of about 1200 bp appears theoretically; and as to the strain that has been successfully knocked out the hydroxyacyl-coenzyme A dehydrogenase gene by double cross over (DCO) recombination, only a band of about 500 bp appears theoretically. As to the strain that has been successfully knocked out the hydroxyacyl-CoA dehydrogenase gene by single cross over (SCO) recombination, there are two bands of about 500 bp and 1200 bp theoretically, indicating that the hydroxyacyl coenzyme A dehydrogenase gene has been successfully knocked out and the function of the original enzyme has been destroyed.

(39) The acyl-coenzyme A thiolase gene knockout validation primers are shown as below:

(40) TABLE-US-00004 SEQIDNO.15 Q-fadA5-YZ-F: TCAGAGTAATGAAACGTGTTCTAGCC SEQIDNO.16 Q-fadA5-YZ-R: ATCCGGATGCAGTCCGGATGGAAT

(41) The results of the validation are as shown in FIG. 3. As to the strain that has not been successfully knocked out the acyl-coenzyme A thiolase gene, only a band of about 1300 bp appears theoretically; and as to the strain that has been successfully knocked out the acyl-coenzyme A thiolase gene by double cross over (DCO) recombination, only a band of about 500 bp appears theoretically, indicating that the acyl-coenzyme A thiolase gene has been successfully knocked out, and the function of the original enzyme has been destroyed.

Example 2 the Transformation of Steroids by Mycobacterium NwIB-00 and the Analysis Method of Results

(42) The sterol substrate was solubilized with 1% to 10% surfactant, polymer or organic solvent (such as Tween 80, ethanol, silicone oil, soybean oil, etc.). Using secondary or tertiary culture as seed, 5% to 10% of the seed was inoculated to the final transformation medium, and the sterol substrate can be added at any time. The conditions for steroid transformation were as follows: incubation temperature of 25-37 C., high dissolved oxygen value, and pH between 5.0 and 8.0. The end time of the conversion reaction was determined by thin layer chromatography (TLC) or gas chromatography (GC) analysis. After the reaction, the steroid conversion products can be extracted with the same volume of ethyl acetate, or chloroform and other organic solvents three times. The obtained solution was combined and vacuum dried. Then, the analysis and product preparation were conducted.

(43) Shake-flask cultivation was adopted to cultivate Mycobacterium NwIB-00 to converse phytosterols, using 5%-10% of Tween80 or silicone oil as a cosolvent of phytosterol, in a 250 ml shake flask with 30 ml volume of sample loading, wherein 5%-10% of the seed was inoculated to a second grade culture containing 0.4-2 g/l of phytosterol. The culture conditions were as follows: 26-35 C., 200-300 rpm, pH5.0-8.0, for 3-7 days. The extraction of ethyl acetate was carried out, and the organic phase was detected by TLC and GC to check the transformation of steroids.

(44) The operating conditions of the thin layer chromatography (TLC) were as follows: petroleum ether:ethyl acetate (6:4 to 7:3) was used as the developing agent; the thin plate was 510 cm prefabricated plate produced by Yantai Silicone Factory; 20% sulfuric acid solution was evenly sprayed; and the plate was baked 5 min-10 min in the 105 C. oven until the spots show up for observation.

(45) The results of the transformation of phytosterols by Mycobacterium NwIB-00 are as shown in FIG. 4. Phytosterols can be completely decomposed and metabolized by Mycobacterium NwIB-00, without the accumulation of 1,4-BNA, 4-BNA, 9-OH-BNA and other products.

Example 3 the Preparation of 1,4-BNA, 4-BNA, 9-OH-BNA from the Degradation of Sterols by the Genetically Engineered Strains NwIB-X01, NwIB-X02, NwIB-X03, NwIB-X04, NwIB-X05, and NwIB-X06

(46) The culture conditions of the genetically engineered strain and the conditions for the transformation of the steroid can be carried out according to Example 2. In the shake flask (30 ml loaded liquid/250 ml shake flask), phytosterols are used as the substrate, and its final concentration is added to 0.5-5%, the conversion time is 5-10 days, and the results of phytosterol transformation by the engineered strains are as shown in FIG. 5 and FIG. 6.

(47) Genetically engineered strain NwIB-X01 can transform and degrade sterol to produce 1,4-BNA and 4-BNA at the same time, wherein the product 1,4-BNA is the main product; NwIB-X02 can transform and degrade sterol and also produce 1,4-BNA and 4-BNA, wherein the product 4-BNA is the main product because of the absence of 3-ketosteroid-.sup.1-dehydrogenase gene in the strain; and NwIB-X03 can transform and degrade sterol to produce 4-BNA and 9-OH-BNA, wherein the product 4-BNA is the main product as compared with NwIB-X02 because of the absence of three 3-ketosteroid-.sup.1-dehydrogenase gene in the strain. Genetically engineered strain NwIB-X06 can transform and degrade sterol to produce 1,4-BNA and 4-BNA, in addition to these, it also can produce androst-4-ene-3,17-dione (AD) and androst-1,4-dien-3,17-dione (ADD).

(48) Genetically engineered strain NwIB-X04 can transform and degrade sterol to produce 9-OH-BNA, in addition to this, it also can produce 9-androst-4-ene-3,17-dione (9-OH-AD); and NwIB-X05 also can transform and degrade sterol to produce 9-OH-BNA.

(49) In view of the above, according to genetically engineered mycobacterium strains of present invention constructed by the modification of hydroxyacyl-coenzyme A dehydrogenase gene and/or acyl-coenzyme A thiolase gene, they can optionally prepare 22-hydroxy-23,24-bisnorchol-1,4-dien-3-one, 22-hydroxy-23,24-bisnorchol-4-ene-3-one and 9,22-dihydroxy-23,24-bisnorchol-4-ene-3-one compounds. These products can be used industrially in the production of adrenocorticotropic steroid drugs, and can partially substitute the current process for the production of adrenocortical hormone based on diosgenin through pregnadienolone, and thus can greatly improve the production efficiency of steroids, help to reduce the energy consumption and material consumption of steroid drug production process, simplify production steps and reduce production costs.

(50) The aforementioned preferable embodiments are exemplary rather than limiting in nature, and many variations of the present invention are possible in light of the above teachings. It is, therefore, to be understood that all easy, equivalent variations and modifications made according to the claims and description of present invention fall into the scope of the invention as defined by the claims. The contents that have not been described in detail are the routine technical solutions.