Marine bacterial gene LfliZ and use

10351857 ยท 2019-07-16

Assignee

Inventors

Cpc classification

International classification

Abstract

It relates to a LfliZ gene and its application. The sequence of gene LfliZ is shown in SEQ ID NO.1. This invention also relates to the recombinant protein LfliZ encoded by LfliZ gene and its application in preparation of 2, 3-cNMPs. The recombinant LfliZ protein encoded by gene LfliZ can bind four kinds of 2, 3-cNMPs during its expression in Escherichia coli. Four kinds of 2, 3-cNMPs can be prepared simultaneously from the recombinant E. coli by extracting the recombinant protein LfliZ. The yield of 2, 3-cNMPs reaches 2.5 mg/L fermentation broth by the method in the present invention, indicating that this method has a good application potential.

Claims

1. A recombinant vector, containing a gene LfliZ having nucleotide sequence as shown in SEQ ID NO:1.

2. The recombinant vector according to claim 1, wherein the recombinant vector is constructed with a plasmid pET-22b (+).

3. The recombinant vector according to claim 1, wherein the recombination vector is transformed into a host cell yields a recombinant cell.

4. The recombinant vector according to claim 3, wherein the host cell is E. coli.

5. The recombinant vector according to claim 4, wherein the E. coli is E. coli BL21 (DE3).

6. A process for preparing 2,3-cyclic nucleoside monophosphates (2,3-cNMPs) by using a gene LfliZ, wherein the gene LfliZ having nucleotide sequence as shown in SEQ ID NO:1; cloning the gene LfliZ into a plasmid as a recombinant vector that is transformed into a host cell that yields as a recombinant cell; culturing the recombinant cell in a fermentation medium; then, preparing the 2, 3-cNMPs from the recombinant cell.

7. The process according to claim 6, wherein the plasmid is pET-22b (+); the host cell is E. coli.

8. The process according to claim 6, wherein the fermentation medium is LB medium.

9. A process for preparing 2, 3-cNMPs by using a gene LfliZ, wherein the gene LfliZ having nucleotide sequence as shown in SEQ ID NO:1; cloning the gene LfliZ into a plasmid as a recombinant vector that is transformed into a host cell that yields as a recombinant cell; culturing the recombinant cell in a fermentation medium; breaking the recombinant cells and purifying a recombinant protein LfliZ having the amino acid sequence shown as SEQ ID NO:2; incubating the recombinant protein LfliZ in a recombinant protein LfliZ solution; and preparing the 2, 3-cNMPs from the recombinant protein LfliZ solution.

10. The process according to claim 9, wherein the plasmid is pET-22b (+); the host cell is E. coli.

11. The process according to claim 9, wherein the fermentation medium is LB medium.

12. The process according to claim 9, wherein the recombinant protein LfliZ solution is consisting of 10 mM Tris-HCl, 100 mM NaCl, pH 7.5.

Description

FIGURE LEGENDS

(1) FIG. 1. Agarose gel electrophoretic analysis for gene LfliZ amplified by PCR. M: DNA marker; LfliZ: gene LfliZ.

(2) FIG. 2. SDS-PAGE analysis of recombinant protein LfliZ purified by Ni.sup.2+-nitrilotriacetic acid resin. M: protein marker; LfliZ: recombinant protein LfliZ.

(3) FIG. 3. HPLC separation of four kinds of 2, 3-cNMPs in the filtrate.

(4) FIG. 4. HPLC and LC-MS analyses of purified 2, 3-cCMP includes: HPLC analysis of purified 2, 3-cCMP (a); LC-MS analysis of purified 2, 3-cCMP, the m/z ratio of purified 2, 3-cCMP is 306.0491 (z=1), corresponding with the theoretical value 306.0486 (b); the structure of 2, 3-cCMP (c).

(5) FIG. 5 HPLC and LC-MS analyses of purified 2, 3-cUMP includes: HPLC analysis of purified 2, 3-cUMP (a); LC-MS analysis of purified 2, 3-cUMP, the m/z ratio of purified 2, 3-cUMP is 307.0331 (z=1), corresponding with the theoretical value 307.0326 (b); the structure of 2, 3-cUMP (c).

(6) FIG. 6 HPLC and LC-MS analyses of purified 2, 3-cGMP includes: HPLC analysis of purified 2, 3-cGMP (a); LC-MS analysis of purified 2, 3-cGMP, the m/z ratio of purified 2, 3-cGMP is 346.0552 (z=1), corresponding with the theoretical value 346.0547 (b); the structure of 2, 3-cGMP (c).

(7) FIG. 7 HPLC and LC-MS analyses of purified 2, 3-cAMP includes: HPLC analysis of purified 2, 3-cAMP (a); LC-MS analysis of purified 2, 3-cAM, the m/z ratio of purified 2, 3-cAMP is 330.06 (z=1), corresponding with the theoretical value 330.0598 (b); the structure of 2, 3-cAMP (c).

ILLUSTRATIVE EMBODIMENTS

(8) The following examples are offered to illustrate, but not to limit the present invention.

(9) Sample Source

(10) E. coli DH5 and E. coli BL21 (DE3), TransGen Biotech Company, China;

(11) pET-22b (+) expression plasmid, Novagen Company, America;

(12) PCR amplification kit, TransGen Biotech Company, China;

(13) Restriction enzymes and ligase Solution I, Takara Biomedical Technology (Beijing) Co., China;

(14) Bacterial genome extraction kit and plasmid miniprep purification kit, Beijing Biotech Corporation, China;

(15) Gel extraction kit, Omega bio-tek Company, America;

(16) 2, 3-cCMP and 2, 3-cAMP, Sigma-Aldrich Corporation, America;

(17) 2, 3-cUMP, 2, 3-cGMP, 3,5-cCMP, 3,5-cUMP, 3,5-cGMP and 3,5-cAMP, Biolog Company, America;

(18) Ampicillinum and IPTG, Merck Company, America;

(19) Methanol, Kemiou chemical reagent Company, China;

(20) Peptone and yeast extract, Oxoid Ltd, England;

(21) DNA sequencing, performed by Beijing Biosune Biotechnology Corporation, China;

(22) Primer synthesis, performed by BGI Company, China;

(23) Pseudoalteromonas sp. SM9913 (hereafter Ps. sp. SM9913), purchased from China Center for Type Culture Collection (CCTCC), and the deposited number is CCTCC NO. M2010223.

Example 1

(24) Method for gene LfliZ cloning and expression vector construction comprises steps of:

(25) 1. Cloning of Gene LfliZ

(26) 1.1. Extraction of Genomic DNA from Ps. Sp. SM9913

(27) The genomic DNA of Ps. sp. SM9913 was extracted according to the instructions of genome extraction kit from Biotech Corporation.

(28) 1.2. Design and Synthesis of the Primers

(29) Primers were designed according to the LfliZ gene sequence. The primer sequences were as follows:

(30) TABLE-US-00001 F: (SEQIDNO:3) GGAATTCCATATGAGTAACCAATCAG; R: (SEQIDNO:4) CCGCTCGAGTGCATTGGTTTTTTTTGC.

(31) Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd, China.

(32) 1.3 Amplification of Gene LfliZ by PCR and its Recovery

(33) (1) The LfliZ gene sequence was amplified with primers F and R, using the genomic DNA of Ps. sp. SM9913 as template. PCR reaction conditions was as follows: pre-denaturing at 95 C. for 5 min; denaturing at 95 C. for 30 sec; annealing at 55 C. for 30 sec; extending at 72 C. for 30 sec; 30 cycles; extending ultimately at 72 C. for 5 min.

(34) The PCR amplification system (50 l) was as follows:

(35) TABLE-US-00002 Sterilized distilled water 32.2 l 5 TransStart FastPfu buffer 10 l dNTP mix 5 l Primer F (50 M) 0.4 l Primer R (50 M) 0.4 l Genomic DNA 1 l TransStart FastPfu DNA polymerase 1 l

(36) (2) The PCR products were subjected to 1% agarose gel electrophoresis. The DNA fragment of gene LfliZ was recovered with DNA purification kit from Omega.

(37) 2. Construction of the Recombinant Expression Vector and Strain.

(38) (1) Digestion of gene and the expression vector

(39) The LfliZ gene and vector pET-22b were digested with restriction enzymes Nde I and Xho I. The digestion reaction system was as follows:

(40) TABLE-US-00003 Buffer 2 l Expression plasmid pET-22b/gene LfliZ 8 l Restriction enzyme Nde I 1 l Restriction enzyme Xho I 1 l Sterilized distilled water 8 l

(41) The samples were mixed smoothly and centrifuged for 2 sec and then incubated at 37 C. for 30 min.

(42) (2) The digested products were subjected to 1% agarose gel electrophoresis, and then the objective DNA fragments were recovered with DNA purification kit from Omega.

(43) (3) The digested gene LfliZ and vector pET-22b from step (2) were ligated

(44) The reaction system was as follows:

(45) TABLE-US-00004 Digested vector pET-22b 1 l Digested gene LfliZ 4 l Solution I 5 l

(46) The sample was mixed smoothly and centrifuged for 2 sec and then incubated at 16 C. overnight.

(47) (4) The recombinant expression vector pET-22b-LfliZ obtained from step (3) was transformed into E. coli BL21 (DE3) according to the method described in Molecular Cloning Manual. The procedure comprises steps of: mix the ligation solution with E. coli BL21 (DE3) competent cells, and ice bath the mixture for 30 min; water bath the mixture at 42 C. for 90 s; immediately transfer into ice bath to cool down the mixture for 1-2 min; add 500 l liquid LB medium, and incubate the mixture at 37 C. for 1 h; centrifuge the mixture, discard the supernatant and resuspended the bacterial cells with 100 l LB liquid medium, then spread the cells on a Maconey agar plate containing 100 g/ml ampicillin and incubate the plate at 37 C. overnight to form colonies of the recombinant strain.

(48) The recombinant strain was verified by plasmid sequencing in Sangon Biotech (Shanghai) Co., Ltd.

(49) The DNA sequence of gene LfliZ was showed in SEQ ID NO. 1.

Example 2

(50) 1. Fermentative Cultivation of the Recombination Strain

(51) (1) Inoculum preparation: the recombinant strain obtained in example 1 was inoculated into liquid LB medium containing 100 g/ml ampicillin, which was then cultivated at 180 rpm and 37 C. overnight to prepare the inoculum.

(52) (2) The inoculum from step (1) was inoculated in 1 L fermentation medium with 1% inoculum size and cultivated at 37 C., 180 rpm until the OD.sub.600 of the culture reached 0.8, and then the culture was incubated at 20 C., 120 rpm for 30 min. After that, 0.1 mM IPTG was added in the culture which was then further cultivated at 20 C., 120 rpm for 24 hours.

(53) The ingredients of 1 liter LB liquid medium (pH 8.0) were as follows: 10 g NaCl, 10 g peptone, and 5 g yeast extract, dissolved in distilled water.

(54) 2. Purification of Protein LfliZ (1) Buffers used for purification

(55) Lysis buffer: 50 mM Tris-HCl, 150 mM NaCl, pH 8.0

(56) Washing buffer: 50 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0

(57) Elution buffer: 50 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 8.0 (2) The cells in the fermentative culture from step 1 were collected and resuspended with 50 ml lysis buffer (for 1 liter medium), and then were broken at the pressure of 1000 bar.

(58) (3) The solution from step (2) was centrifuged at 4 C., 12,000 rpm for 50 min.

(59) (4) The supernatant from step (3) was loaded on a nickel column filled with 2 ml nickel gel. After the supernatant flowed through the nickel column, the column was equilibrated with 20 ml lysis buffer, and then washed with 20 ml washing buffer (50 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0). After that, the recombinant protein LfliZ was eluted with 10 ml elution buffer (50 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 8.0). The eluent containing protein LfliZ was collected. SDS-PAGE analysis of the purified protein LfliZ was shown in FIG. 2.

(60) The protein sequence of LfliZ was shown in SEQ ID NO. 2.

Example 3

(61) 1. Preparation of the Solution Containing 2, 3-cNMPs.

(62) (1) The solution of protein LfliZ obtained from example 2 was incubated at 0 C. for 3 days to release 2, 3-cNMPs from protein LfliZ, and then the solution was centrifuged at 12,000 rpm for 20 min. The supernatant was collected.

(63) (2) The supernatant from step (1) was ultrafiltrated by means of an ultrafiltration tube having a molecular weight cut-off of 3,000 Da to remove proteins. The filtrate was collected, which was a solution containing four kinds of 2, 3-cNMPs.

(64) 2. Purification of Four Kinds of 2, 3-cNMPs (2, 3-cAMP, 2, 3-cGMP, 2, 3-cCMP and d2, 3-cUMP).

(65) (1) The four kinds of 2, 3-cNMPs in the solution obtained from step 1 were separated by high-performance liquid chromatographic (HPLC) on a C.sub.18 reversed-phase column, and each kind of 2, 3-cNMPs was separately collected.

(66) The mobile phases used in the gradient program were as follows: buffer A (10 mM ammonium acetate, pH 5.0) and buffer B (75% (v/v) buffer A, 25% (v/v) methanol).

(67) (2) The protocol used for purification was as follows (the values are times in minutes and percentage of buffer B used): 0.0, 0; 2.5, 0; 5.0, 30; 10.0, 60; 14.0, 100; 21.0, 100; 22.0, 50 and 23.0, 0 at a flow rate of 10 ml/min. The detection wavelength was 254 nm.

(68) HPLC separation of four kinds of 2, 3-cNMPs was shown in FIG. 3. HPLC and LC-MS analyses of each kind of 2, 3-cNMPs were shown in FIGS. 4-7.

(69) 3. Determination of the Yield of 2, 3-cNMPs.

(70) (1) Standard 2, 3-cNMP of each kind was diluted with distilled water to a concentration gradient as follows: 0, 20, 40, 60, 80 and 100 M. The standard solutions were analyzed by HPLC using a C.sub.18 reversed-phase column.

(71) The regression equations of the standard curves were generated based on the concentrations of the standards and the corresponding peak areas.

(72) (2) The concentrations of four kinds of 2, 3-cNMP were calculated based on their respective regression equations. Based on the results, the yields of four kinds of 2, 3-cNMP from 1 L fermentation broth was determined to be 1.300.17 mol 2, 3-cCMP, 1.400.12 mol 2, 3-cUMP, 2.810.25 mol 2, 3-cGMP and 2.610.19 mol 2, 3-cAMP. Therefore, about 2.5 mg 2, 3-cNMPs could be extracted from 1 L fermentation broth in the present invention.