Genes for enhancing salt and drought tolerance in plants and methods of use
11535860 · 2022-12-27
Assignee
Inventors
- Xiaohan Yang (Knoxville, TN)
- Degao Liu (Falcon Heights, MN, US)
- Rongbin Hu (Farragut, TN, US)
- Gerald A. Tuskan (Oak Ridge, TN)
Cpc classification
C12N15/8261
CHEMISTRY; METALLURGY
C12Y401/01031
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The present disclosure provides methods for increasing drought resistance, salt resistance, photosynthetic rate, biomass production and water-use efficiency of a plant. The methods encompass expression of CAM-specific a phosphoenolpyruvate carboxylase (PEPC) in the plant. In comparison to a plant not manipulated in this manner, the disclosed, genetically-modified, plants display improved drought resistance and salt resistance. Also provided are plants that can be obtained by the method according to the invention, and nucleic acid vectors to be used in the described methods.
Claims
1. A method comprising: (i) introducing into a C.sub.3 or C.sub.4 plant cell a nucleic acid encoding a crassulacean acid metabolism (CAM)-specific phosphoenolpyruvate carboxylase (CAM-PEPC) from Agave Americana, (ii) producing a C3 or C4 plant from the plant cell and expressing the CAM-PEPC in the plant, wherein the CAM-PEPC is the only CAM-specific protein expressed in the plant, wherein expression of the CAM-PEPC improves resistance to drought and high salt in the plant as compared to a C3 or C4 plant without the expression of a CAM-PEPC, and (iii) growing the plant under conditions that include a period of drought or high salt.
2. The method of claim 1, wherein the CAM-PEPC comprises an amino acid sequence substantially identical to SEQ ID NO: 19.
3. The method of claim 1, wherein the nucleic acid comprises a nucleic acid sequence substantially identical to SEQ ID NO: 18.
4. The method of claim 1, wherein the plant cell is from a C.sub.3 plant selected from the group consisting of genera Allium, Arabidopsis, Brassica, Capsicum, Citrullus, Cucumis, Eucalyptus, Fragaria, Glycine, Gossypium, Hordeum, Ipomoea, Malus, Manihot, Nicotiana, Oryza, Populus, Prunus, Rosa, Solanum, Spinacia and Triticum.
5. The method of claim 1, wherein the plant cell is from a C.sub.4 plant selected from the group consisting of genera Panicum, Saccharum, Setaria, Sorghum and Zea.
6. The method of claim 1, wherein the plant is grown in an arid environment or a semiarid environment.
7. The method of claim 1, wherein the nucleic acid comprises a promoter selected from the group consisting of a constitutive promoter, a tissue-specific promoter, and a regulated promoter.
8. The method of claim 7, wherein the promoter is a leaf-specific promoter selected from the group consisting of a ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) promoter, a chlorophyll a/b binding-6 (cab6) promoter, a chlorophyll a/b binding-1(Cab-1) promoter, a cab IR promoter from rice, a pyruvate orthophosphate dikinase (PPDK) promoter, a light-harvesting complex of photosystem (Lhcb1*2) promoter, a sucrose-H+ symporter (SUC2) promoter and a thylakoid membrane protein promoter.
9. The method of claim 7, wherein the promoter is a constitutive promoter selected from the group consisting of a ubiquitin promoter, a cauliflower mosaic virus (CaMV) 35S promoter, a nopaline synthase (nos) promoter, an actin promoter, a peanut chlorotic streak caulimovirus promoter, a Chlorella virus methyltransferase gene promoter, a full-length transcript promoter form figwort mosaic virus, a pEMU promoter, a MAS promoter, a maize H3 histone promoter and an Agrobacterium gene promoter.
10. The method of claim 7, wherein the promoter is a regulated promoter selected from the group consisting of a stress induced promoter, a chemical-induced promoter, a light induced promoter, a dark-induced promoter, and a circadian-clock controlled promoter.
11. The method of claim 1, wherein the CAM-PEPC comprises an amino acid sequence of SEQ ID NO: 19.
12. The method of claim 1, wherein the nucleic acid comprises a nucleic acid sequence of SEQ ID NO: 18.
13. A method of producing increased biomass under conditions that include a period of drought or high salt comprising: (i) providing a C.sub.3 or C.sub.4 plant engineered to express a nucleic acid encoding a crassulacean acid metabolism (CAM)-specific phosphoenolpyruvate carboxylase (CAM-PEPC) from Agave Americana, wherein the CAM-PEPC is the only CAM-specific protein expressed in the plant cell wherein expression of the CAM-PEPC improves resistance to drought and high salt in the plant as compared to a C3 or C4 plant without the expression of a CAM-PEPC; and (ii) growing the plant under conditions that comprise conditions that include a period of drought or high salt; (iii) harvesting the plant expressing the CAM-PEPC to acquire the increased biomass.
14. The method of claim 13, wherein the CAM-PEPC comprises an amino acid sequence substantially identical to SEQ ID NO: 19.
15. The method of claim 13, wherein the nucleic acid comprises a nucleic acid sequence substantially identical to SEQ ID NO: 18.
16. The method of claim 13, wherein the CAM-PEPC comprises an amino acid sequence of SEQ ID NO: 19.
17. The method of claim 13, wherein the nucleic acid comprises a nucleic acid sequence of SEQ ID NO: 18.
18. The method of claim 13, wherein the plant is a C.sub.3 plant selected from the group consisting of genera Allium, Arabidopsis, Brassica, Capsicum, Citrullus, Cucumis, Eucalyptus, Fragaria, Glycine, Gossypium, Hordeum, Ipomoea, Malus, Manihot, Nicotiana, Oryza, Populus, Prunus, Rosa, Solanum, Spinacia and Triticum.
19. The method of claim 13, wherein the plant is a C.sub.4 plant selected from the group consisting of genera Panicum, Saccharum, Setaria, Sorghum and Zea.
20. The method of claim 13, wherein the plant is grown in an arid environment or a semiarid environment.
21. The method of claim 13, wherein the nucleic acid comprises a promoter selected from the group consisting of a constitutive promoter, a tissue-specific promoter, and a regulated promoter.
22. The method of claim 21, wherein the promoter is a leaf-specific promoter selected from the group consisting of a ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) promoter, a chlorophyll a/b binding-6 (cab6) promoter, a chlorophyll a/b binding-1(Cab-1) promoter, a cab IR promoter from rice, a pyruvate orthophosphate dikinase (PPDK) promoter, a light-harvesting complex of photosystem (Lhcb1*2) promoter, a sucrose-H+ symporter (SUC2) promoter and a thylakoid membrane protein promoter.
23. The method of claim 21, wherein the promoter is a constitutive promoter selected from the group consisting of a ubiquitin promoter, a cauliflower mosaic virus (CaMV) 35S promoter, a nopaline synthase (nos) promoter, an actin promoter, a peanut chlorotic streak caulimovirus promoter, a Chlorella virus methyltransferase gene promoter, a full-length transcript promoter form figwort mosaic virus, a pEMU promoter, a MAS promoter, a maize H3 histone promoter and an Agrobacterium gene promoter.
24. The method of claim 21, wherein the promoter is a regulated promoter selected from the group consisting of a stress induced promoter, a chemical-induced promoter, a light induced promoter, a dark-induced promoter, and a circadian-clock controlled promoter.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION OF THE INVENTION
Definitions
(14) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
(15) As used herein, the term “about”, when used in connection with a given value, refers to an approximately +/−10% variation from the given value.
(16) The term “C.sub.3 plant” refers to a plant that captures carbon dioxide into three-carbon compounds to enter into the Calvin cycle (photosynthesis pathway). In a C.sub.3 plant carbon dioxide capture and the Calvin cycle occur during the daytime, and stomata of C.sub.3 plants are open during the day for gas exchange, which also leads to increased water loss through the stomata (evapotranspiration).
(17) The term “C.sub.4 plant” refers to a plant that captures carbon dioxide into four-carbon compounds to enter into the Calvin cycle. In a C.sub.4 plant carbon dioxide capture and the Calvin cycle occur during the daytime, and stomata of C.sub.4 plants are open during the day for gas exchange, which also leads to increased water loss.
(18) The term “crassulacean Acid Metabolism,” also known as CAM, refers to a carbon fixation pathway that evolved in some plants as an adaptation to arid conditions. In a plant using full CAM, the stomata in the leaves remain shut during the day to reduce evapotranspiration, but open at night to collect carbon dioxide (CO.sub.2). CAM plants include most succulents, such as cacti and agaves, as well as some orchids and bromeliads. Specific species of CAM plants include Kalanchoe fedtschenkoi, Phalaenopsis equestris, Ananas comosus, and Crassula perforata.
(19) The term “control plant,” as used herein, refers to a plant of the same species that does not comprise the modification or modifications described in this disclosure. In some embodiments, the control plant is of the same variety. In some embodiments, the control plant is of the same genetic background.
(20) The term “DNA,” as used herein, refers to a nucleic acid molecule of one or more nucleotides in length. By “nucleotide” it is meant a naturally-occurring nucleotide, as well modified versions thereof. The term “DNA” includes double-stranded DNA, single-stranded DNA, isolated DNA such as cDNA, as well as modified DNA that differs from naturally-occurring DNA by the addition, deletion, substitution and/or alteration of one or more nucleotides as described herein.
(21) As used herein, the term “drought stress” or “drought” refers to a sub-optimal environmental condition associated with limited availability of water to a plant. Limited availability of water may occur when, for instance, rain is absent or lower and/or when the plants are watered less frequently than required. Limited water availability to a plant may also occur when for instance water is present in soil, but cannot efficiently be extracted by the plant. For instance, when soils strongly bind water or when the water has a high salt content, it may be more difficult for a plant to extract the water from the soil. Hence, many factors can contribute to result in limited availability of water, i.e. drought, to a plant. The effect of subjecting plants to “drought” or “drought stress” may be that plants do not have optimal growth and/or development. Plants subjected to drought may have wilting signs. For example, plants may be subjected to a period of at least 15 days under specific controlled conditions wherein no water is provided, e.g. without rain fall and/or watering of the plants.
(22) The term “exogenous,” as used herein, refers to a substance or molecule originating or produced outside of an organism. The term “exogenous gene” or “exogenous nucleic acid molecule,” as used herein, refers to a nucleic acid that codes for the expression of an RNA and/or protein that has been introduced (“transformed”) into a cell or a progenitor of the cell. An exogenous gene may be from a different species (and so a “heterologous” gene) or from the same species (and so a “homologous” gene), relative to the cell being transformed. A transformed cell may be referred to as a recombinant or genetically modified cell. An “endogenous” nucleic acid molecule, gene, or protein can represent the organism's own gene or protein as it is naturally produced by the organism.
(23) The term “expression” refers to the process of converting genetic information of a polynucleotide into RNA through transcription, which is catalyzed by an enzyme, RNA polymerase and into protein, through translation of mRNA on ribosomes. Expression can be, for example, constitutive or regulated, such as, by an inducible promoter (e.g., lac operon, which can be triggered by Isopropyl β-D-1-thiogalactopyranoside (IPTG)). Up-regulation or overexpression refers to regulation that increases the production of expression products (mRNA, polypeptide or both) relative to basal or native states, while inhibition or down-regulation refers to regulation that decreases production of expression products (mRNA, polypeptide or both) relative to basal or native states. Expression of a gene can be measured through a suitable assay, such as real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR), Northern blot, transcriptome sequencing and Western blot.
(24) The term “gene,” as used herein, refers to a segment of nucleic acid that encodes an individual protein or RNA and can include both exons and introns together with associated regulatory regions such as promoters, operators, terminators, 5′ untranslated regions, 3′ untranslated regions, and the like.
(25) The term “genetically modified” (or “genetically engineered” or “transgenic” or “cisgenic”) refers to a plant comprising a manipulated genome or nucleic acids. In some embodiments, the manipulation is the addition of exogenous nucleic acids to the plant. In some embodiments, the manipulation is changing the endogenous genes of the plant.
(26) The term “homologous” refers to nucleic acids or polypeptides that are highly related at the level of nucleotide or amino acid sequence. Nucleic acids or polypeptides that are homologous to each other are termed “homologues.” The term “homolog” refers to a gene related to a second gene by descent from a common ancestral DNA sequence, therefore, the corresponding polynucleotide/polypeptide has a certain degree of homology, that is to say sequence identity (preferably at least 50%, more preferably at least 60%, even more preferably at least 65%, particularly preferred at least 66%, 68%, 70%, 75%, 80%, 86%, 88%, 90%, 92%, 95%, 97% or 99%).
(27) The term “improved drought resistance” (aka. “drought tolerance”) refers to plants which, when provided with improved drought resistance, when subjected to drought or drought stress do not show effects or show alleviated effects as observed in control plants not provided with improved drought resistance. A normal plant has some level of drought resistance. It can easily be determined whether a plant has improved drought resistance by comparing a control plant with a plant provided with improved drought resistance under controlled conditions chosen such that in the control plants signs of drought can be observed after a certain period, i.e., when the plants are subjected to drought or drought stress. The plants with improved drought resistance will show less and/or reduced signs of having been subjected to drought, such as wilting, as compared to the control plants. The skilled person knows how to select suitable conditions. When a plant has “improved drought resistance,” it is capable of sustaining normal growth and/or normal development when being subjected to drought or drought stress would otherwise have resulted in reduced growth and/or reduced development of normal plants. Hence, “improved drought resistance” is determined by comparing plants, whereby the plant most capable of sustaining (normal) growth under drought stress is a plant with “improved drought resistance.” The skilled person is able to select appropriate conditions to determine drought resistance of a plant and how to measure signs of droughts, such as described in for example manuals by the IRRI, Breeding rice for drought prone environments, Fischer et al., 2003; and by the CIMMYT, Breeding for drought and nitrogen stress tolerance in maize: from theory to practice, Banzinger et al, 2000. Examples of methods for determining improved drought resistance in plants are provided in Snow and Tingey (Snow and Tingey, 1985, Plant Physiol, 77, 602-7) and Harb et al., Analysis of drought stress in Arabidopsis, AOP 2010, Plant Physiology Review.
(28) The term “improved salt resistance” or “improved salt tolerance” refers to plants which, when provided with salt resistance (or being salt resistant), when subjected to high salt stress do not show effects or show alleviated effects as observed in plants not provided with salt resistance. When a plant is “salt resistant,” it is capable of sustaining normal growth and/or normal development when being subjected to a high salt environment that otherwise would have resulted in reduced growth and/or development in normal plants. Hence, salt resistance is determined by comparing plants with another plant, whereby the plant most capable of sustaining (normal) growth may be a “salt resistant” plant, whereas the plant less capable may be termed a “salt sensitive” plant. Providing salt resistance thus is understood to include improving the salt resistance of a plant, when compared with a plant not provided with salt resistance. With plants provided with salt resistance it is e.g. possible to obtain higher yields of crop and/or plant product when the plant is subjected to a period or periods of high salt conditions when compared to plants not provided with salt resistance.
(29) As used herein, the terms “Kalanchoë laxiflora” and “Kalanchoë fedtschenkoi” refer to the two CAM plant species from the genus Kalanchoë.
(30) As used herein, the term “nucleic acid” has its general meaning in the art and refers to refers to a coding or non-coding nucleic sequence. Nucleic acids include DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) nucleic acids. Examples of nucleic acid thus include but are not limited to DNA, mRNA, tRNA, rRNA, tmRNA, miRNA, piRNA, snoRNA, and snRNA. Nucleic acids thus encompass coding and non-coding region of a genome (i.e. nuclear or mitochondrial or chloroplast).
(31) The term “operably linked” refers to positioning of a regulatory region and a sequence to be transcribed in a nucleic acid so as to influence transcription or translation of such a sequence. For example, to bring a coding sequence under the control of a regulatory region, the translation initiation site of the translational reading frame of the polypeptide is typically positioned between one and about fifty nucleotides downstream of the promoter. A regulatory region can, however, be positioned as much as about 5,000 nucleotides upstream of the translation initiation site or about 2,000 nucleotides upstream of the transcription start site. A regulatory region typically comprises at least a core (basal) promoter.
(32) The term “regulatory region” refers to a nucleic acid having nucleotide sequences that influence transcription or translation initiation and rate and stability and/or mobility of a transcription or translation product. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5′ and 3′ untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, introns and combinations thereof.
(33) A regulatory region also may include at least one control element, such as an enhancer sequence, an upstream element or an upstream activation region (UAR). For example, a suitable enhancer is a cis-regulatory element (−212 to −154) from the upstream region of the octopine synthase (ocs) gene (Fromm et al., The Plant Cell, 1:977-984 (1989)). The choice of regulatory regions to be included depends upon several factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level and cell- or tissue-preferential expression. It is a routine matter for one of skill in the art to modulate the expression of a coding sequence by appropriately selecting and positioning regulatory regions relative to the coding sequence.
(34) The term “substantially identical” refers to a sequence (nucleic acid or amino acid sequence) that is at least 80%, 85%, 88%, 90%, 95%, 98%, 99% or greater in sequence identity to a given reference sequence. The terms “substantial identity” or “substantially identical,” as used herein, denote a characteristic of a polynucleotide or polypeptide sequence, wherein the polynucleotide or polypeptide comprises a sequence that has at least 80% sequence identity as compared to a reference sequence over the window of comparison allowing for gaps or mismatches of several bases, which may result from genetic mutation, polymorphism, evolutionary divergence or other phenomena. Polynucleotide or polypeptide sequences with at least 80%, 85%, 88%, 90%, 95%, 98% or 99% sequence identity as compared to a reference sequence over the window of comparison are also considered to have substantial identity with the reference sequence.
(35) A “vector” is a replicon, such as a plasmid, phage or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements. Suitable vector backbones include, for example, those routinely used in the art such as plasmids, viruses, artificial chromosomes, BACs, YACs or PACs. The term “vector” includes cloning and expression vectors, as well as viral vectors and integrating vectors. An “expression vector” is a vector that includes a regulatory region. Suitable expression vectors include, without limitation, plasmids and viral vectors derived from, for example, bacteriophage, baculoviruses and retroviruses. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, Wis.), Clontech (Mountain View, Calif.), Stratagene (La Jolla, Calif.) and Invitrogen/Life Technologies (Carlsbad, Calif.).
(36) Plants
(37) There is no specific limitation on the plants that can be used in the methods of the present disclosure, as long as the plant is suitable to be transformed by a gene. The term “plant,” as used herein, includes whole plants, plant tissues or plant cells. The plants that can be used for the methods and compositions of the present disclosure include various crops, flower plants or plants of forestry, etc. Specifically, the plants include, but are not limited to, dicotyledon, monocotyledon or gymnosperm. More specifically, the plants include, but is not limited to, wheat, barley, rye, rice, corn, sorghum, beet, apple, pear, plum, peach, apricot, cherry, strawberry, Rubus swinhoei Hance, blackberry, bean, lentil, pea, soy, rape, mustard, opium poppy, olea europea, helianthus, coconut, plant producing castor oil, cacao, peanut, calabash, cucumber, watermelon, cotton, flax, cannabis, jute, citrus, lemon, grapefruit, spinach, lettuce, asparagus, cabbage, Brassica campestris L. ssp. Pekinensis, Brassica campestris L. ssp. chinensis, carrot, onion, murphy, tomato, green pepper, avocado, cassia, camphor, tobacco, nut, coffee, eggplant, sugar cane, tea, pepper, grapevine, nettle grass, banana, natural rubber tree and ornamental plant, etc.
(38) In some embodiment the methods and compositions of the present disclosure are also be used over a broad range of plant species from the dicot genera Acer, Afzelia, Arabidopsis, Betula, Brassica, Eucalyptus, Fagus, Fraxinus, Glycine, Gossypium, Jatropha, Juglans, Linum, Lycopersicon, Medicago, Micropus, Populus, Prunus, Quercus, Salix, Solanum, Tectona and Trifolium; and the monocot genera Agrostis, Avena, Festuca, Hordeum, Lemna, Lolium, Milium, Miscanthus, Oryza, Panicum, Pennisetum, Phalaris, Phleum, Poa, Saccharum, Secale, Sorghum, Triticum, Zea and Zoysia; and the gymnosperm genera Abies, Picea and Pinus. In some embodiments, a plant is a member of the species Festuca arundinacea, Miscanthus hybrid (Miscanthus×giganteus), Miscanthus sinensis, Miscanthus sacchariflorus, Panicum virgatum, Pennisetum purpureum, Phalaris arundinacea, Populus spp including but not limited to balsamifera, deltoides, tremuloides, tremula, alba and maximowiczii, Saccharum spp., Secale cereale, Sorghum almum, Sorghum halcapense or Sorghum vulgare. In certain embodiments, the polynucleotides and vectors described herein can be used to transform a number of monocotyledonous and dicotyledonous plants and plant cell systems, wherein such plants are hybrids of different species.
(39) In some embodiments, the plant for the methods and compositions of the present disclosure is a C.sub.3 plant. In some embodiment, the C.sub.3 plant is selected from the group consisting of genera Allium, Arabidopsis, Brassica, Capsicum, Citrullus, Cucumis, Eucalyptus, Fragaria, Glycine, Gossypium, Hordeum, Ipomoea, Malus, Manihot, Nicotiana, Oryza, Populus, Prunus, Rosa, Solanum, Spinacia and Triticum.
(40) In some embodiments, the plant for the methods and compositions of the present disclosure is a C.sub.4 plant. In some embodiment, the C.sub.4 plant is selected from the group consisting of genera Panicum, Saccharum, Setaria, Sorghum and Zea.
(41) Methods of Improving Drought and Salt Tolerance Photosynthetic Rate, Biomass Production and Water-Use Efficiency in Plants
(42) The inventors of the present disclosure have described a process of improving drought and salt tolerance/resistance, photosynthetic rate, biomass production and water-use efficiency in plants. Drought tolerance/resistance and salt tolerance/resistance, increased photosynthetic rate, biomass production and water-use efficiency are desirable qualities that affect plant biomass. With methods of this disclosure, it is possible to generate engineered plants which produce more biomass, and/or more crop and plant product derived thereof, if grown under conditions of low water availability/drought in comparison with plants not subjected to the method according to the present disclosure. In some embodiments, the biomass of the engineered plant is increased by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, or by at least 60% when compared to a corresponding control plant.
(43) In some embodiments, the method comprises introducing into a plant an exogenous nucleic acid encoding a crassulacean acid metabolism (CAM)-specific phosphoenolpyruvate carboxylase (PEPC).
(44) In some embodiments, the exogenous nucleic acid encodes a PEPC gene of a CAM plant species. In a specific embodiment, the CAM plant species is selected from the group consisting of genera Agave, Kalanchoe, Phalaenopsis, Ananas and Crassula. In a specific embodiment, the CAM plant species is selected from the group consisting of Kalanchoe fedtschenkoi, Agave Americana, Phalaenopsis equestris and Ananas comosus.
(45) In a specific embodiment, the CAM plant species is Agave americana. In a specific embodiment, the CAM-specific PEPC comprises an amino acid sequence substantially identical with SEQ ID NO: 19, and a nucleic acid sequence substantially identical with SEQ ID NO: 18.
(46) In some embodiments, the PEPC comprising is expressed constitutively. In some embodiments, the PEPC is expressed in a temporally controlled manner. In a specific embodiment, temporally controlled manner expression of PEPC refers to expression of the PEPC during night time.
(47) In some embodiments a plant, plant cell or plant tissue can be transformed by having a construct integrated into its genome, i.e., can be stably transformed. Stably transformed cells typically retain the introduced nucleic acid with each cell division. A plant or plant cell can also be transiently transformed such that the construct is not integrated into its genome. Transiently transformed cells typically lose all or some portion of the introduced nucleic acid construct with each cell division such that the introduced nucleic acid cannot be detected in daughter cells after a sufficient number of cell divisions. Both transiently transformed and stably transformed transgenic plants and plant cells can be useful in the methods described herein.
(48) Expression Vectors
(49) The polynucleotides and expression vectors described herein can be used to increase the expression of a crassulacean acid metabolism (CAM)-specific phosphoenolpyruvate carboxylase (PEPC) in plants and render them drought and salt resistant.
(50) In some embodiments, the vector comprises a nucleic acid sequence encoding for a PEPC enzyme from a CAM plant. In some embodiments, the PEPC is from a CAM plant species. In a specific embodiment, the CAM plant species is selected from the group consisting of Kalanchoe fedtschenkoi, Phalaenopsis equestris and Ananas comosus.
(51) In a specific embodiment, the CAM plant species is Agave Americana. In a specific embodiment, the CAM-specific PEPC comprises an amino acid sequence substantially identical with SEQ ID NO: 19, and a nucleic acid sequence substantially identical with SEQ ID NO: 18.
(52) The vectors provided herein can include origins of replication, scaffold attachment regions (SARs) and/or markers. A marker gene can confer a selectable phenotype on a plant cell. For example, a marker can confer biocide resistance, such as resistance to an antibiotic (e.g., kanamycin, G418, bleomycin or hygromycin) or an herbicide (e.g., chlorosulfuron or phosphinothricin). In addition, an expression vector can include a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as green fluorescent protein (GFP), glutathione 5-transferase (GST), polyhistidine, c-myc, hemagglutinin or Flag-tag (Kodak, New Haven, Conn.) sequences typically are expressed as a fusion with the encoded polypeptide. Such tags can be inserted anywhere within the polypeptide, including at either the carboxyl or amino terminus. As described herein, plant cells can be transformed with a recombinant nucleic acid construct to express a polypeptide of interest.
(53) A variety of promoters are available for use, depending on the degree of expression desired. For example, a broadly expressing promoter promotes transcription in many, but not necessarily all, plant tissues. Non-limiting examples of broadly expressing promoters that can be included in the nucleic acid constructs provided herein include the cauliflower mosaic virus (CaMV) 35S promoter, the mannopine synthase (MAS) promoter, the 1′ or 2′ promoters derived from T-DNA of Agrobacterium tumefaciens, the figwort mosaic virus 34S promoter, actin promoters such as the rice actin promoter and ubiquitin promoters such as the maize ubiquitin-1 promoter.
(54) In some embodiments, the promoter to drive expression of genes of interest is a constitutive promoter. In some embodiments the constitutive promoter is selected from the group consisting of a ubiquitin promoter, a cauliflower mosaic virus (CaMV) 35S promoter, an actin promoter, a peanut chlorotic streak caulimovirus promoter, a Chlorella virus methyltransferase gene promoter, a full-length transcript promoter form figwort mosaic virus, a pEMU promoter, a MAS promoter, a maize H3 histone promoter and an Agrobacterium gene promoter.
(55) In some embodiments, the promoter to drive expression of genes of interest is a regulated promoter. In some embodiments the regulated promoter is selected from the group consisting of a stress induced promoter, chemical-induced promoter, a light induced promoter, a dark-induced promoter, and a circadian-clock controlled promoter.
(56) Some suitable regulatory regions initiate transcription, only or predominantly, in certain cell types. For instance, promoters active in photosynthetic tissue confer transcription in green tissues such as leaves and stems. Examples of such promoters include the ribulose-1,5-bisphosphate carboxylase (RbcS) promoters such as the RbcS promoter from eastern larch (Larix laricina), the pine chlorophyll a/b binding-6 (cab6) promoter (Yamamoto et al., 1994, Plant Cell Physiol., 35:773-778), the chlorophyll a/b binding-1 (Cab-1) promoter from wheat (Fejes et al., 1990, Plant Mol. Biol., 15:921-932), the chlorophyll a/b binding-1 (CAB-1) promoter from spinach (Lubberstedt et al., 1994, Plant Physiol., 104:997-1006), the cab IR promoter from rice (Luan et al., 1992, Plant Cell, 4:971-981), the pyruvate orthophosphate dikinase (PPDK) promoter from corn (Matsuoka et al., 1993. Proc. Natl. Acad. Sci. USA, 90:9586-9590), the tobacco light-harvesting complex of photosystem (Lhcb1*2) promoter (Cerdan et al., 1997, Plant Mol. Biol., 33:245-255), the Arabidopsis SUC2 sucrose-H+ symporter promoter (Truernit et al., 1995, Planta, 196:564-570) and thylakoid membrane protein promoters from spinach (psaD, psaF, psaE, PC, FNR, atpC, atpD, cab, rbcS).
(57) In some embodiments, promoters of the instant application comprise inducible promoters. Inducible promoters confer transcription in response to external stimuli such as chemical agents or environmental stimuli. For example, inducible promoters can confer transcription in response to hormones such as gibberellic acid or ethylene or in response to light, nitrogen, shade or drought.
(58) A basal promoter is the minimal sequence necessary for assembly of a transcription complex required for transcription initiation. Basal promoters frequently include a “TATA box” element that may be located between about 15 and about 35 nucleotides upstream from the site of transcription initiation. Basal promoters also may include a “CCAAT box” element (typically the sequence CCAAT) and/or a GGGCG sequence, which can be located between about 40 and about 200 nucleotides, typically about 60 to about 120 nucleotides, upstream from the transcription start site.
(59) A 5′ untranslated region (UTR) can be included in nucleic acid constructs described herein. A 5′ UTR is transcribed, but is not translated and lies between the start site of the transcript and the translation initiation codon and may include the +1 nucleotide. A 3′ UTR can be positioned between the translation termination codon and the end of the transcript. UTRs can have particular functions such as increasing mRNA stability or attenuating translation. Examples of 3′ UTRs include, but are not limited to, polyadenylation signals and transcription termination sequences, e.g., a nopaline synthase termination sequence.
(60) It will be understood that more than one regulatory region may be present in a vector, e.g., introns, enhancers, upstream activation regions, transcription terminators and inducible elements. Regulatory regions, such as promoters for endogenous genes, can be obtained by chemical synthesis or by subcloning from a genomic DNA that includes such a regulatory region. A nucleic acid comprising such a regulatory region can also include flanking sequences that contain restriction enzyme sites that facilitate subsequent manipulation.
(61) Techniques for introducing nucleic acids into monocotyledonous and dicotyledonous plants are known in the art and include, without limitation, Agrobacterium-mediated transformation, viral vector-mediated transformation, electroporation and particle gun transformation, e.g., U.S. Pat. Nos. 5,538,880, 5,204,253, 6,329,571 and 6,013,863, incorporated herein by reference. If a cell or tissue culture is used as the recipient tissue for transformation, plants can be regenerated from transformed cultures if desired, by techniques known to those skilled in the art. See, e.g., Niu et al., 2000. Plant Cell Rep. V19:304-310; Chang and Yang, 1996, Bot. Bull. Acad. Sin., V37:35-40 and Han et al., 1999, Biotechnology in Agriculture and Forestry, V44:291 (ed. by Y. P. S. Bajaj), Springer-Vernag.
(62) Genetically Modified (Transgenic) Plants/Plant Species/Plant Cells/Plant Tissues
(63) Also disclosed herein are plants and plant cells genetically modified by introduction of the disclosed gene editing constructs and expression vectors to display increased salt and drought resistance.
(64) In some embodiments, the genetically modified plant comprises a plant that is modified to express an exogenous nucleic acid encoding a crassulacean acid metabolism (CAM)-specific phosphoenolpyruvate carboxylase (PEPC).
(65) In some embodiments, the exogenous nucleic acid encodes a PEPC gene of a CAM plant species. In a specific embodiment, the CAM plant species is selected from the group consisting of genera Agave, Kalanchoe, Phalaenopsis, Ananas and Crassula. In a specific embodiment, the CAM plant species is selected from the group consisting of Kalanchoe fedtschenkoi, Agave Americana, Phalaenopsis equestris and Ananas comosus.
(66) In a specific embodiment, the CAM plant species is Agave Americana. In a specific embodiment, the CAM-specific PEPC comprises an amino acid sequence substantially identical with SEQ ID NO: 19, and a nucleic acid sequence substantially identical with SEQ ID NO: 18.
(67) In some embodiments, the exogenous CAM-specific PEPC is expressed constitutively in the genetically modified plant. In some embodiments, the CAM-specific PEPC is expressed in the genetically-modified plant in a temporally controlled manner. In a specific embodiment, the temporally controlled manner comprises expression of the CAM-specific PEPC during the daytime. In a specific embodiment, the temporally controlled manner comprises expression of the CAM-specific PEPC during the night time.
(68) In some embodiments, the exogenous nucleic acid encodes a PEPC is from a CAM plant species. In a specific embodiment, the CAM plant species is selected from the group consisting of Agave americana, Kalanchoe fedtschenkoi, Phalaenopsis equestris, Ananas comosus and Crassula perforata.
(69) In some embodiments a plant or plant cell can be transformed by having a construct integrated into its genome, i.e., can be stably transformed. Stably transformed cells typically retain the introduced nucleic acid with each cell division. A plant or plant cell can also be transiently transformed such that the construct is not integrated into its genome. Transiently transformed cells typically lose all or some portion of the introduced nucleic acid construct with each cell division such that the introduced nucleic acid cannot be detected in daughter cells after a sufficient number of cell divisions. Both transiently transformed and stably transformed transgenic plants and plant cells can be useful in the methods described herein.
(70) Typically, transgenic plant cells used in methods described herein constitute part or all of a whole plant. Such plants can be grown in a manner suitable for the species under consideration, either in a growth chamber, a greenhouse or in a field. Transgenic plants can be bred as desired for a particular purpose, e.g., to introduce a recombinant nucleic acid into other lines, to transfer a recombinant nucleic acid to other species or for further selection of other desirable traits. Progeny includes descendants of a particular plant or plant line provided the progeny inherits the transgene. Progeny of a plant include seeds formed on F1, F2, F3, F4, F5, F6 and subsequent generation plants or seeds formed on BC1, BC2, BC3 and subsequent generation plants or seeds formed on F1BC1, F1BC2, F1BC3 and subsequent generation plants. Seeds produced by a transgenic plant can be grown and then selfed (or outcrossed and selfed) to obtain seeds homozygous for the nucleic acid construct. Alternatively, transgenic plants can be propagated vegetatively for those species amenable to such techniques.
(71) Transgenic plant cells growing in suspension culture or tissue or organ culture can be useful for extraction of polypeptides or compounds of interest, e.g., lignin monomers or compounds in a lignin biosynthetic pathway. For the purposes of this invention, solid and/or liquid tissue culture techniques can be used. When using solid medium, transgenic plant cells can be placed directly onto the medium or can be placed onto a filter film that is then placed in contact with the medium. When using liquid medium, transgenic plant cells can be placed onto a floatation device, e.g., a porous membrane that contacts the liquid medium. Solid medium typically is made from liquid medium by adding agar. For example, a solid medium can be any of various mineral salt media, e.g., Murashige and Skoog (MS) medium containing agar and a suitable concentration of an auxin, e.g., 2,4-dichlorophenoxyacetic acid (2,4-D) and a suitable concentration of a cytokinin, e.g., kinetin.
(72) In some embodiments, the transgenic plants express the disclosed genes in a tissue-specific manner. In some embodiments, the genes are expressed from nucleic acid constructs that comprise a cell type or tissue type-preferential promoter. As used herein, a “cell type- or tissue-preferential promoter” refers to a promoter that drives expression preferentially in the target tissue, but may also lead to some expression in other cell types or tissues as well. In a specific embodiment, the disclosed genes are expressed in the leaf tissue.
(73) Initial and immediate application of the disclosed methods can be made in the bioenergy crops Populus and switchgrass, but the application can be extended to other bioenergy crops such as corn, other sources of lignocellulosic biomass and other model plants e.g., Salix, Miscanthus, rice, wheat, soybean and Medicago.
(74) For example, the polynucleotides and vectors described herein can be used to transform a number of monocotyledonous and dicotyledonous plants and plant cell systems, including alfalfa, ash, beech, birch, canola, cherry, clover, cotton, cottonseed, eucalyptus, flax, jatropha, mahogany, maple, mustard, oak, poplar, oilseed rape, rapeseed (high erucic acid and canola), red clover, teak, tomato, walnut and willow, as well as monocots such as barley, bluegrass, canarygrass, corn, fescue, field corn, millet, miscanthus, oat, rice, rye, ryegrass, sorghum, sudangrass, sugarcane, sweet corn, switchgrass, turf grasses, timothy and wheat. Gymnosperms such as fir, pine and spruce can also be suitable.
(75) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.
(76) The present disclosure is further illustrated by the following non-limiting examples.
Example 1: CAM-Specific PEPC in Agave americana
(77) Through a tBLASTn search against A. americana transcriptomics data (Abraham P E. et al., 2016. Nature Plants, 2: 16178. 500) using the PEPC protein sequences of Arabidopsis thaliana as queries, the inventors identified a total of 21 transcripts encoding PEPC in A. americana. Several types of PEPC are present in plants, including plant-type PEPCs (PTPCs) and one bacterium-type PEPC (BTPC) (O'Leary B. et al. 2011. Biochemical Journal, 436: 15-34; Shi J. et al. 2015. Plant Physiology, 167: 671-681). The plant-type PEPCs studied so far are classified into four groups, including C.sub.3, C.sub.4 and CAM-types from photosynthetic tissues and root-type from non photosynthetic tissue (Masumoto C. et al. 2010. PNAS, 107: 5226-5231). In order to gain insight into the evolutionary relationships among PTPCs, the inventors constructed a phylogenetic tree using the 21 predicted Agave PEPC transcripts and the C.sub.3-, C.sub.4-, CAM- and root-type PEPCs from rice (Oryza sativa), maize (Zea mays), wheat (Triticum aestivum), sugarcane (Saccharum spp.), sorghum (Sorghum bicolor), foxtail millet (Setaria italica) and orchid (Phalaenopsis equestris) (Masumoto C. et al. 2010. PNAS, 107: 5226-5231; Yang X. et al. 2017, Nature Communications 8: 1899). Phylogenetic analysis of the plant-type PEPCs indicates that Aam080248 (named AaPEPC1) belongs to CAM-type PEPC (
Example 2: AaPEPC1 Binds to Phosphoenolpyruvate
(78) Phosphoenolpyruvate (PEP) is the substrate for PEPC enzymes (Kai Y. et al. 2003. Arch Biochem Biophys, 414: 170-179; Gonzalez-Segura L. et al. 2018. Journal of Biological Chemistry: jbc. RA118. 002884). To understand whether or not AaPEPC1 binds to PEP, the inventors developed protein structural model using I-TASSER (v.5.1) accompanied by 200 ns molecular dynamics (MD) simulation (
Example 3: Development of Transgenic Lines of Tobacco Overexpressing AaPEPC1
(79) After the inventors identified the CAM-isoform of PEPC, the inventors tested the hypothesis that ectopic expression of the AaPEPC1 would bring the C.sub.3 plant a step closer toward the CAM state and consequently enhance photosynthetic CO.sub.2 fixation and abiotic stress tolerance in tobacco. The AaPEPC1 coding sequences were fused behind the cauliflower mosaic virus 35S (CaMV35S) promoter in a binary vector pBI121 to yield p35S::AaPEPC1 for transformation into tobacco (
Example 4: Overexpression of AaPEPC1 Increases Photosynthetic Rate and Water-Use Efficiency
(80) In order to assess whether the constitutive overexpression of AaPEPC1 affects photosynthetic performance, the inventors performed gas exchange analysis of the transgenic tobacco plants over expressing AaPEPC1, along with empty vector (EV) and wild-type (WT) control plants, grown under normal conditions (12 h light/12 h dark photoperiod; without drought- or salt-stress) at four time points (i.e., 3 h, 9 h, 15 h and 21 h after the beginning of the light period). The transgenic plants over-expressing AaPEPC1 showed significantly higher photosynthetic rates than WT and EV controls in the daytime (
Example 5: The Impact of AaPEPC1 Overexpression on the Accumulation of Malate and Glucose
(81) PEPC functions in the production of malate, which is a key intermediate of the tricarboxylic acid (TCA) cycle linking lipids and glucose metabolisms with photosynthesis in plants (Nunes-Nesi A. et al. 2011. Plant Physiology, 155: 101-107; Shi J. et al. 2015. Plant Physiology, 167: 671-681). The diel fluctuation in malate level represents a central biochemical requirement of the CAM photosynthesis pathway (Borland et al. 2014). Also, glycolysis and gluconeogenesis pathways (breakdown and synthesis of glucose) supply substrates (PEP and pyruvate) for nocturnal primary carboxylation and daytime decarboxylation reactions, respectively, and are thus essential for CAM plants (Borland A M. et al., 2014. Trends in Plant Science, 19: 327-338; Bräutigam A. et al. 2017. Plant physiology, 174: 473-477).
(82) To determine the impact of AaPEPC1 overexpression on malate and glucose production in transgenic tobacco, the malate and glucose contents were measured with standard enzyme-linked spectrophotometric methods at 4 time points (i.e., 3 h, 9 h, 15 h and 21 h after the beginning of the light period). The transgenic plants showed higher malate and glucose contents than WT and EV controls at all the four time points during day and night (
Example 6: AaPEPC1 Overexpression Changes Stable Carbon Isotope Ratio
(83) Stable carbon isotope ratio δ.sup.13C (.sup.13C/.sup.12C) is a broadly accepted indicator of the extent to which the biomass is derived from PEPC-mediated CO.sub.2 fixation in plants, because PEPC discriminates less against .sup.13C than Rubisco, the enzyme responsible for most net CO.sub.2 uptake in C.sub.3 photosynthesis plants during the light period. The positive correlation between the δ.sup.13C values and CAM activity has been demonstrated to be a simple and reliable method for determining the type of photosynthesis, including C.sub.3, C.sub.3-CAM intermediate and CAM (Winter K. et al. 2002. Plant Physiology, 129: 1843-1851; Holtum J A. et al. 2004. Trees 18: 658-668; Zhang L. et al. 2016. Plant Journal, 86: 175-185). In this study, the inventors found the δ.sup.13C values were significantly increased (i.e., became less negative) in the transgenic line (OE2), the expression level of AaPEPC1 in which is 7.74-fold higher than that in the other transgenic line (OE1), in comparison with the controls (
Example 7: CAM-Related Genes are Up-Regulated by AaPEPC1 Overexpression
(84) To test whether the re-programed changes in diel malate content will lead to feedback regulation of CAM pathway genes, expression of the orthologs of CAM genes in the transgenic and WT plants was analyzed using quantitative reverse transcription PCR (qRT-PCR) (
Example 8: Impact of AaPEPC1 Overexpression on Biomass Production
(85) Based on the above, the inventors speculated that the higher photosynthetic rates, glucose content and .sup.13C/.sup.12C isotope ratios measured in transgenic plants may result in improved biomass production. To test this speculation, the inventors examined the growth of the transgenic plants, along with EV and WT control plants, in growth chambers under well-water conditions. After 6-weeks of growth, the transgenic AaPEPC1 plants exhibited larger physical size than WT and EV controls (
Example 9: Impact of AaPEPC1 Overexpression on Salt and Drought Tolerance
(86) Most crop plants are susceptible to salinity, with their growth inhibited or even completely prevented by NaCl concentrations of 100-200 mM, resulting in plant death (Munns R et al. 1986. Functional Plant Biology, 13: 143-160; Acosta-Motos J R. et al., 2017. Agronomy, 7: 18). To investigate whether overexpression of AaPEPC1 enhances. salt tolerance in transgenic plants, the transgenic AaPEPC1 plants, and EV and WT controls were grown in pots and irrigated with a 200 mL of 200 mM NaCl solution once every 2 days for 4 weeks. The salt-stress treatment caused the death of WT and EV control plants, while the transgenic plants overexpressing AaPEPC1 maintained growth (
(87) Based on a significant improvement in WUE in the transgenic plants expressing AaPEPC1 (
Example 10: Proline Biosynthesis is Enhanced by AaPEPC1 Overexpression
(88) PEPC plays a crucial role in nitrogen metabolism in Arabidopsis (Shi J. et al. 2015. Plant Physiology, 167: 671-681). Loss-of function of both PEPC1 and PEPC2 decreased the levels of glutamate in Arabidopsis. Glutamate can be converted into proline by two successive reductions catalyzed by pyrroline-5-carboxylate synthase (P5CS) and pyrroline-5-carboxylate reductase (P5CR) (Liu D. et al. 2014. Plant Cell, Tissue and Organ Culture, 117: 1-16). Proline plays important roles in stress tolerance, e.g., drought and salt stress tolerance, by regulating osmotic balance, activating ROS scavenging system, protecting membrane integrity and photosynthesis (Liu D. et al. 2014. Plant Cell, Tissue and Organ Culture, 117: 1-16). The inventors hypothesized that overexpression of AaPEPC1 could enhance the proline biosynthesis, and consequently increases the drought and salt stress tolerance in the transgenic plants. To test this hypothesis, proline content was analyzed in the transgenic AaPEPC1 plants, along with WT and EV controls. Proline contents in the transgenic plants expressing AaPEPC1 were significantly higher than that in the WT and EV controls (
Example 11
(89) Engineering of the water-conserving CO.sub.2-concentrating mechanism of CAM has the potential to improve photosynthetic CO.sub.2 fixation and abiotic stress tolerance in C.sub.3 plants (Borland A M. et al., 2014. Trends in Plant Science, 19: 327-338; Yang X. et al. 2015. New Phytologist, 207: 491-504; Liu D. et al. 2018. Plant Science, 274: 394-401). This study achieved the first success in switching of C.sub.3 toward CAM photosynthesis by engineering of one single gene from CAM plants. In this study, the inventors identified a CAM-type PEPC (AaPEPC1) in A. americana and transformed the AaPEPC1 gene into C.sub.3 plant tobacco. Compared with WT and EV controls, the transgenic plants expressing AaPEPC1 expressed several CAM-like traits: 1) higher WUE, 2) higher stomatal conductance and malate accumulation at the onset of the dark period, 3) higher leaf carbon isotope ratio δ.sup.13C values, and 4) upregulated expression levels of the orthologs of several key CAM pathway genes (
(90) It is very interesting that AaPEPC1 overexpression increased the transcript abundance of several other CAM-related genes, including CA, MDH, ALMT, TDT and ME (
(91) Although PEPC is well-known as a key enzyme for CO.sub.2 fixation, its role in conferring resistance to salt stress in plants has not been very clear yet. In this study, the inventors clearly demonstrated that overexpression of AaPEPC1 significantly increased the salt tolerance in transgenic tobacco plants (
(92) Recently, the photosynthesis and plant growth were significantly improved in tobacco plants through introducing a faster Rubisco of cyanobacterial origin (Lin M T. et al. 2014. Nature, 513: 547), accelerating recovery from photoprotection (Kromdijk J. et al. 2016. Science, 549 354: 857-861), or engineering synthetic glycolate metabolism pathways (South P F. et al. 2019. Science, 363: eaat9077). However, none of these approaches can enhance tolerance to drought or salt stresses. On the other hand, previous genetic engineering efforts made good progress in creating genetically-modified plants with enhanced tolerance to either drought stress (Singha D L. et al. 2017. Plant Cell, Tissue and Organ Culture 130: 577-589; Wang L. et al. 2018. Plant Cell, Tissue and Organ Culture, 133: 27-38) or salt stress (Roy S J. et al. 2014. Current Opinion in Biotechnology 26: 115-124; Liu D. et al. 2015. Plant Cell, Tissue and Organ Culture, 120: 701-715; Li R. et al. 2017. Plant Science, 262: 39-51), with very limited success in conferring tolerance to both drought stress and salt stress in a single transgenic line. In this study, the inventors created genetically-modified tobacco plants that have enhanced performance in multiple aspects: photosynthesis, plant growth, water use efficiency, drought tolerance, and salt tolerance. These pleiotropic effects of AaPEPC1-overexpression open a new door to genetic improvement of crops for sustainable bioenergy and food production on marginal lands to alleviate the challenge caused by human population growth, urbanization, and global climate change.
(93) In conclusion, the inventors report the first successful effort of engineering of a CAM pathway gene to improve photosynthetic CO.sub.2 fixation and abiotic stress tolerance in the model C.sub.3 plant species tobacco. These findings have important implications for ultimate aspirations to engineer CAM into non CAM crops as a means of improving productivity, WUE and abiotic stress tolerance.
Example 12: Materials and Methods
(94) Genome-Wide Analysis of the PEPC Gene Family
(95) Arabidopsis thaliana PEPC sequences (AT1G68750.1, AT1G53310.1, AT3G14940.1 and AT2G42600.2) were retrieved and used as queries in BLAST searches against the Agave americana transcriptomics data (Abraham P E. et al., 2016. Nature Plants, 2: 16178. 500) to identify potential PEPC genes. All homologous protein sequences of the predicted PEPC family members were accepted if they were satisfied with expectation (E) value<1E-10. The expression data of the Agave PEPCs was also obtained from the A. americana transcriptomics data (Abraham et al. 2016). For Agave PEPC genes expression pattern, the log 10 transformed FPKM values and z-score normalized relative expression were used for heatmap analysis.
(96) Phylogenetic Analysis
(97) Multiple alignment of PEPC proteins was performed using the MAFFT online service (Katoh K. et al. 2017. Briefings in Bioinformatics bbx108). The maximum likelihood (ML) phylogenetic tree was constructed using W-IQ-TREE (Trifinopoulos J. et al. 2016. Nucleic Acids Research 44: W232-W235). Sequences used were: foxtail millet (Setaria italica) (AY491400), foxtail millet (S. italica) C.sub.4 (AF495586), maize (Zea mays) C.sub.3 (X61489), maize (Z. mays) C.sub.4 (X15642), maize (Z. mays) root (AB012228), rice (Oryza sativa) C.sub.3 (OS08g0366000, Os09g0315700, Os01g0758300), rice (O. sativa) root (OS02g0244700), sorghum (Sorghum bicolor) C.sub.4 (X63756), sugarcane (Saccharum hybrid var. H32-8560) C.sub.3 (M86661), sugarcane (Saccharum hybrid cultivar Taitang2) C.sub.4 (AY135709), and wheat (Triticum aestivum) (AJ007705) (Masumoto C. et al. 2010. PNAS, 107: 5226-5231). The bootstrap values were calculated as percentages for 1000 replications.
(98) Structural Modeling and Molecular Dynamics Simulation
(99) The A. americana PEPC1 model was built using the iterative threading assembly refinement (I TASSER, V5.1) (Roy A. et al. 2010. Nat Protoc, 5: 725-738) protein structure modeling toolkit. Structure averaging from multiple MD simulations, or, a single long time-scale MD simulation, could effectively refine the predicted structures (Mirjalili V. et al. 2014. Proteins, 82: 196-207). Here, a 200-ns MD simulation without restraint was performed for the best model constructed by I-TASSER. The online program MolProbity (Chen V B. et al., 2010. Acta Crystallogr, D 66: 12-21) was applied to validate the rotamers of Asn, Gln and His, and to determine the protonation states of titratable residues of Glu, Asp, Lys, Arg and His. Missing hydrogen atoms were added using the HBUILD module in CHARMM (Brooks B R. 2009. Journal of Computational Chemistry, 30: 1545-1614). A water box with at least 15 Å to the edge of the protein was used, and sodium/chloride ions were added to balance the net charge of the whole system. The final model has 120,210 atoms with 34,893 water molecules, and has a size of 118×106×102 Å3. The MD simulations were performed using the software NAMD (Phillips J C. et al. 2005. Journal of Computational Chemistry 26: 1781-1802). The CHARMM protein force field (Best R B. et al., 2012. J Chem Theory Comput, 8: 3257-3273) and TIP3P water model (Jorgensen W L. et al. 1983. Journal of Chemical Physics, 79: 926-935) were adopted in all MD simulations. A time step of 2-fs was applied with the SHAKE algorithm to fix the bonds involving hydrogen atoms. After a 50,000 steps energy minimization, the temperature of the system was gradually heated to 300 K with a rate of 0.001 K per time step. The MD simulations were performed under an NPT ensemble with the system pressure of 1 atm and temperature of 300 K maintained by the
(100) Langevin piston controls. Cutoff of switching between 9 and 11 Å was applied for the non-bonded interactions, and particle mesh Ewald summation with a grid spacing of 1.35 Å were applied for long range electrostatic interactions, respectively. A 200 ns MD simulation was performed, and analysis was carried out on the last 50 ns of the MD trajectory. The online tool PDBsum (Laskowski R A. et al. 2018. Protein Sci, 27: 129-134) was used to plot the cartoon topology of the protein structure.
(101) Plasmid Construction
(102) A 2943-bp DNA fragment containing the coding sequence of AaPEPC1 (Aam080248) (Aam080248 transcribed RNA sequence is shown by SEQ ID NO: 17. Aam080248 coding sequence is shown by SEQ ID NO: 18. Aam080248 protein is shown by SEQ ID NO:19) fused to two FLAG epitope tags (Terpe K. 2003. Applied Microbiology and Biotechnology, 60: 523-533) was chemically synthesized by Integrated DNA Technology (Coralville, Iowa) and used to produce a chimeric gene construct, p35S:FLAG-AaPEPC1/pNOS: nptII. The vector contains the CaMV35S promoter driving FLAG-AaPEPC1 and nopaline synthase (NOS) promoter driving the nptII gene for kanamycin resistance as a selection marker. The vector was delivered into the Agrobacterium tumefaciens strain, GV3101, for plant transformation.
(103) Plant Transformation
(104) A woodland tobacco (Nicotiana sylvestris) was employed for genetic transformation. The generation and nursing of transgenic plants were carried out as previously described (Zhang L. et al. 2012. In Vitro Cellular & Developmental Biology-Plant, 48: 275-282). The transgenic lines were assumed as single copy lines with separation rate at about 3:1 (kanamycin resistance versus sensitivity) in T1 generation, and the homozygous lines were assumed if there was no separation in T2 and T3 generation (n>100).
(105) Measurement of Photosynthesis
(106) Photosynthetic rate, stomatal conductance and transpiration rate in the leaves of transgenic plants and WT grown in pots for 6 weeks were measured according to the methods of Liu D. et al. (2014. Plant Cell, Tissue and Organ Culture, 117: 1-16). Relative chlorophyll content (SPAD value in fresh leaves) was measured with Chlorophyll Meter SPAD-502 (Minolta, Japan) (Liu et al. 2014. Plant Cell, Tissue and Organ Culture, 117: 1-16).
(107) Analysis of Malate, Glucose and Proline Content
(108) Mature leaves were sampled into liquid nitrogen at the indicated times and stored at −80° C. until use. The frozen leaf samples were prepared and assayed for malate and glucose content using the standard enzyme-linked spectrophotometric methods according to the manufacturer's instructions of malate and glucose assay kit, respectively (Sigma-Aldrich, #GAHK20, #MAK067). Proline content were analyzed as described by He S. (2009. Plant Cell, Tissue and Organ Culture, 96: 69).
(109) Carbon Isotope Ratio Analysis
(110) Plants were well watered throughout the growing period. Matures leaves were harvested from 6-week-old plants and dried for 1 week at 50° C. Finely ground dry powder were placed in capsules and then analyzed at the University of California Davis Stable Isotope Facility. Carbon isotope compositions of samples are calculated as described by Winter and Holtum (Winter K. et al. 2002. Plant Physiology, 129: 1843-1851).
(111) Salt and Drought Stress Treatment
(112) For salt tolerance analysis, the transgenic plants and controls were watered with 200 mM NaCl solution every other day for 4 weeks according to the method of Liu et al. (Liu et al. 2014. Plant Cell, Tissue and Organ Culture, 117: 1-16). For drought tolerance analysis, the plants were subjected to progressive drought by withholding water until a nearly lethal effect of dehydration was observed on WT. Recovery study was performed for plants under drought stress by re-irrigating with tap water (Xia Z. et al. 2013. PloS One, 8: e69787). After salt or drought treatment, the plants were dried for 48 h in an oven at 80° C. and weighed (Liu et al. 2014. Plant Cell, Tissue and Organ Culture, 117: 1-16). All treatments were performed in triplicate.
(113) Expression Analysis of the Related Genes
(114) The expression of related genes in the transgenic plants and WT was analyzed by qRT-PCR. Specific primers designed for each are listed in Table 1. Tobacco β-actin gene was used as an internal control. Quantification of the gene expression was done with comparative CT method (Schmittgen T D. et al. 2008. Nat Protoc, 3: 1101-1108).
(115) TABLE-US-00001 TABLE 1 Primers Primer name Primer sequence (5′-3′) AaPEPC1_qPCR_F2 GCCTACAGGAGGAGGAGTACGCTG (SEQ ID NO: 1) AaPEPC1_qPCR_R2 CCTGACTGACTGAGTCGGATGTGC (SEQ ID NO: 2) NsyALMT_qRT_F1 AATGGTTCAGAGTATGGATTGG (SEQ ID NO: 3) NsyALMT_qRT_R1 TAAGTGTCGCACCTATGCTG (SEQ ID NO: 4) NsyCA4_qRT_F1 GTCAAAGCCCTAAGTTCTTGGT (SEQ ID NO: 5) NsyCA4_qRT_R1 ACCCACTCTTCAATGAAATCACTG (SEQ ID NO: 6) NsyMDH_qRT_F1 TTGGATATGCTCTTGTTCCGA (SEQ ID NO: 7) NsyMDH_qRT_R1 GCAACAACACCTTTGAGAAGAG (SEQ ID NO: 8) NsyME_qRT_F1 TGGCTTGTGGATTCAAAGGG (SEQ ID NO: 9) NsyME_qRT_R1 GGTTGGCTTAATGGTCTTAACAG (SEQ ID NO: 10) NsyP5CR_qRT_F1 TAATACTCAGGTGGTTGAAGACAG (SEQ ID NO: 11) NsyP5CR_qRT_R1 CAAAGTAAAGACAGTGGCGG (SEQ ID NO: 12) NsyP5CS1_qRT_F1 CTTCAGGCACTTTCTTCCCA (SEQ ID NO: 13) NsyP5CS1_qRT_R1 CATCAGCAACCTCCGTTCTC (SEQ ID NO: 14) NsyTDT_qRT_F1 TGGAACTGTTAGTGTCATGATGG (SEQ ID NO: 15) NsyTDT_qRT_R1 CTGGTGCAATGGCTAAGTATGG (SEQ ID NO: 16)
Statistical Analysis
(116) The data presented as the mean±SD were analyzed by one-way ANOVA analysis with post-hoc Tukey honestly significant difference (HSD). A p-value of <0.05 was considered to be statistically significant.