Antisense Oligonucleotides (ODN) Against SMAD7 and Uses Thereof in Medical Field
20190211336 ยท 2019-07-11
Inventors
Cpc classification
A61P1/04
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
C12N2310/344
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
C12N15/1136
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis.
Claims
1-16. (canceled)
17. An antisense oligonucleotide against SMAD7 consisting of SEQ ID NO: 15 (5-ZTXGCCCCTTCTCCCXGCAZC-3), wherein X is 5-methyl-2-deoxycytidine 5-monophosphate and Z is 2-deoxyguanosine methylphosphonate.
18. The antisense oligonucleotide of claim 17, wherein at least one internucleoside linkage is a phosphorothioate linkage.
19. A method of treating an inflammatory bowel disease, comprising administering to a patient in need thereof an effective amount of the antisense oligonucleotide of claim 17.
20. A method of treating ulcerative colitis, comprising administering to a patient in need thereof an effective amount of the antisense oligonucleotide of claim 17.
21. A method of treating Crohn's disease, comprising administering to a patient in need thereof an effective amount of the antisense oligonucleotide of claim 17.
22. A pharmaceutical composition comprising the antisense oligonucleotide of claim 17 and a pharmaceutically acceptable adjuvant and/or excipient.
23. The pharmaceutical composition of claim 22, wherein the pharmaceutical composition is an oral pharmaceutical composition.
Description
[0071] The present invention is now described, for illustrative but not limitative purposes, according to its preferred embodiments, with particular reference to the figures of the enclosed drawings, wherein:
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
EXAMPLE 1: STUDY ON THE EFFECT OF SMAD7 ANTISENSE OLIGONUCLEOTIDES ACCORDING TO THE PRESENT INVENTION ON INTESTINAL T CELLS APOPTOSIS
[0083] Materials and Methods
[0084] Synthesis of Antisense ODN
[0085] All the Smad7 antisense ODN were synthesized by MWG Biotech AG (MWG Biotech S.r.l., Florence) employing standard automated techniques with an automated DNA synthesizer using standard phosphoroamidite chemistry protocols (Lesiak K. et al., 1993; Xiao W. et al., 1996).
[0086] Oligonucleotides containing 5-methyl-2-deoxycitidine (5-Me-dC) were synthesized according to known synthesis methods (Sanghvi et al., 1993) using commercially available phosphoroamidites, whereas synthesis of modified oligonucleotides containing methylphosphonate groups (MeP) was accomplished using known protocols (Maler M A. et al., 2002).
[0087] The purification of the oligonucleotidic molecules has been carried out HPSF technology, developed by MWG Biotech. Such purification method has revealed an high efficiency since it allows removing failure sequences synthesized during the automated chemical synthesis process, such as, for example, n1, n2, nx sequences, that standard purification classic methods are not capable to remove.
[0088] The above mentioned technology, besides enabling to obtain 100% of the desired length sequences without undesirable failure products, allows avoiding next desalting operation, since the purified sequences are free of both salt and metal ions.
[0089] Given the absence of any salt, oligonucleotides were eventually analysized by MALDI-TOF mass spectrometry techniques according to standard protocols (Guerlavais T. et al., 2002; Ragas J A. et al., 2000). Then oligonucleotides were sterilized and the resulting solution was quantified as optical density (OD) by UV/visible spectrophotometer. Finally the molecules were resuspended in sterile PBS1 before using.
[0090] All the used antisense ODN target Smad7 m-RNA sites which have 100% homology between human and mouse. In all the following oligonucleotides the internucleoside linkage is a phosphorothioate linkage.
[0091] The antisense ODN sequences being used in the present study have been designed according to the phosphorothioate antisense ODN sequence 5-GTCGCCCCTTCTCCCCGCAGC-3 (SEQ ID No 1) targeting the site 403 of the human Smad7 m-RNA, used by the author of the present invention in the course of previous experiments (Monteleone et al., 2001).
[0092] The Smad7 antisense ODN sequence 5-MePGTMe-dCGCCCCTTCTCCCMe-dCGCAMePG-3 (SEQ ID No 4) targets the site 403 of the human Smad7 m-RNA. This is a mixed-backbone oligonucleotide wherein the cytosine belonging to CpG pairs of SEQ ID No 1 were replaced by 5-methylcytosine (herein indicated as Me-dC). In addition, methylphosphonate linkages were placed at the ends of the molecule (herein indicated as MeP).
[0093] The Smad7 antisense ODN sequence 5-GTTTGGTCCTGAACATGC-3 (SEQ ID No 5) targets the site 294 of the human Smad7 m-RNA.
[0094] Mucosal samples were taken from resection specimens of 6 patients with moderate-to-severe CD and 4 patients with severe UC. In addition, intestinal mucosal samples were taken from 10 unaffected IBD patients undergoing colectomy for colon carcinoma (ethical approval was obtained by local committee). LPMC were prepared using the DTT-EDTA-collagenase procedure and resuspended in RPMI 1640 (Sigma-Aldrich S.r.l., Milan) supplemented with a serum replacement reagent HL-1 (Biowhittaker, Wokingham, UK).
[0095] Cells were cultured in the presence and absence of TGF-1 (Sigma-Aldrich, final concentration ranging from 1 to 5 ng/ml) and after 48 hours of incubation were analyzed for the level of apoptosis.
[0096] In other experiments, LPMC isolated from IBD patients intestine were resuspended in RPMI 1640 supplemented with HL-1 and cultured in the presence and absence of the above mentioned Smad7 antisense ODN (SEQ ID No 4, SEQ ID No 5), and in the presence of a control sense oligonucleotide (both used at a concentration of 2 g/ml). After 24 hours, an aliquot of LPMC was used for extracting proteins and evaluate Smad7 expression. The remaining cells were extensively washed and resuspended in RPMI 1640 plus HL-1 and cultured in the presence or absence of TGF-1 (5 ng/ml) for 48 hours and then analyzed for apoptosis.
[0097] Analysis of Apoptosis by Flow Cytometry
[0098] Apoptosis was analyzed by propidium iodide (PI) staining followed by flow cytometry.
[0099] Cells were washed, incubated for 15 minutes at 37 C. in 5 l ribonuclease A (0.6 g/ml, 30-60 Kunitz units, Sigma-Aldrich), and then chilled on ice. Propidium iodide (100 g/ml) was added before analysis by flow cytometry.
[0100] T cells were identified using a specific monoclonal anti-CD3 antibody (DAKO Ltd., Cambridgeshire, UK).
[0101] Protein Extraction and Western Blot Analysis
[0102] LPMC were homogenized and total proteins were extracted in buffer A containing 10 mM Hepes (pH 7.9), 10 mM KCl, 0.1 mM EDTA and 0.2 mM EGTA. Buffer was supplemented with 1 mM dithiothreitol (DTT), 10 g/ml aprotinin, 10 g/ml leupeptin and 1 mM phenylmethanesulphonyl fluoride (all reagents from Sigma-Aldrich).
[0103] Smad7 protein was analyzed using a specific rabbit anti-human Smad7 antibody (1:400 final dilution, Santa Cruz Biotechnology, Inc., CA; USA). Goat anti-rabbit antibodies conjugated to horseradish peroxidase (Dako Ltd) were used at 1:20.000 final dilution to detect primary antibody binding and immunoreactivity was visualized with a chemiluminescence kit (Pierce, Rockford, Ill., USA).
[0104] Organ Culture
[0105] Mucosal explants taken from the surgical specimens of patients were cultured in the presence or absence of Smad7 antisense ODN (SEQ ID No 4, SEQ ID No 5; both used at a final concentration of 10 g/ml) for 40 hours.
[0106] As negative control, a mucosal explant was cultured in the presence of Smad7 sense ODN.
[0107] At the end of the culture, mucosal explants were collected and used for analyzing the number of lamina propria T lymphocytes by immunohistochemistry.
[0108] For this purpose, mucosal sections were prepared and stained with a monoclonal anti-CD3 antibody (DAKO). Goat anti-mouse antibodies conjugated to alkaline phosphatase (DAKO) were used to detect primary antibody binding.
[0109] Results
[0110] The results obtained in the different experiments show how TGF-1 enhanced, dose-dependently, apoptosis of T lymphocytes isolated from the intestine of normal subjects.
[0111] Table 1 shows the percentage of apoptotic T lymphocytes after 48 hours of culture. Numbers are the results of 4 separate experiments in which T cells isolated from the intestine of four normal subjects were used.
TABLE-US-00003 TABLE 1 Exp. 1 Exp. 2 Exp. 3 Exp. 4 Unstimulated 18% 17% 19% 23% TGF-1 (0.2 ng/ml) 22% 24% 23% 25% TGF-1 (1 ng/ml) 31% 33% 28% 31% TGF-1 (5 ng/ml) 33% 34% 32% 37%
[0112] In contrast, T lymphocytes isolated from four IBD patients showed a partial resistance to the TGF-1-induced apoptosis signal as shown in the results reproduced in Table 2 which shows the percentage of apoptotic T lymphocytes after 48 hours of culture.
TABLE-US-00004 TABLE 2 Exp. 1 Exp. 2 Exp. 3 Exp. 4 Unstimulated 11% 10% 9% 7% TGF-1 (0.2 ng/ml) 12% 9% 8% 5% TGF-1 (1 ng/ml) 10% 11% 11% 8% TGF-1 (5 ng/ml) 16% 13% 14% 15%
[0113] In particular, from the analysis of data shown in Table 2 no meaningful increase in apoptosis was seen when T cells from IBD patients were cultured in the presence of either 0.2 ng/ml or 1 ng/ml TGF-1 concentration. In contrast, stimulation of T cells from IBD patients with 5 ng/ml TGF-1 resulted in a small increase in apoptosis.
[0114] Treatment of T lymphocytes isolated from IBD patients with the Smad7 antisense ODN SEQ ID No 4 restored the cell responsiveness to TGF-1, resulting in enhanced cell apoptosis, as shown in percentage values of T lymphocytes reproduced in Table 3. Data refer to four separate experiments in which T cells isolated from the intestine of four IBD patients, were cultured with medium alone (unstimulated) or pre-treated with medium and sense (control) or antisense oligonucleotides overnight and then stimulated with TGF-1 (1 ng/ml).
TABLE-US-00005 TABLE 3 Exp. 1 Exp. 2 Exp. 3 Exp. 4 Unstimulated 10% 9% 8% 7% Medium 11% 9% 8% 5% ODN Sense 12% 10% 10% 8% ODN Antisense 33% 32% 23% 19%
[0115] Furthermore, using ex vivo organ culture, the author of the present invention demonstrated that treatment of IBD biopsies with Smad7 antisense ODN according to the present invention significantly decreased the number of mucosal CD3+ T cells, as shown in the immunohistochemistry of
[0116] Together these observations suggest the possibility that high Smad7 level plays a crucial role in prolonging T cell survival, thereby contributing to the propagation of local inflammation in IBD.
[0117] Thus, blocking Smad7 could represent a promising strategy to control mucosal inflammation in these condition.
EXAMPLE 2: IN VIVO AND IN VITRO STUDIES ON THE EFFECTS OF THE ADMINISTRATION OF SMAD7 ANTISENSE AND SENSE OLIGONUCLEOTIDES IN EXPERIMENTAL MODELS OF TNBS-INDUCED COLITIS
[0118] Material and Method
[0119] All the Smad7 antisense and sense ODN were synthesized by MWG Biotech S.r.l. (Firenze) employing the standard techniques previously described.
[0120] The used antisense ODN target Smad7 m-RNA sites which have 100% homology between human and mouse. In all the following oligonucleotides the internucleoside linkage is a phosphorothioate linkage. All the following sequences were used in the experiments carried out on the experimental induced-colitis models.
[0121] The Smad7 antisense ODN SEQ ID No 1 (5-GTCGCCCCTTCTCCCCGCAGC-3) targets the site 403 of the human Smad7 m-RNA already used by the author of the present invention in the course of experiments published in a previous article (Monteleone et al., 2001).
[0122] For the further study concerning the role of Smad7 on the regulation of T cell apoptosis in LPMC isolated from the intestine of IBD patients the following antisense oligonucleotide sequences SEQ ID No 4 e SEQ ID No 5 were used.
[0123] The Smad7 antisense ODN sequence 5-MePGTMe-dCGCCCCTTCTCCCMe-dCGCAMePG-3 (SEQ ID No 4) targets the site 403 of the human Smad7 m-RNA. This is a mixed-backbone oligonucleotide wherein the cytosine belonging to CpG pairs in the position 3 and 16 of SEQ ID No 1 were replaced by 5-methylcytosine (indicated as Me-dC). In addition, methylphosphonate linkages were placed at the ends of the molecule (indicated as MeP).
[0124] The Smad7 antisense ODN sequence 5-GTTTGGTCCTGAACATGC-3 (SEQ ID No 5) targets the site 294 of the human Smad7 m-RNA. The internucleoside linkages included therein are phosporothioate linkages.
[0125] The Smad7 antisense ODN sequence 5-GTTTGGTCCTGAACAT-3 (SEQ ID No 6) targets the site 296 of the human Smad7 m-RNA.
[0126] The Smad7 antisense ODN sequence 5-GTTTGGTCCTGAACATG-3 (SEQ ID No 7) targets the site 295 of the human Smad7 m-RNA.
[0127] The Smad7 antisense ODN sequence 5-AGCACCGAGTGCGTGAGC-3 (SEQ ID No 8) targets the site 577 of the human Smad7 m-RNA.
[0128] The Smad7 antisense ODN sequence 5-MePAGCACMedCGAGTGMedCGTGAGCMeP-3 (SEQ ID No 9) targets the site 577 of the human Smad7 m-RNA. This is a mixed-backbone oligonucleotide wherein the cytosine in the position 6 and 12 of SEQ ID No 8 were replaced by 5-methylcytosine. In addition, methylphosphonate linkages were placed at the ends of the molecule.
[0129] The Smad7 antisense ODN sequence 5-CGAACATGACCTCCGCAC (SEQ ID No 10) targets the site 233 of the human Smad7 m-RNA.
[0130] The Smad7 antisense ODN sequence 5-Me-d CGA ACA TGA CCT CMe-d CG CAC-3 (SEQ ID No 11) targets the site 233 of the human Smad7 m-RNA. This is a mixed-backbone oligonucleotide wherein the cytosine in the position 1 and 14 of SEQ ID No 10 were replaced by 5-methylcytosine.
[0131] The Smad7 antisense ODN sequence 5-GTMe-dCGCCCCTTCTCCCMe-dCGCAG-3 (SEQ ID No 12) targets the site 403 of the human Smad7 m-RNA. This is a mixed-backbone oligonucleotide wherein the cytosine belonging to CpG pairs in the position 3 and 16 of SEQ ID No 1 were replaced by 5-methylcytosine (indicated as Me-dC).
[0132] The Smad7 antisense ODN sequence 5-GATCGTTTGGTCCTGAA-3 (SEQ ID No 13) targets the site 299 of the human Smad7 m-RNA.
[0133] The Smad7 antisense ODN sequence 5-ATCGTTTGGTCCTGAAC-3 (SEQ ID No 14) targets the site 298 of the human Smad7 m-RNA.
[0134] The Smad7 antisense ODN sequence MePGTMe-dCGCCCCTTCTCCCMe-dCGCAMePGC (SEQ ID No 15) targets the site 403 of the human Smad7 m-RNA. This is a mixed-backbone oligonucleotide wherein the cytosine belonging to CpG pairs in the position 3 and 16 of SEQ ID No 1 were replaced by 5-methylcytosine (indicated as Me-dC). In addition, methylphosphonate linkages were placed at one of the ends of the oligonucleotides and at the guanine residue in position 20.
[0135] Induction of Colitis
[0136] Five to six-week old male SJL/J mice were maintained in a specific pathogen-free animal facility. For induction of colitis, 2.5 mg TNBS (pH 1.5-2.0; Sigma Aldrich) in 50% ethanol was administered per rectum to lightly anesthetized mice through a 3.5 F catheter. The catheter tip was inserted 4 cm proximal to the anal verge, then 100 ml of fluid (TNBS/ethanol) was slowly instilled into the colon.
[0137] To ensure distribution of the TNBS within the entire colon and cecum, mice were held in a vertical position for 30 seconds after the injection. Some of the mice were administered with 50% ethanol alone using the same technique and were used as controls.
[0138] Histologic Assessment of Colitis
[0139] Tissues removed from mice at indicated times of death were fixed in 10% formalin solution (Sigma Aldrich), embedded in paraffin, cut into tissue sections and stained with hematossiline and eosine. Stained sections were examined for evidence of colitis using different criteria such as the presence of lymphocyte infiltration, elongation and/or distortion of crypts, frank ulceration and thickening of the bowel wall.
[0140] The degree of inflammation on microscopic cross-sections of the colon was graded from 0 to 4 as follows:
[0141] 0: no evidence of inflammation;
[0142] 1: low level of lymphocyte infiltration with infiltration seen in a <10% high-power field (hpf=high power field), no structural changes observed;
[0143] 2: moderate lymphocyte infiltration with infiltration seen in <10-25% hpf, crypt elongation, bowel wall thickening which does not extend beyond mucosal layer;
[0144] 3: high level of lymphocyte infiltration with infiltration seen in <25-50% hpf, thickening of bowel wall which extends beyond mucosal layer;
[0145] 4: marked degree of lymphocyte infiltration with infiltration seen in >50% hpf, high vascular density, crypt elongation with distortion, transmural bowel wall-thickening with ulceration.
[0146] Isolation of Lamina Propria Mononuclear Cells (LPMC) and Treatment of Cells with Smad7 Antisense ODN
[0147] The lamina propria mononuclear cells (LPMC) were isolated from colonic specimens. The specimens were first washed in HBSS-calcium magnesium free (Hanks' balanced salt solution, Sigma-Aldrich) and cut into 0.5-cm pieces. They were then incubated twice, each time for 15 minutes in HBSS containing EDTA (0.37 mg/ml) and dithiothreitol (0.145 mg/ml) at 37 C. The tissues were then digested in RPMI containing collagenase D (400 U/ml, Boehringer Mannheim Biochemicals, Indianapolis, Ind.) and DNase I (0.01 mg/ml, Boehringer Mannheim Biochemicals, Indianapolis, Ind.) in a shaking incubator at 37C.
[0148] The LPMC released from the tissue were resuspended in 100% Percoll, layered under a 40% Percoll gradient (Pharmacia Biotech AB, Uppsala, Sweden), and spun at 1,800 rpm for 30 minutes to obtain the lymphocyte-enriched population.
[0149] To assess the in vitro efficacy of Smad7 antisense ODN, the LPMC isolated from TNBS-treated mice, were resuspended in RPMI 1640 (Sigma-Aldrich) supplemented with a serum replacement reagent HL-1 (Biowhittaker) at a final concentration of 110.sup.6/ml in 24 well plates. For transfection of antisense ODN, 2 l of lipofectamine 2000 reagent (LF, Invitrogen Italia SRL, San Giuliano Milanese) was used for each ml of cell medium following the protocol. Then, 2 g/ml of antisense ODN and LF were combined and allowed to incubate for 20 minutes at room temperature. The obtained mixture was then added directly to the cells. After overnight culture, the cells were removed from the plate and used for analysis of Smad7 by Western blotting.
[0150] Treatment of Mice with Smad7 Antisense ODN
[0151] Two days after treatment with TNBS, mice were administered per rectum 150 g of each Smad7 antisense or sense oligonucleotide. At least 5 mice for group were examined. At fifth day mice were sacrificed and whole intestinal mucosal samples were taken and analysed for Smad7 and Smad3 content by Western blotting. In addition intestinal mucosal inflammation degree entity was evaluated.
[0152] Protein Extraction and Western Blot Analysis
[0153] Both lamina propria mononuclear cells and whole colonic specimens were homogenized using the above procedure. Then Smad7 expression was revealed by Western blotting.
[0154] At the end, the blots were stripped using a commercially available solution (Pierce) and probed with anti-actin antibodies (Sigma-Aldrich) to verify the same amount of protein were filled in each well. Detection was accomplished using a chemiluminescence kit (Pierce). The intensity of bands was analysed by a densitometer.
[0155] Both LPMC and whole colonic specimen samples proteins were also analyzed for the content of phosphorylated and total Smad3 protein by Western blotting using specific commercially available antibodies (Santa Cruz).
[0156] For the analysis of phosphorylated Smad3 a specific rabbit anti-human antibody capable to recognize phosphorylated Smad2/3 proteins as antigen (1:500 final dilution), and a goat anti-rabbit antibody conjugated to horseradish peroxidase (1:20.000 dilution) were used. Immunoreactivity was visualized with a chemiluminescence kit (Pierce).
[0157] After detection, blots were stripped using a commercially available solution (Pierce) and incubated with a specific goat anti-human Smad3 antibody (1:500 final dilution) followed by a rabbit anti-goat antibody conjugated to horseradish peroxidase (1:20.000 dilution); then immunoreactivity was visualized with the above mentioned chemiluminescence kit (Pierce).
[0158] Test ELISA
[0159] The amount of active TGF-1 was determined in the intestinal mucosal samples. To this aim total proteins were extracted from mucosal samples from mice with or without TNBS-induced colitis as above indicated. The levels of active TGF-1 were analyzed using a commercially available ELISA kit (R&D Systems, Space Import-Export Sri, Milano). Optical density was measured on a Dynatech MR 5000 ELISA reader at a wavelength of 490 nm. Data were expressed as pg/100 g of total proteins.
[0160] Results
[0161] After receiving TNBS mice developed diarrhoea and weight loss by evidence of the induction of colitis. The colon was macroscopically enlarged and histological analysis of its mucosa showed moderate to severe inflammatory lesions.
[0162] To examine if induction of TNBS-colitis was associated with changes in the production of TGF-1, colonic specimens were taken from mice with or without colitis and analyzed for the content of active TGF-1 by ELISA.
[0163] As several cell types which have the potential to synthesize TGF-1 are present at intestinal level, it was evaluated in whole intestinal mucosal rather than LPMC samples.
[0164] In the absence of colitis low levels of active TGF-1 were detected (8512 and 9426 pg/g of total protein in unstimulated and controls mice respectively). Significantly enhanced TGF-1 levels were measured in mucosal samples from mice with TNBS-induced colitis (985120 pg/g of total protein) (p<0.01). Even though this result seems to suggest that during TNBS-induced colitis there could be an increasing TGF-1 activity, the analysis of intracellular levels of active Smad3 in intestinal LPMC isolated from mice with colitis surprisingly revealed a reduced Smad3 phosphorylation that was associated with an enhanced expression of Smad7 (
[0165] According to the present invention it has been evaluated if treating TNBS mice with Smad7 antisense ODN could restore the endogenous TGF-1 function and limit the ongoing inflammation.
[0166] First, it has been tested the efficacy of the above mentioned Smad7 antisense ODN (SEQ ID No 1 and SEQ ID No 4-15) to decrease Smad7 expression both in vitro and in vivo experiments.
[0167] As regards in vitro experiments, the LPMC isolated from the intestine of mice with TNBS-induced colitis were transfected with each of the Smad7 antisense ODN and incubated overnight Smad7 analysis was carried out by Western blotting.
[0168] As regards in vivo experiments TNBS-treated mice were administered with Smad7 antisense ODN and after 3 days animals were sacrificed, tissue specimens were taken and Smad7 analysis was carried out by Western blotting.
[0169] Table 4 summarizes the results of these experiments and shows the percentage inhibition obtained by each Smad7 antisense oligonucleotide both in vitro and in vivo experiments. Data indicate meanstandard deviation (SEM) of four separate in vitro experiments and meanSEM of five separate in vivo experiments.
TABLE-US-00006 TABLE4 Sequence %inhibition %inhibition SEQID (5.fwdarw.3) Site inLPMC invivo No gtcgccccttctccccgcagc 403 29 3 33 0.5 1 MePgtMedcgccccttctcc 403 34 1.5 55 3 4 cMe-dcgcaMePg gtttggtcctgaacatgc 294 26 2.6 25 3.4 5 gtttggtcctgaacat 296 16 2 15 3.2 6 gtttggtcctgaacatg 295 17 3.1 10 1.12 7 agcaccgagtgcgtg 577(*) 27 0.88 25 2.7 8 agc MePagcacMedcgag 577(*) 29 1.65 30 1.3 9 tgMedc gtgagcMeP cgaacatgacctccg 233(**) 33 2.3 32 1.89 10 cac Me-dcgaacatgacct 233(**) 36 1.5 34 2.2 11 cMe-dcgcac gtMedcgccccttctcccMe 403 32 4.1 42 1.8 12 dcgcag gatcgtttggtcctgaa 299 13 atcgtttggtcctgaac 298 14 MePgtMedcgccccttctcc 403 34 1.6 56 3 15 cMedcgcaMePgc (*)Sequences No 16 and (**) No 12 of the U.S. Pat. No. 6,159,697 by ISIS.
[0170] All the antisense ODN were effective in reducing Smad7 expression when transfected in vitro in LPMC isolated from TNBS-treated murine models. From the analysis of the value of percentage inhibition shown in Table 4 it is remarkable that antisense oligonucleotidic sequences SEQ ID No 4, 10, 11, 12 and 15 showed the major efficacy.
[0171] Nevertheless, the percentage of Smad7 expression inhibition obtained by in vivo treatment with oligonucleotidic sequences SEQ ID No 10 and 11 did not significantly differ from that documented in vitro experiments.
[0172] Instead, treatment of mice with antisense ODN SEQ ID No 4 and 12 and 15 resulted clearly in a greater percentage of Smad7 inhibition than that obtained in vitro experiments, that is 55% vs 34%, 42% vs 32% e 56% vs 34% respectively (P<0.01).
[0173] In contrast, treatment of mice with antisense oligonucleotide SEQ ID No 7 caused a reduction in Smad7 expression in vivo which was of lower entity than that resulting when the antisense oligonucleotide was transfected in LPMC in vitro, that is 10% vs 17%, P<0.01.
[0174] Overall, these results suggest that only specific modifications into a Smad7 antisense ODN sequence are able to improve its pharmacokinetic, biochemical and biophysical profile.
[0175] No sign of acute toxicity was documented in mice receiving antisense oligonucleotides (SEQ ID No 1 and SEQ ID No 4-15). One out of 5, treated with TNBS, died after 3 days (20%). Similarly, 1/5 of mice receiving the Smad7 sense oligonucleotide died after 4 days.
[0176] No mortality was documented in mice group treated with Smad7 antisense ODN SEQ ID No 1 and SEQ ID No 4-15.
[0177] The use of antisense ODN sequences SEQ ID No 13 and SEQ ID No 14 is associated with a reasonable in vitro inhibition activity (11% and 9.5%, respectively). Nevertheless, the in vivo administration of such sequences was unexpectedly joined with a marked deterioration of the colitis, up to cause the death of all the mice after 72 hours of treatment.
[0178] Macroscopic analysis of the intestinal samples taken from these mice has revealed the presence of a severe colitis and this was associated to a substantial increase in the intestinal Smad7 expression.
[0179] As above said, it was tested the efficacy of Smad7 antisense ODN to limit the ongoing inflammation. For this purpose, mice after induction of colitis were administered with antisense oligonucleotides SEQ ID No 1, 4, 5 and 15 considering 5 animals for each group.
[0180] Following the treatment with Smad7 antisense ODN it has been revealed a reduction of the mucosal inflammation. This result was particularly evident in mice treated with antisense oligonucleotides 4 and 15. Indeed, the colitis severity of grade 3-4 in mice with colitis not receiving antisense reached grade 2 or 3 after administration of antisense oligonucleotide sequences 1 or 5 respectively, while in mice treated with oligonucleotidic sequences 4 or 15, inflammation has not exceeded grade 1.
[0181] To examine if Smad7 antisense oligonucleotides were effective also when administered orally, mice with TNBS-induced colitis were treated the day after the induction of colitis with Smad7 antisense oligonucleotide 4 or 15 or control (sense).
[0182] For this purpose oligonucleotides were risuspended in a bicarbonate solution. The final volume of the solution administered to each mouse was of 350 l and contains doses of oligonucleotide equivalent to 250, 500 or 1000 g. Such solution was administered per os through a catheter.
[0183] At fifth day mice were sacrificed and analysis of Smad7 expression and of inflammation degree were evaluated as indicated in the previous paragraphs. All the mice treated with antisense oligonucleotide, and not with the control sense oligonucleotide, showed a meaningful reduction of Smad7 expression ad an increased Smad3 phosphorylation, independently from the dose of the oligonucleotide being used.
[0184] Substantially, Smad7 inhibition was associated with a weight recovery as shown in
[0185] Smad7 inhibition was correlated to a marked suppression of tissutal inflammation as shown in
[0186] Together these observations suggest that the use of antisense ODN, which show the higher efficacy of Smad7 inhibition accompanied by the absence of side effects, following the in vivo administration, can represent a promising therapeutic strategy in the control of mucosa inflammation during IBD, especially if such characteristics of efficacy and toxicity were compared with the results achieved with other antisense ODN sequences with the same efficacy in the Smad7 in vitro inhibition.
EXAMPLE 3: IN VIVO AND IN VITRO STUDIES ON THE EFFECTS OF THE ADMINISTRATION OF SMAD7 ANTISENSE OLIGONUCLEOTIDE (SEQ ID NO:16) IN THE CONTEXT OF ACUTE (TNBS- AND OXAZOLONE-COLITIS), RELAPSING (TNBS) AND LONG TERM (SCID TRANSFER COLITIS) INFLAMMATION IN MICE
[0187] In the present experiment the inventor examined TGF-1 signaling in the context of acute (TNBS- and oxazolone-colitis), relapsing (TNBS) and long term (SCID transfer colitis) inflammation in mice. In these conditions it was found that induction of colitis is accompanied by abundant local TGF-1 production associated with high Smad7 that, as in humans, blocks TGF-1 signaling. However, administration of Smad7 anti-sense oligonucleotides, such as GTXGCCCCTTCTCCCXGCAGC, wherein X is 5-Me-dC (5-methyl 2-deoxycitidine 5-monophosphate) (SEQ ID NO:16) relieves the Smad7 block and enables TGF-1 signaling and amelioration of disease. In fact, with respect to TGF-1 signaling and Smad7 expression, acute and relapsing models of colitis reproduce the findings observed in humans IBD and that Smad7 anti-sense oligonucleotide may therefore have an important place in IBD therapy.
[0188] Materials and Methods
[0189] Induction of TNBS- and Oxazolone-Colitis
[0190] Studies of acute hapten-induced colitis were performed in 5-6 week old male SJL mice (Harlan Laboratories, S. Pietro al Natisone, UD, Italy), and maintained in the animal facility at the Istituto Superiore di Sanit, Rome, Italy. All studies were approved by Animal Care and Use Committee of Istituto Superiore di Sanit and Italian Ministry of Health. For induction of colitis, 2.5 mg of TNBS or 6 mg of oxazolone (Sigma-Aldrich, Milan, Italy) in 50% ethanol was administered to lightly anesthetized mice through a 3.5 F catheter inserted into the rectum. The catheter tip was inserted 4 cm proximal to the anal verge, and 150 l of fluid was slowly instilled into the colon, after which the mouse was held in a vertical position for 30 seconds. Controls consisted of mice treated with 150 l of 50% ethanol and untreated naive mice. Weight changes were recorded daily to assess the induction of colitis and tissues were collected for histologic study and protein analysis. For histological analysis tissues were fixed in 10% neutral buffered formalin solution, embedded in paraffin, cut into tissue sections and stained with hematoxylin and eosin (H&E). For TNBS-colitis stained sections were examined for evidence of colitis and assigned a colitis score by considering the presence of acute and chronic inflammatory infiltrates, elongation and/or distortion of crypts, frank ulceration, and thickening of the bowel wall, as described elsewhere (Goreli L, et al., 2002). For oxazolone-induced colitis, stained sections were examined and assigned a colitis score by examining the slide for the presence of hypervascularization, mononuclear cells, epithelial hyperplasia, epithelial injury, and granulocytes (Boirivant M, et al., 1998; Boirivant M, et al., 2001; Lawrance I C, et al., 2003).
[0191] Colitis was assessed as described elsewhere (Lawrance I C, et al., 2003). Briefly, serial paraffin sections of the colon were stained with H&E, and the degree of inflammation was scored as absent, mild, moderate, or severe based on the density and extent of both the acute and chronic inflammatory infiltrate, loss of goblet cells, and bowel wall thickening. An inflammatory infiltrate of low cellularity confined to the mucosa was scored as mild inflammation, and transmural inflammation with extension into the pericolonic adipose tissue with high cellularity was scored as severe. Intermediate changes were scored as moderate inflammation. SCID model of colitis: colitis was induced in SCID mice according to the protocol described by Read and Powrie (Read S, et al., 1999). Development of colitis was monitored by weekly record of the body weight and presence of loose stools. Diagnosis of colitis was made by histological analysis of the colon.
[0192] Inhibition of Murine Smad7 Production by Smad7 Antisense Oligonucleotide
[0193] To evaluate the ability of Smad7 antisense to inhibit Smad7, murine macrophage cell lines (RAW cells) were transfected with Smad7 antisense or sense oligonucleotides (2 g/ml; GTXGCCCCTTCTCCCXGCAGC, wherein X is 5-Me-dC (SEQ ID NO:16)) by lipofectamine for 48 hours. The cells were then harvested and subjected to Western blot analysis of Smad7. The efficiency of the transfection was determined with a fluorescein-labelled Smad7 antisense oligonucleotide and transfection rate was evaluated by performing flow cytometry and fluorescent microscopy 24 hours after transfection. The same fluorescein-labelled Smad7 antisense oligonucleotide was used to assess the in vivo uptake of the orally administered oligonucleotide. To this end, mice with TNBS-colitis were given fluorescein-labelled antisense DNA (125 g/mouse) by oral administration 1 day after TNBS injection and then sacrificed 0, 4, 8, 16, 24 and 48 hours later. At each time point, stomach, small intestine, colon, liver, spleen, and kidney were collected, cut in sections and analyzed by fluorescent microscopy.
[0194] To examine the therapeutic effect of Smad7 antisense oligonucleotide (GTXGCCCCTTCTCCCXGCAGC, wherein X is 5-Me-dC (SEQ ID NO:16)) on the course of ongoing intestinal inflammation, mice were treated with a single dose of Smad7 antisense or sense oligonucleotide (from 50, 125 or 250 g/mouse) in 500 l of bicarbonate solution (pH 9.5) by oral administration on the day after the induction of colitis. The mice were then monitored daily for weight changes and then sacrificed 3 (TNBS-colitis) and 2 (oxazolone colitis) days after oligonucleotide administration. To evaluate the effect of Smad7 antisense oligonucleotide administration on relapsing TNBS-colitis in BALB/c mice, mice were divided into two groups the day after the final TNBS administration: one group was treated with Smad7 antisense oligonucleotide and the other with sense oligonucleotide (125 g/mouse, on days 1 and 3 after the last TNBS dose). Weight changes were recorded daily and mice were sacrificed at day 6.
[0195] To evaluate the effect of Smad7 antisense oligonucleotide (SEQ ID No:16) on SCID model of colitis, 6 weeks after cell transfer the mice were treated with oral Smad7 anti-sense or sense oligonucleotide (125 g/mouse) and weight changes were recorded on day 1, 3, 7 and 10 after treatment
[0196] Isolation of Lamina Propria Mononuclear Cells (LPMC)
[0197] LPMC were isolated as described in the previous example or by cell sorting after staining cells with anti-mouse CD3-FITC (BD Pharmingen) using a FACS-ARIA. Purity of CD3+ cells was confirmed by flow cytometry and was consistently higher than 95%.
[0198] Determination of Cytokine Secretion by ELISA
[0199] Total protein extracts were prepared as previously described in the above examples. Briefly, snap frozen mucosal samples or cells were homogenized in buffer containing 10 mM Hepes (pH 7.9), 10 mM KCl, 0.1 mM EDTA, and 0.2 mM EGTA, supplemented with 1 mM dithiothreitol (DTT), 10 g/ml aprotinin, 10 g/ml leupeptin, and 1 mM phenylmethanesulphonyl fluoride (Sigma).
[0200] Western Blotting
[0201] Western blotting for the detection of p-Smad3, Smad7 were performed as above described.
[0202] Statistical Analysis
[0203] The significance of differences between groups was determined using either the Mann-Whitney U test or Student t test.
[0204] Results
[0205] It has been shown that TNBS-colitis is characterized by decreased p-Smad3 and increased Smad7 expression. Particularly, levels of activated TGF-11 were higher in extracts from mice with TNBS-colitis (median: 56.5; range: 44-83 pg/100 g total proteins) than those from untreated (median: 8.2; range: <10-19 pg/100 g total proteins, p=0.03) or ethanol-treated mice (median: 19; range: <10-28 pg/100 g total proteins, p=0.04). Since activated TGF-1 is generated in the extracellular space, this indicates that increased amounts of TGF-1 is secreted as well as synthesized in TNBS-colitis.
[0206] In a complementary analysis, TGF-1 was analyzed in extracts of epithelial cells. Colonic epithelial cells from mice treated with TNBS contained higher levels of TGF-1 (447 pg/100 g total proteins) than those measured in extracts of ethanol-treated mice (352.5 pg/100 g total proteins), but the difference was not statistically significant. The lack of statistical significance could rely on the fact that the isolated colonic cells undergo rapid apoptosis. Taken together, these data show that TNBS-colitis is associated with a significant increase in TGF-1 production that is, at least in part, derived from epithelial cells.
[0207] Administration of Smad7 Antisense Oligonucleotide Inhibits Smad7 Protein Expression and Restores TGF-1 Signaling in TNBS-Colitis
[0208] The above data prompted us to explore the possibility that in TNBS-colitis, high local Smad7 blocks the immunosuppressive activity of the endogenous TGF-1 and thus contributes to ongoing intestinal inflammation. Thus, it was determined whether the administration of Smad7-specific antisense oligonucleotide (GTXGCCCCTTCTCCCXGCAGC, wherein X is 5-Me-dC (SEQ ID NO:16)) could affect the course of experimental colitis. In these studies, RAW cells constitutively expressing Smad7 were transfected with Smad7 antisense or sense oligonucleotides and then assessed for Smad7 protein expression by Western blotting. Using a fluorescein-labeled Smad7 antisense DNA to identify transfected cells by flow cytometry, almost 2/3 of the RAW cells were efficiently transfected (
[0209] Orally Administered Smad7 Antisense Oligonucleotide Ameliorates Acute TNBS-Colitis
[0210] Therapeutic effectiveness of Smad7 antisense oligonucleotide (GTXGCCCCTTCTCCCXGCAGC, wherein X is 5-Me-dC (SEQ ID NO:16)) in mice with acute TNBS-colitis was assayed. Mice administered Smad7 antisense oligonucleotide as a single oral dose of 125 or 250 g/mouse (but not 50 g/mouse) on day 1 after induction of TNBS-colitis exhibited an initial weight loss which rapidly stabilized so that by day 4 the weight loss in the treated group was clearly lower than in the untreated group (p<0.01) (
[0211] Administration of Smad7 Antisense Oligonucleotide Ameliorates Oxazolone Colitis
[0212] Next the effect of Smad7 inhibition on oxazolone colitis by administration of Smad7 antisense oligonucleotide (GTXGCCCCTTCTCCCXGCAGC, wherein X is 5-Me-dC (SEQ ID NO:16)) was determined. The oligonucleotides were administered by oral gavage 1 day after the induction of colitis, and mice were sacrificed at day 3. Analysis of Smad7 expression showed a marked reduction in the colon of mice treated with the antisense but not sense oligonucleotide, and this was associated with increased p-Smad3 (
[0213] Smad7 Antisense Oligonucleotide Reverses Relapsing TNBS-Colitis
[0214] In further studies, we examined whether the Smad7 antisense oligonucleotide (GTXGCCCCTTCTCCCXGCAGC, wherein X is 5-Me-dC (SEQ ID NO:16)) could reverse relapsing colitis by the use of a TNBS-colitis model. In this model the mice lost weight during the first 1-2 days following each TNBS instillation but then regained the same or more weight before the next instillation a week later, thus, the average weight of mice in the group administered TNBS was similar to those in the group not administered TNBS at the time of fourth and final treatment. It should be noted that although the mice in this model had persistent inflammation, the latter was being maintained by weekly TNBS administration and thus could be considered as a colitis characterized by persistent inflammation with recurrent relapses of acute inflammation. Histological examination of the colons obtained from mice one day after the fourth weekly instillation of TNBS revealed that 15% of mice developed a severe inflammation, while 70% and 15% of mice had a moderate or mild colitis respectively (
BIBLIOGRAPHY
[0215] Podolsky D. K., N. Engl. J. Med., 2002 Ago; Vol. 347: No 6. [0216] Seegers D. et al. Aliment. Pharmacol. Ther., 2002; Vol. 16: 53-58. [0217] Sandborn J., et al. Gastroenterology, 2002 Mag; Vol. 122: No 6. [0218] Fiocchi C., J. Clin. Invest., 2001 Ago; Vol. 108: 523-526. [0219] Powrie F., et al. J Exp Med 1996; 183: 2669-2674. [0220] Neurath M. F., et al. J Exp Med 1996; 183: 2605-2616. [0221] Ludviksson B. R., et al. J Immunol 1997; 159: 3622-3628. [0222] Shull M. M., et al. Nature 1992; 359: 693-699. [0223] Christ M., et al. J Immunol 1994; 153: 1936-1946. [0224] Hahm K. B., et al. Gut. 2001; 49:190-198. [0225] Gorelik L., et al. Immunity 2000; 12: 171-181. [0226] Heldin C-H., et al. Nature 1997; 390: 465-471. [0227] Yang X., et al. Embo J 1999; 18: 1280-1291. [0228] Hayashi H., et al. Cell 1997; 89: 1165-1173. [0229] Lawrence I C. et al. Inflamm Bowel Dis 2001; 7:16-26. [0230] Monteleone G., et al. J. Clin. Invest., 2001 Giu; Vol. 108:601-609. [0231] Boirivant M., et al. Gastroenterology 1999; 116: 557-565. [0232] Han S H., et al. J Pharmacol Exp Ther. 1998; 287:1105-12. [0233] Arsura M., et al. Immunity 1996; 5: 31-40. [0234] Brevetto statunitense U.S. Pat. No. 6,159,697. [0235] Maggi A., Biotecnologie Farmacologiche, 1998; Cap.8: 125-131. [0236] Agrawal S., Molecular Medicine Today, 2002; Vol. 6: 72-81. [0237] Neurath M., Fuss I., Strober W., Int Rev Immunol., 2000; Vol. 19: 51-62. [0238] Lesiak K. et al., Bioconjugate Chem., 1993; Vol. 4: 467. [0239] Xiao W. et al. Antisense Nucleic Acid Drug Dev., 1996; Vol. 6: 247-258. [0240] Sanghvi et al, Nuclei Acids Research, 1993; Vol. 21: 3197-3203. [0241] Maier M A. et al. Org Lett., 2002; Vol. 2: 1819-1822. [0242] Guerlavals T., et al. Anal Bioanal Chem., 2002; Vol. 374: 57-63. [0243] Ragas J. A., et al. Analyst., 2000; Vol. 125: 575-581. [0244] Goreli L, Flavell R A. Nature Rev. Immunol. 2002; 2: 46-53. [0245] Neurath M F, Fuss I, Kelsall B L, Presky D H, Waegell W, Strober W. J. Exp. Med. 1996; 183: 2605-2616. [0246] Boirivant M, Fuss I J, Chu A, Strober W. J. Exp. Med. 1998; 188: 1929-1939. [0247] Boirivant M, Fuss I J, Ferroni L, De Pascale M, Strober W. J. Immunol. 2001; 166: 3522-3532. [0248] Lawrance I C, Wu F, Leite A Z, Willis J, West G A, Fiocchi C, Chakravarti S. Gastroenterology 2003; 125:1750-1761. [0249] Read S, Powrie F. In: Coligan J E, Kruisbeek A M, Margulies D H, Shevach E M, Strober W, ed. Current Protocols in Immunology. 15.13. John Wiley & Sons, Inc, 1999: 1-10.