Phytophthora Resistance Gene
20190211350 ยท 2019-07-11
Assignee
Inventors
- Jacobus Hubertus Vossen (Wageningen, NL)
- Kwang Ryong Jo (Wageningen, NL)
- Richard Gerardus Franciscus Visser (Bennekom, NL)
Cpc classification
C12N15/8279
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
A01H1/02
HUMAN NECESSITIES
Abstract
The invention relates to a new gene that produces a protein which is capable of inferring oomycete resistance, more preferably resistance to Phytophthora infestans when expressed in a plant, wherein said nucleotide sequence encodes a protein that is encoded by the protein produced by the nucleotide sequence of FIG. 10 or the protein depicted in FIG. 11 or a nucleotide sequence that codes for a protein that has an identity of at least 95% with said protein produced by the nucleotide sequence of FIG. 10 or the protein depicted in FIG. 11. The invention also relates to a method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection comprising providing a plant or a part thereof with a nucleotide sequence as indicated above or a functional fragment thereof, preferably wherein said plant is a plant from the Solanaceae family, more preferably Solanum tuberosum.
Claims
1.-21. (canceled)
22. A method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection, comprising providing a plant or a part thereof with an isolated nucleotide sequence encoding a resistance protein that is able to confer resistance to Phytophthora infestans when expressed in a plant, wherein said nucleotide sequence (a) encodes a protein that is encoded by the nucleotide sequence of SEQ ID NO: 36, (b) encodes the protein having an amino acid sequence of SEQ ID NO: 37, or (c) encodes a nucleotide sequence that codes for a protein that has an identity of at least 95% with said protein produced by the nucleotide sequence of SEQ ID NO: 36 or the protein having an amino acid sequence of SEQ ID NO: 37 or a functional fragment thereof.
23. The method according to claim 22, wherein the nucleotide sequence according to claim 22, wherein said sequence is the part of one of the sequences of
24. The method according to claim 22 or 23, wherein said oomycete comprises Phytophthora, preferably Phytophthora infestans.
25. The method according to claim 24, wherein said plant or part thereof is also provided with a nucleotide sequence encoding a further resistance gene selected from Table 1.
26. A method for obtaining a potato plant that is resistant against an oomycete infection by crossing a potato plant that has the R8 gene from Solanum demissum with a potato plant of interest and testing the offspring of said cross for the presence of a nucleotide sequence as defined in claim 22.
27. The method according to claim 26, wherein said potato plant that has the R8 gene is a potato plant from the variety Sarpo Mira.
28. A method for breeding an oomycete resistant tetraploid plant, preferably a Phytopthora resistant tetraploid plant, comprising a. increasing or decreasing the ploidy level of the gametes of a diploid plant that already contains a nucleic acid sequence as defined in claim 22; b. using said gametes in a cross with gametes of a tetraploid plant; and c. selecting the offspring of said cross for the presence of said nucleic acid sequence.
29. The method according to claim 26, wherein said oomycete resistant plant further comprises one or more further resistance genes selected from Table 1.
30. A method for selecting a plant or plant material or progeny thereof for its susceptibility or resistance to an oomycete infection, said method comprising the steps of testing at least part of said plant or plant material or progeny thereof for the presence or absence of a nucleic acid as defined in claim 22.
31. The method according to claim 26, wherein said testing involves detecting the presence of at least part of the nucleotide sequence as shown in SEQ ID NO. 36 and is performed with a primer or a probe that specifically binds to said nucleotide sequence.
32. A transgenic or tetraploid cell comprising the nucleic acid as defined in claim 22.
33. A vector comprising the nucleic acid sequence as defined in claim 22.
34. The vector according to claim 33, further comprising a promoter and/or terminator with which the nucleic acid sequence is naturally associated.
35. A transgenic or tetraploid host cell comprising the nucleic acid as defined in claim 22 or a vector according to claim 33.
36. A transgenic or tetraploid plant cell comprising the nucleic acid as defined in claim 22 or the vector according to claim 33.
37. The transgenic or tetraploid plant comprising the cell according to claim 36.
38. A plant produced by a method according to claim 26.
39. A plant part taken from the plant according to claim 37.
40. A protein encoded by an isolated or recombinant nucleic acid as defined in claim 22 or a functional fragment thereof.
41. An antibody that binds to the protein of claim 40.
Description
LEGEND TO THE FIGURES
[0014]
[0015] Markers in large font indicate the NBS profiling markers that were linked to R8. Potato genome sequences, the tomato genome sequences and the marker sequence database from the SGN were searched using the NBS5a6H and NBS1M by BLAST analysis. The bars on the left indicate S. phureja scaffolds (PGSC v3). In the middle are the tomato EXPEN 2000 genetic map and the tomato SL2.40 Ch9 physical map (SGN). On the right positions of tomato genome sequences with homology to R genes are shown. Horizontal and diagonal lines indicate corresponding marker positions in the different maps.
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
DETAILED DESCRIPTION
[0028] As used herein, the term plant or part thereof means any complete or partial plant, single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which potato plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems shoots, tubers, including potato tubers for consumption or seed tubers for cultivation or clonal propagation, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.
[0029] As used herein, the term population means a genetically heterogeneous collection of plants sharing a common genetic derivation.
[0030] As used herein, the term variety is as defined in the UPOV treaty and refers to any plant grouping within a single botanical taxon of the lowest known rank, which grouping can be: (a) defined by the expression of the characteristics that results from a given genotype or combination of genotypes, (b) distinguished from any other plant grouping by the expression of at least one of the said characteristics, and (c) considered as a unit with regard to its suitability for being propagated unchanged.
[0031] The term cultivar (for cultivated variety) as used herein is defined as a variety that is not normally found in nature but that has been cultivated by humans, i.e. having a biological status other than a wild status, which wild status indicates the original non-cultivated, or natural state of a plant or accession. The term cultivar specifically relates to a potato plant having a ploidy level that is tetraploid. The term cultivar further includes, but is not limited to, semi-natural, semi-wild, weedy, traditional cultivar, landrace, breeding material, research material, breeder's line, synthetic population, hybrid, founder stock/base population, inbred line (parent of hybrid cultivar), segregating population, mutant/genetic stock, and advanced/improved cultivar.
[0032] As used herein, crossing means the fertilization of female plants (or gametes) by male plants (or gametes). The term gamete refers to the haploid or diploid reproductive cell (egg or sperm) produced in plants by meiosis, or by first or second restitution, or double reduction from a gametophyte and involved in sexual reproduction, during which two gametes of opposite sex fuse to form a diploid or polyploid zygote. The term generally includes reference to a pollen (including the sperm cell) and an ovule (including the ovum). Crossing therefore generally refers to the fertilization of ovules of one individual with pollen from another individual, whereas selfing refers to the fertilization of ovules of an individual with pollen from genetically the same individual.
[0033] The term backcrossing as used herein means the process wherein the plant resulting from a cross between two parental lines is crossed with one of its parental lines, wherein the parental line used in the backcross is referred to as the recurrent parent. Repeated backcrossing results in the genome becoming more and more similar to the recurrent parent, as far as this can be achieved given the level of homo- or heterozygosity of said parent.
[0034] As used herein, selfing is defined as refers to the process of self-fertilization wherein an individual is pollinated or fertilized with its own pollen.
[0035] The term marker as used herein means any indicator that is used in methods for inferring differences in characteristics of genomic sequences. Examples of such indicators are restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), insertion mutations, microsatellite markers (SSRs), sequence-characterized amplified regions (SCARs), cleaved amplified polymorphic sequence (CAPS) markers or isozyme markers or combinations of the markers described herein which defines a specific genetic and chromosomal location.
[0036] As used herein, locus is defined as the genetic or physical position that a given gene occupies on a chromosome of a plant.
[0037] The term allele(s) as used herein means any of one or more alternative forms of a gene, all of which alleles relate to the presence or absence of a particular phenotypic trait or characteristic in a plant. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. It is in some instance more accurate to refer to haplotypes (i.e. an allele of a chromosomal segment) in stead of allele, however, in these instances, the term allele should be understood to comprise the term haplotype.
[0038] The term heterozygous as used herein, and confined to diploids, means a genetic condition existing when different alleles reside at corresponding loci on homologous chromosomes.
[0039] As used herein, and confined to diploids, homozygous is defined as a genetic condition existing when identical alleles reside at corresponding loci on homologous chromosomes.
[0040] As used herein, and confined to tetraploids, the term nulliplex, simplex, duplex, triplex and quadruplex, is defined as a genetic condition existing when a specific allele at a corresponding locus on corresponding homologous chromosomes is present 0, 1, 2, 3 or 4 times, respectively. At the tetraploid level the phenotypic effect associated with a recessive allele is only observed when the allele is present in quadruplex condition, whereas the phenotypic effect associated with a dominant allele is already observed when the allele is present in a simplex or higher condition.
[0041] The terms haploid, diploid and tetraploid as used herein are defined as having respectively one, two and four pairs of each chromosome in each cell (excluding reproductive cells).
[0042] The term haplotype as used herein means a combination of alleles at multiple loci that are transmitted together on the same chromosome. This includes haplotypes referring to as few as two loci, and haplotypes referring to an entire chromosome depending on the number of recombination events that have occurred between a given set of loci.
[0043] As used herein, the term infer or inferring, when used in reference to assessing the presence of the fungal resistance as related to the expression of the R8 gene, means drawing a conclusion about the presence of said gene in a plant or part thereof using a process of analyzing individually or in combination nucleotide occurrence(s) of said gene in a nucleic acid sample of the plant or part thereof. As disclosed herein, the nucleotide occurrence(s) can be identified directly by examining the qualitative differences or quantitative differences in expression levels of nucleic acid molecules, or indirectly by examining (the expression level of) a the R8 protein.
[0044] The term primer as used herein refers to an oligonucleotide which is capable of annealing to the amplification target allowing a DNA polymerase to attach thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH. The (amplification) primer is preferably single stranded for maximum efficiency in amplification. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact lengths of the primers will depend on many factors, including temperature and source of primer. A pair of bi-directional primers as used herein refers to one forward and one reverse primer as commonly used in the art of DNA amplification such as in PCR amplification.
[0045] As used herein, the term probe means a single-stranded oligonucleotide sequence that will recognize and form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence or its cDNA derivative.
[0046] The terms stringency or stringent hybridization conditions refer to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimised to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence. The terms as used include reference to conditions under which a probe or primer will hybridise to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background). Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridise specifically at higher temperatures. Generally, stringent conditions are selected to be about 5 C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe or primer.
[0047] Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M Na+ ion, typically about 0.01 to 1.0 M Na+ ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C. for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60 C. for long probes or primers (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringent conditions or conditions of reduced stringency include hybridization with a buffer solution of 30% formamide, 1 M NaCl, 1% SDS at 37 C. and a wash in 2 SSC at 40 C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37 C., and a wash in 0.1 SSC at 60 C. Hybridization procedures are well known in the art and are described in e.g. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K. eds. (1998) Current protocols in molecular biology. V. B. Chanda, series ed. New York: John Wiley & Sons.
[0048] The present invention describes the cloning of the R8 gene (also identified as Rpi-Smira2 gene). R8 was mapped to a new R gene locus on chromosome IX using a S. demissum MaR8 mapping population. The R gene locus contains at least 10 paralogous sequences, that are closely related to the R8 gene. Only 1 of the six tested paralogs provided recognition of the P. infestans Avr8 effector protein. The R8 gene codes for a protein which is denominated as R8 and the protein encoding nucleotide and its 5 and 3 UTR sequences may be found in
[0049] In a first embodiment, the invention provides an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the R8 amino acid sequence as as encoded by the nucleic acid presented in
[0050] The term nucleic acid means a single or double stranded DNA or RNA molecule.
[0051] Also included are the complementary sequences of the herein described nucleotide sequences.
[0052] The term functional fragment thereof is typically used to refer to a fragment of the R8 protein that is capable of providing at least partial resistance or increasing resistance in a plant of the Solanaceae family against an oomycete infection. Such a fragment is, for example, a truncated version of the R8 protein as presented in
[0053] Also included are protein sequences that are highly homologous to or have a high identity with the herein described R8 protein, where such proteins are capable of providing at least partial resistance or increasing resistance in a plant of the Solanaceae family against an oomycete infection. Included are artificial changes or amino acid residue substitutions that at least partly maintain the effect of the R8 protein. Preferably such proteins would maintain the ability to recognize the P. infestans Avr8 effector protein and induce a defense response. Such proteins are highly homologous or have a high identity with the herein described R8 protein, for example, certain amino acid residues of the original R8 protein can conventionally be replaced by others of comparable nature, e.g. a basic residue by another basic residue, an acidic residue by another acidic residue, a hydrophobic residue by another hydrophobic residue, and so on. Examples of hydrophobic amino acids are valine, leucine and isoleucine. Phenylalanine, tyrosine and tryptophan are examples of amino acids with an aromatic side chain and cysteine as well as methionine are examples of amino acids with sulphur-containing side chains. Serine and threonine contain aliphatic hydroxyl groups and are considered to be hydrophilic. Aspartic acid and glutamic acid are examples of amino acids with an acidic side chain. In short, the term highly homologous or having a high identity include variants of the R8 protein in which amino acids have been inserted, replaced or deleted and which at least partly maintain the effect of the R8 protein (i.e. at least partly providing or increasing resistance in a plant of the Solanaceae family against an oomycete infection). Preferred variants are variants which only contain conventional amino acid replacements as described above. A high identity in the definition as mentioned above means an identity of at least 95%. Most preferred are amino acids that have an identity of 96, 97, 98 or 99% with the amino acid sequence of R8.
[0054] Also included are nucleic acid sequences that encode a highly homologous protein as described above. Preferred are nucleotide sequences that have a high identity with respect to their nucleic acid sequence with the nucleic acid sequence depicted in
[0055] Homology and/or identity percentages can for example be determined after sequence alignments with computer programs such as BLAST, ClustalW or ClustalX. Preferably, for the purposes of the present invention, identity of proteins s determined by the alignment method labeled ClustalW found in the MegAlign v6.1 program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Default parameters for multiple alignment correspond to GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergen Seqs(%)=30, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB. After alignment of the sequences using the ClustalW program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program.
[0056] For nucleotide sequences the BLASTN method is used, which alignment is an algorithm provided by the National Center for Biotechnology Information (NCBI) to compare nucleotide sequences using default parameters.
[0057] Many nucleic acid sequences code for a protein that is 100% identical to the R8 protein as presented in
[0058] A further preferred variant of the nucleic acid sequence as defined above is the nucleic acid sequence that is found in the Rpi-smira2 gene of the potato variety Sarpo Mira. This gene was retrieved from this potato variety by PCR amplification and successive cloning using R8 specific primers. The nucleotide sequence of this gene had one polymorphism when compared with the R8 gene (T>C at position -723 in the 5UTR in R8 vs Rpi-smira2).
[0059] Fragments as well as highly homologous genes of the herein described R8 gene and protein can for example be tested for their functionality by using an Agrobacterium tumefaciens transient transformation assays (agro-infiltration) and/or by using a detached leaf assay as described in the experimental section.
[0060] The experimental part for example describes a functional screen for testing candidate genes using agroinfiltration, whereby 4 week old wild type Nicotiana benthamiana plants are infiltrated with Agrobacterium strains containing the candidate R8 homologues. The infiltrated leaves are subsequently challenged one day after infiltration with a P. infestans strain that is virulent on N. benthamiana, for example IPO-C or 90128, in detached leaf assays. This system is equally suitable for testing candidate homologous fragments of R8. A person skilled in the art thus can easily determine whether or not an R8 fragment can be considered to be a functional fragment.
[0061] Transient gene expression, as is achieved through agroinfiltration, is a fast, flexible and reproducible approach to high-level expression of useful proteins. In plants, recombinant strains of Agrobacterium tumefaciens can be used for transient expression of genes that have been inserted into the T-DNA region of the bacterial Ti plasmid. A bacterial culture is infiltrated into leaves, and upon T-DNA transfer, there is ectopic expression of the gene of interest in the plant cells. However, the utility of the system is limited because the ectopic RNA expression ceases after 2-3 days. It is shown that post-transcriptional gene silencing (PTGS) is a major cause for this lack of efficiency. A system based on co-expression of a viral-encoded suppressor of gene silencing, the p19 protein of tomato bushy stunt virus (TBSV), prevents the onset of PTGS in the infiltrated tissues and allows high level of transient expression. Expression of a range of proteins was enhanced 50-fold or more in the presence of p19 so that protein purification could be achieved from as little as 100 mg of infiltrated leaf material. Although it is clear that the use of p19 has advantages, an agroinfiltration without p19 can also be used to test the functionality of candidate fragments and functional homologues.
[0062] Alternatively, each candidate gene (for example being a fragment or homologue) construct is targeted for transformation to a susceptible potato cultivar, for example Desiree. Primary transformants are challenged in detached leaf assays using for example isolates IPO-0, IPO-C or 90128. Transformants that are resistant to these isolates harbour for example functional fragments or highly homologous sequences of R8.
[0063] In yet another embodiment, the invention provides a vector comprising a nucleic acid as provided herein, i.e. a nucleic acid capable of providing at least partial resistance or increasing resistance in a plant of the Solanaceae family against an oomycete infection. More particularly, the invention provides a vector comprising an isolated, synthetic or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the amino acid sequence R8 of
[0064] Examples of a suitable vector are pBeloBACII, pBINplus, pKGW-MG, or any commercially available cloning vector.
[0065] As will be outlined below there are multiple ways in which a nucleic acid of the invention can be transferred to a plant. One suitable means of transfer is mediated by Agrobacterium in which the nucleic acid to be transferred is part of a binary vector and hence it is preferred that the above described vector is a binary vector. Another suitable means is by crossing a plant which contains the gene encoding R8 to a plant that does not contain the gene and to identify those progeny of the cross that have inherited the R8 gene.
[0066] The invention further provides a host cell comprising a nucleic acid as described herein or a vector as described herein. Examples of a preferred host cell are an E. coli cell suitable for BAC clones (e.g. DH10B) or an Agrobacterium (host) cell. In another embodiment, said host cell comprises a plant cell. A preferred plant cell is a cell derived from a member of the Solanaceae family and even more preferred said plant cell comprises a cell from Solanum tuberosum, Solanum lycopersicum, formerly known as Lycopersicon esculentum, pepper and eggplant. From such a cell, a transgenic or genetically modified plant (for example a potato or tomato plant) can be obtained by methods known by the skilled person (for example regeneration protocols).
[0067] The invention further provides a leaf, tuber, fruit or seed or part or progeny of a genetically modified plant as described herein.
[0068] In yet another embodiment, the invention provides a protein encoded by the herein described isolated or recombinant nucleic acid or a functional fragment or a functional homologue thereof. In a preferred embodiment, the invention provides a protein encoded by a nucleic acid sequence as depicted in
[0069] The herein described R8 protein comprises 1245 amino acids and the LRR domains of R8 consist of 13 imperfect repeats (
[0070] As already described, a functional fragment or a functional highly homologous sequence of R8 is a fragment or homologue that is capable of providing at least partial resistance or increasing resistance in a plant of the Solanaceae family against an oomycete infection and/or recognition of the P. infestans Avr8 effector protein. This means that at least the 6 paralogs (RGA 1.0, 1.1, 1.2, 0.21, 3.1 and 3.2) that have been tested as described in the experimental part are not considered to be functional highly homologous sequences to R8.
[0071] Means to test the functionality of a functional fragment or a functional homologue of R8 have been provided above and may be found in some detail in the experimental section of the present application. Recognition of the Avr8 effector protein can be achieved according to methods as found in the experimental description.
[0072] Based on the herein described nucleic acid sequences, the invention also provides probes and primers (i.e. oligonucleotide sequences complementary to one of the (complementary) DNA strands as described herein). Probes are for example useful in Southern or northern analysis and primers are for example useful in PCR analysis. Primers based on the herein described nucleic acid sequences are very useful to assist plant breeders active in the field of classical breeding and/or breeding by genetic modification of the nucleic acid content of a plant (preferably said plant is a Solanum tuberosum, Solanum lycopersicum, formerly known as Lycopersicon esculentum), pepper or eggplant in selecting a plant that is capable of expressing for example R8 or a functional fragment or functional highly homologous sequence thereof.
[0073] Hence, in a further embodiment, the invention provides a binding molecule capable of binding to a nucleic acid encoding R8 or a functional fragment or functional highly homologous sequence thereof as described herein or its complementary nucleic acid. In a preferred embodiment, said binding molecule is a primer or a probe. As mentioned, such a binding molecule is very useful for plant breeders and hence the invention further provides a method for selecting a plant or plant material or progeny thereof for its susceptibility or resistance to an oomycete infection. Preferably, the nucleic acid of a plant to be tested is isolated from said plant and the obtained isolated nucleic acid is brought in contact with one or multiple (preferably different) binding molecule(s). One can for example use a PCR analysis to test plants for the presence of absence of R8 in the plant genome. Such a method would be especially preferable in marker-free transformation protocols, such as described in WO 03/010319.
[0074] The herein described R8 protein can also be used to elicit antibodies by means known to the skilled person. The invention thus also provides an antibody that (specifically) binds to the protein encoded by the herein described isolated or recombinant nucleic acid (for example the nucleic acid sequence of
[0075] Based on the herein provided nucleic acid sequences, the invention also provides the means to introduce or increase resistance against an oomycete infection in a plant. The invention therefore also provides a method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection comprising providing a plant or a part thereof with:
[0076] an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the R8 amino acid sequence of
[0077] an isolated or recombinant nucleic acid sequence as depicted in
[0078] a vector comprising the herein described nucleic acid sequences, or
[0079] a host cell as described herein.
[0080] Such a method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection may be based on classical breeding, departing from a parent plant that already contains the R8 gene or a functional homolog thereof, or it involves the transfer of DNA into a plant, i.e., involves a method for transforming a plant cell comprising providing said plant cell with a nucleic acid as described herein or a vector as described herein or a host cell as described herein.
[0081] There are multiple ways in which a recombinant nucleic acid can be transferred to a plant cell, for example Agrobacterium mediated transformation. However, besides by Agrobacterium infection, there are other means to effectively deliver DNA to recipient plant cells when one wishes to practice the invention. Suitable methods for delivering DNA to plant cells are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts, by desiccation/inhibition-mediated DNA uptake (Potrykus et al., Mol. Gen. Genet., 199:183-188, 1985), by electroporation (U.S. Pat. No. 5,384,253), by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. Nos. 5,302,523; and 5,464,765), and by acceleration of DNA coated particles (U.S. Pat. Nos. 5,550,318; 5,538,877; and 5,538,880). Through the application of techniques such as these, cells from virtually any plant species may be stably transformed, and these cells may be developed into transgenic plants.
[0082] In case Agrobacterium mediated transfer is used, it is preferred to use a substantially virulent Agrobacterium such as A. tumefaciens, as exemplified by strain A281 or a strain derived thereof or another virulent strain available in the art. These Agrobacterium strains carry a DNA region originating from the virulence region of the Ti plasmid pTiBo542, which coordinates the processing of the T-DNA and its transfer into plant cells. Agrobacterium-based plant transformation is well known in the art (as e.g. described in, for example by Komari, T. et al.: Plant Transformation Technology: Agrobacterium-Mediated Transformation, in: Handbook of Plant Biotechnology, Eds. Christou, P. and Klee, H., John Wiley & Sons, Ltd, Chichester, UK, 2004, pp. 233-262). Preferably a marker-free transformation protocol is used, such as described in WO03/010319.
[0083] Alternatively, the nucleic acid of the R8 gene or a functional highly homologous sequence thereof may be introduced into a plant by crossing. Such a crossing scheme starts off with the selection of a suitable parent plant. This may for instance be an original Solanum demissum variety or a plant from the S. tuberosum variety Sarpo Mira or a plant that has obtained the desired nucleic acid by genetic engineering as described above.
[0084] Any suitable method known in the art for crossing selected plants may be applied in the method according to the invention. This includes both in vivo and in vitro methods. A person skilled in the art will appreciate that in vitro techniques such as protoplast fusion or embryo rescue may be applied when deemed suitable.
[0085] Selected plants that are used for crossing purposes in the methods according to the invention may have any type of ploidy. For example, selected plants may be haploid, diploid or tetraploid. Most cultured potato plants are diploid, and preferably tetraploid. Solanum demissum is a hexaploid plant. Crossing a hexaploid plant with a diploid or a tetraploid plant will generally result in offspring that is sterile.
[0086] Thus, when plants are selected that are hexaploid, their ploidy must be decreased to diploid or tetraploid level before they can be crossed with another diploid or tetraploid plant in the methods according to the invention. Methods for decreasing the ploidy of a plant are well known in the art and can be readily applied by a person skilled in the art. For example, ploidy of a diploid plant for crossing purposes can be increased by using 2N gametes of said diploid plant. Ploidy can also be increased by inhibiting chromosome segregation during meiosis, for example by treating a diploid plant with colchicine. By applying such methods on a diploid plant, embryos or gametes are obtained that comprise double the usual number of chromosomes. Such embryos or gametes can then be used for crossing purposes. For potatoes a resistant tetraploid plant is preferred, since tetraploid plants are known to have higher yields of tubers. A decrease in ploidy can for instance be achieved by a meiotic division and parthenogenesis from said meiotically divided cell. It is also possible to cross hexaploid cells with diploid cells to obtain (in general a low yield of) tetraploid offspring.
[0087] Since the resistance characteristic has appeared to be a dominant trait, it is sufficient if only one allele with the functional gene is present.
[0088] Preferably, selected plants are crossed with each other using classical in vivo crossing methods that comprise one or more crossing steps including selfing. By applying such classical crossing steps characteristics of both the parents can be combined in the progeny. For example, a plant that provides a high yield can be crossed with a plant that contains large amounts of a certain nutrient. Such a crossing would provide progeny comprising both characteristics, i.e. plants that not only comprise large amounts of the nutrient but also provide high yields.
[0089] When applying backcrossing, F1 progeny is crossed with one of its high-yielding parents P to ensure that the characteristics of the F2 progeny resemble those of the high-yielding parent. For example, a selected diploid potato with oomycete resistance is made tetraploid by using colchicine and then crossed with a selected high-yielding tetraploid potato cultivar, with the purpose of ultimately providing a high-yielding tetraploid progeny having oomycete resistance. Also selfing may be applied. Selected plants, either parent or progeny, are then crossed with themselves to produce inbred varieties for breeding. For example, selected specimens from the above mentioned F1 progeny are crossed with themselves to provide an F2 progeny from which specimens can be selected that have an increased level of resistance.
[0090] It is also possible to use a potato breeding technology as described in WO 2011/053135 and WO 2012/144902.
[0091] After transfer of a nucleic acid into a plant or plant cell, it must be determined which plants or plant cells have been provided with said nucleic acid. When selecting and crossing a parental genotype in a method according to the invention, a marker is used to assist selection in at least one selection step. It is known in the art that markers, indicative for a certain trait or condition, can be found in vivo and in vitro at different biological levels. For example, markers can be found at peptide level or at gene level. At gene level, a marker can be detected at RNA level or DNA level. Preferably, in the present invention the presence of such a marker is detected at DNA level, using the above described primers and/or probes. Alternatively, proper expression of the R8 protein or a functional homolog thereof can be assessed in plant parts by performing an immunoassay with an antibody that specifically binds the protein. Next to the primers and probes according to the invention, use can also be made of specific markers that are to be found in the vicinity of the coding sequence. Such markers are indicated in the experimental part below and comprise for instance the markers At5-2FspBI and 184-81-Rsa 1, and especially the markers 10-SCAR and 993-DraI (see
[0092] In case of transgenic approaches selecting a transformed plant may be accomplished by using a selectable marker or a reporter gene. Among the selective markers or selection genes that are most widely used in plant transformation are the bacterial neomycin phosphotransferase genes (nptI, nptII and nptIII genes) conferring resistance to the selective agent kanamycin, suggested in EP131623 and the bacterial aphIV gene suggested in EP186425 conferring resistance to hygromycin. EP 275957 discloses the use of an acetyl transferase gene from Streptomyces viridochromogenes that confers resistance to the herbicide phosphinotricin. Plant genes conferring relative resistance to the herbicide glyphosate are suggested in EP218571. Suitable examples of reporter genes are beta-glucuronidase (GUS), beta-galactosidase, luciferase and green fluorescent protein (GFP).
[0093] In a preferred embodiment, the invention provides a method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection comprising providing a plant or a part thereof with:
[0094] an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the R8 amino acid sequence of
[0095] an isolated or recombinant nucleic acid sequence as depicted in
[0096] a vector comprising the herein described nucleic acid sequences, or
[0097] a host cell as described herein,
[0098] wherein said oomycete comprises Phytophthora, preferably Phytophthora infestans and/or wherein said plant comprises a plant from the Solanaceae family, preferably a potato or tomato plant, more preferably a tetraploid potato plant.
[0099] In a further preferred embodiment, the invention comprises introduction into a plant cell or plant of an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the R8 amino acid sequence of
[0100] The invention further provides a plant part or progeny of a plant according to the invention comprising a nucleic acid encoding the R8 amino acid sequence of
[0101] In a preferred embodiment, the herein described nucleic acid is transferred to a Solanum variety other than Solanum demissum, i.e. the herein described nucleic acid is preferably provided to a non-demissum background, preferably S. lycopersicon or S. tuberosum. Of the latter most preferred is a tetraploid variety and more preferably to a commercial interesting variety such as Bintje, Desiree or Premiere, Spunta, Nicola, Favorit, Russet Burbank, Aveka or Lady Rosetta.
[0102] It is also possible to provide the resistance according to the invention to a plant that is already partially resistant to an oomycete infection, wherein said plant is provided with a nucleic acid encoding a further resistance gene, such as R3a, R3b, R4, Rpi-chc1, Rpi-blb1,-2, -3, Rpi-vnt1 or Rpi-mcq1.
[0103] The invention further provides use of an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the R8 amino acid sequence of
[0104] In yet another embodiment, the invention provides a method for producing R8 protein or a functional fragment or a functional homologue thereof comprising functionally linking a nucleic acid as described herein to a regulatory sequence and allowing said nucleic acid to be expressed in a host cell. Examples of a regulatory sequence are a promoter and/or terminator sequence. Further, the R8 sequence may be expressed under control of its own promoter and terminator, but also other strong or inducible promoters and or vectors may be provided. Therefore, the invention further provides the promoter and/or terminator sequences of R8 (
[0105] The invention will be explained in more detail in the following, non-limiting examples.
EXPERIMENTAL PART
Example 1: Mapping of S. demissum Late Blight Resistance Gene R8
Plant Material and Mapping Population
[0106] MaR8, corresponding to 2424a(5) and PI 303149 (Black et al. 1953; Malcolmson and Black 1966), and cultivar Concurrent were maintained and in vitro and multiplied in the Laboratory of Plant Breeding, Wageningen University. MaR8, as resistant female parent, and the susceptible cultivar Concurrent were crossed to generate a F1 mapping population in the summer of 2008 (population code R8*C). Seeds were sown under sterile conditions and 100 plants were maintained in in vitro culture.
Phytophthora infestans Isolates and Disease Testing
[0107] Phytophthora infestans isolate IPO-C (race 1, 2, 3, 4, 5, 6, 7, 10, 11) was kindly provided by Prof. Francine Govers (Laboratory of Phytopathology, Wageningen University). IPO-C was used in detached leaf assays as described by Vleeshouwers et al. (1999) but also to inoculate field trials. In 2009 and 2010, respectively, four and two in vitro plants per genotype from population R8*C were planted in the beginning of June. Spreader rows and the border rows consisted of the susceptible potato cultivars Bintje and Nicola, which served to support a local late blight epidemic. In the beginning of July, the trial fields were inoculated. For the inoculum production, a large number of detached leaves of potato cultivar Bintje were inoculated with isolate IPO-C. After 6 days, spores were washed off to prepare a spore suspension in large containers. Zoospore release was induced by incubating the containers at 10 C. After the release of the zoospores, the inoculum was adjusted to a concentration of 510.sup.4 zoospores/ml. At nightfall, the zoospore suspension was sprayed on the potato field using a tractor using a spraying arm. After 2 weeks severe late blight symptoms were observed in susceptible plants and a clear segregation of resistance and susceptibility was observed in population R8*C. Scoring was performed in a qualitative way (resistant or susceptible).
DNA Isolation and Marker Analysis
[0108] Genomic DNA was isolated as described by Fulton et al. (1995). Young leaf tissue was collected for DNA isolation according to the CTAB protocol with the Retsch machine (RETSCH Inc., Hannover, Germany). Primers used for marker analysis are listed in Table 2. PCR reactions were performed using DreamTaq polymerase (Fermentas) in a standard PCR program (start: 94 C. for 30 s; amplification: 35 cycles of 94 C. for 30 s, 55 C. for 30 s; 72 C. for 1 min; termination: 72 C. for 2 min). NBS profiling was performed as described by Van der Linden et al. (2004), with minor modifications. The restriction enzyme digestion of genomic DNA and the ligation of adapters were made in one incubation step. Restriction enzymes MseI, HaeIII and RsaI were used for restriction ligation reactions and NBS primers NBS1, NBS2, NBS3, NBS5a6 and NBS9 in combination with the adaptor primer were used for the successive PCR reactions. Primers with corresponding names and sequences have been described previously (Van der Linden et al. 2004; Wang et al. 2008; Mantovani et al. 2006; Brugmans et al. 2008). Totally, 15 primer enzyme combinations were used for NBS profiling. For R gene CDP, R2 and Tm-22 primers (R2LF1, R2LF2, R2LF3, R2LF4, R2LR2, R2LR3, R2LR4, Tm1F, Tm1R, Tm3F, Tm3R, Tm6F, Tm15F, Tm15R, Tm19F, Tm19R, Mcq19F, Mcq21R and Mcq23F) were used as described by Verzaux (2010). HotStarTaq polymerase (QIAGEN) was used in the first PCR and DreamTaq polymerase (Fermentas) in a second PCR. For designing Hero-CDP-primers, Hero-like sequences available from NCBI (www.ncbi.nlm.nih.gov) and S. phureja DM1-3 516R44 (CIP801092) whole genome assembly scaffold sv3 available from the Potato Genome Sequencing Consortium (PGSC; www.potatogenome.net) were collected and aligned. Primers were designed on cluster specific conserved domains encoding CC and LRR. A total of six Hero-CDP degenerate primers were designed and one produced a marker that was linked to R8 (Table 2). For Sw-5-CDP seven specific primers described by Dianese et al. (2010) were used. Like in NBS profiling, the CDP primers were used in combination with a labeled adaptor primer (fluorescent dye IRD700) to enable visualization on a denaturing polyacrylamide gel using a NEN_IR2 DNA analyser (LI-COR_Biosciences, Lincoln, Nebr., USA). NBS profiling was carried out first on a set of 10 resistant and 10 susceptible F1 plants, including the parents. If in this first round polymorphic bands between the parents and co-segregation of these bands with resistance in the F1 plants were found, a second round of NBS profiling was carried out on genomic DNA of the remaining F1 progeny. If multiple markers are found with one primer/enzyme combination, numbers behind the dash are consecutive numbers ordered from low to high molecular weight produced by the same primer enzyme combination. For example, marker CDPTm21-1 and CDPTm21-2 were produced using primer/enzyme combination Tm15R/MseI. In order to screen for cleaved amplified polymorphic sequences (CAPS), PCR was done using primers listed in Table 2 and successively the PCR products were digested using the restriction enzymes listed in Table 2. 5 l of PCR product were added to a 15 l of restriction enzyme digestion according to the manufacturers' instructions.
TABLE-US-00002 TABLE2 MarkersusedformappingofR8intheF1populationMaR8x Concurrent Marker SEQ Poly- name Primername Primersequence(5.fwdarw.3)* IDNO morphism Reference NBS5a6H NBS5a6 YYTKRTHGTMITKGATGAYRTITGG 1 HaeIII VanderLindenetal.2004 NBS1M NBS1 GCIARWGTWGTYTTICCYRAICC 2 MseI CDP.sup.Tm21-1 Tml5R GTAACAAGTCATGTATGCGAC 3 MseI Verzaux2010 CDP.sup.Tm21-2 Tml5R GTAACAAGTCATGTATGCGAC 3 MseI Verzaux2010 CDP.sup.Hero2 Tm19F GCCAAATAGTATTGTCAAGCTC 4 MseI Verzaux2010 CDP.sup.Tm23 Hero4064F RRAGATTCAGCCATKGARATTAAGAAA 5 HaeIII Thisstudy CDP.sup.Sw54 Sw55F AGTCTCCAAACATTCCTGCTTCTC 6 MseI Dianeseetal.2010 CDP.sup.Sw55 Sw55F AGTCTCCAAACATTCCTGCTTCTC 6 HaeIII Dianeseetal.2010 Stm1021 STM1021F GGAGTCAAAGTTTGCTCACATC 7 SSR Collinsetal.1999 STM1021R CACCCTCAACCCCCATATC 8 TG328 TG328F TGAATGGACTGGTGATCTGC 9 SCAR Thisstudy TG328R TTGGAAAGAATTGGCTTTTGA 10 184-81 184-81F CCACCGTATGCTCCGCCGTC 11 CAPS,RsaI Thisstudy 184-81R GTTCCACTTAGCCTTGTCTTGCTCA 12 Generalprimersforprofiling MseI Mse-ad-top CCCGAAAGTATAGATCCCAT 13 VanderLindenetal.2004 adaptor Mse-ad-bottom TAATGGGATCTATACTT 14 Blunt B-ad-top ACTCGATTCTCAACCCGAAAGTATAGATCCCA 15 VanderLindenetal.2004 adaptor B-ad-bottom TGGGATCTATACTT 16 Adaptor ACTCGATTCTCAACCCGAAAG 17 VanderLindenetal.2004 primer F; forward primer, R; reverse primer. *All markers were produced using a standard PCR program
Isolation and Sequence Analysis of NBS Fragments
[0109] Fragments were excised as described in the Odyssey manual for band extraction (Westburg, The Netherlands) and re-amplified with the specific profiling primer and the adapter primer. PCR products were checked on agarose gels and purified with QIAquick PCR purification spin columns (QIAGEN Benelux, The Netherlands). Fragments were cloned into the pGEM-T Easy vector (Promega, USA) prior to sequencing with M13 primers. Sequencing was carried out with the BigDye Terminator kit and an ABI 3700 automated sequencer from Applied Biosystems (USA). Blast analysis of the sequences was performed using the websites from NCBI, PGCS and SGN (blast.ncbi.nlm.nih.gov/; potatogenomics.plantbiology.msu.edu/; solgenomics.net). ClustalX (Jeanmougin et al. 1998) was used to align sequences.
Map Construction
[0110] Co-segregating, simplex-inherited NBS and CDP markers from the tetraploid female parent (MaR8) were scored as dominant markers (Wu et al. 1992). The marker order was determined by TetraploidMap (Hackett and Luo 2003; www.bioss.ac.uk). The map distance was calculated based on the frequency of the recombination between markers. Publicly available potato and tomato genetic maps from the SH x RH population (Van Os et al. 2006), SGN sgn.cornell.edu/cview/map.pl?map_id =9&show_offsets=1&show_ruler=1) and GABI (www.gabipd.org/database/) databases were included for comparison of marker positions and synteny.
Results
Segregation of Resistance in the Mapping Population
[0111] F1 progeny and the parental clones MaR8 and cv. Concurrent were screened for resistance against P. infestans isolate IPO-C. The detached leaf assay with leaves from greenhouse grown plants turned out not to be suitable for the F1 population. In contrast to the mother plant MaR8, the F1 plants showed no clear resistance. Initial screens indicated some variation in resistance; however, these findings were not reproducible for most of the individuals. In contrast, highly reproducible results were obtained in two field trials performed in Wageningen, The Netherlands, in the summer of 2009 and 2010. MaR8 plants remained devoid of late blight symptoms, while cv. Concurrent was completely infected within 2 weeks after inoculation. Among 100 F1 genotypes screened, 52 were resistant, 46 were susceptible and 2 showed intermediate phenotypes. This demonstrates that the resistance in MaR8 is inherited as a dominant simplex allele (.sub.X2 =0.54, P>0.05) at a single locus. The corresponding gene is referred to as R8 hereafter.
Identification of R8 Flanking Markers
[0112] In order to identify markers linked to R8, we used NBS profiling since this technique can also give an indication about the R gene family of the targeted gene. Initially, NBS profiling experiments were carried out using combinations of the NBS5a6 primer and three enzymes (HaeIII, RsaI and MseI) on both parents and 10 resistant and 10 susceptible F1 individuals from the mapping population. Marker NBS5a6H was linked to the resistance phenotype and was found at a frequency of one recombinant in twenty F1 plants. Subsequently, an additional set of NBS primers (NBS1, NBS2, NBS3 and NBS9) was used which resulted in the identification of an additional marker, NBS1M showing linkage to the resistance but without recombinants in twenty F1 plants. The NBS5a6H and NBS1M markers were tested on the complete F1 progeny. 22 additional recombinants were found between NBS5a6H and R8, and three recombinants were identified between NBS1M and R8. These recombinants were not overlapping resulting in 26 recombinants between NBS1M and NBS5a6. This showed that the two NBS profiling markers flank the R8 gene (
Localization of R8 Flanking Markers in the Genome
[0113] The NBS5a6H (361 bp) and NBS1M (301 bp) fragments were cut out of the gel and sequenced (genbank accession numbers: JF317286 and JF317287 respectively). In potato scaffold PGSC0003DMS000000483, a 93% identity match was found for the NBS5a6H sequence. PGSC0003DMS000000483 could be located to chromosome IX using genetic and physical maps of tomato (
Localisation of R8 on Chromosome IX
[0114] In order to verify that R8 and its flanking markers were on chromosome IX, more closely linked markers near the R8 gene were required. Therefore, R gene CDP was performed. Two R gene clusters known to locate on chromosome IV (R2 and Hero), and two clusters known to locate on chromosome IX (Tm-22 and Sw-5) were targeted for R gene-CDP. Using R2-CDP no bands linked to the resistance were found among 24 primer/enzyme combinations (data not shown). Three linked markers, CDPTm21-1 (240 bp), CDPTm21-2 (345 bp) and CDPTm22 (120 bp), were identified using Tm-22 primers out of 36 primer/enzyme combinations. CDPTm21-1 and CDPTm21-2 were identified using the same primer enzyme combination (Tm15R/MseI). All Tm-22-CDP markers are at 2 cM distance (proximal) from R8 (
Example 2: The Avirulence Factor AVR8 for the Mexican S. demissum Late Blight Resistance Gene R8 is Recognized by cv. Sarpo Mira and Resistant Wild Solanum Species from South America
Materials and Methods
Plant Material
[0115] The potato differential plant MaR8, also known as 2424a(5), was used as female parent in a cross with the susceptible cultivar Concurrent to generate a F1 mapping population (R8*C). Cultivar Sarpo Mira was crossed with the susceptible clone RH89-039-16, a donor of the potato genome sequence, to produce population SM*RH. A hundred or thirty of genotypes of populations R8*C or SM*RH, respectively, and their parents, were clonally maintained in vitro culture containing Murashige and Skoog medium (Murashige and Skoog, 1962) supplemented with 3% (w/v) sucrose at 20 C. The wild Solanum plant materials which were maintained in vitro at Wageningen University, Laboratory of Plant Breeding, were used for effector screening and functional allele mining. Information on species, origin, collection site, GPS coordinates and other genbank code are accessible on the SolRgene database.
Phytophthora infestans Isolate and Blight Resistance Tests
[0116] Phytophthora infestans isolate IPO-C (race 1, 2, 3, 4, 5, 6, 7, 10, 11) was used in field trials. Field trials for the mapping populations were done in 2009, 2010 and 2011 in Wageningen, The Netherlands, as described in previous studies (Jo et al. 2011; Rietman et al. 2012). Field trials for germplasm accessions were performed in the growing seasons of the years 2005 and 2007 in Wageningen, The Netherlands (Vleeshouwers et al. 2011b). Disease assessments were made in four replicates per genotype by estimating the percentage of leaf area covered with late blight lesions at multiple time points after inoculation. From these readings, the AUDPC was calculated (Fry 1978) and the AUDPC values were transformed to 1 (susceptible)-9 (resistant) scale.
Screening of in Planta-Induced RXLR Effectors
[0117] A genome-wide collection of RXLR effectors was selected from the P. infestans genome sequence based on presence of a predicted signal peptide, an RXLR motif, and an elevated gene expression at 6 hours post inoculation (hpi) to 3 days post inoculation (dpi) (Haas et al. 2009). Using Gateway technology, effectors were subcloned into pK7WG2 and transformed into Agrobacterium tumefaciens strain AGL1, pSoup, and pVirG cells by electroporation. Agroinfiltration was performed as previously described (Rietman et al. 2012). Briefly, A. tumefaciens strains from frozen glycerol stocks were grown overnight at 28 C. in 3 ml of LB medium supplemented with appropriate antibiotics. The next day these cultures were used to inoculate 15 ml of YEB medium (5 g beef extract, 5 g bacteriological peptone, 5 g sucrose, 1 g yeast extract, 2 ml 1 M MgSO4 in 1 L of milli-Q water) supplemented with antibiotics, 10 l/L of 200 mM acetosyringone and 1000 l/L of 1M MES. On the third day, the cells were harvested and resuspended to a final OD600 of 0.3 in MMA (20 g sucrose, 5 g MS salts and 1.95 g MES in 1 liter of distilled water, adjusted to pH 5.6 with KOH supplemented with 1 ml/L of 200 mM acetosyringone). Leaves of plants were infiltrated with this suspension. Two leaves per plant and three replicate plants of 4 to 5 weeks old were infiltrated with the following constructs: effectors, R3a (Huang et al. 2005) and Avr3a (Armstrong et al. 2005) as the positive control and empty pK7WG2 (Karimi et al. 2002) as the negative control. Responses were scored 3 to 4 days after infiltration.
DNA Isolation and Marker Analysis
[0118] Total genomic DNA was isolated from young leaves as described by Fulton et al. (1995). The Retsch homogenizer (RETSCH Inc., Hannover, Germany) was used to grind young plant materials frozen in liquid nitrogen. For mapping Avr8-responsiveness in F1 populations markers described by Jo et al. (2011) were used (Table 3). For the identification of markers associated with the recognition of AVR8 in various Solanum genotypes, a modification of the NBS profiling protocol of Van der Linden et al. (2004) was carried out as described in Jo et al. (2011). The concentrations of genomic DNA for all samples were adjusted to 300 ng/l prior to profiling experiments. PCR reactions for markers 184-81 and Stm1021 were performed using the primers in Table 3 and DreamTaq polymerase (Fermentas) in a simple PCR program (94 C. for 60 s followed by 30 cycles of 94 C. for 30 s, 58 C. for 60 s, 72 C. for 90 s and a final extension time of 5 min at 72 C.). The polymorphism for marker 184-81 was detected by digesting the PCR product with the restriction enzyme listed in Table 3 and 1% agarose gel electrophoresis. Marker Stm1021 is a simple sequence repeat marker. Polymorphisms were detected using polyacrylamide gel electrophoresis. Fragments were prepared using a labelled forward primer (fluorescent dye IRD800) to enable visualization on a denaturing polyacrylamide gel using a NENR IR2 DNA analyser (LI-CORR Biosciences, Lincoln, Nebr., USA).
TABLE-US-00003 TABLE3 MarkersusedformappingofRpi-Smira2intheF1population(Sarpo MiraxRH) SEQ Marker Tm Product Marker PrimerSequence(5'.fwdarw.3') IDNO type ( C.) size(bp) References CDP3 Hero4064F: 5 CDP/HaeIII 55 500bp Joetal.(2011) RRAGATTCAGCCATKGARATTAAGAAA 184-81 184-81F:CCACCGTATGCTCCGCCGTC 11 CAPSIRsaI 58 480bp Joetal.(2011) 184-81R:GTTCCACTTAGCCTTGTCTTGCTCA 12 CDP4 Sw55F:AGTCTCCAAACATTCCTGCTTCTC 6 CDP/MseI 55 277bp Joetal.(2011) Stm1021 Stm1021F:GGAGTCAAAGTTTGCTCACATC 7 SSR 58 210bp Collinsetal.(1999) Stm1021R:CACCCTCAACCCCCATATC 8 SequencesofadapterandadapterprimerforCDPprofiling MseI Mse-ad-top:CCCGAAAGTATAGATCCCAT 13 adapter Mse-ad-bottom:TAATGGGATCTATACTT 14 Blunt B-ad-top: 15 vanderLindenetal. adapter ACTCGATTCTCAACCCGAAAGTATAGATCCCA (2004) B-ad-bottom:TGGGATCTATACTT 16 Adapter ACTCGATTCTCAACCCGAAAG 17 primer
Map Construction
[0119] The marker order was determined by TetraploidMap (Hackett and Luo, 2003; www.bioss.ac.uk/knowledge/tetraploidmap/). The map distance was calculated based on the frequency of the recombination between markers.
Results
In Planta-Induced RXLR Effector Screening Reveals Candidate Genes for Avr8
[0120] MaR8 was functionally profiled for response to a collection of 234 predicted RXLR effectors selected from the Phytophthora infestans genome sequence described by Haas et al. (2009). Responses to effectors were quantitatively scored for the level of cell death, ranging from 0% (no symptoms) to 100% (confluent cell death in all replicates) four days after agroinfiltration. Out of the 234 tested effectors, 13 effectors triggered more than 30% of cell death in the MaR8 plant. Among those 13 effectors, four effectors, i.e., Avr3a, Avr3b, Avr4 and AvrSmira2 (PITG_07558), were described previously to confer avirulence activity in Sarpo Mira (Rietman 2011).
Response to AVR8 is Co-Segregating with R8 Specific Resistance
[0121] To investigate which of the identified effectors had an avirulence function towards R8, we adopted a genetic approach. MaR8 was crossed with the susceptible cultivar Concurrent and 100 F1 genotypes (population R8*C) were assessed for resistance to P. infestans isolate IPO-C in detached leaf tests and in replicate field trials (Jo et al. 2011). This isolate is virulent on potatoes carrying R3a, R3b, and R4, and therefore, those R genes are expected not to interfere with the R8 phenotype. The population R8*C showed a clear segregation of 1:1 ratio for resistance and susceptibility in field trials but not in laboratory tests (data not shown). Subsequently, we tested this population for response to the effectors that were recognized in MaR8 (Table 4).
TABLE-US-00004 TABLE 4 RXLR effectors that trigger cell death response on the differential plant MaR8 Expression Effector .sup.a SignalP.sup.b in potato.sup.c Gene or construct Gene HMM NN mean 16 48 Response ID annotation Prob. NS score RXLR RXLR Tribe.sup.d hpi hpi MaR8(%).sup.e PITG_15039 0.993 0.928 RILV 1 0.83 1.12 100 PITG_22880 0.999 0.928 na 1 0.74 0.09 100 PITG_07558 Avr8 1.000 0.963 RSLR 2 1.11 0.24 95 PITG_04097 1.000 0.786 RSLR 5 1.40 1.28 75 PITG_18683 1.000 0.862 RSLR 5 0.54 2.61 47 PITG_04169 0.995 0.918 RSLR 10 0.13 0.65 83 PITG_07387 Avr4 0.999 0.903 RFLR 52 0.03 2.00 100 PITG_10540 0.999 0.850 RFLR 57 0.06 1.37 86 PITG_14371_KI.sup.f Avr3a (KI) na na RLLR 58 na na 100 PITG_14374 0.992 na RFLR 58 0.44 0.91 100 PITG_18215 Avr3b 0.999 0.857 RSLR 124 1.51 3.07 100 PITG_23129 0.956 0.452 RLLR 128 1.38 1.28 78 PITG_23131 0.983 0.831 RLLR 128 0.97 1.09 94 pMDC32 Neg control na na 0 R3a:Avr3a Pos control na na 100 .sup.a Description of predicted RXLR effectors from the P. infestans genome reference strain T30-4. .sup.bHidden Markov model (HMM) score and S-mean value predicted using SignalPv2.0. NN = neutral networks output, NS = S score (signal peptide score). .sup.cGene induction on potato in T30-4 reference genome strain. In planta-gene induction was estimated relative to the expression levels in mycelium. Hours post inoculation (hpi). .sup.dRXLR Tribe ID as described by Haas et al. (2009). .sup.ePercentage of cell death response upon agroinfiltration, based on an average of quantitative scores in at least nine replicates. .sup.fAVR3aKI is the avirulent allele of AVR3a. na; not assessed.
[0122] In an initial screen, agroinfiltration was done on ten resistant and ten susceptible individuals of population R8*C. Co-infiltration of R3a/Avr3a and the empty vector pK7WG2 were included as positive and negative controls, respectively. High levels of necrosis in the range of 30%-80% were observed in the negative control for five plants in the resistant set and six in the susceptible set. Also, the Concurrent parent displayed nonspecific response to agroinfiltration (
[0123] All 34 plants that responded to PITG_07558 were resistant to P. infestans in the field, whereas all 31 plants that failed to respond to PITG_07558 were susceptible. Thus, response to PITG_07558 fully co-segregated with R8 specific resistance to P. infestans and we designated PITG_07558 Avr8. To test whether the response to Avr8 co-segregates with the presence of a R8 specific marker, we tested 65 genotypes which were used in agroinfiltration with marker CDP3 (Jo et al. 2011). All 34 resistant AVR8-responding plants contained CDP3, whereas all 31 susceptible non-responding plants did not. These data further confirm that the response to Avr8 is associated with R8 specific resistance.
Avr8 Gene Structure and Expression
[0124] Avr8 (PITG_07558) is a single copy gene in the T30-4 reference genome located at supercontig 11 (Haas et al. 2009;
Rpi-Smira2 is Localized on Chromosome IX
[0125] In previous studies, it was shown that the response to PITG_07558 correlates with field resistance that is conferred by the late blight resistance gene Rpi-Smira2 in cv. Sarpo Mira (Rietman et al. 2012). The fact that Rpi-Smira2 interacts with the same effector as R8 suggests that both genes localize on a similar position of chromosome IX. In order to prove this, the flanking markers to R8, 184-81 and CDP4 (Jo et al. 2011), were tested in Sarpo Mira x RH population (population SM*RH). In population SM*RH, flanking marker CDP4 located 1 cM distal to HR responses to AVR8 upon agroinfiltration (AVR8-HR) and the opposite flanking marker 184-81 2 cM proximal to AVR8-HR (
TABLE-US-00005 TABLE5 MarkersusedformappingofRpi-Smira2intheF1population(Sarpo MiraxRH) SEQ Marker Tm.sup.a Product Marker PrimerSequence(5'.fwdarw.3') IDNO type ( C.) size(bp) References CDP3 Hero4064F: 5 CDP/HaeIII 55 500bp Joetal.(2011) RRAGATTCAGCCATKGARATTAAGAAA 184-81 184-81F:CCACCGTATGCTCCGCCGTC 11 CAPSIRsaI 58 480bp Joetal.(2011) 184-81R:GTTCCACTTAGCCTTGTCTTGCTCA 12 CDP4 Sw55F:AGTCTCCAAACATTCCTGCTTCTC 6 CDP/MseI 55 277bp Joetal.(2011) Stm1021 Stm1021F:GGAGTCAAAGTTTGCTCACATC 7 SSR 58 210bp Collinsetal.(1999) Stm1021R:CACCCTCAACCCCCATATC 8 SequencesofadapterandadapterprimerforCDPprofiling MseI Mse-ad-top:CCCGAAAGTATAGATCCCAT 13 adapter Mse-ad-bottom:TAATGGGATCTATACTT 14 Blunt B-ad-top: 15 vanderLindenetal. adapter ACTCGATTCTCAACCCGAAAGTATAGATCCCA (2004) B-ad-bottom:TGGGATCTATACTT 16 Adapter ACTCGATTCTCAACCCGAAAG 17 primer
[0126] This suggested that CDP3 was present in duplex and that only one marker allele was linked to Rpi-Smira2 which was present in simplex. Therefore, we concluded that Rpi-Smira2 resides in the R8 locus on chromosome IX.
Functional Profiling of Wild Solanum Species for Response to AVR8
[0127] To determine the representation of R8 functional homologs in wild Solanum species, 98 genotypes (72 accessions of 40 species) which are geographically and phylogenetically diverse were selected from wild Solanum section Petota germplasm (Vleeshouwers et al. 2011b). Wild Solanum genotypes that display resistance to P. infestans isolate IPO-C in detached leaf tests as well as in field trials were selected. The plants were functionally tested for cell death responses to AVR8 by agroinfiltration. Also, the potato differential set MaR1 to MaR11 were included in this study. From these 109 genotypes, 60 genotypes showed nonspecific cell death responses to Agrobacterium or did not produce a response to the positive control construct and therefore could not be accurately grouped as responsive or nonresponsive. 35 genotypes that were well amenable to agroinfiltration did not show an Avr8 response. Twelve genotypes from various wild Solanum accessions and two genotypes from the potato differential set displayed specific cell death in response to AVR8 (Table 6). These include genotypes from S. demissum, S. tarijense, S. microdontum gigantophyllum, S. stoloniferum, S. schenkii and two unclassified Solanum section Petota species. From the potato differential set MaR1 to MaR11, as expected, MaR8 as well as MaR9 showed the response to AVR8 (Table 6). The presence of R8 in MaR9 confirms the conclusion of a previous study (Kim et al. 2012). We further tested all AVR8 responding genotypes using R8 flanking markers, and found that S. microdontum spp. gigantophyllum genotypes GIG712-6 and GIG715-4 had distinctive marker patterns, which lack the target bands that linked to the R8 resistance (data not shown). This suggests that AVR8 recognition specificity of these plants may be conferred by R gene(s) different from R8.
TABLE-US-00006 TABLE 6 AVR8 response in a selection of Solanum germplasm material and the Mastenbroek late blight differential set Country R3a/ Resistance Species Genotype.sup.a Series.sup.b of origin Avr8 pK7WG2 Avr3a (IPO-C field).sup.c S. species spp114-5.sup.f Demissa BOL + + R S. demissum DMS345-1 Demissa MEX + + R S. demissum DMS343-1 Demissa MEX + + R S. demissum DMS344-18 Demissa GTM + + R S. demissum DMS585-7 Demissa MEX + + R S. demissum DMS585-1 Demissa MEX + + R S. microdontum gigantophyllum GIG712-6 Tuberosa BOL + + R S. microdontum gigantophyllum GIG715-4 Tuberosa ARG + + M S. schenckii SNK213-1 Demissa MEX + + R S. species spp891-1.sup.g Tuberosa BOL + + R S. tarijense TAR852-5 Yungasensa BOL + + M S. stoloniferum STO389-4 Longipedicellata MEX + + R (S. demissum).sup.d MaR1 (MEX).sup.e + S (S. demissum).sup.d MaR2 (MEX).sup.e + S (S. demissum).sup.d MaR3 (MEX).sup.e + S (S. demissum).sup.d MaR4 (MEX).sup.e + S (S. demissum).sup.d MaR5 (MEX).sup.e M (S. demissum).sup.d MaR6 (MEX).sup.e + S (S. demissum).sup.d MaR7 (MEX).sup.e + S (S. demissum).sup.d MaR8 (MEX).sup.e + + R (S. demissum).sup.d MaR9 (MEX).sup.e + + R (S. demissum).sup.d MaR10 (MEX).sup.e + S (S. demissum).sup.d MaR11 (MEX).sup.e + S .sup.aThe three letter code represents the Solanum species (Simmonds 1962). The first number represents the CBSG number for the accession followed by a genotype number. MEX: Mexico, BOL: Bolivia, ARG: Argentina, GTM: Guatemala. .sup.bClassified according to Hawkes (1990). .sup.cR (highly resistant): >8.5, M (moderately resistant): 4.5-8.0, phenotype data for two years' field trials (Vleeshouwers et al. 2011b). .sup.d,eThe resistance of potato differential set is originating from S. demissum from Mexico. .sup.fUnclassified Solanum, previously named S. astleyi. .sup.gUnclassified Response to Avr8 occurs in Central and South American Solanum species.
[0128] An AFLP-based phylogenetic tree of the Solanum species that were tested for response to AVR8 was created using the SolRgene database (
Example 3: Cloning and Sequencing of the R8 Gene
Materials and Methods
Plant Material
[0129] The potato differential plant MaR8, corresponding to plant 2424a(5) described by Black et al. (1953), was used for bacterial artificial chromosome (BAC) library construction. MaR8*Concurrent population (R8*C) was used for genetic mapping. These plant materials and cv Desiree, which was used for transformation, were maintained in vitro at Wageningen UR Plant Breeding. Nicotiana benthamiana was maintained as seed stock.
Bacterial Artificial Chromosome Library Construction and Screening
[0130] A first BAC library was produced by mechanical shearing of MaR8 genomic DNA and ligation of high molecular weight fragments into pCC1 at RxBiosciences (Rockville, USA). This first BAC library consisted of 768 simple pools of 200 individual BAC clones. Simple pools were stored at 80 C. The average insert size was 55 kb, resulting in a 2.5* coverage of a haploid genome. A second BAC library was produced by Bio S&T (Montreal, Canada). MaR8 genomic DNA was fragmented by partial digestion with HindIII. Size selected fragments were cloned into pIndigoBAC-5. The average insert size was 100 kb (
DNA Sequencing and Bioinformatics Analysis
[0131] BAC clone sequencing was carried out using a shotgun strategy. Fragmentation, library production, 454 sequencing and contig assembly was performed at Macrogen (Seoul, Korea). BAC n2A2 was sequenced using PACBIO (GATC, Germany). Gene structures were predicted using FGENESH2.6 (Softberry) and protein sequences were deduced by translation of ORF using the standard genetic code. Multiple sequence alignments and phylogenetic analyses were conducted using CLUSTALX 1.81 (Thompson et al. 1997) available in the MegAlign Lasergene 9.0 software package (DNASTAR Inc., USA).
Subcloning of Candidate Genes
[0132] Primers were designed for subcloning RGA0.20-3.2 (
TABLE-US-00007 TABLE7 PrimerusedforRGAamplificationandsubcloning Orien- Restriction Tm SEQID Target tation site ( C.) Sequence(5'...3') NO RGA0.20 F SrfI 63 catgcccgggcAAAACTTTCACGCACCCATAGGA 18 R SbfI gcacctgcaggAACAAGAGATGAATTAAGTCGGTAGC 19 RGA0.21 F SrfI 65 catgcccgggcTTTGTATTATGATTGGCCCTGTTCTGA 20 R SbfI gcacctgcaggCTGCGAGTATTGGTGGCTGACAT 21 RGA1.0 F SrfI 65 catgcccgggcCAACAATGCGGCGCTTTAGGA 22 R SbfI gcacctgcaggTGGTGCACTTGCCTGGACTTTA 23 RGA1.1 F SrfI 62 catgcccgggcCCTCCATTTTCCATTAAGTCTTGC 24 R SbfI gcacctgcaggAATGGTTTCATCAATGAATCTTTC 25 RGA1.2 F AscI 65 catggcgcgccTATTAAACAGGAAACACAAAAGCAGT 26 CA R XmaI catgcccgggcTTCCTTGCAAAAATCTCACTCACTATG 27 RGA3.1 F SrfI 62 catgcccgggcCACCTAACTGATTTGCTTC 28 R SbfI gcacctgcaggTCAAACTAAGACACTTAAATTA 29 RGA3.2 F SbfI 65 gcacctgcaggTCTTGTGGTTGTCTTGGTAGCAGGAG 30 R XmaI catgcccgggcGTAGAGAAAAAGGAGAAAGCACAGA 31 Rpi-smira2 F 63 CTGGATTTCTTCAAGATTCGTCGT 32 CDS R TTCAATCTCTTCGACTTCTTCTTACG 33 Rpi-smira2 F 63 AAAACTTTCACGCACCCATAGGA 34 5' end R AGTAAACTTTGACACCTTTAGTTCACCAT 35
Agrobacterium-Mediated Transient Co-Expression in N. benthamiana
[0133] Binary plasmids harbouring RGAs or Avr8 (Jo 2013) were transformed to A. tumefaciens strain AGL1 with an additional plasmid borne copy of VirG (van der Fits et al. 2000). Two leaves per plant and three replicates of 4 weeks old N. benthamiana seedlings were agroinfiltrated. A mixture of R3b and Avr3b (Li et al. 2011) were used as the positive control and empty pBINPLUS was used as a negative control. A. tumefaciens strains from frozen glycerol stocks were grown overnight at 28 C. in 3 ml of LB medium supplemented with appropriate antibiotics. The next day these cultures were used to inoculate 15 ml of YEB medium (5 g beef extract, 5 g bacteriological peptone, 5 g sucrose, 1 g yeast extract, 2 ml 1 M MgSO.sub.4 in 1 liter of milliQ water) supplemented with antibiotics, 10 l/l of 200 mM acetosyringone and 1000 l/l of 1 M MES. On the third day, the cells were harvested and resuspended to a final OD600 of 0.2 in MMA (20 g sucrose, 5 g MS salts and 1.95 g MES in 1 liter of distilled water, adjusted to pH5.6 with KOH) supplemented with 1 ml/l of 200 mM acetosyringone in DMSO. Responses were scored 3 to 4 days after infiltration.
Transformation of Potato
[0134] Binary plasmids harbouring RGAs were transferred to A. tumefaciens strain AGL1 containing the helper plasmid pVirG (van der Fits et al. 2000). The stability of these clones in Agrobacterium was tested and overnight cultures of the transformed A. tumefaciens strain were used to transform susceptible cultivar Desiree (Heeres et al. 2002). The kanamycin resistant regenerants (transgenic events) were analysed by PCR to determine the presence of the desired R8 gene. Two replicates per transgenic event were transferred to the greenhouse for successive climate chamber assays or for planting in the field, respectively.
Late Blight Resistance Tests
[0135] P. infestans isolates and their corresponding (a)-virulence spectra that were used in this study are listed in Table 3. The late blight epidemic in Wageningen in the 2014 and 2015 field trials was a result of natural P. infestans infection that started at the end of June (2014) or half July (2015). Field trials in Wageningen in the years 2012 and 2013, in which recombinant plants from the extended 3020 population were tested, were inoculated at July 1.sup.st with IPO-C as described earlier (Jo et al. 2011). Field trials contained four replicates per genotype and late blight was assessed at weekly intervals after inoculation or after the first late blight symptoms were visible in susceptible control plants by observing late blight lesions, in a qualitative way. Resistant plants remained unaffected untill the end of the experiment mid August, while susceptible plants had died already mid July.
[0136] Climate cell whole plant assays: Two replicates of transgenic Desiree or recombinant seedlings from population R8*C were propagated in vitro. The plants were transferred to potting soil and grown in the greenhouse at 22 C. with a 10 h day/14 h night photoperiod and a relative humidity of 70-80%. One month after potting of the plants, they were transferred into a growth chamber and inoculated. Inoculum was prepared by washing of the oospores from two weeks old rye sucrose agar plates containing the isolates of interest. Plants were inoculated by placing four 141 droplets of inoculum (510.sup.4 zoospores/ml) on the adaxial side of at least three leaves per plant. Inoculated plants were kept for seven days in a climate chamber at 15 C. and 100% humidity with a photoperiod of 16 h/8 h day/night. Late blight levels could be classified in three groups, resistant (no symptoms, limited hypersensitive response (HR)); intermediate resistance (large HR lesions or spreading HR lesions without sporulation) or susceptible (sporulating lesions). Genotypes classified in the resistant group or intermediate resistant group in climate chamber assays did not show significant late blight lesions until the end of the field trial experiments (resistant) and could easily be distinguished from the susceptible group.
Results
R8 Fine Mapping
[0137] In order to fine map R8, molecular markers were required to perform a recombinant screen in F1 population R8*C. R8 is located at the bottom end of chromosome 9, flanked by Tm-2.sup.2-like CDP markers at the centromer proximal side and by Sw-5 CDP markers on the distal side (Jo et al. 2011). The CDP markers were not suitable for high throughput recombinant screens and simple PCR markers needed to be developed. On the proximal side marker 184_81 had been described before, but a marker on the distal side of R8 remained to be developed. Screening of the tomato marker database revealed marker C2_At5g06360, which is located near the telomer of Chr9. MaR8 and cv Concurrent derived amplicons of this marker were screened for cleaved amplified polymorphisms, linked to resistance and this resulted in marker At5g06360_2-FspBI. Population R8*C was expanded to 1720 individuals and recombinants between markers At5g06360_2-FspBI and 184_81-RsaI (
BAC Landing and BAC Walking
[0138] A first BAC library was constructed from the genomic DNA of MaR8 plants. The library was screened using marker CDP.sup.Hero3 and BAC clones 1A6, 3E3 and 6G9 were identified. The insert of 3E3 was sequenced and revealed the presence of four complete (RGA1.1, 1.2, 3.1 and 3.2) and one truncated R gene analog (RGA3.3). The newly obtained sequences were used for new marker development. A screen for markers in the intergenic regions successfully identified two polymorphic markers named 3E3_5-HRM and 3E3_10-SCAR. Mapping of the new markers revealed that the right end of BAC 3E3 fell outside the mapping interval, excluding RGA3.3 as a R8 candidate (
R8 Candidate Cloning and Complementation Analysis
[0139] The seven RGAs in the genetic window were subcloned in the binary vector pBINPLUS-PASSA for Agrobacterium mediated transformation of plants. Stable transgenic plants of the susceptible potato variety Desiree were produced and 10 to 47 events per construct were selected. Six out of seven constructs produced only transformation events that were susceptible to P. infestans isolate IPO-C (Table 8). Eight out of 47 events transformed with RGA0.20 were susceptible, while 39 events showed intermediate to strong late blight resistance in a whole plant assay in climate chambers (
TABLE-US-00008 TABLE 8 Complementation analysis of R8 resistance in Desiree Climate Avr8 chamber whole response in Tested plant assay# Field trial# construct N. benthamiana events# S IR R S R RGA3.2 12 12 0 0 nd nd RGA3.1 10 10 0 0 nd nd RGA1.2 10 10 0 0 nd nd RGA1.1 10 10 0 0 nd nd RGA1.0 10 10 0 0 nd nd RGA0.21 15 15 0 0 nd nd RGA0.20 + 47 8 14 25 8 39 empty 12 12 0 0 12 0 nd: not determined; #: number of events
R8 Sequence Annotation
[0140] The binary vector containing R8 that was used for complementation studies had an insert of 7011 bp. A 1680 bp 5 untranslated region, encompassing a functional promotor, is followed by a single open reading frame of 3738 bp, representing the R8 coding sequence, which is followed by a 1594 bp 3 untranslated region which encompasses a functional transcriptional terminator (
TABLE-US-00009 TABLE 9 Percentages of homology between R proteins from Solanaceae. R8 R1 Sw-5 Rpi-blb2 Prf1 Rpi-chc1 Rpi-tar1 Rpi-vnt1 Rpi-sto1 Bs2 Bs4 gro1.4 26 27.1 25 23.7 28.4 21.8 22.1 24.4 22.1 28.6 14.9 16.2 *** 22.8 88.6 26.1 23.1 19.9 20.3 24.1 20.8 25.7 15.1 15 *** 22.6 23.6 27.2 19.9 19.5 24.5 20.4 26.6 13.9 14.4 *** 26 22.9 19.5 19.9 24.5 19.5 25.4 15 14.6 *** 22.5 19.3 19.3 21.4 21.1 25 16 16.4 *** 21.6 21.6 22.7 18.7 27.1 14.8 15.5 *** 98.2 19.9 34.7 21.7 15.6 15.5 *** 19.9 34.6 21.9 15.2 15.6 *** 23.3 23.2 14.4 14.9 *** 20.7 16.2 16.1 *** 16.1 15.9 *** 40.3 *** R2 R3a R3b Rpi-abpt Tm2{circumflex over ()}2 R9a mcq1 N 26.1 20.7 20.3 26.4 25.4 26.3 24.9 15.8 NRC1 24.6 21.1 19.7 24.3 24.3 25.9 24.6 15.4 R8 25.3 20.7 19.7 25 25.5 26.3 24.8 14.4 R1 23.3 20.8 19.2 23.2 24.9 25.9 24.6 15 Sw-5 22.9 21.8 20.2 22.7 21.7 22.1 21.5 16.2 Rpi-blb2 23.9 18.7 18.3 23.3 23.6 24.3 22.7 14.3 Prf1 23.9 29.2 28.7 23.9 21.1 21.6 20.1 15.1 Rpi-chc1 24 28.8 28.3 24 20.9 21.7 20.1 14.9 Rpi-tar1 29.9 20.9 20.4 29.1 76.6 78.7 82 14.8 Rpi-vnt1 26 30.8 30.7 26.3 22.2 23.6 22.7 15 Rpi-sto1 23.8 21.3 19.3 23.6 23.7 23.6 23.1 15.3 Bs2 15.6 15.8 14.9 15.4 15.4 15.1 15.4 61.1 BS4 15.2 17.1 16.3 14.7 14.7 15 15.3 39.6 gro1.4 *** 24.4 24.2 95.5 28.9 28.9 28.8 15 R2 *** 72.4 24.2 20.5 22 20.6 16.1 R3a *** 24 19.9 20.7 20.3 15.2 R3b *** 28.3 27.9 28.2 14.9 Rpi-abpt *** 74 79 15.3 Tm2{circumflex over ()}2 *** 81.7 14.9 R9a *** 15.4 Rpi-mcq1 *** N
Example 4: Late Blight Challenges
Materials and Methods
Construction of Vectors Harbouring Combinations of R8 with other Late Blight Resistance Genes
[0141] Combinations of R8 with other late blight R genes were made by inserting Rpi-sto1, Rpi-blb3, Rpi-edn2, Rpi-vnt1.1, or Rpi-blb2 into the SbfI and AscI or SrfI and SbfI sites of the recipient vectors containing R8 (pBINPLUS-PAS:R8:SA, pBINPLUS-PASS:R8:A or pBINPLUS-A:R8:SSAP). This resulted in pBINPLUS-PAS:R8:S:Rpi-sto1:A, pBINPLUS-A:R8:S:Rpi-blb3:SAP, pBINPLUS-PAS:R8:S:Rpi-edn2:A, pBINPLUS-PA:Rpi-vnt1.1:SS:R8:A, pBINPLUS-PAS:Rpi-blb2:S:R8:A.
Late Blight Resistance Tests
[0142] P. infestans isolates and their corresponding (a)-virulence spectra that were used in this study are listed in Table 9. The late blight epidemic in Wageningen, the Netherlands, in the 2014 and 2015 field trial was a result of natural P. infestans infection that started at the end of June. Field trials contained four replicates per genotype and late blight was assessed by observing late blight lesions after inoculation or after the first late blight symptoms were visible in susceptible control plants (2014), in a qualitative way. Resistant plants remained unaffected until the end of the experiment mid August, while susceptible plants had died already mid July.
[0143] Climate cell whole plant assays: Two replicates of transgenic Desiree or recombinant seedlings from population 3020 were propagated in vitro. The plants were transferred to potting soil and grown in the greenhouse at 22 C. with a 10 h day/14 h night photoperiod and a relative humidity of 70-80%. One month after potting of the plants, they were transferred into a growth chamber and inoculated. Inoculum was prepared by washing of the oospores from two weeks old rye sucrose agar plates containing the isolates of interest. Plants were inoculated by placing four 10 l droplets of inoculum (5104 zoospores/ml) on the adaxial side of at least three leaves per plant. Inoculated plants were kept for seven days in a climate chamber at 15 C. and 100% humidity with a photoperiod of 16 h day/8 h night. Late blight levels could be classified in three groups, resistant (no symptoms, limited hypersensitive response (HR)); intermediate resistance (large HR lesions or spreading HR lesions without sporulation) or susceptible (sporulating lesions). Genotypes classified in the resistant group or intermediate resistant group in climate chamber assays did not show significant late blight lesions until the end of the field trial experiments (resistant) and could easily be distinguished from the susceptible group.
TABLE-US-00010 TABLE 10 Virulence spectra of different P. infestans isolates used in this study. Isolate Origin A-virulence spectrum Reference NL09066 The Netherlands avrsto1, Avrblb3, Avr8, Avredn2, Avrblb2, Avrvnt1 G. Kessel IPO-C The Netherlands Avrsto1, avrblb3, Avr8, Avredn2, Avrblb2, Avrvnt1 (Zhu et al. 2014) US-22 USA (US090017) Avrsto1, Avrblb3, avr8, Avredn2, Avrblb2, Avrvnt1 G. Kessel NL12097 The Netherlands Avrsto1, Avrblb3, Avr8, avredn2, Avrblb2, Avrvnt1 G. Kessel NL12003 The Netherlands Avrsto1, Avrblb3, Avr8, Avredn2, avrblb2, Avrvnt1 G. Kessel Ec-1 Ecuador Avrsto1, Avrblb3, Avr8, Avredn2, Avrblb2, avrvnt1 (Pel 2010)
Transformation of Potato
[0144] Binary plasmids harbouring combinations of late blight R genes were transferred to A. tumefaciens strain AGL1 containing the helper plasmid pVirG (Van der Fits et al. 2000). The stability of these clones in Agrobacterium was tested and overnight cultures of the transformed A. tumefaciens strain were used to transform susceptible cultivar Desiree (Heeres et al. 2002). The kanamycin resistant regenerants (transgenic events) were analysed by PCR to determine the presence of the R8 and the second late blight resistance gene. Two or four plants per transgenic event were transferred to the greenhouse for climate chamber assays or for planting in the field, respectively.
Results
Potential of R8 for Protection Against Late Blight
[0145] Not only the Avr8 recognition was maintained by the cloned R8 gene (Table 8), but also the broad resistance spectrum of R8 against the current P. infestans population was maintained. 39 transgenic events provided excellent late blight resistance to natural late blight infection in 2014 and 2015 in field trials in Wageningen, The Netherlands (Table 1,
[0146] It was described previously that R8 is the same or a similar gene as Rpi-smira2, the major constituent of the durably late blight resistant variety Sarpo Mira (Jo 2013). To confirm this suggestion, we set out to clone the Rpi-smira2 gene using R8 specific primers (Table S3) that amplified the coding sequence (CDS) or 1690 nucleotides of the 5 untranslated region (UTR) and the first 745 bp of the CDS. Three independent Rpi-smira2 clones of each amplicon were sequenced and the consensus showed 100% identity with R8 in the CDS. At position -723 in the 5UTR there was one T>C polymorphism in R8 vs Rpi-smira2. This clearly confirmed that Rpi-smira2 is the same gene as R8.
Stacking of R8 with other Late Blight R Genes to Achieve Durable Resistance
[0147] The durability of Sarpo mira's resistance was associated with the stacking of multiple R genes (Rietman et al. 2012). To pursue similar or even better durability, we set out to produce stacks of R8 with other late blight R genes in order to create material for future durability challenges. Combinations of R8 with Rpi-sto1, Rpi-blb3, Rpi-edn2, Rpi-vnt1.1 and Rpi-blb2 were made in binary vectors and these constructs were transformed to potato variety Desiree. From each construct 21 transformation events were harvested and tested for the presence and functional expression of both R genes. For this purpose, the events were inoculated with differential P. infestans isolates (Table 10) that had overcome one of the R genes in the stack. There was a remarkable difference in the frequency by which events were produced that were resistant to both differential isolates (Table 3). The most efficient combinations were R8:Rpi-edn2,
[0148] Rpi-vnt1.1:R8 and Rpi-blb2:R8. In 2015 these plants were exposed to durability challenges in field trials in 2015. Indeed, the plants that functionally expressed both R8 and the second R gene remained devoid of any late blight symptoms (Table 11).
TABLE-US-00011 TABLE 11 Combinations of R8 with other late blight R genes in one binary vector transformed to Desiree. Frequency of Immune** Frequency plants among events with Insert in binary that both R genes are both R genes active in the vector active in transgenic events* field R8:Rpi-sto1 0.00 Rpi-blb3:R8 0.08 R8:Rpi-edn2 0.55 1.0 Rpi-vnt1.1:R8 0.86 1.0 Rpi-blb2:R8 0.95 1.0 *21 events per construct were tested for the activity of both R genes using differential isolates. **immunity is defined as absence of symptoms until the end of the growing season of 2015