ANTI-AGING TRANSGENIC CAENORHABDITIS ELEGANS

20190200589 ยท 2019-07-04

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to: a transgenic Caenorhabditis elegans in which a glutamine tRNA 5 terminus-derived fragment (Gln 5-tsRNA) is overexpressed; a preparation method therefor; and a method for screening for aging-associated factors by using the transgenic Caenorhabditis elegans. A transgenic Caenorhabditis elegans model provided in the present invention is an animal model in which Gln 5-tsRNA is overexpressed such that aging is inhibited. When the model of the present invention is used, anti-aging mechanisms can be easily investigated, thereby significantly contributing to various research fields such as that of developing new anti-aging drugs and screening for age-inducing materials.

Claims

1. Transgenic Caenorhabditis elegans in which a glutamine tRNA 5 end-derived fragment (Gln 5-tsRNA) is overexpressed.

2. The transgenic Caenorhabditis elegans of claim 1, which is for an anti-aging animal model.

3. The transgenic Caenorhabditis elegans of claim 1, wherein the Gln 5-tsRNA consists of a nucleotide sequence of SEQ ID NO: 1.

4. The transgenic Caenorhabditis elegans of claim 1, which exhibits an anti-aging effect due to mitochondrial activation.

5. The transgenic Caenorhabditis elegans of claim 1, which exhibits an anti-aging effect via dietary restriction (DR)/AMP-dependent kinase (AMPK) pathways.

6. A method of producing transgenic Caenorhabditis elegans of claim 1, the method comprising: (a) constructing a recombinant vector including a U6 promoter, Gln 5-tsRNA DNA and an U6 3 untranslated region (UTR); and (b) injecting the recombinant vector into Caenorhabditis elegans.

7. The method of claim 6, wherein, in the operation (a), the U6 promoter is a promoter specific for small RNA overexpression.

8. The method of claim 6, wherein, in the operation (b), a method of injecting the recombinant vector into Caenorhabditis elegans is microinjection.

9. A method of screening an aging-inducing candidate material using the Caenorhabditis elegans of claim 1.

10. The method of claim 9, which comprises: (a) treating the transgenic Caenorhabditis elegans of claim 1 with candidate materials; (b) following the treatment of the candidate materials, measuring mitochondrial activity; and (c) selecting a candidate material with lower mitochondrial activity than a control group not treated with the candidate material.

11. The method of claim 9, comprising: (a) treating the transgenic Caenorhabditis elegans of claim 1 with candidate materials; (b) following the treatment of the candidate materials, measuring AMP-dependent kinase (AMPK) activity; and (c) selecting a candidate material with lower AMPK activity than a control group not treated with the candidate material.

Description

DESCRIPTION OF DRAWINGS

[0025] FIG. 1 is a schematic diagram illustrating that four types of tsRNAs are generated according to cleaved sites in mature tRNA.

[0026] FIG. 2 shows a result confirming that Gln 5-tsRNA increases according to age through C. elegans small RNA sequencing database analysis.

[0027] FIG. 3 shows Northern blotting results indicating that mRNA of glutamine 5-tsRNA increases according to age in C. elegans samples.

[0028] FIG. 4 is a schematic diagram illustrating a process of constructing a Gln 5-tsRNA-overexpressing transgenic C. elegans model using a small RNA-specific U6 promoter.

[0029] FIG. 5 shows the result of comparing lifespans between the Gln 5-tsRNA tsRNA-overexpressing transgenic C. elegans and a wild-type to confirm the function of Gln 5-tsRNA in aging.

[0030] FIG. 6 shows the result of confirming a change in mRNA profile induced by the overexpression of Gln 5-tsRNA.

[0031] FIG. 7 shows the result of RNA sequencing analysis, confirming that mRNA levels of mitochondrial genes are much higher than that of a wild-type due to the overexpression of Gln 5-tsRNA.

[0032] FIG. 8 shows the qPCR result confirming that DNA copy number of a mitochondrial gene in Gln 5-tsRNA-overexpressing C. elegans is increased due to aak-2.

[0033] FIG. 9 shows the results of confirming genetic interactions between conventionally-known lifespan regulating pathways (DR, insulin/IGF-1 pathway, etc.) and the overexpression of Gln 5-tsRNA, and specifically, shows the results of measuring changes in lifespan of Gln 5-tsRNA-overexpressing C. elegans in an eat-2() mutation background (FIG. 9A), an aak-2() mutation background (FIG. 9B), a daf-16() mutation background (FIG. 9C), a daf-16() mutation background; daf-2() mutation background (FIG. 9D), and a hsf-1() mutation background (FIG. 9E).

MODES OF THE INVENTION

[0034] The present invention provides transgenic C. elegans in which a glutamine tRNA 5 end-derived fragment (Gln 5-tsRNA) is overexpressed.

[0035] The C. elegans used herein is Caenorhabditis elegans (scientific name), and is a nematode that feeds on bacteria in soil and is widely used in genetic, molecular biological, and cell biological experiments.

[0036] The transformation used herein means that an exogenously-introduced gene is recombined to be artificially inserted into a subject, thereby changing some of the subject's genetic traits.

[0037] The transgenic C. elegans used herein refers to C. elegans in which Gln 5-tsRNA is overexpressed and thus aging is suppressed, that is, an anti-aging characteristic is exhibited, and therefore, the transgenic C. elegans of the present invention may be used for an anti-aging animal model.

[0038] The tRNA-derived fragments (tRNA-derived small RNAs; tsRNAs) used herein refers to a type of small non-coding RNAs, and fragments of specific base sequences generated by cleaving mature tRNA at a specific site.

[0039] The Gln 5-tsRNA used herein is a fragment derived from the 5 end of glutamine tRNA, which is not particularly limited, and may be a fragment consisting of a base sequence of SEQ ID NO: 1 or having 80% or more homology. Here, the homology means that a fragment is naturally or artificially derived from a nucleic acid sequence derived from the common ancestor, and can be modified to include one or more selector codons by any available mutagenesis of any naturally-occurring nucleic acid.

[0040] The term derived from used herein means that a component which is isolated from using a specified molecule or organism, or prepared using the information from it.

[0041] In the present invention, C. elegans for an anti-aging animal model is not particularly limited as long as it expresses an anti-aging characteristic regardless of the type of a mechanism, and the expression of the anti-aging characteristic may be caused by mitochondria activation or AMPK activity.

[0042] Here, mitochondria are cell organelles generating energy in vivo, play an important role in a variety of genetic diseases/adult diseases, and it has been reported that, when the mitochondria produce energy well to help smoothly progress energy metabolism, that is, when the mitochondria are activated, aging is suppressed. In addition, AMPK is a major enzyme that regulates energy homeostasis in a body, and an evolutionarily well-conserved enzyme expressed in most animal tissues. AMPK is associated with aging, which is a symptom accompanied by declination of normal functions of various organs, and since aging induces the occurrence of various diseases such as diabetes type II, neurodegenerative diseases, cancer, cardiovascular diseases, and death resulting therefrom, the potential to develop a new drug using a material that increases or decreases AMPK activity is very large, and can be utilized in various ways.

[0043] In addition, the present invention provides a method of constructing the transgenic C. elegans, which includes: (a) preparing a recombinant vector including a U6 promoter, Gln 5-tsRNA DNA and a U6 3 untranslated region (UTR); and (b) injecting the recombinant vector into C. elegans.

[0044] In the present invention, the recombinant vector is a vector used in genetic engineering, which is, but not limited to, preferably a plasmid vector. The recombinant vector may be, for example, a virus vector, a cosmid vector, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC) or other non-plasmid vectors.

[0045] In the present invention, the recombinant vector may further include a marker gene that can confirm transformation. There is no particular limitation to the marker gene, and the marker gene is preferably a fluorescent protein gene such as a green fluorescent protein (GFP) gene or a red fluorescent protein (RFP) gene.

[0046] The promoter used herein refers to a DNA sequence which regulates expression of a nucleic acid sequence operably linked to specific host cells, and is not particularly limited as long as it is used for expression. The promoter is preferably a U6 promoter suitable for expression of small RNA. In addition, the operably linked means that one nucleic acid fragment is combined with another nucleic acid fragment so that its function or expression is affected by the other nucleic acid fragment.

[0047] In addition, the recombinant vector of the present invention may further include an arbitrary operator sequence for regulating transcription, a sequence encoding a suitable mRNA-ribosome binding site and a sequence that regulates the termination of transcription and translation.

[0048] DNA of Gln 5-tsRNA introduced into the recombinant vector may be arranged to correspond to a transcription direction of the promoter present in a vector to effectively induce the expression of each gene by activity of the promoter.

[0049] In the present invention, a method of injecting the recombinant vector into C. elegans may be any method known in the art without limitation, and the method is preferably microinjection using a micropipette.

[0050] In addition, the present invention provides a method of screening an aging-inducing candidate material using the transgenic C. elegans.

[0051] Although there is no limitation to the method of screening an aging-inducing candidate material in the present invention, it is preferable to treat the transgenic C. elegans with a candidate material, and then measure mitochondrial activity or AMPK activity to select a candidate material with lower activity than the control group not treated with the candidate material.

[0052] According to the screening method of the present invention, searching for an aging-related factor (a gene or a drug) may be rapidly and easily performed, and thus it can contribute greatly to the study of many diseases associated with aging or to the development of new drugs.

[0053] Hereinafter, preferable examples are provided to help in understanding the present invention. However, the following examples are provided to more easily understand the present invention and the scope of the present invention is not limited by the following examples.

EXAMPLE 1

Culture of C. elegans

[0054] After purchase of a standard wild-type Bristol strain N2, C. elegans was cultured in an E. coli (OP50)-seeded nematode growth medium (NGM) agar plate at 20 C.

EXAMPLE 2

Confirmation of Change in tsRNA Level According to Age of C. elegans

[0055] A small RNA sequencing result according to the age of C. elegans was used to analyze how the tsRNA level was changed.

[0056] Specifically, using the modENCODE (http://data.modencode.org/Organism=C. elegans) database, an RNA read sequence obtained by sequencing was matched to each tRNA sequence of the tRNA database so as to analyze which read sequence in each part of specific tRNA is identified.

[0057] Consequently, as shown in FIG. 2, it was confirmed that a glutamine tRNA-derived fragment (Gln tsRNA), particularly, the read sequence of the 5 end, was age-dependently increased. Afterward, by sequencing the fragment using the known method, it was confirmed that the fragment consists of the base sequence of SEQ ID NO: 1.

TABLE-US-00001 [SEQIDNO:1] 5-GGTTCCATGGTGTAGCGGTTAGCACTCAGGACT-3

EXAMPLE 3

Reconfirm that Gln 5-tsRNA was Age-Dependently Increased in C. elegans

[0058] To reconfirm the result of Example 1 using a database, Northern blotting was performed to confirm whether a glutamine tRNA-derived fragment was actually increased according to aging in C. elegans samples.

[0059] Specifically, ten 60-mm plates of each C. elegans sample at the age of 0, 5, 8 or 10 days were collected to extract total RNA, and then Northern blotting was performed using respective probes specific for the 5 end and the 3 end of the glutamine tRNA. At this time, information on each probe used herein is shown below.

TABLE-US-00002 Probeforthe5 endofglutaminetRNA: (SEQIDNO:2) 5-CCTGAGTGCTAACCGCTACACCATGGAACC-3 Probeforthe3 endofglutaminetRNA: (SEQIDNO:3) 5-TGGAGGTTCCACCGAGATTTGAACTCGGGT-3

[0060] Consequently, as shown in FIG. 3, it can be confirmed that the fragment at the 5 end of the glutamine tRNA-derived fragment was increased according to age, which is the same as the result of Example 1.

EXAMPLE 4

Construction of Gln 5-tsRNA-Overexpressing C. elegans

[0061] Based on the result of Example 3, to identify the relationship between Gln 5-tsRNA and aging in vivo, a Gln 5-tsRNA-overexpressing transgenic C. elegans model was constructed.

[0062] To this end, as shown in FIG. 4, a recombinant vector including an U6 promoter which is specific for overexpression of small RNA of C. elegans, Gln 5-tsRNA and U6 3 UTR, was constructed. Specifically, the U6 promoter-Gln 5-tsRNA and the Gln 5-tsRNA-U6 3 UTR were amplified by PCR, a U6 promoter-Gln 5-tsRNA-U6 3 UTR construct was constructed using PCR fusion, and then this construct was cloned in a pUC57 vector using EcoRI and HindIII restriction enzymes. Here, information on each primer used in the PCR is shown below.

TABLE-US-00003 ForwardU6p: (SEQIDNO:4) 5'-CGGGAATTCCTCCAAGAACTCGTACAAAAATGCTCT-3' ReverseU6p-GlntsRNA: (SEQIDNO:5) 5'-AGTCCTGAGTGCTAACCGCTACACCATGGAACCAAACATTTAGATTT GCAATTCAATTATATAGG-3' ForwardGlntsRNA-U6UTR: (SEQIDNO:6) 5'-GGTTCCATGGTGTAGCGGTTAGCACTCAGGACTCAATAATATTCTAG ATATCCCTTTTTG-3' ReverseU6UTR: (SEQIDNO:7) 5'-CGGAAGCTTCACAGCCGACTATGTTTGGCGT-3'

[0063] Afterward, the recombinant vector was overexpressed by microinjecting into a reproductive organ of C. elegans along with a green fluorescence protein (GFP) marker, and then green fluorescence was observed using a fluorescent microscope to confirm whether DNA was contained.

[0064] Consequently, as shown in FIG. 4, it was confirmed that strong green fluorescence was exhibited in C. elegans.

EXAMPLE 5

Measurement of Lifespan of Gln 5-tsRNA-Expressing C. elegans

[0065] Using the Gln 5-tsRNA-overexpressing C. elegans constructed in Example 4, the function of the Gln 5-tsRNA on aging was assessed by measuring the lifespan of C. elegans.

[0066] Specifically, E. coli OP50 was cultured in LB broth containing streptomycin for 12 to 16 hours at 37 C., and then plated in a NGM medium. After approximately 12 to 16 hours, E. coli OP50 was treated with 5 M 5-fluoro-2-deoxyuridine (FUdR), and 30 animals each of Gln 5-tsRNA-overexpressing C. elegans (Young-adult stage) and a control group (wild-type) were plated on each of four plates. Then, the number of living C. elegans was counted once every two to three days to measure the lifespan of C. elegans.

[0067] Consequently, as shown in FIG. 5, it was confirmed that all of three types of glutamine tRNA 5 end-derived fragment (Gln 5-tsRNA)-overexpressing (transformed) C. elegans lines had a longer lifespan than the control group (wild-type (WT)).

[0068] Since this result shows that overexpression of specific tsRNA can extend the lifespan of C. elegans, it means that tsRNA is a material that actively regulates aging/lifespan, not simply a passive byproduct of aging.

[0069] In addition, when associating the result of Example 5 with data of Examples 2 and 3, it can be seen that Gln 5-tsRNA is a compensation mechanism for extending a lifespan by delaying aging, and thus is age-dependently increased in C. elegans.

EXAMPLE 6

Identification of Anti-Aging Mechanism of Gln 5-tsRNA

[0070] 6-1. Gene Screening

[0071] It was intended to identify an anti-aging mechanism by confirming how a gene is actually changed by overexpression of Gln 5-tsRNA using the Gln 5-tsRNA-overexpressing C. elegans constructed in Example 4.

[0072] First, since tsRNAs are known to regulate mRNA transcription, a change in mRNA profile, induced by Gln 5-tsRNA overexpression was observed through RNA sequencing analysis.

[0073] Specifically, three independent sets of samples were prepared by bulk culturing wild-type C. elegans (control group) and Gln 5-tsRNA-overexpressing C. elegans at day 1 adult stage, total RNA was extracted by a TRIzol base method, and then the quality of each sample was determined by RNA electrophoresis and qRT-PCR. Afterward, raw data obtained by RNA sequencing was analyzed using the Cufflinks pipeline.

[0074] Consequently, as shown in FIG. 6, it was confirmed that, compared with the wild-type C. elegans, 1261 types of genes were up-regulated, and 425 types of genes were down-regulated.

[0075] Afterward, as a result of comparing these genes (DEG: differentially expressed genes) with other known longevity mutant C. elegans, it can be seen that the DEGs considerably overlapped genes up-regulated by overexpression of an activated AMP-dependent kinase (AMPK), and genes up-regulated by daf-2()/insulin/insulin-like growth factor 1 (IGF-1) receptor mutations. This analysis result means that it is possible for Gln 5-tsRNA to act together with an AMPK or insulin/IGF-1 signaling pathway.

[0076] In addition, according to an RNA sequencing analysis result, as shown in FIG. 7, it was confirmed that mRNA levels of mitochondrial genes are greatly increased by overexpression of Gln 5-tsRNA, compared with a wild-type.

[0077] Further, according to quantitative PCR (qPCR), as shown in FIG. 8, it was observed that the mitochondrial DNA copy number was also increased. It can be seen that the effect of increasing the mitochondrial DNA copy number due to Gln 5-tsRNA overexpression disappeared through the aak-2 m utation, indicating that the Gln 5-tsRNA overexpression resulted in increasing the mitochondrial DNA copy number through AMPK.

[0078] Since DR is known to activate mitochondrial functions in various species, this result can be understood as Gln 5-tsRNA and DR act together to promote the function of mitochondria to extend a lifespan.

[0079] 6-2. Identification of Anti-Aging Mechanism

[0080] In order to confirm genetic interactions between conventionally known lifespan regulating pathways (DR, insulin/IGF-1 pathway, etc.) and the overexpression of Gln 5-tsRNA, changes in the lifespan of Gln 5-tsRNA-overexpressing C. elegans were determined under DR mimetic eat-2(), insulin/IGF-1 receptor mutant daf-2(), catalytic alpha subunit of AMPK mutant aak-2(), fork head box O(FOXO) transcription factor mutant daf-16(), heat-shock transcription factor 1 (HSF-1) mutant hsf-1() backgrounds.

[0081] Specifically, five long-living adult C. elegans were plated on a NGM medium and synchronized for 16 hours, and then when eggs were grown up to young-adult stages, they were transferred to a 5 M FUdR-treated NGM medium twice every two days. During the final transfer, 120 animals per each background were selected, and then the number of living animals was counted every two to three days until all animals died, resulting in observation of a lifespan change.

[0082] Consequently, as shown in FIG. 9A, the overexpression of Gln 5-tsRNA did not amplify the life-extending (anti-aging) effect of eat-2().

[0083] In addition, as shown in FIG. 9B, it can be seen that the lifespan extended by the overexpression of Gln 5-tsRNA was completely suppressed by the aak-2 mutation, and the aak-2 is known as a gene required for DR-mediated lifespan regulation.

[0084] Contrarily, as shown in FIGS. 9C to 9E, it can be seen that when Gln 5-tsRNA was overexpressed, the lifespan of C. elegans having the daf-16 or hsf-1 mutation was independently increased, and it is known that the daf-16 and hsf-1 are not genes generally required for DR-mediated lifespan regulation.

[0085] Therefore, summarizing the experimental results, it can be seen that the anti-aging effect caused by Gln 5-tsRNA acts through the DR/AMPK pathways.

[0086] It should be understood by those of ordinary skill in the art that the above description of the present invention is exemplary, and the exemplary embodiments disclosed herein can be easily modified into other specific forms without departing from the technical spirit or essential features of the present invention. Therefore, the exemplary embodiments described above should be interpreted as illustrative and not limited in any aspect.

INDUSTRIAL APPLICABILITY

[0087] By not only easily identifying the anti-aging mechanism but also identifying the anti-aging function of tsRNAs, an animal model according to the present invention can be expected to highly contribute to various research fields such as development of new anti-aging drugs, and screening of various factors including an aging-inducing material.

TABLE-US-00004 [SequenceListingFreeText] <210> 1 <211> 33 <212> DNA <213> Caenorhabditiselegans <400> 1 ggttccatggtgtagcggttagcactcaggact <210> 2 <211> 30 <212> DNA <213> ArtificialSequence <220> <223> GlutaminetRNA5 terminalprobe <400> 2 cctgagtgctaaccgctacaccatggaacc <210> 3 <211> 30 <212> DNA <213> ArtificialSequence <220> <223> GlutaminetRNA3 terminalprobe <400> 3 tggaggttccaccgagatttgaactcgggt <210> 4 <211> 36 <212> DNA <213> ArtificialSequence <220> <223> ForwardU6p <400> 4 cgggaattcctccaagaactcgtacaaaaatgctct <210> 5 <211> 65 <212> DNA <213> ArtificialSequence <220> <223> ReverseU6p-GlntsRNA <400> 5 agtcctgagtgctaaccgctacaccatggaaccaaacatt tagatttgcaattcaattatatagg <210> 6 <211> 60 <212> DNA <213> ArtificialSequence <220> <223> ForwardGlntsRNA-U6UTR <400> 6 ggttccatggtgtagcggttagcactcaggactcaataat attctagatatccctttttg <210> 7 <211> 31 <212> DNA <213> ArtificialSequence <220> <223> ReverseU6UTR <400> 7 cggaagcttcacagccgactatgtttggcgt