MATERIALS AND METHODS FOR MODIFYING THE ACTIVITY OF T CELLS
20190203173 ยท 2019-07-04
Assignee
Inventors
- Bruce R. Blazar (Golden Valley, MN)
- Keli Hippen (Minneapolis, MN)
- Pavan Reddy (Ann Arbor, MI, US)
- Yaping Sun (Ann Arbor, MI, US)
- Ramiro Garzon (Columbus, OH)
Cpc classification
A61K2239/26
HUMAN NECESSITIES
A61K39/4611
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
C12N5/0637
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
C12N2310/113
CHEMISTRY; METALLURGY
A61P37/06
HUMAN NECESSITIES
A61K2239/38
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
This disclosure provides miRNA/mRNA pairs that can be used to increase the efficacy of T cells or to down-modulate T cell efficacy and restore equilibrium.
Claims
1. A method of increasing the survival, stability and/or function of T cells, comprising: providing T cells from an individual; contacting the T cells with at least one moiety that decreases or inhibits miRNA-146b, miRNA-4484 or miRNA-155; and introducing the contacted T cells back into the individual.
2. The method of claim 1, wherein the at least one moiety is selected from the group consisting of a nucleic acid molecule, a small molecule, a polypeptide, and an anti-miR.
3-5. (canceled)
6. The method of claim 1, wherein the T cells are contacted with the moiety on day 0.
7. The method of claim 1, wherein the T cells are cultured for about 1 to about 21 days before being contacted with the moiety.
8. The method of claim 1, wherein the T cells are contacted with the moiety for several hours to several days to several weeks.
9. The method of claim 1, wherein the T cells are Treg cells.
10. The method of claim 9, wherein the Treg cells are tTreg cells or iTreg cells.
11. An article of manufacture, comprising at least one moiety that decreases or inhibits miRNA-146b, miRNA-4484 or miRNA-155.
12. The article of manufacture of claim 11, wherein the at least one moiety is selected from the group consisting of a nucleic acid molecule, a small molecule, a polypeptide, and an anti-miR.
13. A method of increasing the survival, stability and/or function of T cells, comprising providing T cells from an individual; contacting the T cells with at least one moiety that decreases or inhibits one or more miRNAs selected from the group consisting of the miRNAs shown in Table 3; and introducing the contacted T cells back into the individual.
14. (canceled)
15. The method of claim 13, wherein the at least one moiety is selected from the group consisting of a nucleic acid molecule (e.g., RNA interference), a small molecule, a polypeptide (e.g., an antibody), and an anti-miR (e.g., an antagomir).
16-18. (canceled)
19. The method of claim 13, wherein the T cells are Treg cells.
20. The method of claim 19, wherein the Treg cells are tTreg cells or iTreg cells.
21. A method of decreasing the activity of T cells, comprising providing T cells from an individual; contacting the T cells with at least one moiety that increases or induces one or more miRNAs selected from the group consisting of the miRNAs shown in Table 3; and introducing the contacted T cells back into the individual.
22. (canceled)
23. The method of claim 21, wherein the at least one moiety is selected from the group consisting of a nucleic acid molecule, a small molecule, a polypeptide, and an anti-miR.
24-26. (canceled)
27. The method of claim 21, wherein the T cells are Treg cells.
28. The method of claim 27, wherein the Treg cells are tTreg cells or iTreg cells.
29-34. (canceled)
Description
DESCRIPTION OF DRAWINGS
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION
[0042] Treg cells develop in the thymus (tTreg) or they can be induced in the periphery (pTreg) in response to environmental cues (e.g., chronic infection). Many of these environmental cues also can be used to induce suppressive function following stimulation in vitro, and these Tregs are denoted iTreg. Because of their relatedness, information on iTreg signaling and function is expected to be directly translatable to pTreg.
[0043] MicroRNAs (miRNAs or miRs) are short (?22 nucleotides), single-stranded RNA molecules that, among other functions, fine-tune the responses of T cells and Treg cells to self-, environmental-, and foreign-antigens. miRs regulate the expression of genes by hybridizing to target sites with complementary sequences, resulting in translational repression, mRNA cleavage, and/or destabilization through effector RNA-mediated silencing complexes (RISCs) or argonaute containing (AGO-containing) micro-ribonucleoprotein (miRNP) effector complexes. Because individual miRs target multiple mRNA species, and individual mRNAs are targeted by multiple miRs, traditional mRNA and miRNA microarray analyses cannot identify specific miRNA-mRNA partners.
[0044] A platform has been developed that can be used to determine specific miRNA species that are actively targeting mRNA, and which mRNA species are bound to miRNA. See, for example, Sun et al., 2013, J. Clinical Invest., 123:4793-54. This platform was used to identify miRNA-mRNA pairs that are differentially expressed in expanded tTreg or iTreg cells relative to control in vitro expanded CD4+ cells (herein referred to as Teff cells). Using these methods, novel miRNA-mRNA associations are described that control tTreg and iTreg survival, stability and/or function.
[0045] The miRNA/mRNA pairs described herein can be used to increase the efficacy (e.g., suppressive function) of Treg cells, e.g., to suppress autoimmunity, graft rejection or GVHD. Also, the miRNA/mRNA pairs described herein can be used to down-modulate Treg efficacy and restore equilibrium, since overly active regulatory T cells are associated with tumor persistence and chronic infections. In addition, the miRNA/mRNA pairs described herein can be used to increase the suppressive function of non-Treg cells, e.g., to suppress autoimmunity, graft rejection or GVHD. As used herein, non-Treg cells include, without limitation, na?ve T cells, effector cells, effector memory cells, memory stem cells, central memory cells, short-lived effector cells, and long-lived effector cells.
[0046] Therefore, methods are provided herein that can be used to increase the survival, stability and/or function of T cells, or, alternatively, decrease the activity of T cells. Such methods typically include providing T cells from an individual (e.g., in vivo or ex vivo) and contacting the T cells with at least one moiety that decreases or inhibits one or more miRNAs or that increases or induces one or more miRNAs. In instances where the contacting step is performed ex vivo, the method further includes introducing the contacted T cells back into the individual. In instances where the contacting step is performed in vivo, the moiety that decreases or inhibits one or more miRNAs or that increases or induces one or more miRNAs can be delivered using, for example, antibody- or ligand-targeted nanoparticles, liposomes, viral or non-viral delivery systems, or other types of DNA- or RNA-based delivery systems.
[0047] Methods of obtaining T cells from an individual are known in the art, as are methods of returning the T cells back into an individual after the cells have been manipulated in the desired manner. Methods of contacting T cells in an individual in vivo also are known in the art. The contacting can be transient (e.g., with a moiety that is designed to transiently decrease or inhibit one or more miRNAs or increase or induce one or more miRNAs) or the contacting can be permanent (e.g., with a moiety that is designed to permanently decrease or inhibit one or more miRNAs or increase or induce one or more miRNAs). It would be understood that, in some instances, the difference between transient effects and permanent effects is genetic engineering (e.g., genetically engineering the T cells to express the moiety). As used herein, transient can refer to hours, days, or weeks, and transient also can refer to the contacting step and/or the effects of the contacting step (e.g., on the one or more miRNAs).
[0048] A well-known class of moieties that down-regulate miRNAs are anti-miRs, which includes a group of compounds known as antagomirs. However, other moieties that down-regulate or up-regulate the indicated miRNAs can be used and include, without limitation, nucleic acid molecules, polypeptides (e.g., antibodies), or small molecules. Nucleic acids include, for example, RNA interference nucleic acids (e.g., shRNA, siRNA, RNAi) or gene editing nucleic acids (e.g., CRISPRs, TALENs, zinc finger nucleases, megaTALs).
[0049] As described herein, the miRNAs that can be down-regulated to increase the survival, stability and/or function of T cells or up-regulated to decrease the activity of T cells are shown, without limitation, in Table 3.
[0050] Moieties as used herein refer to those moieties that act directly on the miRNAs identified herein and also those moieties that act indirectly but still effect the result on the miRNAs identified herein. For example, an increase or induction in one or more miRNAs can occur due to disruption or inhibition of negative regulators (e.g., a different miRNAs) or due to activation or increased expression of positive regulators, or by engaging an enhancer or super-enhancer region.
[0051] Any such moieties can be delivered to the T cells using methods and materials known in the art. Such methods and materials include, without limitation, transduction of viral (e.g., lentiviral, retroviral) or non-viral vectors, lipofection, nanoencapsulation or nanoparticles (e.g., liposomes), electroporation, or delivery of naked RNA molecules.
[0052] As described herein, the T cells can be contacted with the moiety upon collection (e.g., at day 0) or anytime thereafter (e.g., day 1 to day 21). Since many miRNAs are induced following stimulation of the T cell receptors, early disruption (e.g., decrease or increase; inhibition or induction) can be beneficial. The conditions under which the T cells are cultured during the contacting step are known in the art. Depending upon the moiety, the contacting can take place for several hours, several days, or several weeks. Depending upon the moiety, the contacting may be repeated more than once (e.g., a plurality of contacting steps).
[0053] To determine whether the T cells have been sufficiently contacted with the moiety (e.g., contacted with an effective amount of the moiety for a time sufficient to decrease or inhibit one or more of the miRNAs identified herein or to increase or induce one or more of the miRNAs identified herein), the miR or the mRNA can be amplified using, for example, qRT-PCR. Alternatively, one or more protein products of the miR/mRNA interaction can be monitored using, for example, immunoassays (e.g., ELISA, Western blot)). Alternatively, T cells can be evaluated (e.g., in vitro or in vivo) for cell suppression potency and/or survival using known methods.
[0054] Articles of manufacture also are provided herein that include at least one moiety that decreases or inhibits one or more of the miRNAs identified herein or that increases or induces one or more of the miRNAs identified herein, depending on the desired function (e.g., increasing the survival, stability and/or function of T cells or decreasing the activity of T cells). Articles of manufacture are known in the art and typically include one or more containers and packaging materials.
[0055] In accordance with the present invention, there may be employed conventional molecular biology, microbiology, biochemical, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. The invention will be further described in the following examples, which do not limit the scope of the methods and compositions of matter described in the claims.
EXAMPLES
Example 1Cell Purification and Culture
[0056] Non-mobilized peripheral blood (PB) leukapheresis products were purchased from Memorial Blood Center (St. Paul, Minn.). Na?ve human PB tTreg (CD4+25+127-45RA+) were sort-purified from PB mononuclear cells (PBMNCs) (Ficoll-Hypaque, Amersham Biosciences) in a two-step procedure in which CD25+ cells were initially enriched from PBMNCs by AutoMACS (PosselD2) with GMP grade anti-CD25 microbeads (Miltenyi Biotec). CD25+(high) cells were stained with CD4, CD8, CD25, CD127 and CD45RA and sorted via FACSAria as CD4+, CD8-, CD25+(high), CD127- and CD45RA+. Note that the bead-bound and fluorochome-conjugated anti-CD25 antibodies recognize different epitopes (Miltenyi Biotec), followed by sorting on a FACSAria (BD Biosciences). Na?ve human CD4 T cells were sort-purified from the CD25? fraction as CD4+, CD25-, CD127+, and CD45RA+.
[0057] Purified na?ve tTreg and CD4 T cells were stimulated with a K562 cell line engineered to express CD86 and the high-affinity Fc receptor (CD64) (2:1 tTreg/KT), which had been irradiated with 10,000 cGy and incubated with anti-CD3 (Miltenyi Biotec). In some experiments, tTregs were stimulated with KT64/86 cells that were preloaded, irradiated, and frozen (1:1 tTreg/KT). Naive tTreg and CD4+ T cells were cultured in X-Vivo-15 (BioWhittaker, Walkersville, Md.) media supplemented with 10% human AB serum (Valley Biomedical). Recombinant IL-2 (300 IU/mL for Treg, 50 IU/mL for control T cells; Chiron, Emeryville, Calif.) was added on day 2 and maintained for culture duration. Cultures were maintained at 0.25?10.sup.6 to 0.5?10.sup.6 viable nucleated cells/ml every 2 to 3 days. Rapa/TGFbeta iTreg and Teff cultures were re-stimulated on day 7, and tTreg were re-stimulated on day 12 with fresh KT64/86 (2:1 tTreg/KT), and were kept in culture until days 14 and 19, respectively.
[0058] See
[0059] In vitro expansion of na?ve tTreg, Rapa/TGF? iTreg and Teff was performed according to the time line shown schematically in
[0060] Specific details are provided below.
[0061] Culture Conditions [0062] KT64/86 (fresh, 1:2 KT to Treg) [0063] Cell density: 0.25-0.5?10.sup.6 viable NC/ml [0064] seeding density: 1.6-3.2?10.sup.5 viable cells/cm.sup.2 [0065] IL2 (300 IU/ml for tTreg; 50 IU/ml for iTreg and Teff): day 2 and w/re-feeding (total media) [0066] Rapa (100 ng/ml) and TGFbeta (10 ng/ml): day 0 and w/re-feeding (fresh media only) [0067] Re-stimulation (keep in IL-2): [0068] KT64/86 (fresh, 1:2 KT to Treg) [0069] Cell density 0.25 M/ml for 7 days, 0.5 M/ml thereafter
[0070] Aliquots at Harvest [0071] for us: freeze 5 aliquots of 10 million cells in freezing medium (1 ml each) [0072]
[0074] FACS Analysis: (@, Culture Term) [0075] 45RA/LAP/127/25/FoxP3/HLA-DR/45RO/4 [0076] 19/CTLA-4/127/25/FoxP3/Helios/8/4 [0077] 27/57/Ki-67/127/28/FoxP3/CCR7/4
[0078] Suppression Assay [0079] In vitro CFSE: single assay on frozen/thawed Treg aliquots done at the same time.
Example 2CLIP and RNA Isolation
[0080] Cultured T cells were rinsed once with PBS. The cells were then added to 10 ml PBS/plate (100 mm) and exposed to 400 mJ/cm.sup.2 UVA light, followed by an additional 200 ml/cm.sup.2 from a UVAR light set (Therakos). The light set was calibrated periodically using a UVX meter fitted with a UVA detector (UVP; Therakos). The cells were collected, washed twice with PBS, and then lysed on ice for 20 minutes with lysis buffer (25 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM MgCl.sub.2, 0.5% NP-40, and mM DTT) and a freshly added protease inhibitor cocktail (Pierce), 1 mM PMSF, and 250 U/ml RNasin (Promega). The lysates were then centrifuged at 10,000 g at 4? C. for 10 minutes, and the supernatants were subjected to preclearance by a 60-minute incubation at 4? C. with pre-blocked protein A agarose beads, which were prepared by incubating protein A agarose with salmon sperm DNA (100 ?g/ml) and BSA (10 mg/ml) overnight at 4? C. A volume of 400 ?l of the protein A agarose beads was added to each tube of cross-linked lysate. Prior to their addition to the lysate, the beads were washed three times with 0.1 M Na phosphate (pH 8.0) prior to the addition of 50 ?l of bridge Ab [2.4 mg/ml; donkey anti-rabbit IgG F(c); Abnova]. The tubes were then rotated at room temperature for 60 minutes and washed three times with 0.1 M Na phosphate (pH 8.0). The beads were re-suspended in 400 ?l 0.1 M Na phosphate (pH 8.0) prior to the addition of 10 ?l of argonaute 2 rabbit mAb (Cell Signaling Technology). The tubes were rotated at 4? C. for 5 hours and washed three times with lysis buffer. The cross-linked and precleared lysate was added to one prepared tube of beads, and the bead/lysate mix was rotated for 4 hours at 4? C. The beads were then washed twice with lysis buffer, three times with lysis buffer containing 900 mM NaCl and 1% NP-40, twice with lysis buffer, and once with lysis buffer containing 0.05% NP-40. After washing, the beads were subjected to DNase treatment by incubation with 250 ?l of a DNA digestion solution containing 40 mM Tris-HCl, pH 8.0, 10 mM MgSO4, 1 mM CaCl.sub.2), 200 U/ml RNasin, and 0.04 U/ml DNase I (Promega) at 38? C. for 20 minutes, with gentle shaking every 5 minutes. The RNAs caught by CLIP were extracted with either TRIzol LS (Invitrogen), which permits the isolation of total RNA, or an miRNeasy kit (QIAGEN), which is designed for the purification of total RNA, including miRNA and other small RNA molecules.
Example 3Affymetrix Microarrays and Analyses
[0081] The total cellular RNA (tcRNA) was extracted with TRIzol LS reagent from the CLIP agarose beads and cleaned with RNeasy columns (QIAGEN). After the quality of the total RNA was verified by an Agilent 2100 Bioanalyzer, the samples were processed using the WT-Ovation Pico System (Affymetrix), which requires only 500 pg of total RNA and a single round of amplification for samples with even stricter concentration restraints. This system incorporates oligo(dT) and random primers for amplification at the 3 end and throughout the whole transcriptome. Affymetrix human genome U133A Plus 2.0 arrays were used, which contain 47,000 transcripts for annotated genes and expressed sequence.
Example 4Exiqon miRNA Microarrays and Analyses
[0082] Total RNA, including miRNAs and other small RNA molecules, were purified from CLIP agarose beads using the miRNeasy Mini Kit (QIAGEN). After the quality of the total RNA was verified by an Agilent 2100 Bioanalyzer, miRNA microarray experiments were conducted using a single channel for Hy5 on the Exiqon sixth-generation miRCURY LNA miRNA array; these experiments were performed in duplicate. The RNAs and the spike-in miRNAs were treated with calf intestinal alkaline phosphatase (CIP) and then labeled using the Exiqon miRCURY LNA microRNA Array Power Labeling Kit. The denatured, labeled samples were hybridized to miRNA array slides at 56? C. for 16 hours using an Agilent Hybridization SureHyb chamber and gasket slide. The samples were then subjected to a stringent wash protocol. The slides were scanned with a GenePix 4000 microarray scanner (Molecular Devices). The images were captured and analyzed by GAL-file (Exiqon Inc.), which included 1,032 miRNA IDs that had been annotated by miRBase, version 16.0 (microrna.sanger.ac.uk on the World Wide Web). The median of the spot signals after the subtraction of the relative background signals was used as the expression value. The expression levels were calculated using the signals that were above the background level. A probe was retained if the signals in at least half of the samples in at least one condition were 2.5 times above the background signal.
Example 5Results
[0083] At the end of the culture period, tTreg purity was assessed by flow cytometry.
TABLE-US-00001 TABLE 1 Final tTreg product % CD4+ 99 ? 0.4 % CD4+25+ 91 ? 9 % CD127-Foxp3+ 84 ? 5 % Helios+ 88 ? 1 Fold expansion (range) 7475 ? 4362 (3663-14592)
[0084] At the end of the culture period, Rapa/TGF beta iTreg and Teff purity was assessed by flow cytometry.
TABLE-US-00002 TABLE 2 Final Product Rapa/TGF beta iTreg Teff % CD4+ 99 ? 0.2 99 ? 0.2 % CD4+25+ 99 ? 0.2 49 ? 15 % Foxp3 95 ? 3 20 ? 3 (TOTAL) % Foxp3+ 29 ? 6 17 ? 3 % Foxp3++ 66 ? 3 2 ? 0.4 Fold expansion 1077 ? 539 (575-1955) 7785 ? 5785 (3042-17232) (range)
[0085] miRNA microarrays were used to identify differentially expressed miRNA molecules. miRNA was purified from tTreg, Rapa/TGF? iTreg and Teff and quantitated by microarray. Differential miRNA expression between tTreg, R/T iTreg and Teff is shown in
[0086] After CLIP, the miRNAs were co-immunoprecipitated with anti-AGO2 antibodies and then bound to the bridge antibody, anti-rabbit IgG F(c), which links to the protein A agarose beads. The miRNAs and the target mRNAs that associated with the AGO protein were processed using Exiqon miRNA and Affymetrix Gene 430.2 microarrays. This high-throughput assay can screen direct and legitimate miRNA targets in a genome-wide manner and can be used to identify a miRNA-mediated gene regulation network.
Example 6List of miRNAs
[0087] Table 3 below shows the list of miRNAs and the results in an analysis of pairwise significance between Teff and each type of Treg cells. In addition, publications previously describing a role for specific miRNA moieties in Foxp3+ iTreg or tTreg are referenced.
TABLE-US-00003 TABLE 3 miRNAs and Pairwise Significance Pairwise significant miRNA (lower, higher) iTreg tTreg miR-18a-5p (tTreg, Teff), (tTreg, iTreg) miR-20b-3p (tTreg, iTreg) miR-22-3p (iTreg, Teff), (iTreg, tTreg) miR-23b-3p (Teff, iTreg), (tTreg, iTreg) miR-24-2-5p (Teff, tTreg) miR-25-5p (tTreg, Teff) miR-27b-3p (Teff, iTreg), (tTreg, iTreg) miR-29a-3p (Teff, iTreg), (tTreg, iTreg) miR-29b-3p (Teff, iTref) miR-29b-1-5p (Teff, iTreg), (tTreg, iTreg) miR-30e-5p (Teff, tTreg) miR-92a-1-5p (tTreg, Teff) miR-92a-3p (tTreg, iTreg) miR-92b-3p (tTreg, Teff) miR-92b-5p (Teff, tTreg) miR-99b-5p (Teff, iTreg), (tTreg, iTreg) miR-106b-3p (tTreg, Teff) miR-124-1 (iTreg, Teff), (tTreg, Teff) miR-124-2 (iTreg, Teff), (tTreg, Teff) miR-124-3p (iTreg, Teff), (tTreg, Teff) miR-124-3 (iTreg, Teff), (tTreg, Teff) miR-125a-3p (Teff, tTreg) miR-125a-5p (Teff, iTreg), (tTreg, iTreg) Li et al., 2015, Sci Rep, 5: 14615 miR-126-3p (Teff, tTreg), (iTreg, tTreg) Qin et al., Qin et al., 2013, J. 2013, J. Cell Cell Mol Med, Mol Med, 17(2): 252-64 17(2): 252-64 miR-146a-5p (Teff, tTreg) Lu et al., 2010, Cell, 142: 914-29; Bhairavabhotla et al., 2015, Hum Immunol., 77: 201-13 miR-146b-5p (Teff, tTreg), (iTreg, tTreg) Bhairavabhotla et al., 2015, Hum Immunol., 77: 201-13 miR-150-5p (iTreg, Teff), (iTreg, tTreg) miR-151a-5p (Teff, iTreg) miR-181a-5p (iTreg, Teff) miR-181d-5p (Teff, iTreg) miR-181b-5p (iTreg, Teff) miR-181a-2-3p (Teff, iTreg); (Teff, tTreg) miR-182-5p (Teff, tTreg), (iTreg, tTreg) Bothur et al., Chen et al., 2014, 2015, Nat BMC Cancer, 14: 489; Comm, Kelada et al., 2013, 6: 8576 PLoS Path, 9: e1003451 miR-195-5p (Teff, iTreg), (tTreg, iTreg) miR-221-3p (tTreg, Teff), (tTreg, iTreg) miR-222-3p (tTreg, Teff) miR-324-3p (Teff, tTreg) mir-365a (iTreg, Teff), (iTreg, tTreg) miR-422a (Teff, iTreg), (tTreg, iTreg) miR-423-5p (Teff, tTreg), (Teff, iTreg) miR-486-5p (Teff, iTreg), (Teff, tTreg), (iTreg, tTreg) miR-574-3p (Teff, tTreg) miR-619-5p (iTreg, Teff) miR-625-5p (tTreg, Teff), (tTreg, iTreg) mir-1275 (tTreg, Teff) miR-4281 (Teff, tTreg), (iTreg, tTreg) miR-4484 (iTreg, Teff), (tTreg, Teff) miR-4497 (Teff, tTreg) miR-4669 (tTreg, Teff) miR-4730 (iTreg, Teff), (iTreg, tTreg) miR-6126 (iTreg, Teff), (iTreg, tTreg) miR-6514-3p (iTreg, Teff) miR-6716-3p (iTreg, Teff), (iTreg, tTreg) miR-6782-5p (tTreg, Teff), (tTreg, iTreg) mir-6798 (iTreg, Teff), (iTreg, tTreg) miR-6812-5p (tTreg, Teff) let-7b-5p (tTreg, iTreg) let-7c-5p (tTreg, iTreg) let-7e-5p (Teff, iTreg), (tTreg, iTreg)
Example 7Treatment of tTregs and CD4+ T-Cells
[0088] tTreg and CD4+ T-cell cultures, generated as described herein, were frozen on days 14 and 7, respectively. Frozen cells were thawed and re-stimulated with anti-CD3/CD28 mAb-coated Dynabeads (Life Technologies, Carlsbad, Calif.) at 1:3 (cell to bead) ratios in the presence of recombinant IL-2. After 6 days, cultures were washed, re-suspended at 1?10.sup.6 cells/ml, and nanoparticle-encapsulated RNA (50 nM; Scramble/Antagomir, Table 4: EXIQON, Woburn, Mass.) or TRAF6 inhibitor (8 Darmstadt, Germany) or NF-kB inhibitor (PS-1145, 3 ?M or 6 Millennium Pharmaceuticals, Cambridge, Mass.) were added. DMSO were vehicles and used as controls. Cells were cultured another 2 days without further manipulation, and were harvested and assayed as listed. For some experiments, tTreg were kept in culture longer (as indicated) without further antagomir addition.
TABLE-US-00004 TABLE4 SequencesofScramble,AntagomirandRNU44 Name Sequences Scramble TAACACGTCTATACGCCCA (SEQIDNO:1) Antagomir AGCCTATGGAATTCAGTTCTC (SEQIDNO:2) RNU44 CCUGGAUGAUGAUAGCAAAUGCUGACUGAA CAUGAAGGUCUUAAUUAGCUCUAACUGACU (SEQIDNO:3)
Example 8Mice
[0089] NOD/SCID/gamma c?/? mice were purchased from The Jackson Laboratory (Bar Harbor, Me.), and housed in a specific pathogen-free facility in micro-isolator cages. Mice were used at 8-12 weeks. Animal protocols were approved by IACUC at the University of Minnesota.
Example 9Cell Purification and Culture
[0090] For all experiments, non-mobilized peripheral blood (PB) leukapheresis products were purchased from Memorial Blood Center (St. Paul, Minn.). Na?ve human PB tTreg (CD4.sup.+25.sup.+127.sup.?45RA.sup.+) were sort-purified from PB mononuclear cells (PBMNCs) (Ficoll-Hypaque, Amersham Biosciences) in a two-step procedure in which CD25+ cells were initially enriched from PBMNCs by AutoMACS (PosselD2) with GMP grade anti-CD25 microbeads (Miltenyi Biotec). CD25high cells were stained with CD4, CD8, CD25, CD127 and CD45RA and sorted via FACSAria as CD4+, CD8?, CD25high, and CD127?CD45RA+. Note that the bead-bound and fluorochome-conjugated anti-CD25 antibodies recognize different epitopes (Miltenyi Biotec), followed by sorting on a FACSAria (BD Biosciences). Na?ve human CD4 T-cells were sort-purified from the CD25-fraction as CD4+25-127+45RA+.
[0091] Purified na?ve tTreg and CD4 T-cells were stimulated with a K562 cell line engineered to express CD86 and the high-affinity Fc receptor (CD64) (37) (2:1 tTreg/KT), which had been irradiated with 10,000 cGy and incubated with anti-CD3 mAb (Miltenyi Biotec). In some experiments, tTregs were stimulated with KT64/86 cells that were preloaded, irradiated, and frozen (1:1 tTreg/KT). Naive tTreg and CD4 T-cells were cultured in X-Vivo-15 (BioWhittaker, Walkersville, Md.) media supplemented with 10% human AB serum (Valley Biomedical). Recombinant IL-2 (300 IU/mL for Treg, 50 IU/mL for control T-cells; Chiron, Emeryville, Calif.) was added on day 2 and maintained for culture duration. Cultures were maintained at 0.25?10.sup.6 to 0.5?10.sup.6 viable nucleated cells/ml every 2 to 3 days.
Example 10Flow Cytometry, ImageStream and Antibodies
[0092] Human-specific antibodies used for flow cytometry included: CD4 (RPA-T4), CD8 (RPA-T8), CD25 (M-A251), CD45RA (HI100), IFN-gamma, IL-17a, annexin V (PE), 7-AAD (FITC) were purchased from BD Pharmingen, while Foxp3 (clone 249D) was obtained from BioLegend and Ki67 from eBioscience. For cytokine analysis, cells were pre-treated by PMA, ionomycin and brefeldin A for 6 hours and then stained by different cytokine antibodies. The annexin V (PE)/7-AAD (FITC) were applied to assess the apoptosis of tTreg. Acquisition was performed using a LSRII (BD Bioscience) and data were analyzed using FlowJo software (TreeStar) or IDEA (Admin). Nuclear localization of NF-kB was quantitated using an imaging flow cytometer (Imagestream, Amnis Corp; Seattle, Wash.) by intracellularly staining tTreg with anti-NF-kB (vendor) and, after washing, incubating with DRAQS for 15 minutes at 10 ?M final concentration.
Example 11Anti- and Pro-Apoptotic Gene Expression Analysis and TAQMAN? Low Density Arrays (TLDAs)
[0093] RNA was extracted from cell pellets using RNeasy Mini Kit with on-column DNase digestion (Qiagen; Hilden, Germany). cDNA synthesis was performed as described in the Expression Analysis Technical Manual (Affymetrix; Santa Clara, Calif.). GAPDH was used as control gene and related gene expression (Bcl-2, Mcl-1, Bcl-xL, BID and BAX; all from IDT, Coralville, Iowa), was analyzed on an Applied Biosystems 7500 Real-Time PCR System using Taqman Universal PCR Master Mix #4304437 and Assay on Demand primer/probe kits (Applied Biosystems; Waltham, Mass.). For TLDA assay, TLDA v2.0 was performed on the 7900HT real-time PCR system (Applied Biosystems) according to the manufacturer's protocol. Average delta CT was acquired from the results for further analysis. PCR cycling conditions were performed as follows: 95? C. for 15 s and 60? C. for 1 min, 40 cycles and then 95? C. for 10 min. To normalize RNA input, Human RNU44 (Table 4) small RNA was used as an internal control.
Example 12miRNA Target Prediction and Luciferase Reporter Assay
[0094] Potential miRNA targets were sorted by utilizing miRNA prediction software TargetScan (targetscan.org on the World Wide Web), MIRDB (mirdb.org on the World Wide Web) and microRNA (microrna.org on the World Wide Web). For the luciferase reporter assay, the pGL3 firefly luciferase reporter plasmids with the wild-type or mutated (mut) 3 UTR sequences of TRAF6 (Table 5) were transiently transfected into HEK293 cells along with 25 nM miR-146b-5p precursor or negative control precursor and a Renilla luciferase reporter for normalization. After two days, the luciferase activities were measured by QT-PCR. Based on the cells transfected by pGL3 control vector, the mean of the results was set as 100%. The data are mean and standard deviation (SD) of separate transfections.
TABLE-US-00005 TABLE5 WildTypeandMutated3UTRSequencesofTRAF6 Name Sequences Wild CTTCAGTCTTTTTGTAGTATTATATGTAATATATTAAAAGTGAA AATCACTACCGCCTTGTGCTAGTGCCCTCGAGAAGAGTTATTGC TCTAGAAAGTTGAGTTCTCATTTTTTTAACCTGTTATAGATTTC AGAGGATTTGAACCATAATCCTTGGAAAACTTAAGTTCTCATTC ACCCCAGTTTTTCCTCCAGGTTGTTACTAAGGATATTCAGGGAT GAGTTTAAACCCTAAATATAACCTTAATTATTTAGTGTAAACAT GTCTGTTGA (SEQIDNO:4) Mut CTTCAGTCTTTTTGTAGTATTATATGTAATATATTAAAAGTGAA AATCACTACCGCCTTGTGCTAGTGCCCTCGAGAAGAGTTATTGC TCTAGAAAGTTGCTGGAGACTTTTTTTAACCTGTTATAGATTTC AGAGGATTTGAACCATAATCCTTGGAAAACTTACTGGAGACTTC ACCCCAGTTTTTCCTCCAGGTTGTTACTAAGGATATTCAGGGAT GAGTTTAAACCCTAAATATAACCTTAATTATTTAGTGTAAACAT GTCTGTTGA (SEQIDNO:5)
Predicted miR-146b binding sequence is underlined
Example 13Suppression Assays
[0095] The in vitro-suppressive capacity of expanded tTregs was assessed with a carboxy fluorescein succinimidyl ester (CFSE) inhibition assay as previously published (Hippen et al., Blood, 2008, 112(7):2847-57). Briefly, PBMNCs were purified, labeled with CFSE (Invitrogen), and stimulated with anti-CD3 mAb-coated beads (Dynal)?cultured tTreg (1:2 to 1:32 tTregs/PBMNCs). On day 4, cells were stained with antibodies to CD4 and CD8, and suppression was determined from the Division Index (FlowJo, TreeStar). nTregs suppressed CD4 and CD8 T cell responses equivalently and only CD8 data are presented.
Example 14Xenogeneic GVHD Model
[0096] A published xenogeneic GVHD model was used (Hippen et al., Sci. Transl. Med., 2011, 3(83):83ra41). Briefly, NOD/Scid/?c?/? mice between 8-12 weeks old were housed in a pathogen-free facility in micro-isolator cages. On day 0, mice were irradiated with 50 cGy. Human PBMNCs (15?10.sup.6) were injected with or without expanded tTregs (15?10.sup.6). To document PBMC-associated peripheral T-cell expansion, animals were bled (10-40 ?L), red blood cells lysed, and tTreg and PBMC subsets were enumerated by flow cytometry by staining with mAbs to human CD4, Foxp3, CD8, CD45, and HLA-A2 (to differentiate between PBMC and tTreg) and acquired with a known number of counting beads (Sigma-Aldrich). Mice were assessed for signs of GVHD daily, weighed thrice weekly, and human cells in blood quantitated by flow cytometry on the specified dates.
Example 15Statistical Analyses
[0097] RT-PCR data were analyzed using SDS v2.3 software. Survival data were analyzed using Prism 5 (Mantel-Cox). Other data were analyzed by analysis of variance (ANOVA) or Student t test. Probability (P) values less than or equal to 0.05 were considered statistically significant.
Example 16Identification of Human tTreg-Specific miRNA
[0098] Changes in miRNA expression are observed during T-cell differentiation (Monticelli et al., Genome Biol., 2005, 6(8):R71). To identify potential human tTreg-specific miRNA, miRNA expression was compared between in vitro expanded na?ve, CD4 T-cells (CD4.sup.+25.sup.?127.sup.+45RA.sup.+; control T cells) and na?ve, tTregs (CD4.sup.+25.sup.++127.sup.?45RA.sup.+). TLDA was utilized to reveal differential miRNA expression between human na?ve tTregs and CD4 T-cells. RNU44, a ubiquitously expressed small nucleolar RNA, was used to normalize expression between the cell types. After analyzing 768 miRNAs by ranking fold expression, the top 10 differential miRNAs between tTreg and CD4 T cells were chosen for further analysis (
[0099] miR-146b-5p required deeper investigation. While some reports found miR-146a-5p positively regulates tTreg function in mice (Lu et al., Cell, 2010, 142(6):914-29), others found miR-146a and/or 146b knock-down had no impact on human Treg function (Bhairavabhotla et al., Hum. Immunol., 2016, 77(2):201-13). Therefore, it was hypothesized that miR-146b-5p might have an opposite role in controlling tTreg function compared to miR-146a-5p. To confirm the higher expression in tTreg cells, differential expression of miR-146b-5p was validated by quantitative qRT-PCR (
Example 17Knock-Down of miR-146b-5p Enhances FoxP3 Expression, Viability, Expansion and Suppressive Function In Vitro
[0100] To determine whether miR-146b-5p affected human tTreg phenotype or suppressive function, tTregs were incubated with nanoparticle-encapsulated miR-146b-5p antagomir as described in the methods. Scrambled miRNA was utilized as a control. miR-146b-5p knockdown efficiency was ?95% (
[0101] Previous murine studies suggested that miR-146a-5p was involved in Thl responses and its deficiency led to dysregulated IFN-gamma production (Lu et al., Cell, 2010, 142(6):914-29; Stickel et al., Blood, 2014, 124(16):2586-95). However, few expanded human tTregs expressed IFN-gamma under these conditions, and expression was not affected by miR-146b-5p antagomir treatment (
Example 18TRAF6 is a Direct Target of miR-146b-5p and Knock-Down of miR-146b-5p Increases TRAF6 Expression in Human tTregs
[0102] To identify potential miR-146b targets, miRNA prediction software (targetscan.org, MIRDB and microRNA.org) was utilized to reveal the potential targeted miRNAs. After sorting top ten predicted miRNAs in each software, it was found that TRAF6 was the one mRNA involved tTreg function with highest possibility (
[0103] It was next asked whether miR-146b-5p antagomir treatment affected TRAF6 expression in expanded tTregs.
Example 19Inhibition of TRAF6 Signaling Impairs Human tTreg Expansion, Foxp3 Expression and Suppressive Function
[0104] Conditional knockout (cKO) of TRAF6 in murine Treg resulted in decreased Foxp3 stability and loss of in vivo suppressive function (Muto et al., PLoS One, 2013, 8(9):e74639). It was sought to determine if TRAF6 plays a similar role in human tTreg. In vitro expanded tTreg were treated with a TRAF6 signaling inhibitor (6877002) (Chatzigeorgiou et al., PNAS USA, 2014, 111(7):2686-91) for the final 2 days of culture. Similar to reports for murine tTreg, inhibition of TRAF6 signaling in human tTreg cultures decreased Foxp3 protein expression both at a population (68.0%?6.6% vs 46.8%?6.8%, P<0.05,
Example 20Knock Down of miR-146b-5p Increases Nuclear Localization of NF-kB that is Key in Controlling tTreg Function
[0105] TRAF6 is critical for TCR-mediated activation of NF-kB, and acts by ubiquitinylating TAK1, leading to activation of IKK and destruction of IkB, which allows NF-kB to translocate to the nucleus. To determine whether miR-146 antagomir enhanced NF-kB nuclear translocation, in vitro expanded tTreg were left untreated or treated for 2 days with scrambled RNA or miR-146b-5p antagomir, stained for CD4, NF-kB and DRAQS (a nuclear marker) and analyzed using imaging flow cytometry. Similarity feature was acquired to measure quantify translocation. By this method, a more composited/similar image by two colors means more translocation to nucleus. NF-kB in yellow and DRAQS in red are shown in
[0106] NF-kB activation is critical for the development of tTreg in mice and positively regulates FoxP3 expression (Guckel et al., PLoS One, 2011, 6(5):e20003; Barbarulo et al., J. Immunol., 2011, 186(11):6199-206). To address the role of NF-kB in human tTreg, an inhibitor of NF-kB pathway (PS1145) was added for the final 2 days of culture (O'Shaughnessy et al., Am. J. Transplant, 2009, 9(3):452-62). NF-kB inhibition decreased Foxp3 expression in a dose-dependent manner, leading to significantly decreased in vitro suppressive function (
Example 21Antagomir-Treated tTreg Show Transcriptional Signs of NF-kB Activation
[0107] NF-kB activation in T cells results in a series of transcriptional changes that up-regulates metabolism, cell cycle machinery and pro-survival pathways. To determine whether the basal increase in NF-kB nuclear localization observed in antagomir-treated tTreg had transcriptional consequences, the expression of known NF-kB-responsive genes was compared in antagomir-treated tTreg with those left untreated or treated with scramble RNA. One NF-kB target gene, c-myc, is a crucial regulator of T cell glycolysis, and promotes T cell-activation-induced growth and proliferation (Racker et al., PNAS USA, 1985, 82(11):3535-8; Wang et al., Immunity, 2011, 35(6):871-82). Thymocytes from miR-146b transgenic mice have defective IkB degradation following TCR stimulation, and attenuated induction of c-myc (Burger et al., Blood, 2014, 123(26):4089-100; Wei et al., Nat. Immunol., 2016, 17(3):277-85). As shown in
[0108] Together, these data show that miR-146b-5p antagomir treatment of tTreg results in NF-kB activation and expression of pro-survival genes that increase tTreg in vitro expansion and suppressive function.
Example 22miR-146-5p Antagomir Treatment Significantly Increases Human tTreg Efficacy and Persistence in a Xenogeneic Model of GVHD
[0109] Since miR-146b knock down enhances tTreg function, expansion and survival in vitro, we sought to determine whether miR-146b-5p antagomir-treated tTregs would be more effective at preventing xenogeneic GVHD. Ex vivo expanded tTregs (15?10.sup.6) were untreated or treated with scramble or antagomir for 2 days, then injected with allogeneic PBMC (15?10.sup.6) into NSG mice. As shown in
[0110] It was previously shown that adoptive transfer of tTreg ameliorates xGVHD-associated pathologies, weight loss, clinical scores and expansion of human T-cells in peripheral blood (PB). All cohorts of tTreg treated mice showed significantly decreased weight loss (P<0.05) between days 15 and 22, and decreased clinical scores between days 13 and 22 (
[0111] Peripheral expansion of human T-cells on day 14-20 correlates inversely with survival. To quantitate the ability of each Treg cohort to minimize expansion, HLA-A2 mismatching was used to distinguish GVHD-causing PBMC (HLA-A2+) from tTreg (HLA-A2-). Mice were bled on day 14 and the total number of PBMC-derived cells/?1 of blood enumerated (
[0112] Previous studies found that tTreg persistence correlates with efficacy. We tested whether the enhanced survival of antagomir-treated tTreg seen in vitro might affect their persistence in vivo on day 7, 10 and 14. We have shown that, in both our xenogeneic GVHD model and in patients receiving third-party expanded tTreg, that tTreg are difficult to detect in PB beyond day 10-12. Not surprisingly, the cell number on day 10 was hard to detect and the number of tTreg observed on day 14 was not significantly higher than the PBMC only controls (which should have no HLA-A2+ cells) (data not shown). However, mice injected with miR-146b antagomir-treated tTregs had higher absolute numbers of circulating CD4+ HLA-A2? cells on day 7 (
[0113] Thus, knock down of miR-146b-5p in tTregs increases in vivo efficacy and can be exploited to improve the efficacy of adoptive Treg therapy for the prevention of human GVHD.
[0114] These results suggest a new target to increase tTreg efficiency based on miRNA level. These observations include: (1) both miR-146a and miR-146b-5p are highly differentially expressed in tTreg cells compared to control T-cells but these results suggested that, in contrast to miR-146a, miR-146-5p negatively regulates FoxP3 expression, expansion and tTreg function in vitro; (2) TRAF6, which plays an essential role in tTreg expansion and function, is a direct target of miRNA-146b-5p in human tTreg cells; (3) NF-kB pathway is vital for FoxP3 maintenance, miR-146b-5p antagomir treated tTreg cells show enhanced nuclear localization of NF-kB; (4) knock down of miRNA-146b-5p prolongs tTreg survival by regulating NF-kB-related apoptosis/anti-apoptosis genes; and (5) antagomir treatment enhances tTreg efficacy and persistence in a xenogeneic model of GVHD. In summary, knock down of miR-146b-5p in tTregs increases in vivo efficacy and can be exploited to improve the efficacy of adoptive Treg therapy for the prevention of human GVHD.
Example 23Antagomirs Against Additional miRs
[0115]
[0116]
[0117] It is to be understood that, while the methods and compositions of matter have been described herein in conjunction with a number of different aspects, the foregoing description of the various aspects is intended to illustrate and not limit the scope of the methods and compositions of matter. Other aspects, advantages, and modifications are within the scope of the following claims.
[0118] Disclosed are methods and compositions that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that combinations, subsets, interactions, groups, etc. of these methods and compositions are disclosed. That is, while specific reference to each various individual and collective combinations and permutations of these compositions and methods may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular composition of matter or a particular method is disclosed and discussed and a number of compositions or methods are discussed, each and every combination and permutation of the compositions and the methods are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed.