METHODS FOR THE PRODUCTION OF RHAMNOSYLATED FLAVONOIDS

Abstract

A method for the production of rhamnosylated flavonoids comprising the steps of contacting/incubating a glycosyl transferase with a flavonoid and obtaining a rhamnosylated flavonoid. In addition, glycosyl transferases suitable for use in such methods and kits comprising said glycosyl transferases.

Claims

1. A method for the production of rhamnosylated flavonoids, the method comprising (a) contacting/incubating a glycosyl transferase with a flavonoid; and (b) obtaining a rhamnosylated flavonoid, wherein the glycosyl transferase (a) comprises the amino acid sequence of SEQ ID NO: 1; (b) comprises amino acid sequences having at least 80% sequence identity with SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 56, 58, 61; (c) is encoded by a polynucleotide comprising the nucleic acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 37, 38, 57, 59, 60, 62, or 63; (d) is encoded by a polynucleotide having at least 80% sequence identity with SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 37, 38, 57, 59, 60, 62, or 63; or (e) is encoded by a polynucleotide hybridizable under stringent conditions with a polynucleotide comprising SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 37, 38, 57, 59, 60, 62, or 63, and wherein the flavonoid is a compound or a solvate of the following Formula (I) ##STR00034## wherein: is a double bond or a single bond; L is ##STR00035## R.sup.1 and R.sup.2 are independently selected from hydrogen, C.sub.1-5 alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, R.sup.aR.sup.b, R.sup.aOR.sup.b, R.sup.aOR.sup.d, R.sup.aOR.sup.aOR.sup.b, R.sup.aOR.sup.aOR.sup.d, R.sup.aSR.sup.b, R.sup.aSR.sup.aSR.sup.b, R.sup.aNR.sup.bR.sup.b, R.sup.a-halogen, R.sup.a(C.sub.1-5 haloalkyl), R.sup.aCN, R.sup.aCOR.sup.b, R.sup.aCOOR.sup.b, R.sup.aOCOR.sup.b, R.sup.aCONR.sup.bR.sup.b, R.sup.aNR.sup.bCOR.sup.b, R.sup.aSO.sub.2NR.sup.bR.sup.b and R.sup.aNR.sup.bSO.sub.2R.sup.b; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R.sup.c; wherein R.sup.2 is different from OH; or R.sup.1 and R.sup.2 are joined together to form, together with the carbon atom(s) that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents R.sup.e; wherein each R.sup.e is independently selected from C.sub.1-5 alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, R.sup.aR.sup.b, R.sup.aOR.sup.b, R.sup.aOR.sup.d, R.sup.aOR.sup.aOR.sup.b, R.sup.aOR.sup.aOR.sup.d, R.sup.aSR.sup.b, R.sup.aSR.sup.aSR.sup.b, R.sup.aNR.sup.bR.sup.b, R.sup.a-halogen, R.sup.a(C.sub.1-5 haloalkyl), R.sup.aCN, R.sup.aCOR.sup.b, R.sup.aCOOR.sup.b, R.sup.aOCOR.sup.b, R.sup.aCONR.sup.bR.sup.b, R.sup.aNR.sup.bCOR.sup.b, R.sup.aSO.sub.2NR.sup.bR.sup.b and R.sup.aNR.sup.bSO.sub.2R.sup.b; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R.sup.c; R.sup.4, R.sup.5 and R.sup.6 are independently selected from hydrogen, C.sub.1-5 alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, R.sup.aR.sup.b, R.sup.aOR.sup.b, R.sup.aOR.sup.d, R.sup.aOR.sup.aOR.sup.b, R.sup.aOR.sup.aOR.sup.d, R.sup.aSR.sup.b, R.sup.aSR.sup.aSR.sup.b, R.sup.aNR.sup.bR.sup.b, R.sup.a-halogen, R.sup.a(C.sub.1-5 haloalkyl), R.sup.aCN, R.sup.aCOR.sup.b, R.sup.aCOOR.sup.b, R.sup.aOCOR.sup.b, R.sup.aCONR.sup.bR.sup.b, R.sup.aNR.sup.bCOR.sup.b, R.sup.aSO.sub.2NR.sup.bR.sup.b and R.sup.aNR.sup.bSO.sub.2R.sup.b; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R.sup.c; or alternatively, R.sup.4 is selected from hydrogen, C.sub.1-5; alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, R.sup.aR.sup.b, R.sup.aOR.sup.b, R.sup.aOR.sup.d, R.sup.aOR.sup.aOR.sup.b, R.sup.aOR.sup.aOR.sup.d, R.sup.aSR.sup.b, R.sup.aSR.sup.aSR.sup.b, R.sup.aNR.sup.bR.sup.b, R.sup.a-halogen, R.sup.a(C.sub.1-5 haloalkyl), R.sup.aCN, R.sup.aCOR.sup.b, R.sup.aCOOR.sup.b, R.sup.aOCOR.sup.b, R.sup.aCONR.sup.bR.sup.b, R.sup.aNR.sup.bCOR.sup.b, R.sup.aSO.sub.2NR.sup.bR.sup.b and R.sup.aNR.sup.bSO.sub.2R.sup.b; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R.sup.c; and R.sup.5 and R.sup.6 are joined together to form, together with the carbon atoms that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents R.sup.c; or alternatively, R.sup.4 and R.sup.5 are joined together to form, together with the carbon atoms that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents R.sup.c; and R.sup.6 is selected from hydrogen, C.sub.1-5 alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, R.sup.aR.sup.b, R.sup.aOR.sup.b, R.sup.aOR.sup.d, R.sup.aOR.sup.aOR.sup.b, R.sup.aOR.sup.aOR.sup.d, R.sup.aSR.sup.b, R.sup.aSR.sup.aSR.sup.b, R.sup.aNR.sup.bR.sup.b, R.sup.a-halogen, R.sup.a(C.sub.1-5 haloalkyl), R.sup.aCN, R.sup.aCOR.sup.b, R.sup.aCOOR.sup.b, R.sup.aOCOR.sup.b, R.sup.aCONR.sup.bR.sup.b, R.sup.aNR.sup.bCOR.sup.b, R.sup.aSO.sub.2NR.sup.bR.sup.b and R.sup.aNR.sup.bSO.sub.2R.sup.b; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R.sup.c; each R.sup.a is independently selected from a single bond, C.sub.1-5 alkylene, C.sub.2-5 alkenylene, arylene and heteroarylene; wherein said alkylene, said alkenylene, said arylene and said heteroarylene are each optionally substituted with one or more groups R.sup.c; each R.sup.b is independently selected from hydrogen, C.sub.1-5 alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R.sup.c, each R.sup.c is independently selected from C.sub.1-5 alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, (C.sub.0-3 alkylene)-OH, (C.sub.0-3 alkylene)-OR.sup.d, (C.sub.0-3 alkylene)-O(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-O-aryl, (C.sub.0-3 alkylene)-O(C.sub.1-5 alkylene)-OH, (C.sub.0-3 alkylene)-O(C.sub.1-5 alkylene)-OR.sup.d, (C.sub.0-3 alkylene)-O(C.sub.1-5 alkylene)-O(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-SH, (C.sub.0-3 alkylene)-S(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-S-aryl, (C.sub.0-3 alkylene)-S(C.sub.1-5 alkylene)-SH, (C.sub.0-3 alkylene)-S(C.sub.1-5 alkylene)-S(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-NH.sub.2, (C.sub.0-3 alkylene)-NH(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-N(C.sub.1-5 alkyl)(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-halogen, (C.sub.0-3 alkylene)-(C.sub.1-5 haloalkyl), (C.sub.0-3 alkylene)-CN, (C.sub.0-3 alkylene)-CHO, alkylene)-CO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-COOH, (C.sub.0-3 alkylene)-COO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-OCO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-CONH.sub.2, (C.sub.0-3 alkylene)-CONH(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-CON(C.sub.1-5 alkyl)(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-NHCO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-N(C.sub.1-5 alkyl)-CO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-SO.sub.2NH.sub.2, (C.sub.0-3 alkylene)-SO.sub.2NH(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-SO.sub.2N(C.sub.1-5 alkyl)(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-NHSO.sub.2(C.sub.1-5 alkyl), and (C.sub.0-3 alkylene)-N(C.sub.1-5 alkyl)-SO.sub.2(C.sub.1-5 alkyl); wherein said alkyl, said alkenyl, said alkynyl and the alkyl or alkylene moieties comprised in any of the aforementioned groups R.sup.c are each optionally substituted with one or more groups independently selected from halogen, CF.sub.3, CN, OH, OR.sup.d, OC.sub.1-4 alkyl and SC.sub.1-4 alkyl; each R.sup.d is independently selected from a monosaccharide, a disaccharide and an oligosaccharide; and R.sup.3 is rhamnoslyated by said method.

2. The method of claim 1, wherein the flavonoid is contacted/incubated with said glycosyl transferase at a final concentration above its solubility in aqueous solutions.

3. The method of claim 1, wherein the method further comprises a step of providing a host cell transformed with said glycosyl transferase.

4. The method of claim 3, wherein said host cell is incubated prior to contacting/incubating said host cell with a flavonoid.

5. The method of claim 3, wherein said host cell is Escherichia coli.

6. The method of claim 1, wherein contacting and/or incubating is/are done at a temperature from about 20 C. to about 37 C., preferably at a temperature from about 24 C. to about 30 C., and more preferably at a temperature of about 28 C.

7. The method of claim 1, wherein contacting/incubating is/are done at a pH of about 6.5 to about 8.5, preferably at a pH of about 7 to about 8, and more preferably at a pH of about 7.4.

8. The method of claim 1, wherein contacting/incubating is/are done at a concentration of dissolved oxygen (DO) of about 30% to about 50%.

9. The method of claim 1, wherein, when the concentration of dissolved oxygen is above about 50%, a nutrient is added, preferably wherein the nutrient is glucose, sucrose, maltose or glycerol.

10. The method of claim 1, wherein contacting/incubating is/are done in a complex nutrient medium.

11. The method of claim 1, wherein contacting/incubating is/are done in minimal medium.

12. The method of claim 3, wherein the method further comprises a step of harvesting said incubated host cell prior to contacting/incubating said host cell with a flavonoid.

13. The method of claim 12, wherein harvesting is done using a membrane filtration method, preferably a hollow fibre membrane device, or centrifugation.

14. The method of claim 12, wherein the method further comprises solubilization of the harvested host cell in a buffer prior to contacting/incubating said host cell with a flavonoid, preferably wherein the buffer is phosphate-buffered saline (PBS), preferably supplemented with a carbon and energy source, preferably glycerol, glucose, maltose, and/or sucrose, and growth additives, preferably vitamins including biotin and/or thiamin.

15. The method of claim 1, wherein the flavonoid is a flavanone, flavone, isoflavone, flavonol, flavanonol, chalcone, flavanol, anthocyanidine, aurone, flavan, chromene, chromone or xanthone.

16. The method of claim 1, wherein rhamnosylating is the addition of O-(rhamnosyl) at position R.sup.3 of Formula (I) of claim 1, wherein said rhamnosyl is substituted at one or more of its OH groups with one or more groups independently selected from C.sub.1-5 alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, a monosaccharide, a disaccharide and an oligosaccharide.

17. The method of claim 1, wherein the flavonoid is contacted/incubated with said glycosyl transferase at a final concentration above about 200 M.

18. The method of claim 1, wherein the flavonoid is contacted/incubated with said glycosyl transferase at a final concentration above about 500 M.

19. The method of claim 1, wherein the flavonoid is contacted/incubated with said glycosyl transferase at a final concentration above about 1 mM.

20. The method of claim 1, wherein contacting and/or incubating is/are done at a temperature from about 24 C. to about 30 C., preferably at a temperature of about 28 C.

Description

[0187] The present invention is further described by reference to the following non-limiting figures and examples.

[0188] The Figures show:

[0189] FIG. 1: Determination of solubility of naringenin-5-O--L-rhamnoside (NR1) in water. Defined concentrations of NR1 were 0.22 m-filtered before injection to HPLC. Soluble concentrations were calculated from peak areas by determined regression curves.

[0190] FIG. 2: HPLC-chromatogram of naringenin-5-O--L-rhamnoside

[0191] FIG. 3: HPLC-chromatogram of naringenin-4-O--L-rhamnoside

[0192] FIG. 4: HPLC-chromatogram of prunin (naringenin-7-O--D-glucoside)

[0193] FIG. 5: HPLC-chromatogram of homoeriodictyol-5-O--L-rhamnoside (HEDR1)

[0194] FIG. 6: HPLC-chromatogram of HEDR3 (4:1 molar ratio of homoeriodictyol-7-O--L-rhamnoside and homoeriodictyol-4-O--L-rhamnoside)

[0195] FIG. 7: HPLC-chromatogram of homoeriodictyol-4-O--D-glucoside (HED4Glc)

[0196] FIG. 8: HPLC-chromatogram of hesperetin-5-O--L-rhamnoside (HESR1)

[0197] FIG. 9: HPLC-chromatogram of hesperetin-3-O--L-rhamnoside (HESR2)

[0198] FIG. 10: UV.sub.254-chromatogram of hesperetin bioconversion 141020, sample injection volume was 1.2 L applied by the pumping system

[0199] FIG. 11: ESI-TOF negative mode MS-analysis of fraction 3 from hesperetin bioconversion_141020

[0200] FIG. 12: ESI-TOF negative mode MS-analysis of fraction 6 from hesperetin bioconversion_141020

[0201] FIG. 13: prepLC UV.sub.254-chromatogram of PFP-HPLC of fraction 3 bioconversion_141020; the main peak (HESR1) between 3.1 min and 3.5 min was HESR1.

[0202] FIG. 14: ESI-TOF negative mode MS-analysis of fraction 3 from 140424_Naringenin-PetC

[0203] FIG. 15: ESI-TOF negative mode MS-analysis of fraction 5 from 140424_Naringenin-PetC

[0204] FIG. 16: UV-chromatogram of conversion after 24 h in bioreactor unit 1 150603_Naringenin-PetC

[0205] FIG. 17: UV.sub.330 chromatogram of an extract from a naringenin biotransformation with PetD

[0206] FIG. 18: UV.sub.330 chromatogram of an extract from a naringenin biotransformation with PetC

[0207] FIG. 19: UV 210-400 nm absorbance spectra of N5R peaks from figures U1 (middle) and U2 (dark) vs. prunin, the naringenin-7-O--D-glucoside (light).

[0208] FIG. 20: UV 210-400 nm absorbance spectra of GTF product peak Rf 0.77 (dark) vs. prunin (light).

[0209] FIG. 21: UV.sub.330 chromatogram of an extract from a naringenin biotransformation with PetF

[0210] FIG. 22: Cytotoxicity of flavonoid-5-O--L-rhamnosides on normal human epidermal keratinocytes

[0211] FIG. 23: antiinflammatory, protecting, and stimulating activities of flavonoid-5-O--L-rhamnosides on normal human epidermal keratinocytes, normal human dermal fibroblasts, and normal human epidermal melanocytes

EXAMPLES

[0212] The compounds described in this section are defined by their chemical formulae and their corresponding chemical names. In case of conflict between any chemical formula and the corresponding chemical name indicated herein, the present invention relates to both the compound defined by the chemical formula and the compound defined by the chemical name

Part A: Preparation of 5-O-Rhamnosylated Flavonoids

Example A1Preparation of Media and Buffers

[0213] The methods of the present invention can be used to produce rhamnosylated flavonoids, as will be shown in the appended Examples.

[0214] Several growth and biotransformation media were used for the rhmanoslyation of flavonoids. Suitable media thus include: Rich Medium (RM) (Bacto peptone (Difco) 10 g, Yeast extract 5 g, Casamino acids (Difco) 5 g, Meat extract (Difco) 2 g, Malt extract (Difco) 5 g, Glycerol 2 g, MgSO.sub.47 H.sub.2O 1 g, Tween 80 0.05 g and H.sub.2O ad 1000 mL at a final pH of about 7.2); Mineral Salt Medium (MSM) (Buffer and mineral salt stock solution were autoclaved. After the solutions had cooled down, 100 mL of each stock solution were joined and 1 mL vitamin and 1 mL trace element stock solution were added. Then sterile water was added to a final volume of 1 L. The stock solutions were: Buffer stock solution (10) of Na.sub.2HPO.sub.4 70 g, KH.sub.2PO.sub.4 20 g and H.sub.2O ad 1000 mL; Mineral salt stock solution (10) of (NH.sub.4).sub.2SO.sub.4 10 g, MgCl.sub.26 H.sub.2O 2 g, Ca(NO.sub.3).sub.24 H.sub.2O 1 g and H.sub.2O ad 1000 mL; Trace element stock solution (1000) of EDTA 500 mg, FeSO.sub.47 H.sub.2O 300 mg, CoCl.sub.26 H.sub.2O 5 mg, ZnSO.sub.47 H.sub.2O 5 mg, MnCl.sub.24 H.sub.2O 3 mg, NaMoO.sub.42 H.sub.2O 3 mg, NiCl.sub.26 H.sub.2O 2 mg, H.sub.3BO.sub.3 2 mg, CuCl.sub.22 H.sub.2O 1 mg and H.sub.2O ad 200 mL. The solution was sterile filtered. Vitamin stock solution (1000) of Ca-Pantothenate 10 mg, Cyanocobalamine 10 mg, Nicotinic acid 10 mg, Pyridoxal-HCl 10 mg, Riboflavin 10 mg, Thiamin-HCl 10 mg, Biotin 1 mg, Folic acid 1 mg, p-Amino benzoic acid 1 mg and H.sub.2O ad 100 mL. The solution was sterile filtered); Lysogeny Broth (LB) (Yeast extract 5 g, Peptone 10 g, NaCl 5 g and H.sub.2O ad 1000 mL); Terrific Broth (TB) (casein 12 g, yeast extract 24 g, K.sub.2HPO.sub.4 12.5 g, KH.sub.2PO.sub.4 2.3 g and H.sub.2O ad 1000 mL at pH 7.2). In some experiments, in particular when the concentration of dissolved oxygen (DO) was above about 50%, nutrients were added to the solution. This was done using a feed solution of Glucose 500 g, MgSO.sub.4 10 g, thiamine 1 mg and H.sub.2O ad 1000 mL. In some experiments, in particular when cells expressing glycosyl transferase were harvested prior to starting the production of rhamnosylated flavonoids, cells were resuspended in a buffer solution, in particular phosphate buffer saline (PBS). The solution was prepared using NaCl 150 mM, K.sub.2HPO.sub.4/KH.sub.2PO.sub.4 100 mM at a pH of 6.4 to 7.4.

Example A2 Glycosyl Transferases Used for the Production of Rhamnosylated Flavonoids

[0215] Several different glycosyl transferases were used in the methods of the present invention to produce rhamnosylated flavonoids. In particular, the glycosyltransferases (GTs) used for flavonoid rhamnoside production were [0216] 1. GTC, a GT derived metagenomically (AGH18139), preferably having an amino acid sequence as shown in SEQ ID NO:3, encoded by a polynucleotide as shown in SEQ ID NO:4. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO:27. [0217] 2. GTD, a GT from Dyadobacter fermentans (WP_015811417), preferably having an amino acid sequence as shown in SEQ ID NO:5, encoded by a polynucleotide as shown in SEQ ID NO:6. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO:28. [0218] 3. GTF, a GT from Fibrisoma limi (WP_009280674), preferably having an amino acid sequence as shown in SEQ ID NO:7, encoded by a polynucleotide as shown in SEQ ID NO:8. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO:29. [0219] 4. GTS from Segetibacter koreensis (WP_018611930) preferably having an amino acid sequence as shown in SEQ ID NO:9, encoded by a polynucleotide as shown in SEQ ID NO:10. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO:30. [0220] 5. Chimera 3 with AAs 1 to 316 of GTD and AAs 324 to 459 of GTC preferably having an amino acid sequence as shown in SEQ ID NO: 58, encoded by a polynucleotide as shown in SEQ ID NO: 59. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO: 60. [0221] 6. Chimera 4 with AAs 1 to 268 of GTD and AAs 276 to 459 of GTC preferably having an amino acid sequence as shown in SEQ ID NO: 61, encoded by a polynucleotide as shown in SEQ ID NO: 62. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO: 63. [0222] 7. Chimera 1 frameshift with AAs 1 to 234 of GTD and AAs 242 to 443 of GTC preferably having an amino acid sequence as shown in SEQ ID NO: 56, encoded by a polynucleotide as shown in SEQ ID NO: 57.

[0223] The GT genes were amplified by PCR using respective primers given in Table A1. Purified PCR products were ligated into TA-cloning vector pDrive (Qiagen, Germany) Chemically competent E. coli DH5 were transformed with ligation reactions by heat shock and positive clones verified by blue/white screening after incubation. GT from Segetibacter koreensis was directly used as codon-optimized nucleotide sequence.

[0224] Chimera 3 and chimera 4 were created from the codon-optimized nucleotide sequences from GTD and GTC, while chimera 1 was constructed from the SEQ ID NO:4 and SEQ ID NO:6. Chimera 1 was created according to the ligase cycling reaction method described by Kok (2014) ACS Synth Biol 3(2):97-106. Thus, the two nucleotide sequences of each chimeric fragment were amplified via PCR and were assembled using a single-stranded bridging oligo which is complementary to the ends of neighboring nucleotide parts of both fragments. A thermostable ligase was used to join the nucleotides to generate the full-length sequence of the chimeric enzyme.

[0225] Chimera 3 and chimera 4 were constructed according to the AQUA cloning method described by Beyer (2015) PLoS ONE 10(9):e0137652. Therefore, the nucleotide fragments were amplified with complementary regions of 20 to 25 nucleotides, agarose-gel purified, mixed in water, incubated for 1 hour at room temperature and transformed into chemically competent E. coli DH5. The primers used for the chimera construction are listed in Table A2.

TABLE-US-00002 TABLEA1 PrimersusedfortheamplificationoftheGTgenesbyPCR Enzyme Primername Sequence(5.fwdarw.3) GTC GTC-NdeI-for CATATGAGTAATTTATTTTCTTCACAAAC GTC-BamHI-rev GGATCCTTAGTATATCTTTTCTTCTTC GTD GTF_XhoI_for CTCGAGATGACGAAATACAAAAATGAAT GTF_BamHI_rev GGATCCTTAACCGCAAACAACCCGC GTF GTL_XhoI_for CTCGAGATGACAACTAAAAAAATCCTGTT GTL_BamHI_rev GGATCCTTAGATTGCTTCTACGGCTT GTS GTSopt_pET_fw GGGAATTCCATATGATGAAATATATCAGCTCCATTCAG GTSopt_pET_rv CGGGATCCTTAAACCAGAACTTCGGCCTGATAG

TABLE-US-00003 TABLEA2 Primersusedfortheconstructionofchimericenzymes Enzyme Primername Sequence(5.fwdarw.3) Chimera1 Bridge_P1_pETGTD GCGGCCATATCGACGACGACGACAAGCATATGACGAAATAC AAAAATGAATTAACAGGT Bridge_P1_GTCpET GGAAGAAGAAAAGATATACTAAGGATCCGGCTGCT AACAAAGCCCGAAAGG Chim_P1_D_Nde_for CATATGACGAAATACAAAAATGAATT Chim_P1_D_rev GCGGTCATACTCAAATGATT Chim_P1_C_for AGTGATCTGGGAAAAAATATC Chim_P1_C_Bam_rev GGATCCTTAGTATATCTTTTCTTCTTCCT Chimera3 GTDopt_pEt_fw GGGAATTCCATATGATGACCAAATACAAAAATG Chim3_pET_rv CGGGATCCTTAGTAAATCTTTTCTTCTTCCTTC 1r-Chim3-opt-o(Chim3- TGCCCTGAGGAAAGCGCGCACGTAATTC opt) 2f-Chim3-opt-o(Chim3- TGCGCGCTTTCCTCAGGGCAACTTAATC opt) 1f-Assembly-o(Vec) TGACGATAAGGATCGATGGGGATCCATGACCAAATACAAA 1r-Assembly-o(Vec) TATGGTACCAGCTGCAGATCTCGAGTTAGTAAATCTTTTCTTC Chimera4 GTDopt_pEt_fw GGGAATTCCATATGATGACCAAATACAAAAATG Chim3_pET_rv CGGGATCCTTAGTAAATCTTTTCTTCTTCCTTC 1r-Chim4_GTD- CGATTTTGCGCCCATATTGTAACAACTTTTGA o(Chim4_GTC) 2f-Chim4_GTC- ACAATATGGGCGCAAAATCGTCGTAGTC o(Chim4_GTD) 1f-Assembly-o(Vec) TGACGATAAGGATCGATGGGGATCCATGACCAAATACAAA 1r-Assembly-o(Vec) TATGGTACCAGCTGCAGATCTCGAGTTAGTAAATCTTTTCTTC

[0226] To establish expression hosts purified pDrive::GT vectors were incubated with respective endonucleases (Table A1) and the fragments of interest were purified from Agarose after gel electrophoresis. Alternatively, the amplified and purified PCR product was directly incubated with respective endonucleases and purified from agarose gel after electrophoresis. The fragments were ligated into prepared pET19b or pTrcHisA plasmids and competent E. coli Rosetta gami 2 (DE3) were transformed by heat shock. Positive clones were verified after overnight growth by direct colony PCR using T7 promoter primers and the GT gene reverse primers, respectively.

[0227] Altogether, seven production strains were established:

TABLE-US-00004 1. PetC E. coli Rosetta gami 2 (DE3) pET19b::GTC 2. PetD E. coli Rosetta gami 2 (DE3) pET19b::GTD 3. PetF E. coli Rosetta gami 2 (DE3) pET19b::GTF 4. PetS E. coli Rosetta gami 2 (DE3) pET19b::GTS 5. PetChim1fs E. coli Rosetta gami 2 (DE3) pET19b::Chimera 1 frameshift 6. PetChim3 E. coli Rosetta gami 2 (DE3) pET19b::Chimera 3 7. PetChim4 E. coli Rosetta gami 2 (DE3) pET19b::Chimera 4

Example A3Production of Rhamnosylated Flavonoids in Biotransformations

[0228] Three kinds of whole cell bioconversion (biotransformation) were performed. All cultures were inoculated 1/100 with overnight pre-cultures of the respective strain. Pre-cultures were grown at 37 C. in adequate media and volumes from 5 to 100 mL supplemented with appropriate antibiotics.

1. Analytical Small Scale and Quantitative Shake Flask Cultures

[0229] For analytical activity evaluations, 20 mL biotransformations were performed in 100 mL Erlenmeyer flasks while quantitative biotransformations were performed in 500 mL cultures in 3 L Erlenmeyer flasks. Bacterial growth was accomplished in complex media, e.g. LB, TB, and RM, or in M9 supplemented with appropriate antibiotics at 28 C. until an OD.sub.600 of 0.8. Supplementation of 50 or 100 M Isopropyl--D-thiogalactopyranoside (IPTG) induced gene expression overnight (16 h) at 17 C. and 175 rpm shaking. Subsequently, a polyphenolic substrate, e.g. Naringenin, Hesperetin or else, in concentrations of 200-800 M was added to the culture. Alternatively, the polyphenolic substrate was supplemented directly with the IPTG. A third alternative was to harvest the expression cultures by mild centrifugation (5.000 g, 18 C., 10 min) and suspend in the same volume of PBS, supplied with 1% (w/v) glucose, optionally biotin and/or thiamin, each at 1 mg/L, the appropriate antibiotic and the substrate in above mentioned concentrations. All biotransformation reactions in 3 L shake flasks were incubated at 28 C. up to 48 h at 175 rpm.

2. Quantitative bioreactor (fermenter) cultures

[0230] In order of a monitorable process bioconversions were performed in volumes of 0.5 L in a Dasgip fermenter system (Eppendorf, Germany) The whole process was run at 26 to 28 C. and kept at pH 7.0. The dissolved oxygen (DO) was kept at 30% minimum. During growth the DO rises due to carbohydrate consumption. At DO of 50% an additional feed with glucose was started with 1 mL/h following the equation

y=e.sup.0.1x

whereby y represents the added volume (mL) and x the time (h).

[0231] For cell growth the bacterial strains were grown in LB, TB, RM or M9 overnight. At OD.sub.600 of 10 to 50 50 M of IPTG and the polyphenolic substrate (400-1500 M) were added to the culture. The reaction was run for 24 to 48 h.

[0232] All bioconversion reactions were either stopped by cell harvest through centrifugation (13,000 g, 4 C., 20 min) followed by sterile filtration with a 0.22 M PES membrane (Steritop, Carl Roth, Germany) Alternatively, cultures were harvested by hollow fibre membrane filtration techniques, e.g. TFF Centramed system (Pall, USA). Supernatants were purified directly or stored short-term at 4 C. (without light).

Qualitative Analyses of Biotransformation Reactions and Products

[0233] Biotransformation products were determined by thin layer chromatography (TLC) or by HPLC.

[0234] For qualitative TLC analysis, 1 mL culture supernatant was extracted with an equal amount ethyl acetate (EtOAc). After centrifugation (5 min, 3,000 g) the organic phase was transferred into HPLC flat bottom vials and was used for TLC analysis. Samples of 20 L were applied on 2010 cm.sup.2 (HP)TLC silica 60 F.sub.254 plates (Merck KGaA, Darmstadt, Germany) versus 200 pmol of reference flavonoids by the ATS 4 (CAMAG, Switzerland). To avoid carryover of substances, i.e. prevent false positives, samples were spotted with double syringe rinsing in between. The sampled TLC plates were developed in EtOAc/acetic acid/formic acid/water (EtOAc/HAc/HFo/H.sub.2O) 100:11:11:27. After separation the TLC plates were dried in hot air for 1 minute. The chromatograms were read and absorbances of the separated bands were determined densitometrically depending on the absorbance maximum of the educts at 285 to 370 nm (D2) by a TLC Scanner 3 (CAMAG, Switzerland).

Analytical HPLC Conditions

[0235] HPLC analytics were performed on a VWR Hitachi LaChrom Elite device equipped with diode array detection.

Column: Agilent Zorbax SB-C18 2504.6 mm, 5 M

[0236] Flowrate: 1 mL/min
Mobile phases: A: H.sub.2O+0.1% Trifluoro acetic acid (TFA), B: ACN+0.1% TFA 0-5:5% B, 5-15: 15% B, 15-25: 25% B, 25-25: 35% B, 35-45: 40%, 45-55 100% B, 55-63: 5% B
Sample injection volume 100-500 L
MS and MS/MS analyses were obtained on a microOTOF-Q with electrospray ionization (ESI) from Bruker (Bremen, Germany) The ESI source was operated at 4000 V in negative ion mode. Samples were injected by a syringe pump and a flow rate of 200 L/min.

[0237] In order to purify the polyphenolic glycosides two different purification procedures were applied successfully.

1. Extraction and subsequent preparative HPLC [0238] 1.1 In liquid-liquid extractions bioconversion culture supernatants were extracted twice with half a volume of iso-butanol or EtOAc. [0239] 1.2 In solid phase extractions (SPE) supernatants were first bound on suitable polymeric matrices, e.g. Amberlite XAD resins or silica based functionalized phases, e.g. C-18, and subsequently eluted with organic solvents, e.g. ACN, methanol (MeOH), EtOAc, dimethyl sulfoxide (DMSO) et al. or with suitable aqueous solutions thereof, respectively. [0240] Organic solvents were evaporated and the residuum completely dissolved in water-acetonitrile (H.sub.2O-ACN) 80:20. This concentrate was further processed by HPLC as described below.
2. Direct fractionation by preparative HPLC [0241] Sterile filtered (0.2 m) biotransformation culture supernatants or pre-concentrated extracts were loaded on adequate RP18 columns (5 m, 250 mm) and fractionated in a H.sub.2O-ACN gradient under following general conditions: [0242] System: Agilent 1260 Infinity HPLC system. [0243] Column: ZORBAX SB-C18 prepHT 25021.2 mm, 7 m. [0244] Flowrate: 20 mL/min [0245] Mobile Phase: A: Water+0.1 formic acid [0246] B: ACN+0.1 formic acid

TABLE-US-00005 Gradient: 0-5 min 5-30% B.sup. 5-10 min 30% B 10-15 min 35% B 15-20 min 40% B 20-25 min 100% B [0247] Fractions containing the polyphenolic glycosides were evaporated and/or freeze dried. Second polishing steps were performed with a pentafluor-phenyl (PFP) phase by HPLC to separate double peaks or impurities.

[0248] The rhamnose transferring activity was shown with enzymes GTC, GTD, GTF and GTS and the three chimeric enzymes chimera 1 frameshift, chimera 3 and chimera 4 in preparative and analytical biotransformation reactions. The enzymes were functional when expressed in different vector systems. GT-activity could be already determined in cloning systems, e.g. E. coli DH5 transformed with pDrive vector (Qiagen, Germany) carrying GT-genes. E. coli carrying pBluescript II SK+ with inserted GT-genes also was actively glycosylating flavonoids. For preparative scales the production strains PetC, PetD, PetF, PetS, PetChim1fs, PetChim3 and PetChim4 were successfully employed. Products were determined by HPLC, TLC, LC-MS and NMR analyses.

Biotransformation of the Flavanone Hesperetin Using E. coli Rosetta Gami 2 (DE3) pET19b::GTC (PetC)

[0249] In a preparative scale reaction hesperetin (3,5,7-Trihydroxy-4-methoxyflavanone, 2,3-dihydro-5,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-4H-1-benzopyran-4-one, CAS No. 520-33-2) was converted. The biotransformation was performed following general preparative shake flask growth and bioconversion conditions.

[0250] The bioconversion of hesperetin (>98%, Cayman, USA) was monitored by HPLC analyses of 500 L samples taken at start (T=0), 3 h and 24 h reaction at 28 C. The culture supernatant was loaded directly via pump flow to a preparative RP18 column (Agilent, USA). Stepwise elution was performed and seven fractions were collected according to FIG. 10 and table A2.

[0251] All seven fractions subsequently were analyzed by HPLC and ESI-Q-TOF MS analyses. MS analyses in negative ion mode revealed fraction 3 and fraction 6 to contain a compound each with the molecular weight of 448 Da corresponding to hesperetin-O-rhamnoside (C.sub.22H.sub.24O.sub.10) (FIGS. 11 and 12 table A2). To further purify the two compounds fractions 3 and 6 were lyophilized and dissolved in 30% ACN.

[0252] Final purification was performed by HPLC using a PFP column The second purification occurred on a Hypersil Gold PFP, 25010 mm, 5 m purchased from Thermo Fischer Scientific (Langerwehe, Germany) and operated at a flow rate of 6 mL/min (Mobile Phase: A: Water, B: ACN, linear gradient elution (0-8:95%-40% A, 8-13:100% B)(FIG. 13). Subsequently, ESI-TOF MS analyses of the PFP fractions identified the target compounds designated HESR1 and HESR2 in respective fractions (table A3).

[0253] After lyophilization NMR analyses elucidated the molecular structure of HESR1 and HESR2, respectively (Example B-2). HESR1 turned out to be the hesperetin-5-O--L-rhamnoside and had a RT of 28.91 min in analytical HPLC conditions. To this point, this compound has ever been isolated nor synthesized before.

TABLE-US-00006 TABLE A2 Fractionation of hesperetin bioconversion by prepLC separation Frac Volume BeginTime EndTime # # Well Location [l] [min] [min] Description ESI-MS 1 1 Vial 201 20004.17 3.4999 4.5001 Time 2 1 Vial 202 58004.17 4.9999 7.9001 Time 3 1 Vial 203 17804.17 7.9999 8.8901 Time HESR1 448 4 1 Vial 204 20791.67 8.9505 9.9901 Time 5 1 Vial 205 39012.50 10.0495 12.0001 Time 6 1 Vial 206 38004.17 12.0999 14.0001 Time HESR2 448 7 1 Vial 207 40004.17 17.9999 20.0001 Time

TABLE-US-00007 TABLE A3 Peak table of PFP-HPLC of fraction 3 hesperetin bioconversion Width RT [min] Type [min] Area Height Area % Name 2.030 BB 0.1794 866.4182 75.7586 3.9105 2.507 BV 0.1642 493.0764 43.5284 2.2254 2.686 VV 0.0289 20.4545 9.5811 0.0923 2.772 VB 0.0861 85.4639 15.0938 0.3857 2.939 BB 0.0806 119.9032 23.8914 0.5412 3.264 BV 0.1016 16549.5371 2365.6169 74.6942 HESR1 3.488 VV 0.0977 957.1826 140.0522 4.3201 3.742 VB 0.0932 2007.7089 320.0400 9.0615 4.047 BB 0.0816 74.1437 14.5014 0.3346 4.467 BB 0.1241 190.8758 23.6774 0.8615 5.238 BV 0.1326 121.1730 13.5104 0.5469 5.501 VB 0.1617 315.1474 27.9130 1.4224 6.192 BV 0.1654 43.3605 3.8503 0.1957 10.368 VV 0.4019 296.8163 9.8411 1.3396 12.464 VB 0.1204 15.1287 1.7240 0.0683

Biotransformation of the Flavanone Naringenin Using PetC in a Preparative Shake Flask Culture

[0254] Naringenin (4,5,7-Trihydroxyflavanone, 2,3-dihydro-5,7-dihydroxy-2-(4-hydroxyphenyl)-4H-1-benzopyran-4-one, CAS No. 67604-48-2) was converted in a preparative scale reaction. The biotransformation was performed following general preparative shake flask growth and bioconversion conditions.

[0255] The bioconversion of naringenin (98%, Sigma-Aldrich, Switzerland) was controlled by HPLC analyses of a 500 L sample after 24 h reaction. The culture supernatant was directly loaded via pump flow to a preparative RP18 column. Stepwise elution was performed and seven fractions were collected according to table A4.

[0256] All seven fractions subsequently were analyzed by HPLC and ESI-TOF MS analyses. MS analyses in negative ion mode revealed fraction 3 and fraction 5 to contain a compound each with the molecular weight of 418 Da which is the molecular weight of naringenin-O-rhamnoside (C.sub.21H.sub.22O.sub.9)(table A4). The two compounds designated NR1 and NR2 were lyophilized. HPLC analysis in analytical conditions revealed RTs of approx. 27.2 min for NR1 and 35.7 min for NR2, respectively. NMR analyses elucidated the molecular structure of NR1 (Example B-3). NR1 was identified to be an enantiomeric 1:1 mixture of S- and R-naringenin-5-O--L-rhamnoside (N5R). Since the used precursor also was composed of both enantiomers the structure analysis proved that both isomers were converted by GTC. To our knowledge this is the first report that naringenin-5-O--L-rhamnoside has ever been biosynthesized. The compound was isolated from plant material (Shrivastava (1982) Ind J Chem Sect B 21(6):406-407). However, the rare natural occurrence of this scarce flavonoid glycoside has impeded any attempt of an industrial application.

[0257] In contrast, the first time bioconversion of naringenin-5-O--L-rhamnoside opens the way of a biotechnological production process for this compound. Until now the biotechnological production was only shown for e.g. naringenin-7-O--L-xyloside and naringenin-4-O--D-glucoside (Simkhada (2009) Mol. Cells 28:397-401, Werner (2010) Bioprocess Biosyst Eng 33:863-871).

TABLE-US-00008 TABLE A4 Fractionation of naringenin bioconversion by prepLC separation Frac Volume BeginTime EndTime # # Well Location [l] [min] [min] Description ESI-MS 1 1 Vial 201 31518.75 4.6963 6.4407 Time 2 1 Vial 202 17328.75 6.5074 7.4634 Time 3 1 Vial 203 34638.75 7.5301 9.4478 Time NR1 418 4 1 Vial 204 43905.00 9.5130 11.9455 Time 5 1 Vial 205 115995.00 12.0109 18.4484 Time NR2 418 6 1 Vial 206 71111.25 18.5151 22.4590 Time 7 1 Vial 207 80047.50 22.5242 26.9647 Time
Biotransformation of Naringenin Using E. coli Rosetta Gami 2 (DE3)pET19b::GTC (PetC) in a Monitored Bioreactor System

[0258] Next to production of naringenin rhamnosides in shake flask cultures a bioreactor process was successfully established to demonstrate applicability of scale-up under monitored culture parameters.

[0259] In a Dasgip fermenter system (Eppendorf, Germany) naringenin was converted in four fermenter units in parallel under conditions stated above.

[0260] At an OD.sub.600 of 50 expression in PetC was induced by IPTG while simultaneously supplementation of 0.4 g of naringenin (98% CAS No. 67604-48-2, Sigma-Aldrich, Switzerland) per unit was performed. Thus, the final concentration was 2.94 mM of substrate.

[0261] After bioconversion for 24 h the biotransformation was finished and centrifuged. Subsequently, the cell free supernatant was extracted once with an equal volume of iso-butanol by shaking intensively for one minute. Preliminary extraction experiments with defined concentrations of naringenin rhamnosides revealed an average efficiency of 78.67% (table A5).

[0262] HPLC analyses of the bioreactor reactions indicated that both products, NR1 (RT 27,28) and NR2 (RT 35.7), were built successfully (FIG. 16). ESI-MS analyses verified the molecular mass of 418 Da for both products. Quantitative analysis of the bioconversion products elucidated the reaction yields. Concentration calculations were done from peak areas after determination regression curves of NR1 and NR2 (table A6). NR1 yielded an average product concentration of 393 mg/L, NR2 as the byproduct yielded an average 105 mg/L.

TABLE-US-00009 TABLE A5 Extraction of naringenin biotransformation products from supernatant with iso-butanol Extraction mit iso-butanol 1 ml/1 mL 1 shaking % Mean Loss % Std Dev. 75.75160033 78.6707143 21.32928571 2.73747541 82.49563254 76.42705533 80.00856895

TABLE-US-00010 TABLE A6 HPLC chromatogram peak area and resulting product concentrations of NR1 and NR2 NR1 NR2 Concentration Concentration Peak area mg/mL Peak area mg/mL Unit 1 26 C. 24 h 232620332 0.33231476 64179398 0.091684854 Unit 2 28 C. 24 h 192866408 0.27552344 57060698 0.081515283 Unit 3 26 C. 24 h 235176813 0.335966876 61065093 0.087235847 Unit 4 28 C. 24 h 204937318 0.292767597 49803529 0.071147899 Unit 1 26 C. 24 h 232620332 0.422412283 64179398 0.116542547 Unit 2 28 C. 24 h 192866408 0.350223641 57060698 0.103615791 Unit 3 26 C. 24 h 235176813 0.427054564 61065093 0.110887321 Unit 4 28 C. 24 h 204937318 0.372143052 49803529 0.090437591 Average 0.392958385 0.105370812
Biotransformation of Narengenin Using E. coli Rosetta Gami 2 (DE3)pET19b::GTC (PetC), E. coli Rosetta Gami 2 (DE3) pET19b::GTD (PetD), E. coli Rosetta Gami 2 (DE3) pET19b::GTF (PetF), E. coli Rosetta Gami 2 (DE3) pET19b::GTS (PetS), E. coli Rosetta Gami 2 (DE3) pET19b::Chimera 1 Frameshift (PetChim1fs), E. coli Rosetta Gami 2 (DE3)pET19b::Chimera 3 (PetChim3) and E. coli Rosetta Gami 2 (DE3)pET19b::Chimera 4 (PetChim4), Respectively

[0263] To determine the regio specificities of GTC, GTD, GTF and GTS as well as the three chimeric enzymes chimera 1 frameshift, chimera 3 and chimera 4 biotransformations were performed in 20 mL cultures analogously to preparative flask culture bioconversions using naringenin as a substrate among others. To purify the formed flavonoid rhamnosides, the supernatant of the biotransformation was loaded on a C.sub.6H.sub.5 solid phase extraction (SPE) column. The matrix was washed once with 20% acetonitrile. The flavonoid rhamnosides were eluted with 100% acetonitrile. Analyses of the biotransformations were performed using analytical HPLC and LC-MS. For naringenin biotransformations analyses results of the formed products NR1 and NR2 of each production strain are listed in Table A7 and A8, respectively.

TABLE-US-00011 TABLE A7 Formed NR1 products in bioconversions of naringenin with different production strains strain NR1 retention time [min] HPLC ESI-MS ESI-MSMS PetC 27.32 418 272 PetD 27.027 418 272 PetF 26.627 418 272 PetS 26.833 418 272 PetChim1fs 26.673 418 272 PetChim3 26.72 418 272 PetChim4 26.727 418 272

TABLE-US-00012 TABLE A8 Formed NR2 products in bioconversions of naringenin with different production strains strain NR2 retention time [min] HPLC ESI-MS ESI-MSMS PetC 35.48 418 272 PetD 35.547 418 272 PetF 35.26 418 272 PetS 35.28 418 272 PetChim1fs 35.080 418 272 PetChim3 35.267 418 272 PetChim4 35.267 418 272

Biotransformation of the Flavanone Homoeriodictyol (HED) Using PetC

[0264] In preparative scale HED (5,7-Dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-4-chromanone, CAS No. 446-71-9) was glycosylated by PetC. The biotransformation was performed following general preparative shake flask growth and bioconversion conditions.

[0265] The bioconversion of HED was monitored by HPLC analyses. The culture supernatant was loaded directly via pump flow to a preparative RP18 column (Agilent, USA). Stepwise elution was performed and nine fractions were collected according to table A5.

[0266] All nine fractions subsequently were analyzed by HPLC and ESI-TOF MS analyses. MS analyses of fractions 5 and 8 in negative ion mode showed that both contained a compound with the molecular weight of 448 Da which corresponded to the size of a HED-O-rhamnoside and were designated HEDR1 and HEDR3. MS analysis of fraction 7 (HEDR2) gave a molecular weight of 434 Da. However, ESI MS/MS analyses of all three fractions identified a leaving group of 146 Da suggesting a rhamnosidic residue also in fraction 7.

[0267] After HPLC polishing by a (PFP) phase and subsequent lyophilization the molecular structure of HEDR1 was solved by NMR analysis (Example B-1). HEDR1 (RT 28.26 min in analytical HPLC) was identified as the pure compound HED-5-O--L-rhamnoside.

TABLE-US-00013 TABLE A9 Fractionation of HED bioconversion by prepLC separation Frac Volume BeginTime EndTime Description # # Well Location [l] [min] [min] [compound] ESI-MS 1 1 Vial 201 22503.75 5.0999 6.3501 Time 2 1 Vial 202 28593.75 6.4115 8.0001 Time 3 1 Vial 203 34927.50 8.0597 10.0001 Time 4 1 Vial 204 20141.25 10.0611 11.1801 Time 5 1 Vial 205 13695.00 11.2392 12.0001 Time HEDR1 448 6 1 Vial 206 34931.25 12.0594 14.0001 Time 7 1 Vial 207 25203.75 15.5999 17.0001 Time HEDR2 434 8 1 Vial 208 38246.25 17.0753 19.2001 Time HEDR3 448 9 1 Vial 209 66603.75 19.2999 23.0001 Time HED 302

Biotransformation Reactions Using PetC of the Isoflavone Genistein Using PetC

[0268] In preparative scale genistein (4,5,7-Trihydroxyisoflavone, 5,7-dihydroxy-3-(4-hydroxyphenyl)chromen-4-one, CAS No. 446-72-0) was glycosylated in bioconversion reactions using PetC. The biotransformation was performed in PBS following general preparative shake flask growth and bioconversion conditions.

[0269] The bioconversion of genistein was monitored by HPLC analyses. The genistein aglycon showed a RT of approx. 41 min. With reaction progress four peaks of reaction products (GR1-4) with RTs of approx. 26 min, 30 min, 34.7 min, and 35.6 min accumulated in the bioconversion (table A10). The reaction was stopped by cell harvest after 40 h and in preparative RP18 HPLC stepwise elution was performed. All fractions were analyzed by HPLC and ESI-Q-TOF MS analyses.

[0270] Fractions 3, 4, and 5, respectively, showed the molecular masses of genistein rhamnosides in MS analyses. Fraction 3 consisted of two separated major peaks (RT 26 min and 30 min) Fraction 4 showed a double peak of 34.7 min and 35.6 min, fraction 5 only the latter product peak at RT 35.6 min. Separate MS analyses of the peaks in negative ion mode revealed that all peaks contained compounds with the identical molecular masses of 416 which corresponded to the size of genistein-O-rhamnosides. NMR analysis of GR1 identified genistein-5,7-di-O--L-rhamnoside (Example B-9).

Biotransformation of the Isoflavone Biochanin A Using PetC

[0271] In preparative scale biochanin A (5,7-dihydroxy-3-(4-methoxyphenyl)chromen-4-one, CAS No. 491-80-5) was glycosylated in bioconversion reactions using PetC. The biotransformation was performed following general preparative shake flask growth and bioconversion conditions. The bioconversion of biochanin A was monitored by HPLC. The biochanin A aglycon showed a RT of approx. 53.7 min With reaction progress three product peaks at approx. 32.5, 36.6, and 45.6 accumulated in the bioconversion (table A10). These were termed BR1, BR2, and BR3, respectively. The reaction was stopped by cell harvest after 24 h through centrifugation (13,000 g, 4 C.). The filtered supernatant was loaded to a preparative RP18 column and fractionated by stepwise elution. All fractions were analyzed by HPLC and ESI-Q-TOF MS analyses.

[0272] The PetC product BR1 with a RT of 32.5 min was identified by NMR as the 5,7-di-O--L-rhamnoside of biochanin A (Example B-4). NMR analysis of BR2 (RT 36.6) gave the 5-O--L-rhamnoside (example B-5). In accordance to 5-O--L-rhamnosides of other flavonoids, e.g. HED-5-O--L-rhamnoside, BR2 was the most hydrophilic mono-rhamnoside with a slight retardation compared to HEDR1. Taking into account the higher hydrophobicity of the precursor biochanin A (RT 53.5) due to less hydroxy groups and its C4-methoxy function in comparison to a C4-OH of genistein (RT 41) the retard of BR2 compared to GR2 could be explained.

Biotransformation of the Flavone Chrysin Using PetC

[0273] In preparative scale chrysin (5,7-Dihydroxyflavone, 5,7-Dihydroxy-2-phenyl-4-chromen-4-one, CAS No. 480-40-0) was glycosylated in bioconversion reactions using PetC. The biotransformation was performed following stated preparative shake flask conditions in PBS.

[0274] The bioconversion of chrysin was monitored by HPLC analyses. The chrysin aglycon showed a RT of 53.5 min. In PetC bioconversions three reaction product peaks accumulated in the reaction, CR1 at RT 30.6 min, CR2 at RT36.4 min, and CR3 at RT43.4, respectively (table A10). All products were analyzed by HPLC and ESI-Q-TOF MS analyses.

[0275] CR1 was further identified by NMR as the 5,7-di-O--L-rhamnoside of chrysin (Example B-6) and in NMR analysis CR2 turned out to be the 5-O--L-rhamnoside (Example B-7). Like BR2, CR2 was also less hydrophilic than the 5-O-rhamnosides of flavonoids with free OH-groups at ring C, e.g. hesperetin and naringenin, although CR2 was the most hydrophilic mono-rhamnoside of chrysin.

Biotransformation of the Flavone Diosmetin Using PetC

[0276] Diosmetin (5,7-Trihydroxy-4-methoxyflavone, 5,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl) chromen-4-one, CAS No. 520-34-3) was glycosylated in bioconversion reactions using PetC. The biotransformation was performed as stated before.

[0277] The bioconversion of diosmetin was monitored by HPLC. The diosmetin aglycon showed a RT of 41.5 min using the given method. With reaction progress three peaks of putative reaction products at 26.5 (DR1), 29.1 (DR2), and 36 (DR3) accumulated (table A10).

[0278] The product DR2 with a RT of 29.1 min was further identified as the 5-O--L-rhamnoside of diosmetin (D5R) (Example B-10). DR1 was shown by ESI-MS analysis to be a di-rhamnoside of diosmetin. In accordance with the 5-O--L-rhamnosides of other flavonoids, e.g. hesperetin, DR2 had a similar retention in analytical RP18 HPLC-conditions.

[0279] Table A10 summarizes all reaction products of PetC biotransformations with the variety of flavonoid precursors tested.

TABLE-US-00014 TABLE A10 Compilation of applied precursors and corresponding rhamnosylated products NMR Elucidated Precursor Products RT [min] ESI-MS (Part B) Structure Homoeriodictyol 42.4 302.27 HEDR1 28.1 448.11 B-1 5-O--L-rhamnoside HEDR2 34.6 434.13 HEDR3 Double 448.11 Peak 35.8/36.4 Hesperetin 41.1 302.27 HESdiR 26.3 594.12 3,5-di-O--L-rhamnoside HESR1 28.2 448.15 B-2 5-O--L-rhamnoside HESR 2 448.15 Naringenin 40.8 272.26 NR1 27.2 418.1 B-3 5-O--L-rhamnoside NR2 25.7 418.1 Biochanin A 53.7 284.26 BR1 32.5 B-4 5,7-di-O--L-rhamnoside BR2 36.6 430.15 B-5 5-O--L-rhamnoside BR3 45.6 430.15 Chrysin 53.0 254.24 CR1 30.6 B-6 5,7-di-O--L-rhamnoside CR2 36.4 400.14 B-7 5-O--L-rhamnoside CR3 43.4 400.14 Silibinin 39.8 482.44 SR1 32.5 628.15 B-8 5-O--L-rhamnoside Genistein 40.8 270.24 GR1 25.9 B-9 5,7-di-O--L-rhamnoside GR2 30.0 416.15 GR3 34.7 416.15 GR4 35.6 416.15 Diosmetin 41.5 300.26 DR1 26.5 Di-O--L-rhamnoside DR2 29.1 446.15 B-10 5-O--L-rhamnoside DR3 36.0 446.15

Part B: NMRanalyses of the Rhamnosylated Flavonoids

[0280] The following Examples were prepared according to the procedure described above in Part A.

Example B-1: HED-5-O--L-rhamnoside

[0281] ##STR00024##

[0282] .sup.1H NMR ((600 MHz Methanol-d.sub.4): =7.06 (d, J=2.0 Hz, 1H), 7.05 (d, J=2.1 Hz, 1H), 6.91 (dt, J=8.2, 2.1, 0.4 Hz, 1H), 6.90 (ddd, J=8.1, 2.0, 0.6 Hz, 1H), 6.81 (d, J=8.1 Hz, 1H), 6.80 (d, J 8.1 Hz, 1H), 6.32 (d, J=2.3 Hz, 1H), 6.29 (d, J=2.3 Hz, 1H), 6.09 (t, J=2.3 Hz, 2H), 5.44 (d, J=1.9 Hz, 1H), 5.40 (d, J=1.9 Hz, 1H), 5.33 (dd, J=7.7, 2.9 Hz, 1H), 5.31 (dd, J=8.1, 3.0 Hz, 1H), 4.12 (ddd, J 11.2, 3.5, 1.9 Hz, 2H), 4.08 (dd, J=9.5, 3.5 Hz, 1H), 4.05 (dd, J=9.5, 3.5 Hz, 1H), 3.87 (s, 3H), 3.87 (s, 3H), 3.69-3.60 (m, 2H), 3.46 (td, J=9.5, 5.8 Hz, 2H), 3.06-3.02 (m, 1H), 3.02-2.98 (m, 1H), 2.64 (ddd, J=16.6, 15.5, 3.0 Hz, 2H), 1.25 (d, J=6.2 Hz, 3H), 1.23 (d, J=6.3 Hz, 3H).

Example B-2: Hesperetin-5-O--L-rhamnoside

[0283] ##STR00025##

[0284] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): =1.10 (3H, d, J=6.26 Hz, CH.sub.3), 2.45 (m, H-3(a), superimposed by DMSO), 2.97 (1H, dd, J=12.5, 16.5 Hz, H3(b)), 3.27 (1H, t, 9.49 Hz, H(b)), 3.48 (m, H(a), superimposed by HDO), 3.76 (3H, s, OCH3), 3.9-3.8 (2H, m, H(c), Hd), 5.31 (1H, d, 1.76 Hz, He), 5.33 (1H, dd, 12.5, 2.83 Hz, H2), 6.03 (1H, d, 2.19 Hz, H6/H8), 6.20 (1H, d, 2.19 Hz, H6/H8), 6.86 (1H, dd, 8.2, 2.0 Hz, H6), 6.90 (1H, d, 2.0 Hz, H2), 6.93 (1H, d, 8.2 Hz, H5)

Example B-3: Naringenin-5-O--L-rhamnoside

[0285] ##STR00026##

[0286] .sup.1H NMR (600 MHz, DMSO-d.sub.6): =7.30 (d, J=6.9 Hz, 2H), 7.29 (d, J=6.9 Hz, 2H), 6.79 (d, J=8.6 Hz, 2H), 6.78 (d, J=8.6 Hz, 2H), 6.22 (d, J=2.3 Hz, 1H), 6.20 (d, J=2.2 Hz, 1H), 6.02 (d, J=2.2 Hz, 1H), 6.01 (d, J=2.2 Hz, 1H), 5.38 (dd, J=12.7, 3.1 Hz, 1H), 5.35 (dd, J=13.0, 2.5 Hz, 1H), 5.31 (d, J=1.8 Hz, 1H), 5.27 (d, J=1.9 Hz, 1H), 3.90-3.88 (m, 1H), 3.88-3.85 (m, 1H), 3.85-3.80 (m, 2H), 3.50 (dq, J=9.2, 6.2 Hz, 1H), 3.48 (dq, J=9.1, 6.2 Hz, 1H), 3.29 (t, J=9.8 Hz, 2H), 3.07-2.98 (m, 2H), 2.55-2.48 (m, 2H), 1.12 (d, J=6.2 Hz, 3H), 1.10 (d, J=6.2 Hz, 3H).

[0287] .sup.13C NMR (151 MHz, DMSO-d.sub.6): =187.75, 187.71, 164.04, 163.92, 163.80, 158.33, 158.23, 157.48, 157.44, 129.26, 129.24, 129.18, 129.15, 128.07, 128.00, 115.00, 105.19, 105.06, 98.58, 98.44, 97.25, 96.85, 96.77, 96.64, 78.03, 77.97, 71.67, 71.65, 69.98, 69.95, 69.66, 69.64, 44.78, 44.74, 17.80, 17.75.

Example B-4: Biochanin A-5,7-di-O--L-rhamnoside

[0288] ##STR00027##

[0289] .sup.1H NMR (400 MHz DMSO-d.sub.6): =8.21 (s, 1H), 7.43 (d, J=8.5 Hz, 2H), 6.97 (d, J=8.6 Hz, 2H), 6.86 (d, J=1.8 Hz, 1H), 6.74 (d, J=1.8 Hz, 1H), 5.53 (d, J=1.6 Hz, 1H), 5.41 (d, J=1.6 Hz, 1H), 5.15 (s, 1H), 5.00 (s, 1H), 4.93 (s, 1H), 4.83 (s, 1H), 4.70 (s, 1H), 3.93 (br, 1H), 3.87 (br, 1H), 3.85 (br, 1H), 3.77 (s, 3H), 3.64 (dd, J=9.3, 3.0 Hz, 1H), 3.54 (dq, J=9.4, 6.4 Hz, 1H), 3.44 (dq, J=9.4, 6.4 Hz, 1H), 3.34 (br, 1H), 1.13 (d, J=6.1 Hz, 3H), 1.09 (d, J=6.1 Hz, 3H)

Example B-5: Biochanin A 5-O--L-rhamnoside

[0290] ##STR00028##

[0291] .sup.1H NMR (400 MHz DMSO-d.sub.6): =8.21 (s, 1H), 7.42 (d, J=8.7 Hz, 2H), 6.96 (d, J=8.7 Hz 2H), 6.55 (d, J=1.9 Hz, 1H), 6.48 (d, J=1.9 Hz, 1H), 5.33 (d, J=1.7 Hz, 1H), 5.1-4.1 (br, nH), 3.91 (br, 1H), 3.86 (d, J=9.7, 1H), 3.77 (s, 3H), 3.48 (br, superimposed by impurity, 1H), 3.44 (impurity), 3.3 (superimposed by HDO), 1.10 (d, J=6.2 Hz, 3H)

Example B-6: Chrysin-di-5,7-O--L-rhamnoside

[0292] ##STR00029##

[0293] .sup.1H NMR (400 MHz DMSO-d.sub.6): =8.05 (m, 2H), 7.57 (m, 3H), 7.08 (s, 1H), 6.76 (d, J=2.3 Hz, 1H), 6.75 (s, 1H), 5.56 (d, J=1.6 Hz, 1H), 5.42 (d, J=1.6 Hz, 1H), 5.17 (s, 1H), 5.02 (s, 1H), 4.94 (s, 1H), 4.86 (s, 1H), 4.71 (s, 1H), 3.97 (br, 1H), 3.88 (dd, J=9.5, 3.1 Hz, 1H), 3.87 (br, 1H), 3.66 (dd, J=9.3, 3.4 Hz, 1H), 3.56 (dq, J=9.4, 6.2 Hz, 1H), 3.47 (dq, J=9.4, 6.2 Hz, 1H), 3.32 (superimposed by HDO, 2H), 1.14 (d, J=6.2 Hz, 3H), 1.11 (d, J=6.2 Hz, 3H)

Example B-7: Chrysin-5-O--L-rhamnoside

[0294] ##STR00030##

[0295] .sup.1H NMR (400 MHz DMSO-d.sub.6): =8.01 (m, 2H), 7.56 (m, 3H), 6.66 (s, 1H), 6.64 (d, J=2.1 Hz, 1H), 6.55 (d, J=2.1 Hz, 1H), 5.33 (d, J=1.5 Hz, 1H), 5.01 (s, 1H), 4.85 (d, J=4.7 Hz, 1H), 4.69 (s, 1H), 3.96 (br, 1H), 3.87 (md, J=8.2 Hz, 1H), 3.54 (dq, J=9.4, 6.2 Hz, 1H), 3.3 (superimposed by HDO), 1.11 (d, J=6.1 Hz, 3H)

Example B-8: Silibinin-5-O--L-rhamnoside

[0296] ##STR00031##

[0297] .sup.1H NMR (400 MHz DMSO-d.sub.6): =7.05 (dd, J=5.3, 1.9 Hz, 1H), 7.01 (br, 1H), 6.99 (ddd, J=8.5, 4.4, 1.8 Hz, 1H), 6.96 (dd, J=8.3, 2.3 Hz, 1H), 6.86 (dd, J=8.0, 1.8 Hz, 1H), 6.80 (d, J=8.0 Hz, 1H), 6.25 (d, J=1.9 Hz, 1H), 5.97 (dd, J=2.1, 3.7 Hz, 1H), 5.32 (d, J=1.6 Hz, 1H), 5.01 (d, J=11.2 Hz, 1H), 4.90 (d, J=7.3 Hz, 1H), 4.36 (ddd, J=11.2, 6.5, 4.6 Hz, 1H), 4.16 (ddd, J=7.6, 3.0, 4.6 Hz, 1H), 3.89 (m, 1H), 3.83 (br, 1H), 3.77 (d, J=1.8 Hz, 1H), 3.53 (m, 3H), 3.30 (superimposed by HDO, 3H), 1.13 (d, J=6.2 Hz, 3H)

Example B-9: Genistein-5,7-di-O--L-rhamnoside

[0298] ##STR00032##

[0299] .sup.1H NMR (400 MHz DMSO-d.sub.6): =8.16 (s, 1H), 7.31 (d, J=8.4 Hz, 2H), 6.85 (d, J=2.1 Hz, 1H), 6.79 (d, J=8.4 Hz, 2H), 6.73 (d, J=2.1 Hz, 1H), 5.52 (d, J=1.8 Hz, 1H), 5.40 (d, J=1.8 Hz, 1H), 5.14 (d, J=3.8 Hz, 1H), 4.99 (d, J=3.8 Hz, 1H), 4.92 (d, J=5.2 Hz, 1H), 5.83 (d, J=5.2 Hz, 1H), 5.79 (d, J=5.5 Hz, 1H), 4.69 (d, J=5.5 Hz, 1H), 3.93 (br, 1H), 3.87 (br, 1H), 3.85 (br, 1H), 3.64 (br, 1H), 3.44 (m, 2H), 3.2 (superimposed by HDO, 2H), 1.12 (d, J=6.2 Hz, 3H), 1.09 (d, J=6.2 Hz, 3H)

Example B-10: Diosmetin-5-O--L-rhamnoside

[0300] ##STR00033##

[0301] .sup.1H NMR (600 MHz DMSO-d.sub.6): =7.45 (dd, J=8.5, 2.3 Hz, 1H), 7.36 (d, J=2.3 Hz, 1H), 7.06 (d, J=8.6 Hz, 1H), 6.61 (d, J=2.3 Hz, 1H), 6.54 (d, J=2.3 Hz, 1H), 6.45 (s, 1H), 5.32 (d, J=1.7 Hz, 1H), 3.96 (dd, J=3.5, 2.0 Hz, 1H), 3.86 (m, 1H), 3.85 (s, 3H), 3.54 (dq, J=9.4, 6.3 Hz, 1H), 3.30 (superimposed by HDO, 1H), 1.11 (d, J=6.2, 3H)

Part C: Solubility

[0302] FIG. 1 illustrates the amounts of Naringenin-5-rhamnoside recaptured from a RP18 HPLC-column after loading of a 0.2 m filtered solution containing defined amounts up to 25 mM of the same. Amounts were calculated from a regression curve. The maximum water solubility of Naringenin-5-rhamnoside approximately is 10 mmol/L, which is equivalent to 4.2 g/L.

[0303] The hydrophilicity of molecules is also reflected in the retention times in a reverse phase (RP) chromatography. Hydrophobic molecules have later retention times, which can be used as qualitative determination of their water solubility.

[0304] HPLC-chromatography was performed using a VWR Hitachi LaChrom Elite device equipped with diode array detection under the following conditions:

Column: Agilent Zorbax SB-C18 2504.6 mm, 5 M, Flow 1 mL/min
Mobile phases: A: H.sub.2O+0.1% Trifluoro acetic acid (TFA);

B: ACN+0.1% TFA

[0305] Sample injection volume: 500 L;

Gradient: 0-5 min: 5% B, 5-15 min: 15% B, 15-25 min: 25% B, 25-25 min: 35% B, 35-45 min: 40%, 45-55 min: 100% B, 55-63 min: 5% B

[0306]

TABLE-US-00015 TABLE B1 contains a summary of the retention times according to FIGS. 2-9 and Example A-2. N-5-O--L- N-7-O--D- N-4-O--L- Order of elution rhamnoside glucoside rhamnoside Retention time [min] 27.3 30.9 36 Order of elution HED-5-O--L- HED-4-O--D- HEDR3 rhamnoside glucoside Retention time [min] 28.3 30.1 35.8 Order of elution HES-5-O--L- HESR2 HES-7-O--D- rhamnoside glucoside Retention time [min] 28.9 36 31

[0307] Generally, it is well known that glucosides of lipophilic small molecules in comparison to their corresponding rhamnosides are better water soluble, e.g. isoquercitrin (quercetin-3-glucoside) vs. quercitrin (quercetin-3-rhamnosides). Table B1 comprehensively shows the 5-O--L-rhamnosides are more soluble than -L-rhamnosides and -D-glucosides at other positions of the flavonoid backbone. All the 5-O--L-rhamnosides eluted below 30 min in RP18 reverse phase HPLC. In contrast, flavanone glucosides entirely were retained at RTs above 30 min independent of the position at the backbone. In case of HED it was shown that among other positions, here C4 and C7, the differences concerning the retention times of the -L-rhamnosides were marginal, whereas the C5 position had a strong effect on it. This was an absolutely unexpected finding.

[0308] The apparent differences of the solubility are clearly induced by the attachment site of the sugar at the polyphenolic scaffold. In 4-on-5-hydroxy benzopyrans the OH-group and the keto-function can form a hydrogen bond. This binding is impaired by the substitution of an -L-rhamnoside at C5 resulting in an optimized solvation shell surrounding the molecule. Further, in aqueous environments the hydrophilic rhamnose residue at the C5 position might shield a larger area of the hydrophobic polyphenol with the effect of a reduced contact to the surrounding water molecules. Another explanation would be that the occupation of the C5 position more effectively forms a molecule with a spatial separation a hydrophilic saccharide part and a hydrophobic polyphenolic part. This would result in emulsifying properties and the formation of micelles. An emulsion therefore enhances the solubility of the involved compound.

Part D: Activity of Rhamnosylated Flavonoids

Example D-1: Cytotoxicity of flavonoid-5-O--L-rhamnosides

[0309] To determine the cytotoxicity of flavonoid-5-O--L-rhamnosides tests were performed versus their aglycon derivatives in cell monolayer cultures. For this purpose concentrations ranging from 1 M to 250 M were chosen. The viability of normal human epidermal keratinocytes (NHEK) was twice evaluated by a MTT reduction assay and morphological observation with a microscope. NHEK were grown at 37 C. and 5% CO.sub.2 aeration in Keratinocyte-SFM medium supplemented with epidermal growth factor (EGF) at 0.25 ng/mL, pituitary extract (PE) at 25 g/mL and gentamycin (25 g/mL) for 24 h and were used at the 3rd passage. For cytotoxicity testing, pre-incubated NHEK were given fresh culture medium containing a specific concentration of test compound and incubated for 24 h. After a medium change at same test concentration cells were incubated a further 24 h until viability was determined. Test results are given in Table B2 and illustrated in FIG. 10.

TABLE-US-00016 TABLE B2 Cytotoxicity of flavonoid-5-O--L-rhamnosides on normal human epidermal keratinocytes [M] from stock solution at 100 mM in DMSO Compound Control 1 2.5 5 10 25 50 100 250 Hesperetin Viability (%) 98 98 103 98 107 101 106 106 98 54 102 102 106 109 106 105 109 106 100 59 Mean 100 105 103 106 103 108 106 99 57 sd 2 2 8 1 3 2 0 1 4 Morph. obs. + + + + + + + +/ +/ Hes-5-Rha Viability (%) 95 85 86 87 81 86 89 81 86 91 118 103 108 113 95 103 112 93 108 102 Mean 100 97 100 88 95 101 87 97 96 sd 14 16 19 10 13 16 9 16 8 Morph. obs. + + + + + + + + + Naringenin Viability (%) 95 96 96 95 93 95 89 85 76 48 104 105 95 92 91 95 94 94 74 47 Mean 100 95 93 92 95 92 89 75 47 sd 5 1 2 1 0 4 6 2 1 Morph. obs. + + + + + + + +/,* +/,* Nar-5-Rha Viability (%) 96 99 91 92 85 94 92 78 82 79 101 104 111 93 88 100 98 91 90 87 Mean 100 101 93 86 97 95 84 86 83 sd 3 14 1 2 4 4 9 6 6 Morph. obs. + + + + + + + + +/

[0310] Cytotoxicity measurements on monolayer cultures of NHEK demonstrated a better compatibility of the 5-O--L-rhamnosides versus their flavonoid aglycons at elevated concentration. Up to 100 M no consistent differences were observed (FIG. 10). However, at 250 M concentration of the aglycons hesperetin and naringenin the viability of NHEK was decreased to about 50% while the mitochondrial activity of NHEK treated with the corresponding 5-O--L-rhamnosides was still unaffected compared to lower concentrations. In particular these results were unexpected as the solubility of flavonoid aglycons generally is below 100 M in aqueous phases while that of glycosidic derivatives is above 250 M. These data clearly demonstrated that the 5-O--L-rhamnosides were less toxic to the normal human keratinocytes.

Example D-2: Anti-Inflammatory Properties

Anti-Inflammatory Potential

[0311] NHEK were pre-incubated for 24 h with the test compounds. The medium was replaced with the NHEK culture medium containing the inflammatory inducers (PMA or Poly I:C) and incubated for another 24 hours. Positive and negative controls ran in parallel. At the endpoint the culture supernatants were quantified of secreted IL-8, PGE2 and TNF-, by means of ELISA.

Anti-Inflammatory Effects of 5-O-Rhamnosides in NHEK Cell Cultures

[0312]

TABLE-US-00017 TABLE B3 Inhibition of 5-O-rhamnosides on Cytokine release in human keratinocytes (NHEK) % stim. Compound Cytokine [pg/mL] control Inhibition Conc. Stimulation Type Mean sd % sd p.sup.(1) % sd p.sup.(1) Non- Control 96 126 18 8 1 *** 100 1 *** stimulat 157 127 Stimulated Control 1846 1569 141 100 9 0 10 conditions: 1480 PMA - 1 g/ml 1381 Indomethacin 39 39 0 2 0 *** 106 0 *** 10.sup.6M 39 39 Dexamethasone 1318 1437 168 92 11 9 12 10.sup.6M 1556 HESR1 PMA PGE.sub.2 582 507 107 32 7 74 7 (HES-5- 431 Rha) IL-8 3242 2843 564 98 19 34 17 100 M 2445 poly(I:C) IL-8 2617 2793 250 76 7 24 7 2970 TNF 416 423 9 75 2 26 2 429 NR1 PMA PGE.sub.2 851 1271 594 81 38 21 41 (N-5- 1691 Rha) IL-8 2572 2564 12 88 0 12 0 100 M 2555 poly(I:C) IL-8 3055 3154 140 86 4 14 4 3253 TNF 516 516 0 92 0 8 0 516

[0313] Compared to control experiments the 5-O-rhamnosides showed anti-inflammatory activities on human keratinocytes concerning three different inflammation markers IL-8, TNF, and PGE2 under inflammatory stimuli (PMA, poly(I:C)). Especially, the activity of HESR1 on PGE2 was remarkable with a 74% inhibition. An anti-inflammatory activity is well documented for flavonoid derivatives. And several authors reported their action via COX, NFB, and MAPK pathways (Biesalski (2007) Curr Opin Clin Nutr Metab Care 10(6):724-728, Santangelo (2007) Ann Ist Super Sanita 43(4): 394-405). However, the exceptional water solubility of flavonoid-5-O-rhamnosides disclosed here allows much higher intracellular concentrations of these compounds than achievable with their rarely soluble aglycon counterparts. The aglycon solubilities are mostly below their effective concentration. Thus, the invention enables higher efficacy for anti-inflammatory purposes.

[0314] Among many other regulatory activities TNF also is a potent inhibitor of hair follicle growth (Lim (2003) Korean J Dermatology 41: 445-450). Thus, TNF inhibiting compounds contribute to maintain normal healthy hair growth or even stimulate it.

Example D-3: Antioxidative Properties

Antioxidative Effects of 5-O-Rhamnosides in NHEK Cell Cultures

[0315] Pre-incubated NHEK were incubated with the test compound for 24 h. Then the specific fluorescence probe for the measurement of hydrogen peroxide (DHR) or lipid peroxides (C.sub.11-fluor) was added and incubated for 45 min. Irradiation occurred with in H.sub.2O.sub.2 determination UVB at 180 mJ/cm.sup.2 (+UVA at 2839 mJ/cm.sup.2) or UVB at 240 mJ/cm.sup.2 (+UVA at 3538 mJ/cm.sup.2) in lipid peroxide, respectively, using a SOL500 Sun Simulator lamp. After irradiation the cells were post-incubated for 30 min before flow-cytometry analysis.

TABLE-US-00018 TABLE B4 Protection of 5-O-rhamnosides against UV-induced H.sub.2O.sub.2 stress in NHEK cells % irradiated Test H.sub.2O.sub.2 (AU) control Protection compound Concentration (DHR GMFI) Mean sd % sd p.sup.(1) % sd p.sup.(1) Non-Irradiated No DHR 9 8.77 0 condition probe 8 9 Control 311 316.33 3 17 0 ** 100 0 ** 319 319 Irradiated Control 1770 1846.83 209 100 11 0 14 conditions: 1307 180 mJ/cm.sup.2 UVB 2388 (2839 mJ/cm.sup.2 UVA) 1182 2169 2265 BHA 100 M 740 776 29 42 2 * 70 2 * 834 754 Vit. E 50 M 628 655 17 35 1 ** 78 1 ** 650 687 HESR1 100 M 1046 1152 150 62 8 45 10 1258 NR1 100 M 2531 2516.5 21 136 1 44 1 2502

TABLE-US-00019 TABLE B5 Protection of 5-O-rhamnosides against UV-induced lipid peroxide in NHEK cells % Irradiated Test C11-fluor (AU) control Protection compound Concentration GMFI 1/GMFI Mean sd % sd p.sup.(1) % sd p.sup.(1) Non- No C11- 3 3.1E01 3.1E01 1.1E02 Irradiated fluor 3 3.0E01 condition probe 3 3.3E01 Control 9049 1.1E04 1.1E04 7.6E06 23 2 *** 100 2 *** 10874 9.2E05 8504 1.2E04 Irradiated Control 2273 4.4E04 4.6E04 1.2E05 100 3 0 3 conditions: 2072 4.8E04 240 mJ/cm.sup.2 2166 4.6E04 UVB BHT 50 M 3139 3.2E04 3.3E04 8.5E06 72 2 37 2 *** (3538 mJ/cm.sup.2 UVA) 3047 3.3E04 2877 3.5E04 HESR1 100 M 1671 6.0E04 6.4E04 6.3E05 99 10 1 12 1455 6.9E04 NR1 100 M 2414 4.1E04 4.3E04 2.1E05 93 4 9 6 2255 4.4E04

[0316] An anti-oxidative function of the tested flavonoid-5-O-rhamnosides could be observed for HESR1 on mitochondrially produced hydrogen peroxides species and for NR1 on lipid peroxides, respectively. However, it is argued that these parameters are influenced also by different intracellular metabolites and factors, e.g. gluthation. Hence, interpretation of anti-oxidative response often is difficult to address to a single determinant.

Example D-4: Stimulating Properties of 5-O-rhamnosides

[0317] Tests were performed with normal human dermal fibroblast cultures at the 8.sup.th passage. Cells were grown in DMEM supplemented with glutamine at 2 mM, penicillin at 50 U/mL and streptomycin (50 g/mL) and 10% of fetal calf serum (FCS) at 37 C. in a 5% CO.sub.2 atmosphere.

Stimulation of Flavonoid-5-O-rhamnosides on Syntheses of Procollagen I, Release of VEGF, and Fibronectin Production in NHDF Cells

[0318] Fibroblasts were cultured for 24 hours before the cells were incubated with the test compounds for further 72 hours. After the incubation the culture supernatants were collected in order to measure the released quantities of procollagen I, VEGF, and fibronectin by means of ELISA. Reference test compounds were vitamin C (procollagen I), PMA (VEGF), and TGF- (fibronectin).

TABLE-US-00020 TABLE B6 Stimulation of 5-O-rhamnosides on procollagen I synthesis in NHDF cells Basic data Normalized data Treatment Procollagen I % % Compound Conc. (ng/ml) Mean sd Control sd p.sup.(1) Stimulation sd p.sup.(1) Control 1893 1667 122 100 7 0 7 1473 1637 Vitamin C 20 g/ml 4739 5272 323 316 19 *** 216 19 *** 5854 5225 NR1 100 M 1334 1097 335 66 20 34 20 860 HESR1 100 M 1929 1968 55 118 3 18 3 2007

TABLE-US-00021 TABLE B7 Stimulation of 5-O-rhamnosides on VEGF release in NHDF cells Basic data Normalized data Treatment VEGF Mean VEGF % sd % sd Compound Conc. (pg/ml) (pg/ml) sd Control (%) p.sup.(1) Stimulation (%) p.sup.(1) Control 83 72 6 100 9 0 9 73 61 PMA 1 g/ml 150 148 3 205 4 *** 105 4 *** 150 143 NR1 100 M 90 92 3 128 4 28 4 94 HESR1 100 M 70 73 5 101 6 1 6 76

TABLE-US-00022 TABLE B8 Stimulation of 5-O-rhamnosides on fibronectin synthesis in NHDF cells Basic data Normalized data Treatment Fibronectin Mean % sd % sd Compound Conc. (ng/ml) (ng/ml) sd Control (%) p.sup.(1) Stimulation (%) p.sup.(1) Control 6017 6108 86 100 1 0 1 6281 6027 TGF- 10 ng/ml 10870 #### 95 181 2 *** 81 2 *** 11178 11128 NR1 100 M 6833 7326 698 120 11 20 11 7820 HESR1 100 M 5843 5853 14 96 0 4 0 5864

[0319] Results demonstrated that flavonoid-5-O-rhamnosides can positively affect extracellular matrix components. HESR1 stimulated procollagen I synthesis in NHDF by about 20% at 100 M. NR1 at 100 M had a stimulating effect on fibronectin synthesis with an increase of 20% in NHDF. Both polymers are well known to be important extracellular tissue stabilization factors in human skin. Hence substances promoting collagen synthesis or fibronectin synthesis support a firm skin, reduce wrinkles and diminish skin aging. VEGF release was also stimulated approx. 30% by NR1 indicating angiogenic properties of flavonoid-5-O-rhamnosides. Moderate elevation levels of VEGF are known to positively influence hair and skin nourishment through vascularization and thus promote e.g. hair growth (Yano (2001) J Clin Invest 107:409-417, KR101629503B1). Also, Fibronectin was described to be a promoting factor on human hair growth as stated in US 2011/0123481 A1. Hence, NR1 stimulates hair growth by stimulating the release of VEGF as well as the synthesis of fibronectin in normal human fibroblasts.

Stimulation of Flavonoid-5-O-rhamnosides on MMP-1 Release in UVA-Irradiated NHDF

[0320] Human fibroblasts were cultured for 24 hours before the cells were pre-incubated with the test or reference compounds (dexamethasone) for another 24 hours. The medium was replaced by the irradiation medium (EBSS, CaCl.sub.2) 0.264 g/L, MgClSO.sub.4 0.2 g/L) containing the test compounds) and cells were irradiated with UVA (15 J/cm.sup.2). The irradiation medium was replaced by culture medium including again the test compounds incubated for 48 hours. After incubation the quantity of matrix metallopeptidase 1 (MMP-1) in the culture supernatant was measured using an ELISA kit.

TABLE-US-00023 TABLE B10 Stimulation of 5-O-rhamnosides on UV-induced MMP-1 release in NHDF cells Basic data Mean % Normalized data Treatment MMP-1 MMP-1 Irradiated sd % sd Test compound Conc. (ng/ml) (ng/ml) sd control (%) p.sup.(1) Protection (%) p.sup.(1) Non- Control 28.1 25.5 1.6 36 2 ** 100 4 ** Irradiated 26.1 22.5 Irradiated conditions: Control 83.7 71.0 7.1 100 10 0 16 15 J/cm.sup.2 UVA 59.1 70.3 Dexamethasone 10.sup.7M 2.5 2.9 0.2 4 0 *** 150 0 *** 3.1 3.2 NR1 100 M 211.7 240.3 40.3 338 57 372 89 268.8 HESR1 100 M 87.0 82.2 6.8 116 10 25 15 77.4

[0321] Flavonoid-5-O-rhamnosides showed high activities on MMP-1 levels in NHDF. NR1 caused a dramatic upregulation of MMP-1 biosynthesis nearly 4-fold in UV-irradiated conditions.

[0322] MMP-1 also known as interstitial collagenase is responsible for collagen degradation in human tissues. Here, MMP-1 plays important roles in pathogenic arthritic diseases but was also correlated with cancer via metastasis and tumorigenesis (Vincenti (2002) Arthritis Res 4:157-164, Henckels (2013) F.sub.1000Research 2:229). Additionally, MMP-1 activity is important in early stages of wound healing (Caley (2015) Adv Wound Care 4: 225-234). Thus, MMP-1 regulating compounds can be useful in novel wound care therapies, especially if they possess anti-inflammatory and VEGF activities as stated above.

[0323] NR1 even enables novel therapies against arthritic diseases via novel biological regulatory targets. For example, MMP-1 expression is regulated via global MAPK or NFB pathways (Vincenti and Brinckerhoff 2002, Arthritis Research 4(3):157-164). Since flavonoid-5-O-rhamnosides are disclosed here to possess anti-inflammatory activities and reduce IL-8, TNF, and PGE-2 release, pathways that are also regulated by MAPK and NFB. Thus, one could speculate that MMP-1 stimulation by flavonoid-5-O-rhamnosides is due to another, unknown pathway that might be addressed by novel pharmaceuticals to fight arthritic disease.

[0324] Current dermocosmetic concepts to reduce skin wrinkles address the activity of collagenase. Next to collagenase inhibition one contrary concept is to support its activity. In this concept misfolded collagene fibres that solidify wrinkles within the tissue are degraded by the action of collagenases. Simultaneously, new collagene has to be synthesized by the tissue to rebuild skin firmness. In this concept, the disclosed flavonoid-5-O-rhamnosides combine ideal activities as they show stimulating activity of procollagen and MMP-1.

[0325] Finally, MMP-1 upregulating flavonoid-5-O-rhamnosides serve as drugs in local therapeutics to fight abnormal collagene syndroms like Dupuytren's contracture.

Example D-5: Modulation of Transcriptional Regulators by Flavonoid-5-O-Rhamnosides

NF-B Activity in Fibroblasts

[0326] NIH3T3-KBF-Luc cells were stably transfected with the KBF-Luc plasmid (Sancho (2003) Mol Pharmacol 63:429-438), which contains three copies of NF-B binding site (from major histocompatibility complex promoter), fused to a minimal simian virus 40 promoter driving the luciferase gene. Cells (110.sup.4 for NIH3T3-KBF-Luc) were seeded the day before the assay on 96-well plate. Then the cells were treated with the test substances for 15 min and then stimulated with 30 ng/ml of TNF. After 6 h, the cells were washed twice with PBS and lysed in 50 l lysis buffer containing 25 mM Tris-phosphate (pH 7.8), 8 mM MgCl.sub.2, 1 mM DTT, 1% Triton X-100, and 7% glycerol during 15 min at RT in a horizontal shaker. Luciferase activity was measured using a GloMax 96 microplate luminometer (Promega) following the instructions of the luciferase assay kit (Promega, Madison, Wis., USA). The RLU was calculated and the results expressed as percentage of inhibition of NF-B activity induced by TNF (100% activation) (tables B10.1-B10.3). The experiments for each concentration of the test items were done in triplicate wells.

TABLE-US-00024 TABLE B10.1 Influence of 5-O-rhamnosides on NF-B activity in NIH3T3 cells RLU % RLU 1 RLU 2 RLU 3 MEAN specific Activation Control 38240 38870 34680 37263 0 0 TNF 30 ng/ml 115870 120220 121040 119043 81780 100.0 +30 ng/ml TNF HESR1 10 M 186120 181040 182280 183147 145883 178.4 HESR1 25 M 218940 216580 213320 216280 179017 218.9 NR1 10 M 134540 126580 130240 130453 93190 114.0 NR1 25 M 151080 151840 143870 148930 111667 136.5 Chrysin 10 M 301630 274240 303950 293273 256010 313.0 Chrysin 25 M 273410 272580 285980 277323 240060 293.5

TABLE-US-00025 TABLE B10.2 Influence of 5-O-rhamnosides on NF-B activity in NIH3T3 cells RLU % RLU 1 RLU 2 RLU 3 MEAN specific Activation Control 23060 23330 23700 23363 0 0 TNF 30 ng/ml 144940 156140 160200 153760 130397 100.0 +30 ng/ml TNF CR1 10 M 157870 169000 173010 166627 143263 109.9 CR1 25 M 175140 183630 183960 180910 157547 120.8 CR2 10 M 156600 160140 151070 155937 132573 101.7 CR2 25 M 170390 179220 163490 171033 147670 113.2 Diosmetin 10 M 398660 411390 412940 407663 384300 294.7 Diosmetin 25 M 448530 452660 451610 450933 427570 327.9 DR2 10 M 211150 215320 213260 213243 189880 145.6 DR2 25 M 245900 241550 234880 240777 217413 166.7 Biochanin A 10 M 588070 586440 579220 584577 561213 430.4 Biochanin A 25 M 570360 573190 594510 579353 555990 426.4 BR1 10 M 259120 247590 229500 245403 222040 170.3 BR1 25 M 211660 208010 203720 207797 184433 141.4 BR2 10 M 205410 202640 202940 203663 180300 138.3 BR2 25 M 237390 235850 235350 236197 212833 163.2

TABLE-US-00026 TABLE B10.3 Influence of 5-O-rhamnosides on NF-B activity in NIH3T3 cells RLU % RLU 1 RLU 2 RLU 3 MEAN specific Activation Control 32200 33240 33100 32847 0 0 TNF 30 ng/ml 179150 179270 184270 180897 148050 100.0 +30 ng/ml Silibinin 10 M 249050 238550 231180 239593 206747 139.6 TNF Silibinin 25 M 212420 210050 200660 207710 174863 118.1 SR1 10 M 269710 262180 254090 261993 229147 154.8 SR1 25 M 174940 171280 171730 172650 139803 94.4

[0327] It was reported that NF-B activity is reduced by many flavonoids (Prasad (2010) Planta Med 76: 1044-1063). Chrysin was reported to inhibit NF-B activity through the inhibition of IB phosphorylation (Romier(2008) Brit J Nutr 100: 542-551). However, when NIH3T3-KBF-Luc cells were stimulated with TNF the activity of NF-B was generally co-stimulated by flavonoids and their 5-O-rhamnosides at 10 M and 25 M, respectively.

STAT3 Activity

[0328] HeLa-STAT3-luc cells were stably transfected with the plasmid 4M67 pTATA TK-Luc. Cells (2010.sup.3 cells/ml) were seeded 96-well plate the day before the assay. Then the cells were treated with the test substances for 15 mM and then stimulated with IFN- 25 IU/ml. After 6 h, the cells were washed twice with PBS and lysed in 50.sub.111 lysis buffer containing 25 mM Tris-phosphate (pH 7.8), 8 mM MgCl.sub.2, 1 mM DTT, 1% Triton X-100, and 7% glycerol during 15 mM at RT in a horizontal shaker. Luciferase activity was measured using GloMax 96 microplate luminometer (Promega) following the instructions of the luciferase assay kit (Promega, Madison, Wis., USA). The RLU was calculated and the results were expressed as percentage of inhibition of STAT3 activity induced by IFN- (100% activation) (tables B11.1-B11.3). The experiments for each concentration of the test items were done in triplicate wells.

TABLE-US-00027 TABLE B11.1 STAT3 activation by flavonoids and their 5-O-rhamnosides in HeLa cells RLU RLU 1 RLU 2 RLU 3 MEAN specific % Activation Control 2060 2067 1895 2007 0 0 IFN 25 U/ml 12482 15099 15993 14525 12517 100 +IFN 25 U/ml HESR1 25 M 13396 12243 12859 12833 10825 86.48 HESR1 50 M 14303 13124 11985 13137 11130 88.92 NR1 25 M 10925 8301 8752 9326 7319 58.47 NR1 50 M 18272 6426 7599 10766 8758 69.97 Chrysin 25 M 28031 22367 17504 22634 20627 164.78 Chrysin 50 M 27912 3531 16304 15916 13908 111.11 C57dR 25 M 11316 1954 8493 7254 5247 41.92 C57dR 50 M 9196 2358 6307 5954 3946 31.53 C5R 25 M 7897 2398 5326 5207 3200 25.56 C5R 50 M 6897 7665 10507 8356 6349 50.72 Diosmetin 25 M 16337 14303 17066 15902 13895 111.00 Diosmetin 50 M 9189 7751 7857 8266 6258 50.00 D5R 25 M 12137 10269 9275 10560 8553 68.33 D5R 50 M 13005 10547 10143 11232 9224 73.69

TABLE-US-00028 TABLE B11.2 STAT3 activation by flavonoids and their 5-O-rhamnosides in HeLa cells RLU RLU 1 RLU 2 RLU 3 MEAN specific % Activation Control 1875 1815 1815 1835 0 0 IFN 25 U/ml 9659 9851 10116 9875 8040 100 +IFN 25 U/ml Biochanin A 25 M 9732 9023 8911 9222 7387 91.87 Biochanin A 50 M 6804 12097 11786 10229 8394 104.40 BR1 25 M 8162 12819 11157 10713 8878 110.41 BR1 50 M 12336 11620 12104 12020 10185 126.67 BR2 25 M 11157 10163 10660 10660 8825 109.76 BR2 50 M 7983 9023 11110 9372 7537 93.74 Silibinin 25 MI 12389 11170 11210 11590 9755 121.32 Silibinin 50 M 12157 11885 10540 11527 9692 120.55

TABLE-US-00029 TABLE B11.3 STAT3 activation by flavonoids and their 5-O-rhamnosides in HeLa cells RLU % Acti- RLU 1 RLU 2 RLU 3 MEAN specific vation Control 2312 2233 2173 2239 0 0 IFN 25 U/ml 11375 10852 11269 11165 9158 100 SR1 25 M + 9507 11653 10203 10454 8447 92.24 IFN 25 U/ml SR1 50 M + 10090 11355 10938 10794 8787 95.95 IFN 25 U/ml

[0329] STAT3 is a transcriptional factor of many genes related to epidermal homeostasis. Its activity has effects on tissue repair and injury healing but also is inhibiting on hair follicle regeneration (Liang (2012) J Neurosci32:10662-10673). STAT3 activity may even promote melanoma and increases expression of genes linked to cancer and metastasis (Cao(2016) Sci. Rep. 6, 21731).

Example D-6: Alteration of Glucose Uptake into Cells by Flavonoid 5-O-Rhamnosides

Determination of Glucose Uptake in Keratinocytes

[0330] HaCaT cells (510.sup.4) were seeded in 96-well black plates and incubated for 24 h. Then, medium was removed and the cells cultivated in OptiMEM, labeled with 50 M 2-NBDG (2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose and treated with the test substances or the positive control, Rosiglitazone, for 24 h. Medium was removed and the wells were carefully washed with PBS and incubated in PBS (100 l/well). Finally the fluorescence was measured using the Incucyte FLR software, the data were analyzed by the total green object integrated intensity (GCUm2Well) of the imaging system IncuCyte HD (Essen BioScience). The fluorescence of Rosiglitazone is taken as 100% of glucose uptake, and the glucose uptake was calculated as (% Glucose uptake)=100(TB)/(RB), where T (treated) is the fluorescence of test substance-treated cells, B (Basal) is the fluorescence of 2-NBDG cells and P (Positive control) is the fluorescence of cells treated with Rosiglitazone. Results of triplicate measurements are given in tables B12.1 and B12.2.

TABLE-US-00030 TABLE B12.1 Influence of flavonoid 5-O-rhamnosides on Glucose uptake in HaCaT cells % RFU Glucose Measure 1 Measure 2 Measure 3 Mean specific uptake Control 8945 6910 3086 6314 0 0.0 2NBDG 50 M 176818 359765 312467 283017 276703 0.0 +2NBDG 50 M Rosiglitazone 776381 707003 1141924 875103 868789 100.0 80 M HESR1 25 M 756943 549324 384251 563506 557192 64.1 HESR1 50 M 501977 642949 529620 558182 551868 63.5 NR1 25 M 493970 1160754 649291 768005 761691 87.7 NR1 50 M 278134 256310 257198 263881 257567 29.6 CR1 25 M 291406 358114 628963 426161 419847 48.3 CR1 50 M 619992 595330 174412 463245 456931 52.6 CR2 25 M 427937 431593 390512 416681 410367 47.2 CR2 50 M 771478 1100390 923151 931673 925359 106.5 DR2 25 M 632398 940240 197738 590125 583811 67.2 DR2 50 M 2958363 1297231 2493030 2249541 2243227 258.2

TABLE-US-00031 TABLE B12.2 Influence of flavonoid 5-O-rhamnosides on Glucose uptake in HaCaT cells % RFU Glucose Measure 1 Measure 2 Measure 3 Mean specific uptake Control 44637 49871 4750 33086 0 0.0 2NBDG 50 M 492141 470496 873235 611957 578871 0.0 +2NBDG 50 M Rosiglitazone 923011 1440455 1584421 1315962 1282877 100.0 80 M BR1 25 M 730362 661244 400131 597246 564160 44.0 BR1 50 M 899548 626443 743535 756509 723423 56.4 BR2 25 M 998132 1149619 935073 1027608 994522 77.5 BR2 50 M 1657600 1788604 1619334 1688513 1655427 129.0 SR1 25 M 579565 3067153 4212718 2619812 2586726 201.6 SR1 50 M 2064420 3541782 2654102 2753435 2720349 212.1