Melon plants with a dominant melon yellowing associated virus (MYaV) resistance gene
10334797 ยท 2019-07-02
Assignee
Inventors
- Ebenezer Ogundiwin (Woodland, CA)
- Dyeme Bento (Rio Grande do Norte, BR)
- Peter Visser (Gainesville, FL, US)
Cpc classification
International classification
A01H1/04
HUMAN NECESSITIES
A01H1/02
HUMAN NECESSITIES
Abstract
The present invention relates to the field of melon plants having a dominant Melon Yellowing associated Virus (MYaV) resistance gene in their genome, introgressed from wild melon accessions.
Claims
1. A non-wild cultivated Cucumis melo plant, or part thereof, comprising resistance against Melon Yellowing associated Virus (MYaV) wherein said resistance is conferred by an introgression fragment on chromosome 6 in homozygous or heterozygous form and wherein said introgression fragment is from a wild accession of the species Cucumis melo, a representative sample of seeds of said wild accession having been deposited under accession number NCI MB 41967 or NCIMB 41968, wherein said introgression fragment comprises at least two of the following SNP markers: a) the CC or AC genotype for the Single Nucleotide Polymorphism marker mME15090 in SEQ ID NO: 1; b) the AA or AG genotype for the Single Nucleotide Polymorphism marker mME12135 in SEQ ID NO: 3; c) the AA or AG genotype for the Single Nucleotide Polymorphism marker mME21377 in SEQ ID NO: 8; and/or d) the TT or CT genotype for the Single Nucleotide Polymorphism marker mME13585 in SEQ ID NO: 12.
2. The plant according to claim 1, wherein said plant has an average MYaV disease score of at least 3 on a scale of 1=totally yellow leaves to 9=totally green leaves when grown in an MYaV infested area.
3. The plant according to claim 1, wherein said introgression fragment comprises at least three of the following SNP markers: a) the CC or AC genotype for the Single Nucleotide Polymorphism marker mME15090 in SEQ ID NO: 1; b) the AA or AG genotype for the Single Nucleotide Polymorphism marker mME12135 in SEQ ID NO: 3; c) the AA or AG genotype for the Single Nucleotide Polymorphism marker mME21377 in SEQ ID NO: 8; and/or d) the TT or CT genotype for the Single Nucleotide Polymorphism marker mME13585 in SEQ ID NO: 12.
4. The plant according to claim 1, wherein said introgression fragment comprises at least one of: a) the CC or AC genotype for the Single Nucleotide Polymorphism marker mME15090 in SEQ ID NO: 1; and/or b) the AA or AG genotype for the Single Nucleotide Polymorphism marker mME12135 in SEQ ID NO: 3.
5. The plant according to claim 1, wherein said plant does not comprise the following Single Nucleotide Polymorphism (SNP) markers: a) the TT or GT genotype for the SNP marker mME36533 in SEQ ID NO: 11; and b) at least one of: the GG or AG genotype for the SNP marker mME40332 in SEQ ID NO: 2; the TT or AT genotype for the SNP marker mME28908 in SEQ ID NO: 4; the AA or AT genotype for the SNP marker mME9692 in SEQ ID NO: 6; and/or the CC or CT genotype for the SNP marker mME50656 in SEQ ID NO: 7.
6. The plant according to claim 1, wherein said introgression fragment is a fragment of the chromosome 6 which is present in seeds deposited under accession number NCIMB 41967 or NCIMB 41968.
7. The plant according to claim 1, wherein said plant is an F1 hybrid.
8. The plant according to claim 1, wherein said introgression fragment is equal to or less than 10 Mb in size.
9. Seeds from which a plant according to claim 1 can be grown.
10. A melon fruit harvested from a plant according to claim 1.
11. A plant cell, tissue or plant part of a plant or of a seed according to claim 1 comprising at least one recombinant chromosome 6, wherein said recombinant chromosome 6 comprises an introgression fragment from a wild C. melo plant and wherein said introgression fragment comprises an allele conferring MYaV resistance.
12. A method for producing a non-wild cultivated C. melo plant comprising an introgression fragment on chromosome 6, wherein said introgression fragment comprises an MYaV-resistance allele, comprising: a) crossing a first melon plant being susceptible to MYaV with a second melon plant having resistance to MYaV, said second melon plant is grown from seeds deposited under accession number NCI MB 41967, NCI-4IB 41968 or MYaV-resistant progeny of either of these; b) collecting F1 seeds from said cross and growing said F1 seeds to obtain F1 plants having an introgression fragment on chromosome 6, wherein said introgression fragment comprises the CC or AC genotype for the SNP marker mME15090 in SEQ ID NO: 1 and/or the AA or AG genotype for the SNP marker mM1E12135 in SEQ ID NO: 3, c) optionally selfing said F1 plants one or more times to produce an F2 or F3 or further selling population, d) optionally backcrossing an F1 plant or an F2 or F3 or further selling plant to the first melon plant of part a) to produce a backcross population, e) optionally selfing the backcross population one or more times, and f) identifying an F2, F3, further selfing or backcross plant which comprises the CC or AC genotype for the SNP marker mM15090 in SEQ ID NO: 1 and/or the AA or AG genotype for the SNP marker mME12135 in SEQ ID NO: 3.
13. A method for identifying a non-wild cultivated C. melo plant comprising an introgression fragment on chromosome 6, wherein said introgression fragment comprises an MYaV-resistance allele and wherein said introgression fragment is a fragment of chromosome 6 as found in NCIMB 41967 or NCIM1B 41968 and said introgression fragment comprises the CC or AC genotype for the SNP marker mME15090 in SEQ ID NO: 1 and/or the AA or AG genotype for the SNP marker mME12135 in SEQ ID NO: 3, comprising: a) screening a population of recombinant, C. melo plants using a molecular marker assay which detects at least one of: SNP marker mME15090 in SEQ ID NO: 1 and/or SNP marker mME12135 in SEQ ID NO: 3; and b) identifying and/or selecting a plant comprising at least the CC or AC genotype for the SNP marker mME15090 in SEQ ID NO: 1 and/or the AA or AG genotype for the SNP marker mME12135 in SEQ ID NO: 3.
14. A method of producing C. melo F1 hybrid plants comprising a MYaV resistance phenotype comprising: a) crossing a first inbred melon plant comprising at least one recombinant chromosome 6 having an introgression fragment comprising an allele conferring MYaV resistance, wherein said introgression fragment is from NCIMB 41967, NCIMB 41968 or MYaV-resistant progeny of either of these and said introgression fragment comprises the CC or AC genotype for the SNP marker mME15090 in SEQ ID NO: 1 and/or the AA or AG genotype for the SNP marker mME12135 in SEQ ID NO: 3, with a second inbred melon plant with or without recombinant chromosome 6 having an introgression fragment comprising an allele conferring MYaV resistance, and b collecting F1 hybrid seeds from said cross.
15. A method for generating MYaV resistant progeny of NCIMB41967 or NCIMB41968, said method comprising: a) growing a plant from seeds deposited under accession number NCIMB41967 or NCIMB41968; b) selfing said plant one or more times or crossing said plant one or more times with another melon plant to generate progeny seeds; c) screening said progeny seeds or plants grown from said seeds or parts of the seeds or plants using a molecular marker assay which detects at least one of: SNP marker mME15090 in SEQ ID NO: 1 and/or SNP marker mME12135 in SEQ ID NO: 3; d) identifying and/or selecting a progeny plant comprising at least the CC or AC genotype for the SNP marker mME15090 in SEQ ID NO: 1 and/or the AA or AG genotype for the SNP marker mME12135 in SEQ ID NO: 3; and optionally e) confirming MYaV resistance of the progeny plant in an MYaV resistance assay.
16. The plant according to claim 1, wherein said introgression fragment is equal to or less than 8 Mb in size.
Description
FIGURE LEGENDS
(1)
(2)
SEED DEPOSITS
(3) A representative sample of seeds of wild melon accessions comprising the QTL (designated MYaV6.1) for MYaV resistance on chromosome 6 were deposited by Nunhems B.V. on 2 May 2012 at the NCIMB Ltd. (Ferguson Building, Craibstone Estate, Bucksburn Aberdeen, Scotland AB21 9YA, UK) according to the Budapest Treaty, under the Expert Solution (EPC 2000, Rule 32(1)). Seeds were given the following deposit numbers: NCIMB 41966 and NCIMB 41969 and NCIMB41967 and NCIMB41968.
(4) A representative sample (2600) of seeds (BC1S2) of a cultivated melon plant comprising the QTL for MYaV resistance on chromosome 6 in homozygous form (designated MYaV6.1) was deposited by Nunhems B.V. on 15 Feb. 2013 at the NCIMB Ltd. (Ferguson Building, Craibstone Estate, Bucksburn Aberdeen, Scotland AB21 9YA, UK) according to the Budapest Treaty, under the Expert Solution (EPC 2000, Rule 32(1)). Seeds were given the following deposit number: NCIMB 42113.
(5) A representative sample of seeds (BC4F2) of a cultivated melon plant comprising the QTL for MYaV resistance on chromosome 6 in homozygous form (designated MYaV6.1) was deposited by Nunhems B.V. on 12 Dec. 2013 at the NCIMB Ltd. (Ferguson Building, Craibstone Estate, Bucksburn Aberdeen, Scotland AB21 9YA, UK) according to the Budapest Treaty, under the Expert Solution (EPC 2000, Rule 32(1)). Seeds were given the following deposit number: NCIMB 42198.
(6) The Applicant requests that samples of the biological material and any material derived therefrom be only released to a designated Expert in accordance with Rule 32(1) EPC or related legislation of countries or treaties having similar rules and regulation, until the mention of the grant of the patent, or for 20 years from the date of filing if the application is refused, withdrawn or deemed to be withdrawn.
(7) Access to the deposit will be available during the pendency of this application to persons determined by the Director of the U.S. Patent Office to be entitled thereto upon request. Subject to 37 C.F.R. 1.808(b), all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent. The deposit will be maintained for a period of 30 years, or 5 years after the most recent request, or for the enforceable life of the patent whichever is longer, and will be replaced if it ever becomes nonviable during that period. Applicant does not waive any rights granted under this patent on this application or under the Plant Variety Protection Act (7 USC 2321 et seq.).
(8) The following non-limiting Examples describe how one can obtain plants according to the invention, comprising a recombinant chromosome 6. Unless stated otherwise in the Examples, all recombinant DNA techniques are carried out according to standard protocols as described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, and Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY; and in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by R. D. D. Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK. Standard breeding methods are described in Principles of Plant breeding, Second Edition, Robert W. Allard (ISBN 0-471-02309-4).
Example 1Resistance on Chromosome 6 of NCIMB 41966
(9) 1.1 Material and Methods
(10) 1.1.1 F2 and F3 Population Development
(11) A cross was made between the breeding line (990631-2)-Q-1-K, which is susceptible to MYaV, and a wild melon accession, Cucmis melo ssp. agrestis, obtained from the USA but originally originating from India, seeds of which were deposited by Nunhems B.V. under accession number NCIMB 41966.
(12) F1 progeny obtained from the cross were selfed to obtain an F2 population, which was used for genotyping (96 F2 plants were genotyped). F2 plants were selfed to obtain F3 families, which were phenotyped in an MYaV resistance assay in the field, near Mossoro, Brazil in 2010, as described below.
(13) 1.1.2 MYaV-Resistance Assay of F3 Families
(14) The MYaV-resistance assays were conducted in 2010 in the open field near Mossoro, under natural high MYaV incidence. Each F3 family was planted in three replicates of 20 plants per replicate in 2010, together with susceptible controls (4 plants, 3 replicates) and resistant control NCIMB41966 (20 plants). A complete randomized design was used, as the disease pressure was uniform across the field.
(15) Susceptible controls were Glory F1 (Origene Seeds), Ruidera F1, Amaregal F1, Guapore, Goldex, DRY9150 and Sancho (Syngenta).
(16) Phenotyping for MYaV-symptoms was conducted visually, when the susceptible controls showed clear yellowing symptoms.
(17) Each plant was given a disease score on the following scale, whereby only the older leaves, i.e. the first third (.sup.rd) of the plant around the main stem and root system, are used. Thus, when referring herein to all leaves or few leaves or a certain percentage of total leaf area, only the leaves in the oldest .sup.rd of the plant is referred to, see also
(18) TABLE-US-00001 9 Totally green (all leaves in the oldest .sup.rd of the plant are green) 8 Few leaves (in the oldest .sup.rd of a plant) start to show yellow shadow/mottling 7 Up to about 17% of total leaf area (in the oldest .sup.rd of a plant) is yellow 6 About 17% to 32% of total leaf area (in the oldest .sup.rd of a plant) is yellow 5 33% to 48% of total leaf area (in the oldest .sup.rd of a plant) is yellow 4 49% to 64% of total leaf area (in the oldest .sup.rd of a plant) is yellow 3 65% to 80% of total leaf area (in the oldest .sup.rd of a plant) is yellow 2 81% to 99% leaves area (in the oldest .sup.rd of the plant) yellow 1 Totally yellow (all leaves in the oldest .sup.rd of the plant are yellow)
(19) The average disease score was calculated per F3 family and per control.
(20) 1.1.3 Genotyping of F2 Families
(21) Genotyping of F2 families was done using the SNP (Single Nucleotide Polymorphism) Illumina Infinium Array, containing 4600 SNPs. Some ICuGI SSR (Single Sequence Repeat) markers were also analysed and served as anchor markers alongside a few other anchor SNP markers to determine linkage group number and orientation.
(22) 1.1.4 Data Analysis of F2 Genotype and F3 Phenotype Data
(23) Linkage mapping was conducted using JoinMap v4 and QTL analysis was conducted with MapQTL v5 software.
(24) 1.2 Results
(25) 1.2.1 Results of the MYaV Resistance Assay in 2010
(26) The results for the susceptible and resistant checks are shown below:
(27) TABLE-US-00002 Average Yellowing Scoring MYaV susceptible check varieties Glory 2 Ruidera 1.44 Amaregal 1.29 Guapor 1 Goldex 1 DRY 9150 1 Sancho 1 MYaV resistant check NCIMB41966 9
1.2.2 Results of QTL Mapping of F2 and F3 Families
(28) The SNP markers mapped to 12 linkage groups, corresponding to the haploid chromosome number of melon.
(29) For the 2010 phenotype data a significant QTL for MYaV resistance was found on linkage group VI (based on ICuGI nomenclature), with a peak LOD score of 6.3 and explaining 32.6% of the observed phenotypic variation for MYaV resistance.
(30) The results are shown in
(31) The following SNP markers were associated with the MYaV resistance phenotype. The SNP genotype of the resistant and susceptible parent at the marker locus is also indicated in the Table.
(32) TABLE-US-00003 TABLE 1 SNP genotype of resistant Susceptible Resistant heterozygous LOD parent: parent plant (comprising score (990631- NCIMB 1 recombinant (2010 SEQ NMID SNP 2)-Q-1-K 41966 chromosome) data) ID NO: mME15090 [A/C] AA CC CA 1.33** 1 mME40332 [A/G] AA GG GA 2.20** 2 mME12135 [A/G] GG AA AG 5.30 3 mME28908 [A/T] AA TT TA 5.26 4 mME9692 [A/T] TT AA AT 3.13 6 mME50656* [C/T] TT CC CT 1.43** 7 *corresponds to EST marker A_38-F04 (GenBank Accession AM730270), which was used to link the genetic map of linkage group VI to the physical map (scaffold 00021). See Garcia-Mas et al. June 2012, PNAS Early Edition, page 1-6, Supplementary Information Appendix - FIG. S2. **even though the LOD score is below 3.0, these markers are still considered significant, as confirmed using separate phenotyping data obtained in 2009 (results not shown)
Example 2Resistance on Chromosome 6 of NCIMB 41969
(33) 2.1 Material and Methods
(34) 2.1.1 F2 Population Development
(35) A cross was made between the hybrid Galia melon variety Amaregal F1, which is susceptible to MYaV, and a wild melon accession, obtained from Spain but originally originating from Uzbekistan, seeds of which were deposited by Nunhems B.V. under accession number NCIMB 41969.
(36) F1 progeny obtained from the cross were selfed to obtain an F2 population, which was used for genotyping (181 F2 plants). F2 plants were phenotyped in an MYaV resistance assay in the field, near Mossoro, Brazil in 2011, as described below.
(37) 2.1.2 MYaV-Resistance Assay of F2 Plants
(38) The MYaV-resistance assays were conducted in 2011 in the open field near Mossoro, under natural high MYaV incidence.
(39) Susceptible controls (10 plants per plot) were Amaregal (Nunhems), Sancho (Syngenta), and Caribbean Gold. Also NCIMB 41969 was included as resistant check (20 plants per plot).
(40) Phenotyping for MYaV-symptoms was conducted visually, when the susceptible controls showed clear yellowing symptoms.
(41) Each plant was given a disease score on the scale described above under 1.1.2.
(42) The average disease score was calculated per plant line or variety.
(43) 2.1.3 Genotyping of F2 Families
(44) Genotyping of F2 plants was done using a genome wide set of 96 markers on a KASP-platform for the initial scaffold map. Some ICuGI SSR (Single Sequence Repeat) markers were also analysed and served as anchor markers alongside a few other anchor SNP markers to determine linkage group number and orientation.
(45) 2.1.4 Data Analysis of F2 Genotype and F2 Phenotype Data
(46) Linkage mapping was conducted using JoinMap v4 and QTL analysis was conducted with MapQTL v5 software.
(47) 2.2 Results
(48) 2.2.1 Results of the MYaV Resistance Assay in 2011
(49) The results for the susceptible and resistant checks are shown below:
(50) TABLE-US-00004 Average Yellowing Scoring MYaV susceptible check varieties Amaregal 1 Sancho 1 Caribbean Gold 1 MYaV resistant check NCIMB41969 9
2.2.2 Results of QTL Mapping of F2 Plants
(51) The SNP markers mapped to 12 linkage groups, corresponding to the haploid chromosome number of melon.
(52) A significant QTL for MYaV resistance was found on linkage group VI (based on ICuGI nomenclature), with a peak LOD score of 50.3 and explaining 91.7% of the observed phenotypic variation for MYaV resistance.
(53) The results are shown in
(54) The following SNP markers were associated with the QTL. The SNP genotype of the resistant and susceptible parent at the marker locus is also indicated in the Table.
(55) TABLE-US-00005 TABLE 2 SNP genotype of resistant Resistant heterozygous LOD parent plant (comprising score Susceptible NCIMB 1 recombinant (2011 SEQ NMID SNP parent: 41969 chromosome) data) ID NO: mME21377 [A/G] GG AA AG 6.81 8 mME15090 [A/C] AA CC ( CA 17.14 9 mME12135 [A/G] GG AA AG 24.86 10 mME36533 [G/T] GG TT TG 7.64 11 mME13585 [C/T] CC TT TC 6.58 12
(56) Examples 1 and 2, above, show that an introgression fragment from wild melons, comprising a MYaV resistance conferring locus, confers MYaV-resistance when transferred into cultivated melon. As the QTL mapped to linkage group 6, the QTL was termed MYaV6.1. Seeds of such cultivated melon plants comprising the QTL termed MYaV6.1, have been deposited under deposit number NCIMB 42113 (comprising the introgression fragment from NCIMB 41969) and NCIMB 42198 (comprising the introgression fragment from NCIMB 41966).
(57) The QTL MYaV6.1 was found in two wild melon accessions, from different origins (India and Uzbekistan), and two SNP markers (mME12135 and ME15090) was found to be commonly linked to the QTL in both populations, while four SNP markers (mME40332, mME28908, mME9692 and mME50656) and three SNP markers (mME21377, mME36533 and mME13585) were associated with (linked to) the QTL derived from NCIMB41966 and NCIMB41969, respectively.
(58) One or more (at least two, three, four, five, six, seven, or more) or all of the SNP markers associated with MYaV6.1 provided herein, can be used for various purposes, such as a) to detect the presence of an introgression fragment on chromosome 6 comprising QTL MYaV6.1 in cultivated melon plants or plant parts; b) to transfer the recombinant chromosome 6, comprising the MYaV-resistance conferring locus (MYaV6.1), from one cultivated melon into other cultivated melon plants, especially MYaV-susceptible varieties or breeding lines; c) to generate and/or select new cultivated melon plants comprising an introgression with QTL MYaV6.1 from a wild source, such as a wild melon or wild relative of melon (such as from NCIMB 41966 or NCIMB 41969, or other wild melons or wild relatives of melon), d) to reduce the size of the wild introgression fragment comprising the QTL MYaV6.1, i.e. to generate and select recombinants having a smaller introgression fragment on chromosome 6, but which retain the MYaV resistance conferring part of the introgression fragment; e) to develop alternative molecular markers for any of the aforementioned purposes, linked to MYaV6.1; f) to screen wild melon accessions or wild relatives of melon for the presence of one or more of the markers and, thus, the presence of QTL MYaV6.1 and to introgress the resistance-conferring part of these new resistance sources into cultivated, MYaV-susceptible, melon plants.
Example 3SNP Assays (KASP Assay) or MYaV-Marker Assay
(59) In order to screen plants for the presence of one or more of the above molecular markers, linked to the introgression fragment conferring MYaV resistance, a KASP-assay (a SNP genotyping assay or KBioscience Allele-Specific PCR genotyping-assay) was developed for SNP markers mME21377, mME1590, mME12135, mME36533 and mME13585.
(60) Based on the genomic sequences comprising the SNP (see Table 3 below and Sequence listing), for each SNP marker two allele-specific forward primers (i.e. detecting either the nucleotide of the susceptible or resistant parent at the SNP locus) and one common reverse primer (in italics) were developed, indicated in Table 3 and 4 (all sequences are given in 5 to 3 direction).
(61) TABLE-US-00006 TABLE3 marker SNP Genomicsequenceforprimerdesign(5 to3 direction) mME12135 [A/G] TGCCAGCCGCACGTTTCATCTTTTGGTAATAACTATTAAAAGCATAGGAAGCATGTGCTTGAAGGGAGTT[A/G]GGATCGT AACAAGCGCCACCCTGTTGAATGGAACGGCAATCAGCCTGTCCTTCACCACAAGCATAGTCCA [SEQIDNO:3andSEQIDNO:10] mME21377 [A/G] TGTATCAGGAACATAGCCAGCTGCTTTCATCTTCTCTGGCAACGCCTCCAAGAACATGTAGATTTCCTTG[A/G]CTTGAG GGTGAGATGTATCGCCACCGAGAAACATATGTGCTTTGCCATTTATCTCGATCCAACTGCAACC[SEQIDNO:8] mME15090 [A/C] CATTATGATATCTTTCTCTCAACTCAACCATGAACTCTAAAGCACCATTCCCATCTTTCATCTTTCGGTA[A/C]GCTCGC AAGGCTGTAGAGTAGGATACGGGAGACAGAGTTAGGCCTTTCTTCGGCATCTCTTCAAGAATGC [SEQIDNO:1andSEQIDNO:9] mME36533 [G/T] CTATAATACTTCAATAAATAACATGCATACATACATACATGGATAATATAGAGAGAAGACAAGGATAGCT[G/T]AAGTTTA GTAGTTTTGAAGATGTGAATCTCGATTTTTATCTACTACACTGTTTGAATGGAATCCTTTTCT[SEQIDNO:11] mME13585 [C/T] CATATTATTCTTAAATAATATAAACCACATAATTATTAAATTAAATTGAACTAAAACTACCCTATTT TAA[C/T]GCTTTACAAACTCTTATCTAATGTATGCTTCATTTAATTATTTTTTTGGTTGATACTTTCATTTTATTTT [SEQIDNO:12]
(62) TABLE-US-00007 TABLE4 Primer-allele Primer-allele Probe Probe marker SNP FAM(dye) VIC(dye) FAM VIC PrimerCommon mME12135 [A/G] GAAGGTGACCAAGTTCATGCT GAAGGTCGGAGTCAACGGATTG T C AGGAAGCATGTGCTTGA GGTGGCGCTTGTTACGATCCT GTGGCGCTTGTTACGATCCC AGGGAGTT (SEQIDNO:13) (SEQIDNO:14) (SEQIDNO:15) mME21377 [A/G] GAAGGTGACCAAGTTCATGCT GAAGGTCGGAGTCAACGGATTGC T C GCAACGCCTCCAAGAAC GGCGATACATCTCACCCTCAA GATACATCTCACCCTCAAGC ATGTAGAT GT (SEQIDNO:20) (SEQIDNO:21) (SEQIDNO:19) mME15090 [A/C] GAAGGTGACCAAGTTCATGCT GAAGGTCGGAGTCAACGGATTAC T G CTAAAGCACCATTCCCAT ACTCTACAGCCTTGCGAGCT TCTACAGCCTTGCGAGCG CTTTCATCTTT (SEQIDNO:22) (SEQIDNO:23) (SEQIDNO:24) mME36533 [G/T] GAAGGTGACCAAGTTCATGCT GAAGGTCGGAGTCAACGGATTG C A CATGGATAATATAGAGA AGATTCACATCTTCAAAACTAC AGATTCACATCTTCAAAACTACTA GAAGACAAGGATA TAAACTTC AACTTA (SEQIDNO:27) (SEQIDNO:25) (SEQIDNO:26) mME13585 [C/T] GAAGGTGACCAAGTTCATGCT GAAGGTCGGAGTCAACGGATTA G A TTAAATTGAACTAAAAC GCATACATTAGATAAGAGTTT GCATACATTAGATAAGAGTTTGT TACCCTATTTTAA GTAAAGCG AAAGCA (SEQIDNO:30) (SEQIDNO:28) (SEQIDNO:29)
(63) Using the above primers, KASP-assays can be carried out according to standard protocols developed by KBioscience.co.uk (see www.kbioscience.co.uk), in order to detect the presence of either the resistant or susceptible SNP-genotype in homozygous or heterozygous form in plant DNA derived from melon cells or tissues. If the genotype at a given SNP is homozygous, only one fluorescent signal will be detected. If the genotype of the plant at a given SNP is heterozygous, a mixed fluorescent signal will be detected.
(64) For any of the other SNP markers, e.g. mME40332, mME28908, mME9692 and mME50656, similar SNP-genotyping assays can be developed in order to detect the SNP-genotype.
Example 4Resistance on Chromosome 6 of NCIMB 41967 and NCIMB 41968
(65) Two other wild accessions of C. melo, referred to as Papaya netted (NCIMB 41968) and Local 2 (NCIMB 41967), were screened for both MYaV resistance using the same disease assay as described above and for the presence of the SNP markers which are linked to QTL MYaV6.1.
(66) The results are shown below:
(67) TABLE-US-00008 Accessions Average Yellowing Scoring NCIMB41967 9 NCIMB41968 9 Amaregal (susceptible) 1
(68) The result of the marker assays are shown below:
(69) TABLE-US-00009 Susceptible SNP Resistant SNP Papaya netted - Local 2 - NMID SNP genotype: genotype NCIMB41968 NCIMB41967 mME21377 [A/G] GG AA or AG AA AA mME15090 [A/C] AA CC or AC CC CC mME12135 [A/G] GG AA or AG AA AA mME36533 [G/T] GG TT or GT GG GG mME13585 [C/T] CC TT or TC TT TT
(70) Thus, both NCIMB41968 and NCIMB41967 comprise the resistance genotype of four markers, including the two common markers. These accession therefore comprises the QTL MYaV6.1 on chromosome 6.
Example 5Introgression of QTL MYaV6.1 from NCIMB 41967 and NCIMB 41968 into Cultivated Melon
(71) Both NCIMB41967 and NCIMB41968 were crossed with the MYaV susceptible cultivar Amaregal (Galia). The F2 population was phenotyped for MYaV resistance and resistant F2 plants (average yellowing score of 9) were backcrossed several times in order to generate a BC4 and BC5 generation comprising the QTL MYaV6.1 on chromosome 6. Marker analysis using the above markers was done to select individuals carrying the resistance genotype of the SNP markers and therefore also the QTL.