IMPROVEMENTS IN OR RELATING TO NICKING ENZYMES

Abstract

Disclosed is a composition comprising a nicking enzyme and a water-soluble rubidium salt, and a method of performing a reaction catalysed by a nicking enzyme including the presence of a water-soluble rubidium salt in the reaction.

Claims

1. A composition comprising a nicking enzyme and a water-soluble rubidium salt.

2. The composition according to claim 1, wherein the rubidium salt is selected from the group consisting of: rubidium sulfate, a rubidium halide and rubidium nitrate.

3. The composition according to claim 2, wherein the rubidium halide is rubidium chloride.

4. The composition according to claim 1, wherein the nicking enzyme is selected from the group consisting of: Nb.Bsml, Nb.Bts, Nt.AlwI, Nt.BbvC, Nt.BstNBI and Nt.Bpu101.

5. The composition according to claim 1, provided in dry form.

6. The composition according to claim 1, provided as an aqueous solution.

7. The composition according to claim 1, further comprising a pH buffer substance.

8. The composition according to claim 7, wherein the pH buffer substance is selected from the group consisting of: Trishydrochloride, Tris hemisulfate, Tris EDTA, Tris Base, Tris EGTA, N,N-Bis(2-hydroxyethyl)glycine, N,N-Bis(2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid, 4-(2-hydroxyethyl)-1-piperazinepropanesulfonic acid, N-(2-hydroxyethyl)piperazine-N′-(4-butanesulfonic acid), 4-(2-hydroxyethyl)piperazine-1-ethane sul foni c acid, orthoboric acid, 3-(N-Morphol ino)prop ane sul foni c acid hemi sodium salt, 3-(N-Morpholino)propanesulfonic acid sodium salt, 3-(N-Morpholino)propanesulfonic acid, Piperazine-1,4-b i s(2-hydroxypropanesulfonic acid) dihydrate, N-[Tri s(hy droxymethyl)m ethyl] -3-aminoprop anesulfonic acid, 3-(N-tri s [hydroxymethyl]methyl amino)-2-hydroxypropane sulfonic acid, N-[Tris(hydroxymethyl)methyl]glycine, sodium chloride, sodium sulfate, sodium acetate, sodium hydride, sodium nitrite, sodium nitrate, sodium borate, boric acid, potassium sulfate, potassium acetate, potassium borate, potassium chloride, potassium nitrite, potassium nitrate, magnesium sulfate, magnesium chloride, magnesium acetate, ammonium chloride, ammonium sulfate, ammonium acetate, ethyl enedi aminetetraaceti c acid, ethylene glycol-bi s(2-aminoethylether)-N,N,N′,N′-tetraacetic acid, citric acid, or a combination thereof.

9. The composition according to claim 1, comprising a carbohydrate.

10. The composition according to claim 9, wherein the carbohydrate is selected from the group consisting of: fructose, ficoll®, hydroxyethyl (heta) starch, pentosan polysulfate, polyphosphoric acid, poly-L-glutamic acid, sucrose, trehalose, maltotriose, dextrans, mannitol, sorbitol, glucose, mannose, galactose, lactose, maltose, lactulose, raffinose, melezitose, 1,6-anhydroglucose, k-carrageenan, microcrystalline cellulose, polyethylene glycols, polyvinylpyrrolidone, leucrose, kestose, stachyose, verbascose, nystose, maltodextrin, cyclodextrins, isomaltooligosaccharide, fructooligosaccharides, inulin, or a combination thereof.

11. The composition according to claim 1, wherein the composition is other than the composition or aqueous solution consisting of 12.5 mM MgSO.sub.4, 90 mM Tris-HCl (pH 8.5), 15 mM NH.sub.4CH.sub.3CO.sub.2, 15 mM Na.sub.2SO.sub.4, 5 mM DTT, 0.2 mg/ml BSA, 0.02% Triton X-100, 20 mM Rb.sub.2SO.sub.4, 10 mM L-threonine, and 0.008 U/μl nicking enzyme.

12. The composition according to claim 1, wherein the composition is other than a composition comprising 12.5 mM MgSO.sub.4, 90 mM Tris-HCl (pH 8.5), 15 mM NH.sub.4CH.sub.3CO2, 15 mM Na.sub.2SO.sub.4, 5 mM DTT, 0.2 mg/ml BSA, 0.02% Triton X-100, 20 mM Rb.sub.2SO.sub.4, 10 mM L-threonine, and 0.008 U/μl nicking enzyme in combination with one or more additional constituents.

13. A kit for performing a nucleic acid amplification reaction, the kit comprising a package and, within the package, one or more aliquots of the composition according to claim 1.

14. A lateral flow or microfluidic device comprising a measured amount of the composition according to claim 1.

15. A method for performing a reaction catalysed by a nicking enzyme, the method comprising the step of contacting a nicking enzyme with a double stranded polynucleotide substrate having a recognition site for the nicking enzyme, in the presence of a water-soluble rubidium salt, in aqueous conditions compatible with the nicking enzyme, so as to effect at least one single-stranded nick or cut in the double stranded polynucleotide substrate.

16. The method according to claim 15, wherein the single-stranded nick in the substrate is made in conditions other than in an aqueous solution comprising the following constituents at the recited concentration: 12.5 mM MgSO.sub.4, 90 mM Tris-HCl (pH 8.5), 15 mM NH.sub.4CH.sub.3CO.sub.2, 15 mM Na.sub.2SO.sub.4, 5 mM DTT, 0.2 mg/ml BSA, 0.02% Triton X-100, 20 mM Rb.sub.2SO.sub.4, 10 mM L-threonine, and 0.008 U/μl nicking enzyme.

17. The method according to claim 15, wherein the reaction catalysed by the nicking enzyme is part of or comprised within a nucleic acid amplification reaction.

18. A reaction mixture for performing a reaction comprising the nicking of a double stranded oligonucleotide or polynucleotide substrate, the reaction mixture comprising: a nicking enzyme; a double stranded oligonucleotide or polynucleotide substrate; and a water-soluble rubidium salt.

19. The reaction mixture according to claim 18, wherein the rubidium ion is present in solution at a concentration in the range 10-50 mM, more preferably 10-30 mM.

20. The reaction mixture according to claim 18, wherein the nicking enzyme is not a “V”-type nicking enzyme.

21. The reaction mixture according to claim 18, further comprising at least one buffer agent.

22. The reaction mixture according to claim 18, further comprising nucleotide triphosphates and a DNA polymerase.

23. The reaction mixture according to claim 18, other than a reaction mixture comprising 12.5 mM MgSO.sub.4, 90 mM Tris-HCl (pH 8.5), 15 mM NH.sub.4CH.sub.3CO.sub.2, 15 mM Na.sub.2SO.sub.4, 5 mM DTT, 0.2 mg/ml BSA, 0.02% Triton X-100, 20 mM Rb.sub.2SO.sub.4, 10 mM L-threonine, and 0.008 U/μl nicking enzyme.

24. The reaction mixture according to claim 22, wherein the DNA polymerase has strand-displacement activity.

Description

[0049] The various aspects of the invention will now be further described by way of illustrative example and with reference to the accompanying drawing figures, in which:

[0050] FIG. 1 is a graph of relative fluorescence units against time (minutes), showing the results of STAR DNA amplification assays performed without rubidium sulfate in the reaction mixture (“cont.”) or in the presence of 10, 20 or 50 mM rubidium sulfate;

[0051] FIGS. 2a and 2b are graphs of relative fluorescence (arbitrary units) against time (minutes) showing the results of STAR DNA amplification assays performed in the absence of a rubidium salt (“cont.”) or in the presence of 10 or 50 mM of (FIG. 2a) rubidium nitrate or (FIG. 2b) rubidium chloride;

[0052] FIG. 3 is a schematic representation of the Polymerase Acitivity Assay (“PAA”) performed by the inventors;

[0053] FIGS. 4a and 4b are graphs of relative fluorescence (arbitrary units) against temperature in ° C. (FIG. 4a) or cycle number (FIG. 4b);

[0054] FIG. 5 is a schematic representation of the Nicking Enzyme Activity Assay (“NAA”) performed by the inventors;

[0055] FIG. 6a is a graph of average relative fluorescence (arbitrary units) against instantaneous temperature (° C.) (i.e. the temperature of the sample at the time the fluorescence reading was taken);

[0056] FIG. 6b is a graph of relative fluorescence (arbitrary units) against amplification cycle number;

[0057] FIGS. 7-9 are graphs of relative fluorescence (arbitrary units) against time (minutes) showing the results of STAR DNA amplification assays performed in the presence of various alkali or alkaline earth metal salts other than those of rubidium;

[0058] FIG. 10 is a graph of average relative fluorescence (arbitrary units) against time (minutes) showing the results of a NAA performed by the inventors using the nicking enzyme Nb.Bsml in the absence (dotted line, control) or presence (solid line) of 20 mM rubidium sulfate;

[0059] FIG. 11 is a graph of relative fluorescence (arbitrary units) against time (minutes) showing the results of an isothermal “NEAR” DNA amplification reaction performed in the absence (“cont.”) or presence (“Rb”) of 20 mM rubidium sulfate;

[0060] FIG. 12A is a computer-generated model of the domain architecture of the nicking enzyme N.BspD6I, and FIG. 12B shows a surface fill representation superimposed on the model;

[0061] FIG. 13 is a computer-generated model of the putative active site of N.BspD6I;

[0062] FIG. 14 shows a computer-generated model of a putative allosteric site on the surface of N.BspD6I with a potential binding pocket for a rubidium ion; and

[0063] FIG. 15 is a graph of relative fluorescence (arbitrary units) against time (minutes) for a NAA using the nicking enzyme Nb.BbvCl in the presence or absence of rubidium chloride.

EXAMPLES

Example 1

Enhancement of Amplification Reactions by Rubidium Sulphate

[0064] Investigations into various STAR buffer components have resulted in the discovery of the enhancing qualities of rubidium compounds which demonstrate improved assay speed and consistency for all reactions in the STAR method (WO 2018/002649).

[0065] Enzymes, Oligonucleotides, and Target

[0066] Chlamydia trachomatis (Ct) was used as the target for rubidium testing. Chlamydia trachomatis Serovar J (ATCC VR-886) genomic DNA was acquired from American Type Culture Collection (Manassas, VA). The open reading frame 6 region of the cryptic plasmid was amplified with primers STARctF61a2 (SEQ ID NO: 1 5′-CGACTCCATATGGAGTCGATTTCCCCGAATTAmG-3′) and STARctR61c2 (SEQ ID NO: 2 5′-GGACTCCACACGGAGTCCTTTTTCCTTGTTTAmC -3′). The resulting DNA template was detected using a molecular beacon STARctMB1 (SEQ ID NO:3, 5′-FAM/ccattCCTTGTTTACTCGTATTTTTAGGaatgg/BHQ1-3′) as described in EP No. 0728218. Bst X DNA polymerase was purchased from Qiagen (Beverly, MA). Nt.BstNBI nicking endonuclease was purchased from New England BioLabs (Ipswich, MA) described in US Pat. No. 6,191,267. Rubidium sulfate was purchased from Sigma Aldrich (St. Louis, Mo.).

[0067] Oligonucleotides and molecular beacons were synthesized by Integrated DNA Technologies (Coralville, Iowa). The general features of the primers used in the STAR reactions are as described in WO 2018/002649.

[0068] Amplification Conditions and Procedure

[0069] The general method for STAR reactions are as described in WO 2018/002649. The STAR mixture contained two primers, polymerase, and nicking enzyme (referenced above). Reactions were performed in a final volume of 25 μl, including 1.0 μM of the forward primer, 0.5 μM of the reverse primer, 0.25 μM molecular beacon, 10 μl STAR Master Mix and 5 μl DNA sample. STAR master mix contained the following reagents; 12 mM MgSO.sub.4, 90 mM Tris-HCl (pH 8.5), 300 μM each dNTPs, 20 mM (NH.sub.4).sub.2SO.sub.4, 15 mM Na.sub.2SO.sub.4, 2 mM. DTT, 0,01% Triton X-100, 15 SU nicking endonuclease, 60U polymerase. To the STAR master mix was added rubidium sulfate at 10, 20 or 50 mM in the test samples, or no rubidium sulfate in the control group (“cont.” in FIG. 1), Each reaction mixture contained 100 copies of the target primers. The temperature of the reactions was controlled, with a relatively high initiation temperature followed by a gradual drop over time, for optimal STAR activity. The initiation phase, primarily involving polymerase activity, was at the elevated temperature of 60° C. for 15 seconds. An exponential amplification phase, in which both the polymerase s and nicking enzyme are highly active, was achieved by dropping the temperature −0.4 degrees

[0070] Celsius every 15 seconds for a total of 10 minutes. Amplification and STAR product detection were performed with the Agilent Mx3005P qPCR apparatus (Agilent).

[0071] Every reaction had a pre-incubation to allow the reagents to come to reaction temperature and to test the effect that salts had on amplification kinetics, enzyme performance, and signal fluorescence.

[0072] The amplification system, isothermal and STAR, relies on two main enzymes for functionality, the polymerase and nicking enzyme. Either or both enzymes can be optimized is to a selected temperature which results in significant performance improvements, a benefit that the selective temperature amplification reaction utilizes. Further, enzymes require co-factors for modulation and activity, for example, magnesium is a requirement for polymerase activity. Investigations into alternative metal ions and cofactors by the inventors led to the discovery that rubidium improved STAR reactions compared to those which did not contain rubidium sulphate (FIG. 1). An optimal concentration of rubidium is recommended for maximal performance improvements. FIG. 1 demonstrates that rubidium sulphate improved STAR reactions between a concentration of 10 to 20 mM. A concentration of 50 mM, was detrimental to amplification, slowing the reaction (although it is noted that, at 50 mM rubidium sulfate, the replicate sample results are still more tightly grouped than with the control group). Not to the limit the inventors to any particular theory, it is believed the sulfate anion was the cause of slower reactions at the concentration of 50 mM rubidium sulfate. (Note that the Mg2+ ions in the reaction mix are required for the activity of the polymerase).

Example 2

Enhancement of Amplification Reactions by other Rubidium Salts

[0073] To further demonstrate that it was the rubidium cation that specifically improved STAR, other rubidium salts were tested. The experiments were conducted as described in Example 1 above, but using rubidium nitrate or rubidium chloride in place of rubidium sulfate. The results are shown in FIG. 2, Rubidium nitrate and rubidium chloride demonstrated similar performance improvements as rubidium sulphate. Unsurprisingly, different tolerances for the anion of the salt was demonstrated but all three rubidium salts showed improvement in assay performance, in a range of 10 to 50 mM. Without limiting the inventors to any theo is believed that the amplification improvements can be attributed to at least one characteristic. In most nucleic acid amplification reactions, a polymerase initiates strand extension in a reaction. Polymerases are known to require catalytic ions to help guide polymerase selection of the correct nucleotide for incorporation into the growing nucleic acid strand during strand extension, ro underscoring the importance of the delicate conformational changes for polymerase efficiency and fidelity. If rubidium could serve as a better catalytic ion, than ions currently known in the art, for polymerase activity, one might possibly expect improved fidelity resulting in increased assay sensitivity. When rubidium is added to STAR reactions, however, this was not observed. What became apparent was (i) improved reaction speed and (ii) significantly tighter replicates (i.e. greater reproducibility and less variability). This observed improvement could result from improvement of the exponential phase of the reaction, The reaction exponential phase relies on a nicking endonuclease for product turnover. Faster turnover would increase speed and tighten replicates as product is more consistently made. This would suggest that rubidium modulates or improves the nicking endonuclease This was surprising and not previously known in the art to the best knowledge of the inventors.

Example 3

Results using Polymerase Activity Assay

[0074] The hypothesis outlined above was tested by performing a polymerase activity assay (Example 3) and a nicking enzyme activity assay (Example 4) in the presence of rubidium.

[0075] Polymerase Activity Assay Design, Enzymes, and Oligonucleotides:

[0076] Synthetic oligonuleotides for the Polymerase Activity Assay (PAA) were synthesized by Integrated DNA Technologies (Coralville, IA). The design consists of three oligonucleotides; the template oligo (NEF), (SEQ ID NO: 4 5′-/56-FAM/ACCGCGCGCACCGAGTCTGTCGGCAGCACCGCT-3′), priming oligo (PO), (SEQ ID NO: 5 5′-AGCGGTGCTGCCGACA-3′), and quenching oligo (POQ), (SEQ ID NO: 6 5′-GGTGCGCGCGGT/3BHQ_1/−3′). Together these three oligonucleotides form a complex in solution each with unique functions, as shown in FIG. 3. The NEF has a 5′ fluorophore, POQ has a 3′ quenching moiety that absorbs the photons released by the 5′ template oligo fluorophore. The PO serves as the initiation site for a strand displacement polymerase to extend and displace the quenching oligo allowing for fluorescence to be generated due to the quenching oligo no longer being in proximity to the template oligo. Highly active strand displacing polymerases generate a fluorescent signal at an increased s rate compared to less active polymerases or those that lack stand displacing activity.

[0077] Polymerase Activity Assay Conditions

[0078] The basic PAA mixture contains a template oligo (NEF) with a 5′-FAM modification, a priming oligo (PO) which anneals to the template's 3-end, a quenching oligo (POQ) with a 3′-BHQ1 modification which anneals to the template's 5′-end, and a polymerase (referenced above). The reactions were performed in a final volume of 25 μl, including 0.2 μM NEF, 0.3 μM PO, 0.7 μM POQ, and 1× PAA Master Mix. At a 1× concentration, the PAA master mix contained the following reagents; 12.5 mM MgSO.sub.4, 90 mM Tris-HCl (pH 8.5), 300 μM each dNTPs, 15 mM NH.sub.4CH.sub.3CO.sub.2, 15 mM Na.sub.2SO.sub.4, 5 mM DTT, 0.2 mg/ml BSA, 0.02% Triton X-100, 15 mM Rb.sub.2SO.sub.4, 10 mM L-Threonine, and 0.03 U/μl polymerase. The reactions were run using a STAR temperature profile as previously described (Example 1). The PAA was performed with the Agilent Mx3005P qPCR apparatus (Agilent). Every reaction had a pre-reaction incubation to allow the reagents to come to temperature to test the effect of the selected temperature profile and occlude any variation as reactions heated up. Each reaction assessed amplification kinetics, enzyme performance, and signal fluorescence.

[0079] FIG. 4a shows the average polymerase activity assay with and without rubidium sulfate. The Figure shows that rubidium sulfate does not change the activity of the polymerase in any significant manner: the control results (no added rubidium) are closely similar to those obtained in the presence of 15 mM rubidium. FIG. 4b shows the six replicates for +/− rubidium. None of the replicates shows a significant difference, indicating that the improvement seen in the STAR reaction is not due to rubidium acting on the polymerase.

Example 4

Results using Nicking Enzyme Activity Assay

[0080] Nicking Activity Assay (NAA) Design, Enzymes, and Oligonucleotides:

[0081] Synthetic oligonuleotides for the nicking activity assay were synthesized by Integrated DNA Technologies (Coralville, IA). The design consists of two oligonucleotides; the template oligo (NEQ), (SEQ ID NO: 7 5′-ACCGCGCGCACCGAGTCTGTCGGCA/3BHQ_1/-3′) and priming oligo (POF, SEQ ID NO: 8 5′-56-FAM/CTGCCGACAGACTCGGTGCGCGCGGT-3″). Together these oligonucleotides form a complex in solution each with unique functions, as shown in FIG. 5. The template s oligo has a nicking site for nicking endonuclease activity and downstream a 3′ quencher.

[0082] The priming oligo has the complementary nicking site sequence and a 5′ fluorophore. When in solution the two form a complex that completes a nicking binding site allowing for the nicking endonuclease to cut. The oligonucleotide quencher 5′ of the nick site, following a nick by a nicking endonuclease, now has a low melting temperature. Because the reaction is performed above this melting temperature, the shortened fragment containing the quencher is released from the complex generating fluorescence. The more active the nicking enzyme the faster and greater the florescent signal is generated.

[0083] Nicking Activity Assay Conditions

[0084] The basic NAA mixture contained the template oligo (NEQ) with a 3′ modification, is and the priming oligo (POF) with a 5′-FAM modification which anneals to the template, and a nicking endonuclease (referenced above). The reactions were performed in a final volume of 25 .sub.i.i1, including 1. NEQ, 1.6 POE, and 1× NAA Master Mix. At a IX concentration, the NAA master mix contained the following reagents; 12.5 mM MgSO4, 90 mM Tris-HCl (pH 8.5), 15 mkt N.H.sub.4CH.sub.3CO.sub.2, 15 mM Na.sub.2SG.sub.L 5 mM DTT, 0,2 mg/ml BSA, 0.02% Triton X-100, 15 mM Rb.sub.7S0,.sub.4, 10 mM L-Threonine, and 0.008 Utpl nicking endonuclease. The reactions were run using a STAR temperature profile as previously described (Example 1). The NAA was performed with the Agilent Mx3005P qPCR apparatus (Agilent). Every reaction had a pre-reaction incubation to allow the reagents to come to temperature to test the effect of the selected temperature profile and occlude any variation as reactions heated up. Each reaction assessed amplification kinetics, enzyme performance, and signal fluorescence.

[0085] FIG. 6a shows the average nicking enzyme activity with and without rubidium sulfate. The Figure shows that, surprisingly, rubidium sulfate significantly increased the activity of the nicking enzyme. FIG. 6b shows the six replicates for each condition. All of the replicates showed markedly increased nicking enzyme activity in the presence of rubidium (replicates E4-E9) compared to results in the absence of rubidium (replicates D4-D9). This is an unexpected result, as it has not been previously reported that rubidium could increase the activity of a nicking endonuclease. Not to limit the applicants to any particular theory, this would further explain the improvements observed in Examples 1 & 2, indicating that the exponential phase of amplification is improved, generating faster product turnover.

Example 5

Results of ion replacement in STAR

[0086] The unexpected improvement of the nicking enzyme by rubidium suggests that other readily available alkali and alkaline earth metals should be tested to determine if they improved the activity of the nicking endonuclease. Different salts were replaced in various buffer combinations and their effects on STAR were determined. The following salts were tested. at various concentrations; lithium acetate, potassium acetate, lithium sulfate, strontium chloride, strontium acetate, scandium acetate, and yttrium acetate. FIG. 7 shows results obtained with lithium and potassium acetate, neither of which improved STAR, with lithium is possibly inhibiting the reaction, slowing it down. FIG. 8 shows the results for strontium acetate: 10 mM possibly slightly slowed the reaction, while 20 and 50 mM fully inhibited the reaction. FIG. 9 shows the results for scandium acetate: all concentrations fully inhibited the reaction. For brevity the results from the other tested salts are not shown as none of them improved the STAR reaction, and most fully inhibited the reaction, further supporting the surprising nature of the results obtained with rubidium.

Example 6

Results in a modified Nicking Enzyme Activity Assay (NAA) with other Nickinu: Enzymes

[0087] To demonstrate that rubidium improves the activity of nicking endonucleases other than Nt.BstNBI, a modified NAA was performed using the nicking endonuclease Nb.Bsml, purchased from New England BioLabs (Ipswich, MA). The modified NAA was run with and without rubidium using the following conditions.

[0088] Nicking Activity Assay (NA A) Design, Enzymes, and Oligonucleotides:

[0089] Synthetic oligonucleotides for the modified nicking activity assay were synthesized by

[0090] Integrated DNA Technologies (Coralville, IA). The design consists of the following oligonucleotide: the Probe Oligo (DLPFQ) (SEQ ID NO: 9 5′-/56-FAM/CACTTGGCATTCTATTACACAATAGAATGCCAAGTG/3BHQ_1/-3″). The Nb.Bsml recognition sequence is GAATG CN. (The underscore indicates the nick site). The oligonucleotide contains self-complementary sequences and forms a molecular beacon-like probe in solution. The probe has a nicking site for nicking endonuclease activity and a 3′ quencher. Upstream of the nicking binding site is a 5′ fluorophore. When in solution a complex is formed that completes a nicking binding site allowing for the nicking endonuclease to nick. Nb.Bsml is a bottom cutter and therefore will cut on the opposite strand of the nicking binding site. The oligonucleotide quencher 3′ of the nick site, following a nick by a nicking endonuclease, now has a low melting temperature. Because the reaction is performed above this melting temperature, the shortened fragment containing the quencher is released from the complex, generating fluorescence. The more active the nicking enzyme the faster and greater the florescent signal is generated.

[0091] Nicking Activity Assay Conditions

[0092] The basic NAA mixture contained the probe oligo (DLPFQ) with a 5′-FAM modification is and a 3′-BHQ1 modification which folds on itself, and a nicking endonuclease (referenced above). The primer sequences are the same as those detailed in Example 1. The reactions were performed in a final volume of 25 ul, including different concentrations of DLPFQ depending on the nicking enzyme used, and 1× NAA Master Mix. At a 1× concentration, the NAA master mix contained the following reagents; 12.5 mM MgSO.sub.4, 90 mM Tris-HCl (pH 8.5), 15 mM NR.sub.ICH.sub.3CO.sub.2; 15 mM Na.sub.2SO.sub.4, 5 mM MT, 0.2. mg/ml BSA, 0.02% Triton X-100, 20 mM R1).sub.2SO.sub.4, 10 mM L-Threonine, and a range from 0.01 to 0.5 U/μl nicking endonuclease. The reactions are run using a STAR temperature profile as previously described (Example 1). The modified NAA was performed with the Agilent Mx3005P qPCR apparatus (Agilent). Every reaction had a pre-reaction incubation to allow the reagents to come to temperature to test the effect of the selected temperature profile and occlude any variation as reactions heated up. Each reaction assessed kinetics, enzyme performance, and signal fluorescence.

[0093] FIG. 10 shows the results obtained from an average of six replicates of nicking enzyme activity assays with and without rubidium sulfate. The data show that rubidium sulfate increases the activity of this other nicking endonuclease.

Example 7

Results in Isothermal Amplification

[0094] Rubidium may be employed in any amplification technology thus, for example, the amplification process may be based on the amplification process employed in strand displacement amplification, or based on that used in NEAR or indeed any other nucleic acid amplification process which relies on the creation of a single stranded nick and subsequent extension from the 3′ end of the nicked strand. Accordingly, the teachings of the prior art in relation to the amplification stages of SDA or NEAR will, in general, be equally applicable to the amplification process of the method of the present invention.

[0095] Amplification Conditions and Procedure

[0096] The basic mixture contains two primers, polymerase, and nicking enzyme (referenced above). The primer sequences are the same as those detailed in Example 1. The reactions were performed in a final volume of 25 μM, including 1.0 μM of the forward primer, 0.5 μM is of the reverse primer, 0.25 μM molecular beacon, 10 μM Master Mix and 5 til DNA sample.

[0097] The master mix contained the following reagents; 12.5 inM MgSO.sub.4, 90 mM Tris-HCl (pH 8,5), 300 μM each dNTPs, 40 mM NR.sub.IOAc, 15 mM Na.sub.2SO.sub.4, 2 mM DTT, 0.01% Triton X-100, 15U nicking endonuclease, 60U polymerase. The temperature of the reaction was isothermal, as described in US2009/0017453. Amplification and product detection were performed vith the Agilent Mx3005P qPCR apparatus (Agilent).

[0098] Every reaction had a pre-incubation to allow the reagents to come to reaction temperature and to test the effect that salts had on amplification kinetics, enzyme performance, and signal fluorescence.

[0099] Results

[0100] The results in FIG. 11 show the average of 4 replicates of isothermal amplification runs at 100 copies and 10 copies template with and without 20 mM rubidium sulfate (“ntc” =no template control). From the data in the figure, it is evident that rubidium sulfate improves the isothermal reaction, 15 mM of rubidium sulfate made the 10 copy reaction perform similar to the 100 copy reaction without rubidium sulfate. For brevity the replicates for the data are not shown, but the inventors found that the replicates with rubidium were tighter than without rubidium.

Example 8

Nicking Enzyme Crystal Structure

[0101] After the empirical data previously referenced was generated, further analysis of the crystal structure of the nicking enzyme was undertaken. Not to limit the applicants to any particular theory, FIG. 12 shows the domain architecture of the nicking enzyme N.BspD6I (Protein Data. Bank (“PDB”) 1D 2EWF) modeled with a bound DNA recognition motif from PDB ID 2VLA as referenced in Kachalova et al., 2008. The overall architecture has been described and is shown here in several subdomains: a DNA binding domain made up of D1 and D2, and a linker that joins the catalytic c-terminal domain composed of subdomains CD1 and CD2. A surface fill representation is shown superimposed on the cartoon model in FIG. 12 B. FIG. 13 shows the putative active site displaying residues E482, E418, V470, H.sub.489, and E469. A speculative binding site for rubidium (shown by E418, E482, or E469) identified by rubidium's radius of hydration versus magnesium or sodium (1.6Arb+versus 1.3NMg++ to 11.1Na+) may lend greater stability to the nicking enzyme's folding within the local environment and/or stabilize the catalytic domain allowing for more efficient activity of key residues that are critical to the function of the enzyme. Additionally, in FIG. 14, at the surface of the nicking enzyme, a potential solvent exposed pocket is made up of Cl) linker and D1 domains. Rubidium may act as a speculative allosteric co-factor in this pocket and enhance overall activity. The many glutamic and aspartic acid residues in this pocket can contribute to rubidium binding (residues E364, E335, E368, D341, D357, E353, E305, E327). However, a cluster of glutamic acid residues most proximal to the active site likely chelate rubidium (residues E364, E335, E368),

Example 9:

Results in licking Enzyme Activity Assay (NAA) with third Nicking Enzyme under isothermal Condition

[0102] To demonstrate that rubidium improves the activity of a third nicking endonuclease a modified NAA was run using the nicking endonuclease, Nb.BbvCl, purchased from New

[0103] England BioLabs (Ipswich, MA). A NAA was run with and without rubidium using the following conditions.

[0104] Nicking Activity Assay (NAA) Design, Enzymes, and Oligonucleotides: Synthetic oligonucleotides for the nicking activity assay were synthesized by Integrated DNA Technologies (Coralville, IA). The assay comprises use of the following oligonucleotide probe (DLPFQ) (SEQ ID .sup.-NO: 10 5′456-FAM/CATGCTGAGGAATATTA.CACAATATTCCTCAGCATG/3BHQ_1/-3′). The oligonucleotide forms a molecular beacon-like probe in solution. The probe has a nicking site for nicking endonuclease activity and a 3′ quencher. Upstream of the nicking enzyme binding site is a 5′ fluorophore. When in solution a complex is formed that completes a nicking binding site allowing for the nicking endonuclease to cut, this nicking enzyme is a bottom cutter and therefore will cut on the opposite strand from the nicking binding site. The oligonucleotide quencher 3′ of the nick site, following a nick by a nicking endonuclease, now has a low melting temperature. Because the reaction is performed. above this melting temperature, the shortened fra.gment containing the quencher is released from the complex generating fluorescence. The more active the nicking enzyme the faster and greater the florescent signal is generated.

[0105] Nicking Activity Assay Conditions

[0106] The basic (NAA) mixture contains the probe oligo (DLPFQ) with a 5′-FAM modification and a 3′-BEIQ1 modification which folds on itself, and a nicking endonuclease (referenced above). The reactions were performed in a final volume of 25 μl, including different concentrations of POFQ depending on the Nicking Enzyme used, and 1× NA A Master Mix. At a 1× concentration, the NAA master mix contains the following reagents; 40 ml RbCl 1× CutSmart Buffer purchased from New England BioLabs (Ipswich, MA), and a range from 0.01 to 0.5 U/μl nicking endonuclease. The reactions are run using an isothermal temperature profile, 50° C. The NAA was performed with the Agilent Mx3005P qPCR apparatus (A.gi lent). Every reaction had a pre-reaction incubation to allow the reagents to come to temperature to test the effect of the selected temperature profile and occlude any variation as reactions heated up. Each reaction assessed kinetics, enzyme performance, and signal fluorescence.

[0107] FIG. 15 is a graph of average relative fluorescence units (a measure of nicking enzyme activity in the NAA) against time (in minutes). The graph shows the results for four replicate samples in the NA assay with rubidium (solid lines) or without (dotted lines, control). The data shows that rubidium chloride increases the activity of Nb,BbvCl nicking endonuclease under isothermal conditions.