GENERATION OF TAGGED DNA FRAGMENTS

20190194718 ยท 2019-06-27

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention is directed to novel methods, kits and uses to be employed for the generation of tagged DNA fragments of a target DNA and nucleic acid molecules associated therewith

    Claims

    1. A method for generating tagged DNA fragments of a target DNA, comprising (i) contacting said target DNA with an integrase and at least one DNA adaptor molecule that comprises an integrase recognition site, to obtain a reaction mixture, (ii) incubating said reaction mixture under conditions wherein a 3 processing of said at least one adaptor molecule and a strand transfer reaction is catalyzed by said integrase, wherein (a) said target DNA is fragmented to generate a plurality of target DNA fragments, and (b) said at least one DNA adaptor molecule is joined to at least one end of each of the plurality of said target DNA fragments, to generate a plurality of tagged DNA fragments of said target DNA.

    2. The method of claim 1, wherein the at least one DNA adaptor molecule is joined to both ends of each of the plurality of said target DNA fragments.

    3. The method of claim 1, wherein the at least one DNA adaptor molecule further comprises a site for annealing an oligonucleotide, wherein the site for annealing an oligonucleotide is configured for annealing a PCR and/or sequencing primer.

    4. The method of claim 1, further comprising after step (ii) the following step: (ii)' subjecting said plurality of tagged DNA fragments of said target DNA to a PCR to add to said at least one DNA adaptor molecule a site for annealing an oligonucleotide, wherein said site for annealing an oligonucleotide is configured for annealing a PCR and/or sequencing primer.

    5. The method of claim 1, wherein said integrase is selected from the group consisting of: retroviral integrases, HIV integrases, and integrases derived from retroviral integrases.

    6. The method of claim 1, wherein said at least one DNA adaptor molecule consists of two nucleic acid molecules comprising complementary nucleotide sequences and being specifically hybridized to each other, selected from the following group: Adaptor 1 (SEQ ID no. 1+SEQ ID no. 2), Adaptor 2 (SEQ ID no. 3+SEQ ID no. 2), Adaptor 3 (SEQ ID no. 6+SEQ ID no. 2), Adaptor 4 (SEQ ID no. 7+SEQ ID no. 2), Adaptor 5 (SEQ ID no. 8+SEQ ID no. 4), Adaptor 6 (SEQ ID no. 9+SEQ ID no. 4), Adaptor 7 (SEQ ID no. 8+SEQ ID no. 5), Adaptor 8 (SEQ ID no. 9+SEQ ID no. 5), Adaptor 9 (SEQ ID no. 14+SEQ ID no. 15), Adaptor 10 (SEQ ID no. 10+SEQ ID no. 11), and Adaptor 11 (SEQ ID no. 12+SEQ ID no. 13).

    7. The method of claim 1, further comprising after step (ii) and/or (ii)' the following step: (iii) purifying said plurality of tagged DNA fragments of said target DNA.

    8. The method of claim 1, wherein the method is performed within one reaction vessel.

    9. A kit for generating tagged DNA fragments of a target DNA, comprising: (i) an integrase, and (ii) at least one DNA adaptor molecule comprising an integrase recognition site.

    10. The kit of claim further comprising at least one PCR primer pair configured to add in a PCR reaction to said at least one DNA adaptor molecule a site for annealing an oligonucleotide, wherein said site for annealing an oligonucleotide is configured for annealing a PCR and/or sequencing primer.

    11. The kit of claim 9, wherein said at least one DNA adaptor molecule further comprises a site for annealing an oligonucleotide, wherein said site for annealing an oligonucleotide is configured for annealing a PCR and/or sequencing primer.

    12. The kit of claim 9, characterized in that said integrase is selected from the group consisting of: retroviral integrases, HIV integrases, and integrases derived from retroviral integrases.

    13. The kit of claim 9, wherein said at least one DNA adaptor molecule consists of two nucleic acid molecules comprising complementary nucleotide sequences and being specifically hybridized to each other, selected from the following group: Adaptor 1 (SEQ ID no. 1+SEQ ID no. 2), Adaptor 2 (SEQ ID no. 3+SEQ ID no. 2), Adaptor 3 (SEQ ID no. 6+SEQ ID no. 2), Adaptor 4 (SEQ ID no. 7+SEQ ID no. 2), Adaptor 5 (SEQ ID no. 8+SEQ ID no. 4), Adaptor 6 (SEQ ID no. 9+SEQ ID no. 4), Adaptor 7 (SEQ ID no. 8+SEQ ID no. 5), Adaptor 8 (SEQ ID no. 9+SEQ ID no. 5), Adaptor 9 (SEQ ID no. 14+SEQ ID no. 15), Adaptor 10 (SEQ ID no. 10+SEQ ID no. 11), and Adaptor 11 (SEQ ID no. 12+SEQ ID no. 13).

    14. A method of using an integrase for generating a library of tagged DNA fragments of a target DNA, preferably said library of tagged DNA fragments is a library to be used for DNA sequencing, preferably via next generation sequencing.

    15. A nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1 to 15.

    Description

    IN THE FIGURES:

    [0101] FIG. 1 shows a diagram illustrating the differences in the sequence of events in HIV-1 integration involving integrases (left) and Tn5 transposition involving transposases (right).

    [0102] FIG. 2 shows a diagram illustrating an embodiment of the method according to the invention (A) and details on a tagged plasmid DNA fragment generated by said method (B).

    [0103] FIG. 3 shows photographs of agarose gels demonstrating the successful generation of tagged plasmid DNA fragments by the method of the invention.

    [0104] FIG. 4 shows an electropherogramm of fragmented and adaptor ligated genomic DNA using two different cycling conditions and two different reaction buffers.

    [0105] FIG. 5 shows a diagram illustrating another embodiment of the method according to the invention.

    [0106] FIG. 6 shows electropherogramms of fragmented and adaptor ligated genomic DNA using various fragmentation adaptors and PCR primer mixes.

    [0107] FIG. 7 shows electropherogramms of fragmented and adaptor ligated genomic DNA using different incubation temperatures.

    EXAMPLES

    [0108] A central aspect of the method according to the invention is the use of an integrase enzyme in contrast to the use of a transposase enzyme employed in the prior art fragmentation and simultaneous adaptor ligation, e.g. as disclosed in WO 2010/048605.

    [0109] Integration of retrovitral DNA is an obligatory step of retrovirus replication because proviral DNA is the template for productive infection. The process of integration as catalyzed by the integrase can be divided into two sequential reactions. The first one, named 3 processing, corresponds to a specific endonucleolytic reaction which prepares the viral DNA extremities to be competent for the subsequent covalent insertion, named strand transfer, into the host cell genome by a trans-esterification reaction. The integrase first binds to a short sequence at each and of the viral DNA known as integrase recognition sequence (IRS) or long terminal repeat (LTR), respectively, and catalyzes an endonucleotide cleavage known as 3 processing, in which a denucleotide is eliminated from each and of the viral DNA. The resulting cleaved DNA is then used as substrate for integration or strand transfer leading to the covalent insertion of the viral DNA into the genome of the infected cell. This second reaction occurs simultaneously at both ends of the viral DNA molecule, with an offset of precisely five base pairs between the two opposite points of insertion.

    [0110] In FIG. 1 such events are illustrated in HIV-1 integration (left) in comparison with Tn5 transposition (right). HIV-1: I) donor DNA; II) integrase-catalyzed 3 processing; III) integrase-catalyzed strand transfer; IV) product of strand transfer; V) DNA repaired strand transfer product. Tn5 transposon: 1) donor DNA; 2) 3 processing; 3-4) 5 processing, consisting of loop formation (3) and generation of blunt-ended DNA (4); 5) strand transfer; 6) repaired strand transfer product.

    [0111] FIG. 2 shows a graphical illustration of the method according to the invention. Two DNA adaptor molecules (Adaptors 1 and 2) each of which comprising an integrase recognition site (IRS) and a primer annealing site (PAS), were incubated with an integrase enzyme (INT) and the target DNA to be fragmented and tagged; cf. FIG. 2A upper part.

    [0112] The integrase (INT) binds to the IRS of the adaptor molecules Adaptor 1 and 2 and the target DNA and catalyzes the 3 processing and strand transfer; cf. FIG. 2A, middle part.

    [0113] In FIG. 2A, lower part, the result of the integrase reaction is shown, i.e. the fragmented and tagged target DNA having at its both ends joined adaptors, wherein the adaptors are joined via the respective IRS sections of the adaptors thus exposing the PASs at the extremities of the fragmented and tagged target DNA.

    [0114] In FIG. 2B the fragmented and tagged target DNA is shown in further detail. The fragmented and tagged target DNA comprises at its extremities the PAS sections allowing the annealing of a PCR primer and the elongation of the latter in 3 direction.

    [0115] The integrase reaction is used in the method of the present invention to fragment genomic DNA and ligate DNA adaptor molecules to both ends. The DNA adaptor molecules then can be used for e.g. amplification of the generated tagged and fragmented target DNA and subsequently cluster generation and sequencing.

    [0116] Two different HIV integrases were exemplarily used, namely a codon optimized, in-house expressed and purified HIV-1-derived integrase having 171 amino acids of the sequence as shown under SEQ ID no. 16. The HIV-1-derived integrase has a size of 18.97 kDa and comprises the core domain of HIV integrase represented by amino acids numbers 50 to 212. Such integrase is referred to as QHIN 1. The HIV-1-derived integrase catalyzes the disintegration reaction, however not the integration (3 processing and transfer). =27965; pl (theoretically): pH 7.82; mutation: F185K (solubility).

    [0117] The second integrase is a commercially available wild-type HIV-1 integrase (BioProducts MD, LLC, Middletown, Md., United States of America). Such integrase is referred to as BPHIN 1.

    [0118] Different adaptor molecules were designed to include recognition sides for the HIV-1 integrase and sequences that can be used for the amplification of the library and subsequently sequencing on Illumina NGS platforms. The following Table 1 includes the sequences that were used by the inventors to form the DNA adapter molecules:

    TABLE-US-00001 TABLE1 Sequencesusedforthe generationofDNAadaptormolecules SEQ ID Name Sequence no. 21/21_IN_1 5GTGTGGAAAATCTCTAGCAGT-3 1 21/21_IN_2 5-ACTGCTAGAGATTTTCCACAC-3 2 19/21_IN_3 5GTGTGGAAAATCTCTAGCA-3 3 rev_6(long)_ 5-ACTGCT(AGATCGGAAGTGC)-3 4 IN_10 rev_6_IN_11 5-ACTGCT-3 5 21/21plus_IN_4 5 AATGATACGGCGACCACCGAG 6 ATCTACACTCTTTCCCTACACGAC GCTCTTCCGATCTGTGTGGAAAATCTC TAGCAGT-3 21/21plus_IN_5 5-CAAGCAGAAGACGGCATACGA 7 GATCGTGATGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTGTGTGG AAAATCTCTAGCAGT-3 6/6plus_IN_6 5 AATGATACGGCGACCACCGAG 8 ATCTACACTCTTTCCCTACACGAC GCTCTTCCGATCTAGCAGT-3 6/6plus_IN_7 5-CAAGCAGAAGACGGCATACGA 9 GATCGTGATGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTAGCAG T-3 yoshi.U5LTR 5-TGTGTGCCCGTCTGTTGTGTG 10 ACTCTGGTAACTAGAGATCCTCAG ACCTTTTTGGTAGTGTGGAAAATC TCTAGCA-3 yoshi.U5LTR- 5-ACTGCTAGAGATTTTCCACAC 11 revB TACCAAAAAGGTCTGAGGATCTCT AGTTACCAGAGTCACACAACAGAC GGGCACACA-3 yoshi.U3LTR 5-ACTGGAAGGGTTAATTTACTC 12 CAAGCAAAGGCAAGATATCCTTG ATTTGTGGGTCTATAACACACAAG GCTACTTCCCA-3 yoshi.U3LTR- 5-TGGGAAGTAGCCTTGTGTGTT 13 rev ATAGACCCACAAATCAAGGATATC TTGCCTTTGCTTGGAGTAAATTAA CCCTTCCAGT-3 RB67_IN_8 5-CGATAGGATCCGAGTGAATTA 14 GCCCTTCCA-3 RB50_IN_9 5-ACTGGAAGGGCTAATTCACT 15 CGGATCCTATCG-3

    [0119] Adaptor molecules were formed by mixing the before-listed oligonucleotides in different ratios to each other. An initial denaturation step of two minutes at 98 C. to eliminate putative secondary structures of the oligonucleotides was followed by a slow cooling down of the probes to allow annealing of the complementary oligonucleotides. The following Table 2 shows the different adaptors formulations.

    TABLE-US-00002 TABLE 2 DNA adaptor molecules Dilute in RNAse free Water Mix And Ratio IN adaptor 1 21/21_IN_1 (SEQ ID no. 1) 21/21_IN_2 (SEQ ID no. 2) 1:2 IN adaptor 2 19/21 IN_3 (SEQ ID no. 3) 21/21_IN_2 (SEQ ID no. 2) 1:2 IN adaptor 3 21/21plus_IN_4 (SEQ ID no. 6) 21/21_IN_2 (SEQ ID no. 2) 1:2 IN adaptor 4 21/21plus_IN_5 (SEQ ID no. 7) 21/21_IN_2 (SEQ ID no. 2) 1:2 IN adaptor 3 21/21plus_IN_4 (SEQ ID no. 6) 21/21_IN_2 (SEQ ID no. 2) 1:4 IN adaptor 4 21/21plus_IN_5 (SEQ ID no. 7) 21/21_IN_2 (SEQ ID no. 2) 1:4 IN adaptor 5 6/6plus_IN_6 (SEQ ID no. 8) rev_6(long)_IN_10 (SEQ ID no. 4) 1:2 IN adaptor 6 6/6plus_IN_7 (SEQ ID no. 9) rev_6(long)_IN_10 (SEQ ID no. 4) 1:2 IN adaptor 5 6/6plus_IN_6 (SEQ ID no. 8) rev_6(long)_IN_10 (SEQ ID no. 4) 1:4 IN adaptor 6 6/6plus_IN_7 (SEQ ID no. 9) rev_6(long)_IN_10 (SEQ ID no. 4) 1:4 IN adaptor 7 6/6plus_IN_6 (SEQ ID no. 8) rev_6_IN_11 (SEQ ID no. 5) 1:2 IN adaptor 8 6/6plus_IN_7 (SEQ ID no. 9) rev_6_IN_11 (SEQ ID no. 5) 1:2 IN adaptor 7 6/6plus_IN_6 (SEQ ID no. 8) rev_6_IN_11 (SEQ ID no. 5) 1:4 IN adaptor 8 6/6plus_IN_7 (SEQ ID no. 9) rev_6_IN_11 (SEQ ID no. 5) 1:4 IN adaptor 9 RB67_IN_8 (SEQ ID no. 14) RB50_IN_9 (SEQ ID no. 15) 1:2 IN adaptor 10 yoshi.U5LTR (SEQ ID no. 10) yoshi.U5LTR-revB (SEQ ID no. 11) 1:2 IN adaptor 11 yoshi. U3LTR (SEQ ID no. 12) yoshi. U3LTR-rev (SEQ ID no. 13) 1:2

    [0120] In a first feasibility assay the IN adaptors 1 to 11 were used in combination with the codon-optimized, in-house expressed HIV-1-derived integrase (QHIN 1) to simultaneously fragment and adaptor ligate a bacterial plasmid DNA (pGL2).

    The Experimental Schedule is as Follows:

    [0121]

    TABLE-US-00003 Reagent conc. in RXN L mix QHIN 1 800 nM 2 Integration Adaptor 10 M 50 nM 0.25 Buffer 2x* 1x 25 Water 21.75 *Buffer 2x: 10 mM MnCl.sub.2, 40 mM HEPES (pH 7.5), 2 mM dithiothreitol, 0.1% Nonidet P40, 1 mM CHAPS, 40 mM NaCl. [0122] Incubation for 10 min at 37 C. to form the integration complexes.

    TABLE-US-00004 Reagent conc. in RXN l add Target DNA (Plasmid; pGL2) 274 ng/L 50 nM 1 Total 50 [0123] Incubation for 1 h at 37 C. for the fragmentation and simultaneous adaptor ligation of the plasmid target DNA.

    [0124] After the incubation the fragmented and adaptor ligated DNA was purified using QlAquick columns and reaction clean-up protocol. The agarose gel analysis showed no fragments since the concentrations of plasmid and fragments are too low to be visualized on an agarose gel. Fragmented and adaptor ligated DNA was then amplified using specific primers for the adaptors. For IN adaptor 1 and 2 no PCR primers have been available. For IN adaptors 3 to 8 the IIlumina P1 and P2 primers were used, for IN adaptor 9 the RB primer and for IN adaptors 10 and 11 the U5LTR and U3LTD primers were used.

    [0125] In the following table the sequences of the used PCR primers are listed.

    TABLE-US-00005 TABLE3 UsedPCRprimers SEQ PCRPrimers: Sequence IDno. PrimerP1 AATGATACGGCGACCACCGA 17 PrimerP2 CAAGCAGAAGACGGCATACGA 18 U5LTRFor GTGTGCCCGTCTGTTGTGT 19 U5LTRRev CCACACTACCAAAAAGGTCTGA 20 U3LTRFor ACTCCAAGCAAAGGCAAGAT 21 U3LTRRev TGGGAAGTAGCCTTGTGTGTT 22 RBPrimer AGGATCCGAGTGAATTAGCCCT 23

    [0126] PCR set-up protocol and cycling conditions are listed below.

    TABLE-US-00006 MMX Conc. Conc. in RXN L HotStarTq MMX 2x 1x 25 Primer for 10 M 0.3 M 1.5 Primer rev 10 M 0.3 M 1.5 or Primer Mix 10 M 0.3 M 3 Template 5 Rnase Free Water 17 Volume Total 50

    TABLE-US-00007 Cycling 95 C. 15 min 94 C. 30 sec 35x 60 C. 30 sec 72 C. 1 min 72 C. 10 min 4 C. hold

    [0127] The amplicons were analyzed in a 2% agarose gel and show a fragmentation of the plasmid DNA with sizes between 250 and 1000 bp (FIG. 3A).

    [0128] In order to see if the fragmentation is an effect caused by the remaining adaptors in the PCR a second PCR was performed with the same fragmented and ligated samples and PCR only with the adaptors as no template control (NTC). No amplicons were obtained using only the adaptors (NTC). FIG. 3B shows the agarose gel by means of which the amplified fragmented and ligated DNA is analyzed side by side with the corresponding adaptors amplification (NTC).

    [0129] In a second experiment a second HIV-1 integrase, (wild-type HIV integrase; Bio Products MD, LLC, Middletown, MD, USA) (BPHIN 1) was used to fragment and ligate plasmid DNA (pGL2) using the best performing adaptors. IN adaptor 7 and IN adaptor 7 in pair with 8 were used in this assay.

    Assay

    [0130]

    TABLE-US-00008 Reagent conc. in RXN L mix BPHIN 1 3.2 nM 5 IN adaptor 10 M 400 nM 2 Buffer 2x* 1x 25 Water 13.74 *Buffer 2x: 10 mM MnCl.sub.2, 40 mM HEPES (pH 7.5), 2 mM dithiothreitol, 0.1% Nonidet P40, 1 mM CHAPS, 40 mM NaCl. [0131] Incubate 10 min at 37 C.

    TABLE-US-00009 Reagent conc. in RXN l add Target (Plasmid); pGL2 274 ng/L 50 nM 4.26 total 50 [0132] Incubate for 1 h at 37 C.

    [0133] The fragmented and adaptor ligated target DNA was amplified using the Illumina primers P1 and P2 and analyzed on an agarose gel. The result is shown in FIG. 3C. Again, a fragmentation of the plasmid was obtained with fragment sizes between 150 and 500 bp.

    [0134] In order to test if these results are an artifact from non-specific plasmid amplification, the plasmid was amplified in parallel with the fragmented and adaptor ligated plasmid DNA using the P1 and P2 primers and analyzed in agarose electrophoresis. The result is shown in FIG. 3D. As can be seen, in the gel image no amplification was obtained with the plasmid and the adaptors.

    [0135] After testing the invention by using plasmids as target DNA the next step was to test whether by the inventive method it was able to generate libraries using genomic DNA as target DNA. In the following experiments E. coli DNA was used as target DNA for the generation of fragmented DNA with adaptor on the fragment ends that can be used for amplification of these fragments and subsequent sequencing on NGS platforms.

    [0136] For the following setup the best performing adaptors IN_adaptor_7 and IN_adaptor_8 were used. QHIN_1 stored in two different buffers (D and VV) was tested in parallel. 10Ong genomic DNA from E. coli was used as target DNA for fragmentation and adapter ligation.

    Experimental Setup:

    [0137] QHIN_1 storage buffers

    [0138] D: Dar-Buffer [0139] 25 mM Tris-HCl pH7,4 [0140] 1 M NaCl [0141] 7,5 mM CHAPS [0142] 1 mM DTT [0143] 50% Glycerol

    [0144] W: Wang50-Buffer [0145] 20 mM HEPES pH7,35 [0146] 1 M NaCl [0147] 1 mM DTT [0148] 50% Glycerol
    Two mastermixes (MMX) were prepared one using 0.2 pM adaptor.

    TABLE-US-00010 Reagent conc. in RXN L QHIN 1 0.16 M 5 IN adaptor 6 0.2 M 1 IN adaptor 7 0.2 M 1 Buffer 2x 1x 25.00 Water 13.00 incubate 10 min at 37 C. Total 45.00

    TABLE-US-00011 add Target (gDNA) 100/20 ng/L 100 ng 5.00 Total 50.00

    [0149] After incubation the samples were purified with QiaQuick columns and PCR-amplified with Primers P1 and P2 using two different cycling conditions in order to investigate if completion of gaps in the strands resulted by the integration is needed before the conventional cycling.

    The PCR Setup is Described in the Following Table:

    [0150]

    TABLE-US-00012 Stock M final conc. M volume 2xMMX 1x 25 L 10 M Forward Primer 0.3 M 1.5 L 10 M Reverse Primer 0.3 M 1.5 L 5x Q-Solution 0.5x 5 L Template DNA 12 L Water 5 L Total 50 L

    Cycling Conditions:

    [0151]

    TABLE-US-00013 1. cycling: 98 C. 2 min 98 C. 20 sec 35x 60 C. 30 sec 72 C. 30 sec 72 C. 1 min 4 C. hold 2. cycling: 98 C. 2 min 72 C. 2 min 98 C. 20 sec 35x 60 C. 30 sec 72 C. 30 sec 72 C. 1 min 4 C. hold

    [0152] After the PCR the remaining adaptors and primers were removed using Agencourt AMPure XP Beads and probes were analyzed via capillary electrophoresis using and Agilent DNA chip.

    FIG. 4 Represents the Electropherogram of all Samples:

    [0153] 1: D 100 1; Dar-Buffer/100 ng gDNA/1.cycling [0154] 2: W 100 1; Wang50-Buffer/100 ng gDNA/1.cycling [0155] 3: D 100 2; Dar-Buffer/100 ng gDNA/2.cycling [0156] 4: W 100 2; Wang50-Buffer/100 ng gDNA/2.cycling.

    [0157] Here fragments of amplified DNA can be seen with a main size distribution between 1000-5000 bp. That means fragmentation and adaptor ligations occurred and the generated fragments could be amplified using Primers P1 and P2.

    [0158] Further experiments were performed to optimize the size distributions of the fragments without giving different results (data not shown). That's why the inventors have tried to perform fragmentation using short adaptors only comprising the integrase recognition site (IRS) and then complete the adaptor sequence over PCR by adding the primer annealing site (PAS). The principle of this embodiment is illustrated in FIG. 5. After the target DNA has been simultaneously fragmented and adaptor ligated (upper part) the ligated fragments are then subjected to a PCR (lower part). In the PCR two PCR primer pairs are used. The first PCR primer pair is consisting two primers each of which comprising an integrase recognition site (IRS) capable to hybridize to the IRS of the adaptor ligated DNA fragments, and each comprising a primer annealing site (PAS1 or PAS2). The second PCR primer pair is consisting of two primers (P1 and P2) each of which can hybridize to the primer annealing sites PAS1 or PAS2, respectively. In the subsequent PCR the adaptor ligated DNA fragments are amplified and the adaptors are completed by addition of the primer annealing sites PAS1 and PAS2.

    [0159] Therefore, for further fragmentation experiments the fragmentation adaptors comprising IRS but no PAS (IN_adaptor 1; IN_adaptor_2), the PCR primer mix-1 (21/21plus_IN_4 (SEQ ID no. 6); 21/21plus_IN_5 (SEQ ID no. 7); Primer P1 (SEQ ID no. 17); Primer P2 (SEQ ID no. 18), or PCR primer mix-2 (6/6plus_IN_6 (SEQ ID no. 8); 6/6plus_IN_7 (SEQ ID no. 9); Primer P1 (SEQ ID no. 17); Primer P2 (SEQ ID no. 18) were used. The long PCR primers 21/21plus_IN_4 and 21/21plus_IN_5 or 6/6plus_IN_6 and 6/6plus_IN_7 comprise the IRSs and PAS, respectively. The short PCR primers P1 and P2 can hybridize to the respective PAS.

    [0160] 100 ng gDNA from E.coli were processed using the adaptors and primer formulations from the tables above and analyzed on Agilents Bioanalyzer using Agilent DNA chips. FIG. 6 shows the distribution of fragments after amplification with Primer mix 1 (A; C) and Primer mix 2 (B; D). [0161] 3: 1.IN1; IN adaptor 1/primer mix 1 [0162] 1: 1.N1_0; IN adaptor 1/primer mix 1_No template Control [0163] 7: 2.IN1; IN adaptor 1/primer mix 2 [0164] 5: 2.N1_0; IN adaptor 1/primer mix 2_No template Control [0165] 4: 1.IN2; IN adaptor 2/primer mix 1 [0166] 2: 1.N2_0; IN adaptor 2/primer mix 1_No template Control [0167] 8: 2.IN2; IN adaptor 2/primer mix 2 [0168] 6: 2.N2_0; IN adaptor 2/primer mix 2_No template Control

    [0169] As can be seen the best results were produced by using IN_adaptor 2 and PCR primer mix 1 since a better fragment distribution is achieved.

    [0170] Further experiments were planned with IN adaptor 2 for optimization of fragmentation.

    [0171] Different concentrations and incubation temperature as well as purification procedures were tested to obtain a better size distribution of the library and remove remaining adaptor.

    [0172] FIG. 7 shows fragmentation and adaptor ligation of 100 ng E. coli gDNA under different incubation temperatures. Surprisingly the in-house HIV-integrase (QHIN_1) used here shows a quite high thermostability which allows incubation of libraries at higher temperatures and results to a better size distribution of the library.

    A:

    [0173] 1:30; incubation of IN adaptor_2 complex with target DNA at 30 C. [0174] 3:37; incubation of IN adaptor 2 complex with target DNA at 37 C. [0175] 5:40; incubation of IN adaptor 2 complex with target DNA at 40 C. [0176] 7:45; incubation of IN adaptor 2 complex with target DNA at 45 C.

    B:

    [0177] 1:37; incubation of IN adaptor 2 complex with target DNA at 37 C. [0178] 3:50; incubation of IN adaptor 2 complex with target DNA at 50 C. [0179] 5:55; incubation of IN adaptor 2 complex with target DNA at 55 C. [0180] 7:60; incubation of IN/adaptor 2 complex with target DNA at 60 C.

    [0181] According to the presented data the inventors were able to reproduce the plasmid fragmentation results using the HIV-1-integrase enzyme with gDNA. The assay has been optimized to generate a library with a suitable size distribution for several NGS platforms.

    [0182] Summarizing the above results, the inventors have successfully tested different integrase enzymes to develop the method according to the invention to be used to generate libraries of fragments of tagged target DNA in only one step.