RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy

Abstract

The current invention provides an improved oligonucleotide and its use for treating, ameliorating, preventing and/or delaying DMD or BMD.

Claims

1-18. (canceled)

19. A 2-O-methyl phosphorothioate oligonucleotide of 25 bases in length, having the base sequence GUUGX.sub.1X.sub.1UX.sub.1X.sub.1GGUUX.sub.1UGAAGGUGUUX.sub.1 (SEQ ID NO: 92), wherein each X.sub.1 is 5-methyl-cytosine, or a pharmaceutically acceptable salt thereof.

20. A pharmaceutical composition, comprising the oligonucleotide of claim 19 and a pharmaceutically acceptable carrier.

21. A method for treating a patient with Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD) who has a mutation of the DMD gene that is amenable to exon 53 skipping, comprising administering to the patient the oligonucleotide of claim 19, wherein the antisense oligonucleotide induces exon 53 skipping.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0748] FIG. 1 shows comparison of AONs with or without cytosine to 5-methylcytosine substitution in differentiated healthy muscle cells in vitro after transection with (FIG. 1A) PS229L/PS524, SEQ ID NO:52 (corresponding to SEQ ID NO: 91 for the non-modified sequence, corresponding to SEQ ID NO: 92 wherein all cytosines are modified ) or (FIG. 1B) PS220/PS339 (SEQ ID NO:21, corresponding to SEQ ID NO. 101 for the non-modified sequence, corresponding to SEQ ID NO:200 wherein all cytosines are modified) or (FIG. 1C) PS524/PS1317/PS1318/PS1319, SEQ ID NO:52 (corresponding to SEQ ID NO: 92 (PS524) wherein all 6 cytosines are modified, to SEQ ID NO: 217 (PS1317) wherein 4 of the 6 cytosines are modified, to SEQ ID NO: 218 (PS1318) wherein 2 of the 6 cytosines are modified and to SEQ ID NO:219 (PS1319) wherein 3 of the 6 cytosines are modified SEQ ID NO:217). Average skipping percentages were calculated from triplo (n=3) (FIG. 1A, FIG. 1B) or duplo (n=2) (FIG. 1C) transfections per concentration. Solid lines refer to AONs with 5-methylcytosines, dotted lines to AONs with non-substituted cytosines (FIG. 1A, FIG. 1B).

[0749] FIG. 2 is a summary of the pharmacokinetic study in wild type (control) and mdx mice, comparing plasma and muscle tissue profiles of AONs with 5-methylcytosines (PS524, SEQ ID NO:52 (i.e. corresponding to SEQ ID NO: 92wherein all cytosines are modified) and PS652, SEQ ID NO:57 (i.e. corresponding to SEQ ID NO: 185 wherein all cytosines are modified) and AONs with unmodified (non-methylated) cytosines (PS229L, SEQ ID NO:52 corresponding to SEQ ID NO: 91 for the non-modified sequence, and PS531, SEQ ID NO:57 corresponding to SEQ ID NO: 137 for the non-modified sequence). (FIG. 2A) Pharmacokinetic tissue analysis of: 1) the ratio between the average levels of AON in muscle in mdx mice versus control, mice after one single sc injection; 2) the levels of the AONs (?g/g) in several mdx muscles (dia=diaphragm, gastroc=gastrocnemius, quadr=quadriceps, tric=triceps) at 14 days; 3) the relative muscle/kidney and muscle/liver levels at day 14, and4) the estimated half-life of the different AONs in triceps. (FIG. 2B) Pharmacokinetic plasma analysis of 1) Tmax (time at which Cmax was reached, only two time points of analysts included (15 or 60 min). 2) Cmax (highest plasma concentration reached), 3) AUC (area under curve; indicative for bioavailability) an 4) Cl (plasma clearance at 24 h.

[0750] FIG. 3 shows analysis of cytokine levels in human whole blood upon incubation with 0, 10, 25, or 50 ?g/ml of AONs with unmodified cytokines PS232 (SEQ ID NO: 39, corresponding to SEQ ID NO: 119 for the non-modified sequence) and PS534 (SEQ ID NO:59, corresponding to SEQ ID NO: 139 for the non-modified sequence) (black bars) or AONs with 5-methylcytosines PS648 (SEQ ID NO: 39, corresponding to SEQ ID NO: 201 wherein all cytosines are modified) and PS653 (SEQ ID NO:59, to SEQ ID NO: 192 wherein all cytosines are modified) (grey bars). The levels of TNF? (FIG. 3A, FIG. 3B). MCP-1 (FIG. 3C, FIG. 3C), IP-10 (FIG. 3E, FIG. 3F), and IL6 (FIG. 3G, FIG. 3H) were determined using commercially available ELISA kits. Each experiment was repeated four times (n=4). Data is shown for the most pronounced response of each cytokine.

[0751] FIG. 4 shows activity comparisons of AONs with 5-methylcytosines and/or 5-methyluracils with corresponding AONs without these base modifications, (FIG. 4A) Transfection of 200 nM, in duplo, into differentiated healthy muscle cells in vitro. Activity was expressed as average percentage exon 51 (PS43, non-modified sequence represented by SEQ ID NO: 111, PS559 corresponding to SEQ ID NO: 202, wherein all uraciles are modified, PS1106 corresponding to SEQ ID NO:203, wherein all cytosines and all uraciles are modified. All sequences are derived from SEQ ID NO: 31), exon 44 (PS188, non-modified sequence represented by SEQ ID NO: 95, PS785, corresponding to SEQ ID NO: 204, wherein all uraciles are modified. PS1107; corresponding to SEQ ID NO:205, wherein all cytosines and all uraciles are modified. All sequences are derived from SEQ ID NO 15); or exon 52 (PS235, non-modified sequence represented by SEQ ID NO: 120, PS786: corresponding to SEQ ID NO: 172, wherein all uraciles are modified. All sequences are derived from SEQ ID NO 40) skipping (n=2). AON sequences (5 to 3) and base modifications (bold, underlined nucleotides) are shown in the table underneath. (FIG. 4B) Intramuscular injection of 20 ?g of PS49 (non-modified sequence, SEQ ID NO: 216) or PS959 (modified sequence wherein ah uracils are modified, SEQ ID NO.214) in the gastrocnemius muscles of mdx mice. Activity was expressed as average percentage murine exon 23 skipping (n=4). AON sequences (5 to 3) and base modifications (bold, underlined nucleotides) are shown in the table underneath.

[0752] FIG. 5 shows activity comparisons of AONs with 2,6-diaminopurines with corresponding AONs without this base modification. (FIG. 5A), Transfection of 200 nM, in duplo, into differentiated healthy muscle cells in vitro. Activity was expressed as average percentage exon 51 (PS43, non-modified sequence represented by SEQ ID NO: 111, PS403, corresponding to SEQ ID NO: 206, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 31), exon 52 (PS235, non-modified sequence represented by SEQ ID NO: 120, PS897: corresponding to SEQ SD NO: 173, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 40), or exon 44 (PS188, non-modified sequence represented by SEQ ID NO: 95, PS733: corresponding to SEQ ID NO: 207, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 15) skipping (n=2). AON sequences (5 to 3) and base modifications (bold, underlined nucleotides) are shown in the table underneath. (FIG. 5B) and (FIG. 5C) The effect of substituting all unmodified adenines (PS188; SEQ ID NO: 95) with 2,6-diaminopurines (PS733; SEQ ID NO:207) on in vitro safety. As markers for activation of the alternative complement pathway, split factors C3a (FIG. 5B) and Bb (FIG. 5C) were measured in monkey plasma.

EXAMPLES

[0753]

TABLE-US-00002 TABLEL GeneralstructuresofAONs. X= Corm.sup.5C,Y= Uorm.sup.5U,Z= Aora.sup.2A; I= inosine(hypoxanthinebase), X.sub.1= m.sup.5C,Y.sub.1= m.sup.5U,Z.sub.1= a.sup.2A SEQ DMD ID Exon AONSequence(5.fwdarw.3) NO 44 GXXZYYYXYXZZXZGZYXY 14 GCCAUUUCUCAACAGAUCU 94 44 YXZGXYYXYGYYZGXXZXYG 15 UCAGCUUCUGUUAGCCACUG 95 Y.sub.1CAGCY.sub.1Y.sub.1CY.sub.1GY.sub.1Y.sub.1AGCCACY.sub.1G 204 UX.sub.1AGX.sub.1UUX.sub.1UGUUAGX.sub.1X.sub.1AX.sub.1UG 208 Y.sub.1X.sub.1AGX.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1GY.sub.1Y.sub.1AGX.sub.1X.sub.1AX.sub.1Y.sub.1G 205 UCZ.sub.1GCUUCUGUUZ.sub.1GCCZ.sub.1CUG 207 44 YYYGYZYYYZGXZYGYYXXX 16 UUUGUAUUUAGCAUGUUCCC 96 44 ZYYXYXZGGZZYYYGYGYXYYYX 17 AUUCUCAGGAAUUUGUGUCUUUC 97 44 XXZYYYGYZYYYZGXZYGYYXXX 18 CCAUUUGUAUUUAGCAUGUUCCC 98 44 YXYXZGGZZYYYGYGYXYYYX 19 UCUCAGGAAUUUGUGUCUUUC 99 44 GXXZYYYXYXZZXZGZYXYGYXZ 20 GCCAUUUCUCAACAGAUCUGUCA 100 45 YYYGXXGXYGXXXZZYGXXZYXXYG 21 UUUGCCGCUGCCCCAAUGCCAUCCUG 101 UUUGX.sub.1X.sub.1GX.sub.1UGX.sub.1X.sub.1X.sub.1AAUGX.sub.1X.sub.1AUX.sub.1X.sub.1UG 200 Y.sub.1Y.sub.1Y.sub.1GX.sub.1X.sub.1GX.sub.1Y.sub.1GX.sub.1X.sub.1X.sub.1AAY.sub.1GX.sub.1X.sub.1AY.sub.1X.sub.1X.sub.1Y.sub.1G 209 UUUGCCGCUGCCCZ.sub.1Z.sub.1UGCCZ.sub.1UCCUG 210 45 YYGXXGXYGXXXZZXYGXXZYXXYG 22 UUGCCGCUGCCCAAUGCCAUCCUG 102 45 YYGXXGXYGXXXZZYGXXZYXXYGG 23 UUGCCGCUGCCCAAUGCCAUCCUGG 103 45 YGXXGXYGXXXZZYGXXZYXXYG 24 UGCCGCUGCCCAAUGCCAUCCUG 104 45 YGXXGXYGXXXZZYGXXZYXXYGG 25 UGCCGCUGCCCAAUGCCAUCCUGG 105 45 GXXGXYGXXXZZYGXXZYXXYG 26 GCCGCUGCCCAAUGCCAUCCUG 106 45 XXGXYGXXXZZYGXXZYXXYGG 27 CCGCUGCCCAAUGCCAUCCUGG 107 45 YYYGXXIXYGXXXZZYGXXZYXXYG 28 UUUGCCICUGCCCAAUGCCAUCCUG 108 45 XZGYYYGXXGXYGXXXZZYGXXZYX 29 CAGUUUGCCGCUGCCCAAUGCCAUC 109 45 XZGYYYGXXGXYGXXXZZYGXXZYXXYGGZ 30 CAGUUUGCCGCUGCCCAAUGCCAUCCUGGA 110 51 YXZZGGZZGZYGGXZYYYXY 31 UCAAGGAAGAUGGCAUUUCU 111 Y.sub.1CAAGGAAGAY.sub.1GGCAY.sub.1Y.sub.1Y.sub.1CY.sub.1 202 Y.sub.1X.sub.1AAGGAAGAY.sub.1GGX.sub.1AY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1 203 UCZ.sub.1Z.sub.1GGZ.sub.1Z.sub.1GZ.sub.1UGGCZ.sub.1UUUCU 206 UX.sub.1AAGGAAGAUGGX.sub.1AUUUX.sub.1U 215 51 YGGXZYYYXYZGYYYGG 32 UGGCAUUUCUAGUUUGG 112 51 XZYXZZGGZZGZYGGXZYYYXY 33 CAUCAAGGAAGAUGGCAUUUCU 113 51 XZZXZYXZZGGZZGZYGGXZYYYXY 34 CAACAUCAAGGAAGAUGGCAUUUCU 114 51 XXYXYGYGZYYYYZYZZXYYGZY 35 CCUCUGUGAUUUUAUAACUUGAU 115 51 XXZGZGXZGGYZXXYXXZZXZYX 36 CCAGAGCAGGUACCUCCAACAUC 116 51 ZXZYXZZGGZZGZYGGXZYYYXYZGYYYGG 37 ACAUCAAGGAAGAUGGCAUUUCUAGUUUGG 117 51 ZXZYXZZGGZZGZYGGXZYYYXYZG 38 ACAUCAAGGAAGAUGGCAUUUCUAG 118 52 XYXYYGZYYGXYGGYXYYGYYYYYX 39 CUCUUGAUUGCUGGUCUUGUUUUUC 119 X.sub.1UX.sub.1UUGAUUGX.sub.1UGGUX.sub.1UUGUUUUUX.sub.1 201 52 GGYZZYGZGYYXYYXXZZXYGG 40 GGUAAUGAGUUCUUCCAACUGG 120 GGUAAUGAGUUX.sub.1UUX.sub.1X.sub.1AAX.sub.1UGG 171 GGY.sub.1AAY.sub.1GAGY.sub.1Y.sub.1CY.sub.1Y.sub.1CCAACY.sub.1GG 172 GGUZ.sub.1Z.sub.1UGZ.sub.1GUUCUUCCZ.sub.1Z.sub.1CUGG 173 GGY.sub.1AAY.sub.1GAGY.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1AAX.sub.1Y.sub.1GG 174 GGUZ.sub.1Z.sub.1UGZ.sub.1GUUX.sub.1UUX.sub.1X.sub.1Z.sub.1Z.sub.1X.sub.1UGG 175 GGY.sub.1Z.sub.1Z.sub.1Y.sub.1GZ.sub.1GY.sub.1Y.sub.1CY.sub.1Y.sub.1CCZ.sub.1Z.sub.1CY.sub.1GG 176 GGY.sub.1Z.sub.1Z.sub.1Y.sub.1GZ.sub.1GY.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1Z.sub.1Z.sub.1X.sub.1Y.sub.1GG 177 52 YXYYGZYYGXYGGYXYYGYYYYYXZ 41 UCUUGAUUGCUGGUCUUGUUUUUCA 121 52 YYXXZZXYGGGGZXGXXYXYGYYXX 42 UUCCAACUGGGGACGCCUCUGUUCC 122 52 YGYYXYZGXXYXYYGZYYGXYGGYX 43 UGUUCUAGCCUCUUGAUUGCUGGUC 123 UGUUX.sub.1UAGX.sub.1X.sub.1UX.sub.1UUGAUUGX.sub.1UGGUX.sub.1 178 Y.sub.1GY.sub.1Y.sub.1CY.sub.1AGCCY.sub.1CY.sub.1Y.sub.1GAY.sub.1Y.sub.1GCY.sub.1GGY.sub.1C 179 UGUUCUZ.sub.1GCCUCUUGZ.sub.1UUGCUGGUC 180 Y.sub.1GY.sub.1Y.sub.1X.sub.1Y.sub.1AGX.sub.1X.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1GAY.sub.1Y.sub.1GX.sub.1Y.sub.1GGY.sub.1X.sub.1 181 UGUUX.sub.1UZ.sub.1GX.sub.1X.sub.1UX.sub.1UUGZ.sub.1UUGX.sub.1UGGUX.sub.1 182 Y.sub.1GY.sub.1Y.sub.1CY.sub.1Z.sub.1GCCY.sub.1CY.sub.1Y.sub.1GZ.sub.1Y.sub.1Y.sub.1GCY.sub.1GGY.sub.1C 183 Y.sub.1GY.sub.1Y.sub.1X.sub.1Y.sub.1Z.sub.1GX.sub.1X.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1GZ.sub.1Y.sub.1Y.sub.1GX.sub.1Y.sub.1GGY.sub.1X.sub.1 184 53 XYGYYGXXYXXGGYYXYG 44 CUGUUGCCUCCGGUUCUG 124 53 XZZXYGYYGXXYXXGGYYXYGZ 45 CAACUGUUGCCUCCGGUUCUGA 125 53 XZZXYGYYGXXYXXGGYYXYGZZ 46 CAACUGUUGCCUCCGGUUCUGAA 126 53 XZZXYGYYGXXYXXGGYYXYGZZG 47 CAACUGUUGCCUCCGGUUCUGAAG 127 53 XYGYYGXXYXXGGYYXYGZZGG 48 CUGUUGCCUCCGGUUCUGAAGG 128 53 XYGYYGXXYXXGGYXYGZZGGY 49 CUGUUGCCUCCGGUUCUGAAGGU 129 53 XYGYYGXXYXXGGYYXYGZZGGYG 50 CUGUUGCCUCCGGUUCUGAAGGUG 130 53 XYGYYGXXYXXGGYYXYGZZGGYGY 51 CUGUUGCCUCCGGUUCUGAAGGUGU 131 53 GYYGXXYXXGGYYXYGZZGGYGYYX 52 GUUGCCUCCGGUUCUGAAGGUGUUC 91 GUUGX.sub.1X.sub.1UX.sub.1X.sub.1GGUUX.sub.1UGAAGGUGUUX.sub.1 92 GUUGX.sub.1X.sub.1UCCGGUUX.sub.1UGAAGGUGUUX.sub.1 217 GUUGX.sub.1X.sub.1UCCGGUUCUGAAGGUGUUC 218 GUUGCX.sub.1UCCGGUUX.sub.1UGAAGGUGUUX.sub.1 219 GY.sub.1Y.sub.1GCCY.sub.1CCGGY.sub.1Y.sub.1CY.sub.1GAAGGY.sub.1G 211 Y.sub.1Y.sub.1C GY.sub.1Y.sub.1GX.sub.1X.sub.1Y.sub.1X.sub.1X.sub.1GGY.sub.1Y.sub.1X.sub.1Y.sub.1GAAGG 212 Y.sub.1GY.sub.1Y.sub.1X.sub.1 GUUGCCUCCGGUUCUGZ.sub.1Z.sub.1GGUGUUC 213 53 GXXYXXGGYYXYGZZGGYGYYXYYG 53 GCCUCCGGUUCUGAAGGUGUUCUUG 133 53 YYGXXYXXGGYYXYGZZGGYGYYXYYGYZX 54 UUGCCUCCGGUUCUGAAGGUGUUCUUGUAC 134 53 XYGYYGXXYXXGGYYXYGZZGGYGYYXYYG 55 CUGUUGCCUCCGGUUCUGAAGGUGUUCUUG 135 53 XZZXYGYYGXXYXXGGYYXYGZZGGYGYYXYYG 56 CAACUGUUGCCUCCGGUUCUGAAGGUGUUCUUG 136 55 GZGYYYXYYXXZZZGXZGXXYXYX 57 GAGUUUCUUCCAAAGCAGCCUCUC 137 GAGUUUX.sub.1UUX.sub.1X.sub.1AAAGX.sub.1AGX.sub.1X.sub.1UX.sub.1UX.sub.1 185 GAGY.sub.1Y.sub.1Y.sub.1CY.sub.1Y.sub.1CCAAAGCAGCCY.sub.1CY.sub.1C 186 GZ.sub.1GUUUCUUCCZ.sub.1Z.sub.1Z.sub.1GCZ.sub.1GCCUCUC 187 GAGY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1AAAGX.sub.1AGX.sub.1X.sub.1Y.sub.1X.sub.1Y.sub.1X.sub.1 188 GZ.sub.1GUUUX.sub.1UUX.sub.1X.sub.1Z.sub.1Z.sub.1Z.sub.1GX.sub.1Z.sub.1GX.sub.1X.sub.1UX.sub.1UX.sub.1 189 GZ.sub.1GY.sub.1Y.sub.1Y.sub.1CY.sub.1Y.sub.1CCZ.sub.1Z.sub.1Z.sub.1GCZ.sub.1GCCY.sub.1CY.sub.1C 190 GZ.sub.1GY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1Z.sub.1Z.sub.1Z.sub.1GX.sub.1Z.sub.1GX.sub.1X.sub.1Y.sub.1X.sub.1Y.sub.1X.sub.1 191 55 YZYGZGYYYXYYXXZZZGXZGXXYX 58 UAUGAGUUUCUUCCAAAGCAGCCUC 138 55 ZGXZYXXYGYZGGZXZYYGGXZGY 59 AGCAUCCUGUAGGACAUUGGCAGU 139 AGX.sub.1AUX.sub.1X.sub.1UGUAGGAX.sub.1AUUGGX.sub.1AGU 192 AGCAY.sub.1CCY.sub.1GY.sub.1AGGACAY.sub.1Y.sub.1GGCAGY.sub.1 193 Z.sub.1GCZ.sub.1UCCUGUZ.sub.1GGZ.sub.1CZ.sub.1UUGGCZ.sub.1GU 194 AGX.sub.1AY.sub.1X.sub.1X.sub.1Y.sub.1GY.sub.1AGGAX.sub.1AY.sub.1Y.sub.1GGX.sub.1AGY.sub.1 195 Z.sub.1GX.sub.1Z.sub.1UX.sub.1X.sub.1UGUZ.sub.1GGZ.sub.1X.sub.1Z.sub.1UUGGX.sub.1Z.sub.1GU 196 Z.sub.1GCZ.sub.1Y.sub.1CCY.sub.1GY.sub.1Z.sub.1GGZ.sub.1CZ.sub.1Y.sub.1Y.sub.1GGCZ.sub.1GY.sub.1 197 Z.sub.1GX.sub.1Z.sub.1Y.sub.1X.sub.1X.sub.1Y.sub.1GY.sub.1Z.sub.1GGZ.sub.1X.sub.1Z.sub.1Y.sub.1Y.sub.1GGX.sub.1Z.sub.1GY.sub.1 198 55 XZYXXYGYZGGZXZYYGGXZGYYG 60 CAUCCUGUAGGACAUUGGCAGUUG 140 55 YXXYGYZGGZXZYYGGXZGYYGYY 61 UCCUGUAGGACAUUGGCAGUUGUU 141 55 XYGYZGGZXZYYGGXZGYYGYYYX 62 CUGUAGGACAUUGGCAGUUGUUUC 142

TABLE-US-00003 TABLE2 GeneralstructuresofAONs. X= Corm.sup.5C,Y= Uorm.sup.5U,Z= Aora.sup.2A; I= inosine(hypoxanthinebase), X.sub.1= m.sup.5C,Y.sub.1= m.sup.5U,Z.sub.1= a.sup.2A DMDExon AONSequence(5.fwdarw.3) SEQIDNO 44 ZYYYXYXZZXZGZ 63 AUUUCUCAACAGA 143 44 ZGXYYXYGYYZGXXZ 64 AGCUUCUGUUAGCCA 144 44 ZYYXYXZGGZZ 65 AUUCUCAGGAA 145 44 ZYYYGYZYYYZGXZ 66 AUUUGUAUUUAGCA 146 44 ZYYYXYXZZXZGZYXYGYXZ 67 AUUUCUCAACAGAUCUGUCA 147 44 XYYYXYXZZXZGZ 68 AUUUCUCAACAGA 148 44 ZXZGZYXYGYXZ 69 ACAGAUCUGUCA 149 45 YYYGXXGXYGXXXZZYGXXZ 70 UUUGCCGCUGCCCAAUGCCA 150 45 XGXYGXXXZZYGXXZYXXYG 71 CGCUGCCCAAUGCCAUCCUG 151 45 GXXGXYGXXXZZYGXXZYXX 72 GCCGCUGCCCAAUGCCAUCC 152 51 ZZGGZZGZYGGXZ 73 AAGGAAGAUGGCA 153 51 ZGGZZGZYGGXZ 74 AGGAAGAUGGCA 154 51 ZGZGXZGGYZ 75 AGAGCAGGUA 155 51 ZGXZGGYZXXYXXZ 76 AGCAGGUACCUCCA 156 51 ZXXYXXZZXZ 77 ACCUCCAACA 157 52 ZZYGZGYYXYYXXZZ 78 AAUGAGUUCUUCCAA 158 52 ZYGZGYYXYYXXZ 79 AUGAGUUCUUCCA 159 52 ZGYYXYYXXZ 80 AGUUCUUCCA 160 52 ZGXXYXYYGZ 81 AGCCUCUUGA 161 53 GYYGXXYXXGGYYXYGZZGG 82 GUUGCCUCCGGUUCUGAAGG 162 53 XYXXGGYYXYGZZGGYGYYX 83 CUCCGGUUCUGAAGGUGUUC 163 53 XXYXXGGYYXYGZZGGY 84 CCUCCGGUUCUGAAGGU 164 55 ZGYYYXYYXXZZZGXZ 85 AGUUUCUUCCAAAGCA 165 55 ZGYYYXYYXXZ 86 AGUUUCUUCCA 166 55 ZGXZYXXYGYZGGZXZYYGGXZ 87 AGCAUCCUGUAGGACAUUGGCA 167 55 ZGXZYXXYGYZ 88 AGCAUCCUGUA 168 55 ZYXXYGYZGGZ 89 AUCCUGUAGGA 169 55 ZGGZXZYYGGXZ 90 AGGACAUUGGCA 170

TABLE-US-00004 TABLE3 MostpreferredAONs GeneralstructuresofAONs. X= Corm.sup.5C,Y= Uorm.sup.5U,Z= Aora.sup.2A;I= inosine (hypoxanthinebase),X.sub.1= m.sup.5C,Y.sub.1= m.sup.5U,Z.sub.1= a.sup.2A DMD SEQ Exon AONSequence(5.fwdarw.3) IDNO 44 YXZGXYYXYGYYZGXXZXYG 15 UCAGCUUCUGUUAGCCACUG 95 PS188 FIG.4,5 Y.sub.1CAGGY.sub.1Y.sub.1CY.sub.1GY.sub.1YAGCCACY.sub.1G 204 PS785 FIG.4 UX.sub.1AGX.sub.1UUX.sub.1UGUUAGX.sub.1X.sub.1AX.sub.1UG 208 PS658 Y.sub.1X.sub.1AGX.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1GY.sub.1Y.sub.1AGX.sub.1X.sub.1AX.sub.1Y.sub.1G 205 PS1107 FIG.4 UCZ.sub.1GCUUCUGUUZ.sub.1GCCZ.sub.1CUG 207 PS733 FIG.5 45 YYYGXXGXYGXXXZZYGXXZYXXYG 21 UUUGCCGCUGCCCAAUGCCAUCCUG 101 PS220 FIG.1b UUUGX.sub.1X.sub.1GX.sub.1UGX.sub.1X.sub.1X.sub.1AAUGX.sub.1X.sub.1AUX.sub.1X.sub.1UG 200 P3399 FIG.1b Y.sub.1Y.sub.1Y.sub.1GX.sub.1X.sub.1GX.sub.1Y.sub.1GX.sub.1X.sub.1X.sub.1AAY.sub.1GX.sub.1X.sub.1AY.sub.1X.sub.1X.sub.1Y.sub.1G 209 PS1108 UUUGCCGCUGCCCZ.sub.1Z.sub.1UGCCZ.sub.1UCCUG 210 PS1229 YYYGXXIXYGXXXZZYGXXZYXXYG 28 UUUGCCICUGCCCAAUGCCAUCCUG 108 PS305 51 YXZZGGZZGZYGGXZYYYXY 31 UCAAGGAAGAUGGCAUUUCU 111 PS43 FIG.4,5 Y.sub.1CAAGGAAGAY.sub.1GGCAY.sub.1Y.sub.1Y.sub.1CY.sub.1 202 PS559 FIG.4 Y.sub.1X.sub.1AAGGAAGAY.sub.1GGX.sub.1AY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1 203 PS1106 FIG.4 UCZ.sub.1Z.sub.1GGZZ.sub.1GZ.sub.1UGGCZ.sub.1UUUCU 206 PS403 FIG.5 UX.sub.1AAGGAAGAUGGX.sub.1AUUUX.sub.1U 215 PS401 52 GGYZZYGZGYYXYYXXZZXYGG 40 GGUAAUGAGUUCUUCCAACUGG 120 PS235 FIG.4,5 GGUAAUGAGUUXIUUX.sub.1X.sub.1AAX.sub.1UGG 171 PS650 GGY.sub.1AAY.sub.1GAGY.sub.1Y.sub.1CY.sub.1Y.sub.1CCAACY.sub.1GG 172 PS786 FIG.4 GGUZ.sub.1Z.sub.1UGZ.sub.1GUUCUUCCZ.sub.1Z.sub.1CUGG 173 PS897 FIG.5 GGY.sub.1AAY.sub.1GAGY.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1AAX.sub.1Y.sub.1GG 174 PS1110 53 GYYGXXYXXGGYYXYGZZGGYGYYX 52 GUUGCCUCCGGUUCUGAAGGUGUUC 91 PS229L FIG.1a,2 GUUGX.sub.1X.sub.1UX.sub.1X.sub.1GGUUX.sub.1UGAAGGUGUUX.sub.1 92 PS524 FIG.1a,c,2 GUUGX.sub.1X.sub.1UCCGGUUX.sub.1UGAAGGUGUUX.sub.1 217 PS1317 FIG.1c GUUGX.sub.1X.sub.1UCCGGUUCUGAAGGUGUUC 218 PS1318 FIG.1c GUUGCX.sub.1UCCGGUUX.sub.1UGAAGGUGUUX.sub.1 219 PS1319 FIG.1c GY.sub.1Y.sub.1GCCY.sub.1CCGGY.sub.1Y.sub.1CY.sub.1GAAGGY.sub.1GY.sub.1Y.sub.1C 211 GY.sub.1Y.sub.1GX.sub.1X.sub.1Y.sub.1X.sub.1X.sub.1GGY.sub.1Y.sub.1X.sub.1Y.sub.1GAAGGY.sub.1GY.sub.1Y.sub.1X.sub.1 212 PS1109 GUUGCCUCCGGUUCUGZ.sub.1Z.sub.1GGUGUUC 213 55 GZGYYYXYYXXZZZGXZGXXYXYX 57 GAGUUUCUUCCAAAGCAGCCUCUC 137 PS531 FIG.2 GAGUUUX.sub.1UUX.sub.1X.sub.1AAAGX.sub.1AGX.sub.1X.sub.1UX.sub.1UX.sub.1 185 PS652 FIG.2 GAGY.sub.1Y.sub.1Y.sub.1CY.sub.1Y.sub.1CCAAAGCAGCCY.sub.1CY.sub.1C 186 GZ.sub.1GUUUCUUCCZ.sub.1Z.sub.1GCZ.sub.1GCCUCUC 187 GAGY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1AAAGX.sub.1AGX.sub.1X.sub.1Y.sub.1X.sub.1Y.sub.1X.sub.1 188 PS1112

[0754] Preferred non modified oligonucleotides (X?C, Y?U, Z=A) are more preferably derived from each of the oligonucleotide basis sequence (SEQ ID NO:14-90) and are represented by a nucleotide or base sequence SEQ ID NO:91, 93-170

[0755] Preferred modified oligonucleotides derived from one of the nucleotide or base sequences SEQ ID NO:14-90 and comprising at least one X is m.sup.5C and/or at least one Y is m.sup.5U and/or at least one Z is a.sup.2A are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-213, 215, 217, 218, 219. Even more preferred modified oligonucleotides (all X=m.sup.5C?X.sub.1 and/or all Y=m.sup.5U?Y.sub.1 and/or all Z=a.sup.2A=Z.sub.1) are derived from, the most preferred nucleotide or base sequences (SEQ ID NO:15, 21 ,31, 40, 52, and 57) and are represented by SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219. The most preferred modified oligonucleotides are disclosed to Table 3.

Example 1

[0756] Material and Methods

[0757] AONs

[0758] All oligonucleotides (PS220/PS399, based on SEQ ID NO:21 corresponding to SEQ ID NO:101 for the non-modified sequence (PS220) and to SEQ ID NO:200 wherein all cytosines are modified (PS399); PS229L/PS524/PS1317/PS1318/PS1319, based on SEQ ID NO:52 corresponding to SEQ ID NO:91 for the non-modified sequence (PS229L), to SEQ ID NO:92 (PS524) wherein all 6 cytosines are modified, to SEQ ID NO: 217 (PS1317) wherein 4 of the 6 cytosines are modified, to SEQ ID NO: 218 (PS1318) wherein 2 of the 6 cytosines are modified and to SEQ ID NO:219 (PS1319) wherein 3 of the 6 cytosines are modified; PS232/PS648, based on SEQ ID NO: 39 corresponding to SEQ ID NO:119 for the non-modified sequence (PS232) and to SEQ ID NO:201 wherein all cytosines are modified (PS648); PS531/PS652, based on SEQ ID NO:57 corresponding to SEQ ID NO:137 for the non-modified sequence (PS531) and to SEQ ID NO:185 wherein all cytosines are modified (PS652); PS534/PS653, based on SEQ ID NO:59 corresponding to SEQ ID NO:139 for the non-modified sequence (PS534) and to SEQ ID NO:192 wherein all cytosines are modified (PS653)) were 2-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/?KTA Oligopilot), through standard phosphoramidite protocols, or obtained from commercial suppliers, in 40 nmol-4.5 mmol synthesis scale, Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH.sub.4OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized. Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS399 (ChemGenes, 1 ?mol synthesis scale, used as received), PS1317, PS1318, and PS1319 (ChemGenes, 200 nmol synthesis scale, used as received), PS229L, PS232, PS524, and PS648 (EuroGentec, 40 nmol synthesis scale, used as received), PS229L (Prosensa, 5.9 g obtained material, purity 81%), PS524 (Avecia, 4.5 mmol synthesis scale, purity 93%), PS534 (Prosensa, 2 ?mol synthesis scale, purity 86%), PS653 (Prosensa, 40 nmol synthesis scale, purity 77%), PS531 (Avecia, 4.6 g obtained material, purity 85%), PS652 (Avecia, 2.4 g obtained material, purity 84% and 3.8 g obtained material purity 82%). For the in vitro transfection experiments described herein, 50 ?M working solutions of the AONs were prepared in 20 mM phosphate buffer (pH 7.0). For the whole blood cytokine release assays in this example, the concentrations of the stock solutions (prepared in DNase/RNase-free distilled water (Invitrogen)) varied: PS232 (8.75 mg/mL), PS534 (7.02 mg/mL), PS648 (8.55 mg/mL), PS653 (8.12 mg/mL).

[0759] Transfection and RT-PCR Analysis

[0760] Differentiated human healthy control muscle cells (myotubes) were transfected in 6-wells plates with a triplo AON concentration, series of 0-100-200-400 nM (FIG. 1a, PS229L/PS524, SEQ ID NO:91/92) or 0-50-100-200-400-800 nM (FIG. 1b, PS220/PS399, SEQ ID NO: 101/200) or with an in duplo concentration of 400 nM (FIG. 1c, PS524/PS1317/PS1318/PS1319, SEQ ID NO:92/217/218/219), according to non-GLP standard operating procedures. For transfection polyethylenimine (ExGen500, Fermentas) was used (2 ?l per ?g AON, in 0.15M NaCl). Aforementioned transfection procedures were adapted from previously reported material and methods (Aartsma-Rus et al., 2003). At 24 hrs after transfection, RNA was isolated and analyzed by RT-PCR. Briefly, to generate dystrophin-specific cDNA, a DMD gene specific reverse primer in exon 47 (PS220/PS399) or exon 55 (PS229UPS 524/PS1317/PS 1318/PS 1319) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA. The PCR analysis was subsequently done on 3 ?l of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 45 (PS220/PS399) or 53 (PS229L/PS524/PS1317/PS 1318/PS 1319). The RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described (Aartsma-Rus et al., 2003). RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent). The data was processed, by Agilent 2100 Bioanalyzer software and Excel 2007. The ratio of the smaller transcript product (containing the exon 45(PS220/PS399) or 53 skip (PS229L/PS124/PS1317/PS1318/PS1319)) to the total amount of transcript products was assessed (representing the exon 45 or 53 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.

[0761] Pharmacokinetic Study in Wild Type and Mdx Mice

[0762] Mdx (C57Bl/10ScSn-Dmd.sup.mdx/J) and wild-type (C57Bl/10ScSnJ) mice at 5 weeks of age were obtained from Jackson Laboratory (Maine USA). The AONs (PS229L/PS524 corresponding to SEQ ID NO: 91/92, PS531/PS652 corresponding to SEQ ID NO: 137/185) we administered in physiological saline at a dose of 100 mg/kg by subcutaneous injections three times per week for two weeks. To determine the plasma profile of the AONs, plasma samples were taken from 2 animals per time-point (per AON group) at the following times for the animals: 15 min, 1 h, 2 h, 6 h and 24 hours after dosing. To obtain plasma venous whole blood was collected into Li-Heparin tubes, centrifuged and kept at ?80? C. until analysis. For distribution analysis 7 organs (heart, kidney cortex, liver, diaphragm, gastrocnemius, quadriceps & triceps) were harvested upon sacrifice of the animals. The tissues were snap frozen and stored at ?80? C. until analysis.

[0763] AON Hybridisation Assay

[0764] To determine the concentration of the AONs (PS229L/PS524 corresponding to SEQ ID NO: 91/92, PS531/PS652 corresponding to SEQ ID NO: 137/185) in plasma and tissue an AON hybridization assay was used, which is based on the assay described by Yu et al., 2002. For the tissue distribution analysis, tissues were homogenized, using a MagNaLyzer (Roche) to a concentration of 60 mg/ml in protK buffer (100 mmol/l Tris-HCl pH8.5, 200 mmol/l NaCl, 5 mmol/l EDTA, 0.2% SDS) containing 2 mg/ml proteinase K, followed by a 2 hours incubation (liver) or 4 hours incubation (all other organs) in a rotating hybridization oven at 55? C. and then stored ?20? C. until use. All tissue homogenates and calibration curves were diluted (fit to criteria of the assay) in 60 times diluted pooled mdx control tissue homogenate (kidney, liver, several muscle groups). A template probe specific for each AON (5 gaatagacg-anti-AON-biotio 3, DNA phosphate oligonucleotide) and a ligation probe (p-cgtctattc-DIG DNA phosphate oligonucleotide) were used in the hybridization assay. The homogenates were incubated for 1 h at 37? C. with, template probe (50 nmol/l) and the hybridized samples were transferred to streptavidin coated 96-well plates and incubated for 30 rain at 37? C. Subsequently, the plate was washed 4 times and the digoxigenin-labeled ligation (2 nmol/l) was added and incubated for 30 min at ambient temperature. The DIG-label was detected using an anti-DIG-PQD (1:7,500-1:30,000; Roche Diagnostics), which was visualized with a 3,3,5,5-tetramethylbenzidine substrate (Sigma Aldrich, the Netherlands), and the reaction was stopped using an acidic solution (Sigma Aldrich). The absorption was measured at 450 nm using a BioTek Synergy HT plate reader (Beun de Ronde, Abcoude, The Netherlands). Plasma samples were analyzed according to the same protocol, using 100 times diluted pooled mdx plasma.

[0765] Whole Blood Cytokine Release Assay

[0766] For the detection of possible cytokine stimulation induced by selected AONs (PS232/PS648 corresponding to SEQ ID NO: 119/201 and PS534/PS653 corresponding to SEQ ID NO: 139/192) whole blood (anticoagulant CPD) from healthy human volunteers was used. Varying AON concentrations (ranging from 0 to 50 ?g/ml, in a dilution of approximately 1:0.01 (v/v)) were added to the blood and the samples were incubated for 4 hours at 37? C. under 5% CO.sub.2 atmosphere. After incubation, the samples were centrifuged at 3200?g for 15 minutes at 4? C. and plasma supernatants were collected and stored at ?20? C. until cytokine quantification. MCP-1, IL-6, TNF-?, and IP-10 concentrations were determined by sandwich ELISA (human MCP-1, IL-6, TNF-?, IP-10 ELISA kits (R&D Systems). The experiments with human whole blood were repealed three to four times. FIG. 3 is based on one experiment only, but considered representative.

[0767] Results

[0768] The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all cytosines with 5-methylcytosines (m5C) was tested in cultured, differentiated, healthy muscle cells in vitro. In FIGS. 1a and 1b two examples are shown. When comparing PS229L and PS524 (=PS229L-m5C) (i.e. non-modified sequence SEQ ID NO: 91 compared with the modified sequence SEQ ID NO: 92 wherein all cytosines have been modified) in a dose-response transfection experiment using 0-100-200-400 nM, PS524 was clearly more efficient than PS229L at 200 and 400 nM (1.9-fold higher exon 53 skipping levels) (FIG. 1a). Similarly, when comparing PS220 and PS399 (=PS220-m5C) (i.e. non-modified sequence SEQ ID NO: 101 compared with the modified sequence SEQ ID NO: 200 wherein all cytosines have been modified) in a dose-response transfection experiment using 0-50-100-200-400-800 nM, PS399 was clearly more efficient than PS220, especially at lower concentrations (up to 10-fold higher exon 45 skipping levels at 50 nM) (FIG. 1b). These results demonstrate that the presence of 5-methylcytosines has a positive effect on the activity of the AONs. In PS524 (SEQ ID NO:92) all 6 cytosines are substituted with 5-methylcytosines (m5C) which had a positive effect on the exon skipping activity when compared to the non-modified counterpart oligonucleotide PS229L (SEQ ID NO:91) (FIG. 1a). To test whether such positive effect may be correlated with the number or percentage of base modifications incorporated, PS1317, PS1318, and PS1319, with respectively 4, 2, and 3 of the 6 cytosines substituted with 5-methylcytosines (m5C), were tested and directly compared to PS524 in cultured, differentiated, healthy muscle cells in vitro. PS1317, PS1318, and PS1319 were all effective in inducing exon 53 skipping (47%, 37%, and 45% respectively) (FIG. 1c). When compared to the levels obtained with PS524 however (64%), these results indeed suggest that reducing the number of 5-methylcytosines (m5C), from 6 to 4, 3, or 2 5-methylcytosines, leads to a reduced positive effect on exon skipping activity of the AON.

[0769] To investigate whether 5-methylcytosines affect bio-stability, -distribution, and/or -availability, a pharamacokinetic study was performed both in wild type (control) and mdx mice. The mdx mouse model for DMD has a natural nonsense mutation in exon 23 and is therefore dystrophin-deficient. The lack of dystrophin at the membranes increases the permeability of the muscle fibers for relatively small molecules as AONs, and has indeed been demonstrated to enhance 2-O-methyl phosphorothioate RNA AON uptake by muscle up to 10-fold (Heemskerk et al., 2010). The mice were injected subcutaneously with 100 mg/kg of either 5-methylcytosine-containing AONs (PS524, PS652 corresponding to SEQ ID NO: 92, 185) or their counterparts with unmodified cytosines (PS229L, PS531 corresponding to SEQ ID NO: 91, 137), three times per week for two weeks. At different time-points (day 1, 7, 14) after the last injection, the mice were sacrificed and different muscle groups (heart, diaphragm, gastrocnemius, quadriceps, and triceps) and liver and kidney were isolated to determine AON concentrations therein (FIG. 2A). As anticipated, for all compounds the concentrations in mdx muscles (average of all samples) was higher than those in control mice. The ratio mdx to control AON levels appeared relatively higher for the AONs with 5-methylcytosines. More specifically, in the mdx mice, the levels of PS524 and PS652 were 2- to 3-fold higher than that of PS229L and PS531. (FIG. 2A). When monitoring the levels of AON in kidney and liver (known toxicity organs), the ratios between muscle tissue and toxicity tissues remained similar, or were even favorable for PS524. These results suggest, that AONs with 5-methylcytosine are taken up better by or more stable in muscle than AONs with unmodified cytosines. Indeed the half life in muscle was longer for PS524 (>20 days) and PS652 (25 days) when compared to PS229L (7 days) and PS531 (10 days). In plasma, the Cmax values of the AONs injected were similar, which confirms that the mice received equal doses (FIG. 2B). Remarkably, the AUC values (as indicator for bioavailability) were 1.5 to 2.3-fold higher for the 5-methylcytosine containing AONs. This was associated with a lower clearance which supports their higher muscle tissue levels. The results from this pharmacokinetic study thus demonstrate that the presence of 5-methylcytosines has a positive effect on the bio-stability, -distribution, and/or -availability of the AONs, while the muscle/toxicity organ ratios were similar to those with the AONs with unmodified cytosines.

[0770] The in vitro safety profile of AONs with 5-methylcytosines (PS648, PS653 corresponding to SEQ ID NO: 201, 192) was compared to that of AONs with unmodified cytosines (PS232, PS534, corresponding to SEQ ID NO: 119, 139). AONs may stimulate an innate immune response by activating the Toll-like receptors (including TLR7, TLR8, TLR9), which results in set of coordinated immune responses that include innate immunity. Several chemo- and cytokines, such as IP-10, TNF?, IL-6 and MCP-1 play a role in this process, and were therefore monitored in human whole blood incubated with 0 to 50 ?g/ml of each AON (using commercially available ELISA kits). PS232 and PS534 both have unmodified cytosines and induced the release of TNF-? (FIGS. 3A, B), MCP-1 (FIGS. 3C, D), IP-10 (FIGS. 3E, F), and IL-6 (FIGS. 3G, H) at increasing doses. In contrast, both PS648 and PS653 (with 5-methylcytosines) did not have any effect on TNF-?, IP-10 and IL-6. PS653, not PS648, seemed to induce a minor release of MCP-1 only. In conclusion, the presence of 5-methylcytosines improved the safety profile of these AONs in vitro.

Example 2

[0771] Material and Methods

[0772] AONs

[0773] All oligonucleotides (PS43/PS559/PS1106, all based on SEQ ID NO:31, and corresponding to SEQ ID NO: 111 (PS43) non modified sequence, SEQ ID NO: 202 (PS559) wherein all uraciles have been modified, and SEQ ID NO: 203 (PS1106) wherein all uraciles and all cytosines have been modified: PS188/PS785/PS1107, all based on SEQ ID NO:15, and corresponding to SEQ ID NO: 95 (PS188) non-modified sequence, SEQ ID NO: 204 (PS785) wherein all uraciles have been modified, and SEQ ID NO: 205 (PS1107) wherein all uraciles and all cytosines have been modified; PS235/PS786, both based on SEQ ID NO:40, and corresponding to SEQ ID NO: 120 (PS235) non-modified sequence and SEQ ID NO: 172 (PS786) wherein all uraciles have been modified), and PS49 (SEQ ID NO:216) non-modified sequence and PS959 (SEQ ID NO:214) wherein all cytosines have been modified, were 2-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/?KTA Oligopilot) through standard phosphoramidite protocols, or obtained from commercial suppliers, in 200 nmol-286.1 g scale. Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH.sub.4OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized. Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS188 (Girindus, 286.1 g obtained product purity 93%), PS785, PS786, PS1106, and PS1107 (ChemGenes, 200 nmol synthesis scale, used as received), PS43 (Prosensa, 1 ?mol synthesis scale, purity 90%), PS559 (ChemGenes, 1 ?mol synthesis scale, used as received), PS235 (Prosensa, 1.92 mmol synthesis scale, purity 91%). For the in vitro transection experiments described herein, 50 ?M working solutions of the AONs were prepared in 20 mM phosphate buffer (pH 7.0).

[0774] Transfection and RT-PCR Analysis

[0775] Differentiated human healthy control muscle cells (myotubes) were transacted in 6-wells plates with a fixed AON concentration of 200 nM, according to non-GLP standard operating procedures. For transfection polyethylenimine (ExGen500, Fermentas) was used (2 ?l per ?g AON, in 0.15M NaCl). Aforementioned transfection procedures were adapted from previously reported material and methods (Aartsma-Rus et al., 2003). At 24 hrs after transfection, RNA was isolated and analyzed by RT-PCR. Briefly, to generate dystrophin-specific cDNA, a DMD gene specific reverse primer in exon 53 (PS43/PS559/PS1106, SEQ ID NO: 111, 202, 203), exon 46 (PS188/PS785/PS1107 SEQ ID NO: 95, 204, 205) or exon 54 (PS235/PS786, SEQ ID NO: 120, 172) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA. The PCR analysis was subsequently done on 3 ?l of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 51 (PS43/PS559/PS1106), exon 44 (PS188/PS785/PS1107) or exon 52 (PS235/PS786). The RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described [Aartsma-Rus et al., Hum Mol Genet 2003; 12(8):907-14]. RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysts (Agilent). The data was processed by Agilent 2100 Bioanalyzer software and Excel 2007. The ratio of the smaller transcript product (containing the exon 51 (PS43/PS559/PS1106), exon 44 (PS188/PS785/PSI107), or exon 52 skip (PS235/PS786) to the total amount of transcript products was assessed (representing the exon 51, 44, or 52 skipping efficiencies in percentages) aid directly compared to that in non-transfected cells.

[0776] In Vivo Administration and RT-PCR

[0777] The experiments with the mdx mouse model (C57Bl/10ScSn-mdx/J; Charles River Laboratories) were approved by the local LUMC Animal Ethics Committee (DEC number 11145). Two mdx mice per group were anaesthetized using isoflurane and then injected intramuscularly in both gastrocnemius muscles, with 20 ug PS49 (SEQ ID NO: 216) or PS959 (SEQ ID NO:214), diluted in sterile saline to a total volume of 50 ?l per injection, on two consecutive days. Animals were sacrificed 1 week after the last injection by cervical dislocation and muscles were isolated and snap frozen in magnalyzer greenbead tubes (Roche). Six-hundred ?l Tripure (Roche) was added to the tubes and muscles were homogenized using the bulletblender machine, 3?1 min speed 10. The lysate was transferred to a clean tube to which 120 ?l of chloroform was added. Samples were vigorously shaken en incubated on ice for 5 minutes, then centrifuged for 15 minutes at maximum speed at 4? C. The supernatant was transferred to another tube and 1 volume of isopropanol was added. Samples were mixed and incubated at 4 degrees for at least 30 minutes. Then, samples were centrifuged for 15 minutes at maximum speed at 4? C., washed with 70% ethanol followed by a second centrifugation step of 10 minutes at maximum speed at 4? C. RNA pellets were airdried and solved in DEPC treated water. cDNA was generated using 400 ng total RNA with random hexamer primers using Transcriptor reverse transcriptase (RT) (Roche Diagnostics) according to the manufacturers instructions. PCRs were performed by 30 cycles of 94 degrees for 30 s, 60 degrees for 30 s and 72 degrees for 30 s in a 50 ?l reaction using 1.5 ?l cDNA as template using primers specific for mouse exon 22 and exon 24. PCR products were visualized on 2% agarose gels quantified the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, Calif., USA).

[0778] Results

[0779] The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all unmodified cytosines with 5-methylcytosines and substituting all unmodified uracils with 5-methyluracils (as in PS1106, PS 1107, SEQ ID NO: 203, 205), and of only substituting all unmodified uracils with 5-methyluracils (as in PS559, PS785, PS786, SEQ ID NO: 202, 204, 172), was first tested at a fixed 200 nM AON concentration in cultured, differentiated, healthy muscle cells in vitro (FIG. 4A). The AONs with 5-methyluracils (PS559, PS785, and PS786) increased the exon skipping efficiencies 1.3- to 3-fold when compared to their counterparts with unmodified uracils. When also replacing the unmodified cytosines by 5-methylcytosines, the skipping levels were further increased (PS1106 versus PS559, SEQ ID NO: 203 versus 202) or similar (PS1107 versus PS785, SEQ ID NO: 205 versus 204). The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all unmodified uracils (as in PS49; SEQ ID NO:216) with 5-methyluracils (as in PS959; SEQ ID NO:214) was then also tested in muscle of the mdx mouse model. PS959 with all 5-methyluracils increased the exon 23 skipping efficiencies approximately 3-fold when compared to PS49 with unmodified uracils (n=4 per AON) (FIG. 4B). These results demonstrate that not only 5-methylcytosines may have a positive effect on exon skipping activity (as also shown in FIG. 1) but also, 5-methyluracils, both in vitro and in vivo. In addition the combined use of these 5-methylpyrimidine may even further increase activity.

Example 3

[0780] Material and Methods

[0781] AONs

[0782] All oligonucleotides (PS43/PS403, based on SEQ ID NO:31, and corresponding to SEQ ID NO: 111 (PS43) for the non-modified and SEQ ID NO: 206 (PS403) for the sequence wherein all adenines have been modified; PS188/PS733, based on SEQ ID NO:15, and corresponding to SEQ ID NO: 95 (PS188) for the non-modified and SEQ ID NO: 207 (PS733) for the sequence wherein all adenines have been modified; PS235/PS897, based on SEQ ID NO:40, and corresponding to SEQ ID NO: 120 (PS235) for the non-modified and SEQ ID NO: 173 (PS897) for the sequence wherein all adenines have been modified) were 2-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/?KTA Oligopilot) through standard phosphoramidite protocols, or obtained from commercial suppliers, in 200 nmol-151 g scale. Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH.sub.4OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized. Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS188 (Girindus, 151 g obtained, purity 92%), PS733 (TriLink or ChemGenes, 200 nmol/1 mg synthesis scale, used as received, PS43 (Prosensa, 10 ?mol synthesis scale, purity 86%), PS403 (ChemGenes, 1 ?mol synthesis scale, used as received), PS235 (Prosensa, 1.92 mmol synthesis scale, purity 91%), PS897 (ChemGenes, 200 nmol synthesis scale, used as received). For the in vitro transfection experiments described herein, 50 ?M working solutions of the AONs were prepared in 20 mM phosphate buffer (pH 7.0). For the in vitro complement activation assays described herein, 3 mg/mL stock solutions of PS188 and PS733 were prepared in 20 mM phosphate buffer (pH 7.0).

[0783] Transfection and RT-PCR Analysis

[0784] Differentiated human healthy control muscle cells (myotubes) were transfected in 6-wells plates with a fixed AON concentration of 200 nM, according to non-GLP standard operating procedures. For transfection polyethylenimine (ExGen500, Fermentas) was used (2 ?l per ?g AON, in 0.15M NaCl). Aforementioned transfection procedures were adapted from previously reported material and methods (Aartsma-Rus et al., 2003). At 24 hrs after transection, RNA was isolated and analyzed by RT-PCR. Briefly, to generate dystrophin-specific cDNA, a DMD gene specific reverse primer in exon 53 (PS43/PS403, SEQ ID NO: 111/206), exon 46 (PS188/PS733, SEQ ID NO: 95/207) or exon 54 (PS235/PS897, SEQ ID NO: 120/173) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA. The PCR analysis was subsequently done on 3 ?l of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 51 (PS43/PS403), exon 44 (PS188/PS733) or exon 52 (PS235/PS897). The RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described [Aartsma-Rus et al., Hum Mol Genet 2003; 12(8):907-14). RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent). The data was processed by Agilent 2100 Bioanalyzer software and Excel 2007. The ratio of the smaller transcript product (containing the exon 51 (PS43/PS403), exon 44 (PSI88/PS733), or exon 52 skip (PS235/PS897) to the total amount of transcript products was assessed (representing the exon 51, 44, or 52 skipping efficiencies in percentages) and directly compared; to that in non-transfected cells.

[0785] Complement Activation Assay

[0786] Antisense oligonucleotides may activate the alternative complement pathway, which contains several split factors, such as C3a and factor Bb (the latter is unique to the alternative pathway). The ability of AONs to possibly activate the complement pathway was assessed in plasma from Cynomolgus monkeys (LiHe plasma, CIT, France). Increasing concentrations (from 0 to 300 ?g/mL) of PS188 (SEQ ID NO: 95) and PS733 (PS207), in a dilution of 1:10 (v/v)), were added to the plasma and incubated at 37? C. for 30 min. The reaction was terminated by transferring the samples to ice and making dilutions in ice-cold diluent. Bb and C3a concentrations were determined by ELISA (Quidel, San Diego, Calif.),

[0787] Results

[0788] The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all unmodified adenines with 2,6-diaminopurines was tested at a fixed AON concentration (200 nM) in cultured, differentiated, healthy muscle cells in vitro. In FIG. 5A examples for three different AON sequences are shown. The AONs with 2,6-diaminopurines (PS403, PS897, and PS733, SEQ ID NO: 206, 207, 173) increased the exon skipping efficiencies 2- to 4-fold when compared to their counterparts with unmodified adenines (compared to SEQ ID NO: 111, 95, 120). There seemed to be a correlation with the number of 2,6-diaminopurines in each AON.

[0789] The effect of substituting all unmodified adenines (as in PS188; SEQ ID NO: 95) with 2,6-diaminopurines (as in PS733; SEQ ID NO:207) on in vitro safety, i.e. possible activation of the alternative complement pathway, was tested in monkey plasma. Whereas PS188 induced relatively high levels of both split factors Bb and C3a, the 2,6-diaminopurines in PS733 completely abolished the effect on the alternative pathway, showing no increase in either Bb or C3a levels (FIG. 5B). Thus the presence of 2,6-diaminopurines seemed to improve the safety profile of PS188 in vitro.

[0790] These results demonstrate the positive effect of 2,6-diaminopurines on the exon skipping activity and safety of AONs.

LIST OF REFERENCES

[0791] van Ommen, van Deutekom, Aartsma-Rus, Curr Opin Mol Ther. 2008; 10(2):140-9,

[0792] Yokota, Duddy, Partidge, Acta Myol. 2007; 26(3):179-84.

[0793] van Deutekom et al., N Engl J Med. 2007; 357(26):2677-86.

[0794] Goemans et al., N Engl J Med. 2011; 364(16):1513-22.

[0795] Cirak et al., Lancet 2011; 378: 595-605.

[0796] Heemskerk et al., Mol Ther 2010; 18(6):1210-7.

[0797] Aartsma-Rus et al. Hum Mol Gen 2003; 12(8):907-14.

[0798] Yu R Z., Anal Biochem 2002; 304: 19-25.

[0799] Krieg A M. et al., Nature 1995; 374: 546-549.

[0800] Diehold S. S., et.al., Eur J Immunol. 2006; December; 36(12):3256-67.

[0801] Krieg, A. M., Curr. Opin. Immunol. 2000; 12: 35-43.

[0802] Wagner, H., Adv. Immunol. 1999; 73; 329-368.

[0803] Popovic P J. et al. J of Immunol 2006; 177: 8701-8707.

[0804] Peacock H et al. J. Am. Chem. Soc. 2011, 133, 9200

[0805] Arai K et al. Bioorg. Med. Chem. 2011, 21, 6285

[0806] Ehmsen J. et al, J. Cell Sci. 2002, 115 (Pt14): 2801-2803.

[0807] Monaco A. P., et al., Genomics 1988; 2: 90-95.

[0808] Manzur A. Y. et al., Wiley publishers, 2008. The Cochrane collaboration.

[0809] Hodgetts S., et al, Neuromuscular Disorders 2006; 16: 591-602.

[0810] Aartsma-Rus et al, Oligonucleotides 2010, 20(2): 69-77

[0811] Zuker M., et al, Nucleic Acids Res. 2003; 31(13):3406-15.

[0812] Cartegni L, et al, Nat Rev Genet 2002; 3(4):285-98.

[0813] Cartegni L, et al, Nucleic Acids Res 2003; 31(13):3568-71

[0814] Remington: The Science and Practice of Pharmacy, 20th Edition.

[0815] Baltimore, Md.: Lippincott Williams & Wilkins, 2000

[0816] Kumar L, Pharm. Technol. 2008, 3, 128

[0817] Bruno, K., Advanced Drug Delivery Reviews 2011; 63: 1210.

[0818] Hari et al. Org. Biomol. Chem. 2012, 10, 9639);

[0819] Hanessian et al. Angew. Chem. Intl Ed. 2012, 45, 11242