PARTHENOGENETIC HAPLOID INDUCTION GENE DMP AND APPLICATION THEREOF

Abstract

Provided are a parthenogenetic haploid induction gene DMP and an application thereof. The parthenogenetic haploid induction genes AtDMP8 and AtDMP9 are cloned from Arabidopsis thaliana. Experiments have shown that mutations of AtDMP8 and AtDMP9 can produce parthenogenetic haploid inducibility, to enable dicotyledonous crops to be induced to produce haploids via parthenogenetic means. The present invention was further verified in tomatoes, and it was also found in tomatoes that the mutation of SlDMP can produce parthenogenetic haploid inducibility. The invention lays an important foundation for broadening the application of haploid breeding technology on dicotyledonous plants and revealing the biological mechanism of parthenogenetic haploid production. Given the universality of the utilization of haploid breeding technology in the current breeding industry, the invention has very wide application space and market prospects.

Claims

1. A method for preparing a plant haploid inducer line is as follows A1) or A2): A1) silencing or inhibiting the expression and/or activity of the gene DMP in the plant genome or knocking out the gene DMP to obtain a plant haploid inducer line; A2) inhibiting the activity of protein DMP in the plant to obtain a plant haploid inducer line; the plant is dicotyledonous; the protein DMP is a protein represented by the following B1) or B2) or B3) or B4): B1) a protein with the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6; B2) a fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of the protein shown in SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6; B3) a protein having the same function obtained by substituting and/or deleting and/or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6; B4) a protein having 75% or more homology with the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6 and having the same function.

2. The method according to the claim 1, wherein, when the dicotyledonous plant is Arabidopsis thaliana, gene DMP is gene AtDMP8 and/or gene AtDMP9; protein DMP is protein AtDMP8 and/or protein AtDMP9.

3. The method according to the claim 1, wherein, when the dicotyledonous plant is tomato, the gene DMP is gene SlDMP; the DMP protein is protein SlDMP.

4. The method according to claim 1, wherein, the gene DMP is the gene shown in the following C1) or C2) or C3) or C4): C1) a cDNA molecule or a genomic DNA molecule shown in SEQ ID No. 1 or SEQ ID No. 3 or SEQ ID No. 5; C2) a cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined by C1); C3) a cDNA molecule or a genomic DNA molecule derived from a dicotyledonous plant and having 75% or more identity to the nucleotide sequence defined in C1); C4) a cDNA molecule or a genomic DNA molecule that hybridizes with a nucleotide sequence defined by C1) or C2) or C3) under stringent conditions; The DMP gene has the following functions: the dicotyledonous plant becomes a plant haploid inducer line when the DMP gene is silenced or inhibited or knocked out therein.

5. The method according to claim 1, wherein, the said knocking out gene AtDMP8 and/or gene AtDMP9 or said knocking out gene SlDMP is by CRISPR/Cas9.

6. The method according to claim 1, wherein, when the dicotyledonous plant is Arabidopsis thaliana, the target site of the CRISPR/Cas9 is located at positions 98-117 of SEQ ID No. 1, positions 290-309 of SEQ ID No. 3, positions 368-387of SEQ ID No. 3 and positions 509-528of SEQ ID No. 1.

7. The method according to claim 1, wherein, when the dicotyledonous plant is tomato, the target site of the CRISPR/Cas9 is located at positions 76-95 of SEQ ID No.5, positions 247-266 of SEQ ID No. 5.

8. The method according to claim 1, wherein, the method further comprises the steps of screening gene DMP mutants.

9. The method according to claim 1, wherein, the plant haploid inducer line specifically comprises an Arabidopsis thaliana mutant line T1-34, an Arabidopsis thaliana mutant line T1-6, an Arabidopsis thaliana mutant line T1-11, an Arabidopsis thaliana mutant line T1-19, an Arabidopsis thaliana mutant line T1-24, an Arabidopsis thaliana mutant line T1-25, an Arabidopsis thaliana mutant line T1-28, or an Arabidopsis thaliana mutant line T1-32; the difference between the genomic DNA of the Arabidopsis thaliana mutant line T1-34 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurs in one chromosome at positions 115-512 of SEQ ID No. 1, and a base (T) insertion occurs in the other chromosome at positions 114-115 of SEQ ID No. 1; the difference between the genomic DNA of the Arabidopsis thaliana mutant line T1-6 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurs in one chromosome at positions 115-512 of SEQ ID No. 1, and a fragment deletion occurs in the other chromosome at positions 113-114 of SEQ ID No. 1; and in a gene encoding protein AtDMP9, a fragment insertion occurs in both chromosomes at positions 160-161 of SEQ ID No. 3, with the nucleotide sequence of the inserted fragment shown as SEQ ID No. 13; the difference between the genomic DNA of the Arabidopsis thaliana mutant line T1-11 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a base (T) insertion occurs at positions 114-115 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, a base (T) insertion occurs in one chromosome at positions 160-161 of SEQ ID No. 3, and a fragment insertion occurs in the other chromosome at positions 160-161 of SEQ ID No. 3, with the nucleotide sequence of the inserted fragment shown as SEQ ID No. 13; the difference between the genome of the Arabidopsis thaliana mutant line T1-19 and the genome of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a base (T) deletion occurs in one chromosome at position 114 of SEQ ID No. 1, and a fragment deletion occurs in the other chromosome at positions 115-511 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, a fragment deletion occurs in one chromosome at positions 161-560 of SEQ ID No. 3, and a fragment deletion occurs in the other chromosome at positions 161-564 of SEQ ID No. 3; the difference between the genomic DNA of the Arabidopsis thaliana mutant line T1-24 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurs in one chromosome at positions 115-512 of SEQ ID No. 1, and a base (T) insertion occurs in the other chromosome at positions 114-115 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, a fragment deletion occurs in one chromosome at positions 161-560 of SEQ ID No. 3, and a fragment deletion occurs in the other chromosome at positions 159-160 of SEQ ID No. 3; the difference between the genomic DNA of the Arabidopsis thaliana mutant line T1-25 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a base (T) deletion occurs in one chromosome at position 114 of SEQ ID No. 1, and a fragment CGT insertion occurs in the other chromosome at positions 114-115 of SEQ ID No. 1; and in a gene encoding protein AtDMP9, a fragment deletion occurs in one chromosome at positions 161-162 of SEQ ID No. 3, and a base (A) insertion occurs in the other chromosome at positions 160-161 of SEQ ID No. 3; the difference between the genomic DNA of the Arabidopsis thaliana mutant line T1-28 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurs in one chromosome at positions 115-512 of SEQ ID No. 1, and a base (T) deletion occurs in the other chromosome at position 114 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, and a base (A) insertion occurs in both chromosomes at positions 160-161 of SEQ ID No. 3; the difference between the genomic DNA of the Arabidopsis thaliana mutant line T1-32 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurs in one chromosome at positions 115-511 of SEQ ID No. 1, and a base (T) insertion occurs in the other chromosome at positions 114-115 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, and a base (C) deletion occurs in both chromosomes at position 161 of SEQ ID No. 3.

10. The method according to claim 1, wherein, the method further comprising the step of producing the offspring of the plant haploid inducer line: selfing the plant haploid inducer line.

11. The method according to claim 10, wherein, the method further comprises the steps of screening gene DMP mutants.

12. The method according to claim 10, wherein, the plant haploid inducer line is an Arabidopsis thaliana mutant line T2-33, an Arabidopsis thaliana mutant line T2-38, a tomato mutant line sldmp-1 or a tomato mutant line sldmp-2; the difference of the genomic DNA of the Arabidopsis thaliana mutant line T2-33 and the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP9, a base (T) insertion occurs in both chromosomes at positions 160-161 of SEQ ID No. 3, and a fragment insertion occurs in both chromosomes at positions 561-562 of SEQ ID No. 3, with the nucleotide sequence of the inserted fragment shown as SEQ ID No. 14; the difference between the genomic DNA of the Arabidopsis thaliana mutant line T2-38 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurs in both chromosomes at positions 115-127 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, a base (T) and a base (G) insertion occurs in both chromosomes at positions 160-161 of SEQ ID No. 3 and positions 562-563 of SEQ ID No. 3, respectively; the difference between the genome DNA of the tomato mutant line sldmp-1 and the genome DNA of wild-type tomato AC only lies in that in a gene encoding SlDMP protein, and a base (C) insertion occurs in both chromosomes at positions 92-93 of SEQ ID No. 5; the difference between the genome DNA of the tomato mutant line sldmp-2 and the genome DNA of wild-type tomato AC only lies in that in a gene encoding protein SlDMP, a fragment deletion occurs in both chromosomes at positions 93-249 of SEQ ID No. 5.

13. A method for preparing a plant haploid, comprises the following steps, selfing the plant haploid inducer line or the offspring thereof prepared by the method of claim 1, or crossing the plant haploid inducer line or the offspring thereof with other plant materials as a male parent to obtain the selfed offspring or the cross-species offspring, namely the plant haploid; the plant is a dicotyledonous plant.

14. The method according to claim 13, wherein, the method further comprises the following steps: performing fluorescent labeling identification and/or haploid traits identification and/or leaf ploidy identification and/or molecular marker identification on the selfed offspring or the cross-species offspring single plant, and selecting the offspring single plants identified as haploids by at least one method as plant haploids.

15. A plant haploid inducer line, in which the expression and/or activity of the gene/protein DMP in the plant was silenced or inhibited or in which the gene DMP was knocked out; or, the offspring of the plant haploid inducer line, in which the expression and/or activity of the gene/protein DMP in the plant was silenced or inhibited or in which the gene DMP was knocked out; or, a plant haploid prepared by the method of claim 13.

16. The plant haploid inducer line according to claim 15, wherein, the plant haploid inducer line include cells, tissues, and organs derived from the plant haploid inducer line; the organs include seeds, leaves, fruits, flowers, stems and roots.

17. The plant haploid inducer line according to claim 15, wherein, the plant haploid inducer line include propagation materials, the propagation materials include a group consisting of pollen, ovaries, ovules, germs, endosperms, egg cells, cleavage, roots, root tips, hypocotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts, and tissue cultures.

18. (canceled)

19. The plant haploid according to claim 15, wherein, the plant haploid include cells, tissues, and organs derived from the plant haploid inducer line; the organs include seeds, leaves, fruits, flowers, stems and roots.

20. The plant haploid according to claim 15, wherein, the plant haploid include propagation materials, the propagation materials include a group consisting of pollen, ovaries, ovules, germs, endosperms, egg cells, cleavage, roots, root tips, hypocotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts, and tissue cultures.

21-24. (canceled)

25. The plant haploid inducer line or the plant haploid according to claim 15, wherein, the plant is dicotyledonous.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0101] FIG. 1 shows a graph comparing Arabidopsis thaliana haploids and diploids. The plants indicated by the arrows are haploids.

[0102] FIG. 2 shows a graph comparing Arabidopsis thaliana haploids and diploids after bolting FIG. 3 shows a graph comparing flow cytometry results for Arabidopsis thaliana haploids and diploids.

[0103] FIG. 4A and FIG. 4B shows a graph of fluorescence identification of Arabidopsis thaliana haploids. Panel 4A shows the phenotype of Arabidopsis thaliana seeds under white light, Panel 4B shows the phenotype of Arabidopsis thaliana seeds under fluorescence, and the seeds indicated by the arrows are haploids.

[0104] FIG. 5 shows a gel image of molecular marker verification of Arabidopsis thaliana haploids and diploids. M is a 2K molecular marker, I is a female parent material banding pattern, II is a male parent material banding pattern, III is a haploid banding pattern, and IV is a diploid banding pattern.

[0105] FIGS. 6A-6D shows a graph comparing plants and fruits of wild-type tomato and sldmp mutants. Panels 6A and 6B show wild-type tomato and sldmp mutant plants, respectively, and panels 6C and 6D shows show wild-type tomato and sldmp mutant selfed fruits, respectively.

[0106] FIGS. 7A-7D shows a graph of fluorescence expression of tomato seeds. Panels 7A and 7B show the ungerminated and germinated performance of tomato seeds photographed under bright fields, and Panels 7C and 7D show the ungerminated and germinated performance of tomato seeds photographed under fluorescence.

[0107] FIG. 8 shows a graph comparing flow cytometry results for tomato haploids and diploids.

[0108] FIG. 9A and FIG. 9B shows a schematic diagram of the structure of the main elements in the recombinant vector. Panels 9A and 9B show a schematic diagram of the structure of Arabidopsis thaliana and tomato vector, respectively.

BEST MODE OF IMPLEMENTING THE INVENTION

[0109] The following examples facilitate a better understanding of the present invention but do not limit the present invention. The experimental methods in the following examples are conventional unless otherwise specified. The experimental materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified. In the quantitative experiments of the following examples, triplicate experiments are set up, and the results are averaged.

[0110] The pICSL4723 vector in the following examples is described in the document “Castel, B. and L. Tomlinson, et al. (2019). Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis thaliana. PloS one, 14(1).”, publicly available from the Chinese Agricultural University, the test material is used only for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0111] Wild-type Arabidopsis thaliana Col-0 and ms1 in the following examples are described in the literature “Rosso, M. G. and Y. Li, et al. (2003). An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol 53 (1-2): 247-59.”, publicly available from China Agricultural University, the biological material is only used for repeating the relevant experiments of the present invention, and cannot be used for other purposes.

[0112] Wild-type tomato AC in the following examples is described in the literature “ Yuan, G. and C. Jia, et al. (2010). Effect of brassinosteroids on drought resistance and abscisic acid concentration in tomato under water stress. Scientia Horticulturae 126 (2): 103-108.”, publicly available from China Agricultural University, the biological material is only used for repeating the relevant experiments of the present invention, and cannot be used for other purposes.

[0113] The wild-type tomato Micro-Tom in the following examples is described in the literature “Sun, H. and S. Uchii, et al. (2006). A highly efficient transformation protocol for Micro-Tom, a model cultivar for tomato functional genomics. Plant and Cell Physiology 47 (3): 426-431.”, publicly available from China Agricultural University, the biological material is only used for repeating the relevant experiments of the present invention, and cannot be used for other purposes.

[0114] The CDS sequence of gene AtDMP8 in the invention is shown in positions 95-826 of SEQ ID No. 1 in the sequence listing, and the amino acid sequence of the protein encoded by gene AtDMP8 is shown in SEQ ID No. 2.

[0115] The CDS sequence of gene AtDMP9 in the invention is shown in positions 141-875 of SEQ ID No. 3 in the sequence listing, and the amino acid sequence of the protein encoded by gene AtDMP9 is shown in SEQ ID No. 4.

[0116] The CDS sequence of gene SlDMP in the invention is shown in positions 1-678 of SEQ ID No. 5 in a sequence table, and the amino acid sequence of the protein encoded by gene SlDMP is shown in SEQ ID No. 6.

Example 1. Preparation of Gene AtDMP8 and/or Gene AtDMP9 Knockout Arabidopsis thaliana mutants and Uses Thereof

[0117] I. Genes AtDMP8 and/or AtDMP9 were knocked out using a CRISPR/Cas9 system Genes AtDMP8 and/or AtDMP9 in Arabidopsis thaliana were knocked out by a CRISPR/Cas9 system to obtain gene AtDMP8 and/or gene AtDMP9 knockout Arabidopsis thaliana mutants. The specific steps were as follows:

[0118] 1. Selection of sgRNA Sequences

[0119] Target site sequences were designed on gene AtDMP8 and/or gene AtDMP9, respectively, and were 20 bp in length.

[0120] The target site 1 was located at positions 98-117 of SEQ ID No. 1 and 144-163 of SEQ ID No. 3, and the sequence of sgRNA target site 1 was GAGAAAACAGAGGAAAGCGT. (SEQ ID NO.15)

[0121] Target site 2 was located at positions 290-309 of SEQ ID No. 3, and the sequence of sgRNA target site 2 was AAGAGGTCGAAAACGTCGCA. (SEQ ID NO.16)

[0122] The target site 3 was located at 368-387 of SEQ ID No. 3, and the sequence of sgRNA target site 3 was TCAAGAGTGTTCCTGTCGGA. (SEQ ID NO.17)

[0123] The target site 4 was located at positions 509-528 of SEQ ID No. 1 and 558-577 of SEQ ID No. 3, and the sequence of sgRNA target site 4 was ATGACAACCGCGAGTCCACG (SEQ ID NO.18).

[0124] 2. Construction of CRISPR/Cas9 Vector

[0125] The CRISPR/Cas9 vector is a recombinant vector(vector structure diagram shown in FIG. 9A) obtained by connecting a DNA molecule shown in SEQ ID No. 7 (sgRNA expression element), a DNA molecule shown in SEQ ID No. 9 (Cas9 expression element), and a DNA molecule shown in SEQ ID No. 10 (fluorescent protein expression element) to a pICSL4723 vector through a golden gate method. The DNA molecule shown in SEQ ID No. 7 sequentially comprises a coding sequence of sgRNA targeted to the target site 1, a coding sequence of sgRNA targeted to the target site 2, a coding sequence of sgRNA targeted to the target site 2, and a coding sequence of sgRNA targeted to the target site 4, with an AtU6-26 promoter used for initiating the expression of the coding sequence of sgRNA found near the beginning of each sgRNA coding sequence.

[0126] 3. Acquisition of Transgenic Plants

[0127] The CRISPR/Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cells GV3101 through heat shock (Agrobacterium GV3101 competent cells were purchased from Beijing Aosen Dingxin Biotechnology Co., Ltd., and publicly available) to obtain a recombinant strain GV3101/CRISPR/Cas9.

[0128] Then the inflorescence of wild Arabidopsis thaliana Col-0 was infected with the recombinant strain GV3101/CRISPR/Cas9 by adopting a transformation method of infecting Arabidopsis thaliana inflorescences with Agrobacterium (i.e. the recombinant Agrobacterium was subjected to expanding propagation at 28° C., and Arabidopsis thaliana inflorescence was infected with the propagated Agrobacterium solution), and T1 generation transgenic Arabidopsis thaliana plant was obtained after red fluorescence screening.

[0129] 4. Identification of Transgenic Plants with Mutation of Gene AtDMP8 and/or Gene AtDMP9

[0130] Leaves of the T1 generation transgenic Arabidopsis thaliana plant obtained in step 3 were collected, genomic DNA was extracted as a template, and PCR amplification was conducted by adopting the following two pairs of primers respectively, to obtain PCR amplification products of different lines.

[0131] The sequences of the primers for detecting gene AtDMP8 mutant sequence were as follows:

TABLE-US-00001 DMP8F1: (SEQ ID NO. 19) TGCGAAATGAGATTGGTTTTGGG; DMP8R1: (SEQ ID NO. 20) AAACACCCTGTGACTCTCCG.

[0132] The sequences of the primers for detecting gene AtDMP9 mutant sequence were as follows:

TABLE-US-00002 DMP9F1: (SEQ ID NO. 21) ATAACCGTCAATAACCGCCG; DMP9R2: (SEQ ID NO. 22) CCAGTCATGCAACCAACACC.

[0133] The PCR amplification products of different lines were subjected to Sanger sequencing, and the sequencing results were compared with AtDMP8 and AtDMP9 of wild-type Arabidopsis thaliana Col-0, respectively. The genotypes of AtDMP8 and AtDMP9 were identified according to the following principles, respectively.

[0134] If the sequence had a doublet characteristic from the target site sequence, the genotype of the line was heterozygous (i.e. gene AtDMP8 and/or gene AtDMP9 mutated on one of the two homologous chromosomes, and unmutated on the other chromosome), and the line was a T1 generation transgenic Arabidopsis thaliana heterozygous mutant line;

[0135] For a sequence with specific singlet characteristics from the target site sequence, if it was the same as the gene sequence of AtDMP8 and AtDMP9 of wild-type Arabidopsis thaliana Col-0, the genotype of the line was wild-type, that is there was no mutation on the gene sequence of AtDMP8 and AtDMP9; if it was different from the gene sequence of AtDMP8 and/or AtDMP9 of the wild-type Arabidopsis thaliana Col-0, the genotype of the line was homozygous (the gene AtDMP8 and/or gene AtDMP9 mutated on both homologous chromosomes), the line was a T1 generation transgenic Arabidopsis thaliana homozygous mutant line.

[0136] The identification results were shown in Tables 1 and 2 (Tables 1 and 2 were mutations genes AtDMP8 and AtDMP9 of T1 generation transgenic Arabidopsis thaliana, respectively): among 41 T1 generation transgenic Arabidopsis thaliana plants, there was 33 T1 generation transgenic plants with mutation of gene AtDMP8, of which 2 plants have a homozygous mutation in gene AtDMP8 and 17 plants had a biallelic mutation in gene AtDMP8. There were 28 T1 generation transgenic plants with mutation of gene AtDMP9, of which 5 plants had a homozygous mutation in gene AtDMP9 and 7 plants had a biallelic mutation in gene AtDMP9. There were 12 plants with homozygous/biallelic mutations in AtDMP8 and AtDMP9. Individuals that resulted in a frameshift mutation (deletion not a multiple of 3) among homozygous/biallelic mutant individuals were further selected for phenotypic identification. There were three types of AtDMP8 homozygous mutation/biallelic mutation, AtDMP9 homozygous mutation/biallelic mutation, and AtDMP8 and AtDMP9 homozygous mutation/biallelic mutation.

TABLE-US-00003 TABLE 1 Gene AtDMP8 mutation types in T1 generation transgenic Arabidopsis thaliana Serial Numb er AtDMP8 allele 1 allele2 T1-1 Biallelic GAAAG------------------- GGGGCGTCGGAATCA (SEQ ID mutation NO. 23)..GACTCCACGT (SEQ ID NO. 24) T1-2 Heterozygous -----------------CTCGC WT mutation T1-3 Biallelic GAAAGACGTCGGAATCA (SEQ GGGTCGTCGGAATCA (SEQ ID mutation ID NO. 25)..GACTCCACGT (SEQ NO. 27)..GACTCCACGT (SEQ ID ID NO. 26) NO. 28) T1-4 Wild- WT WT type T1-5 Wild- WT WT type T1-6 Biallelic GAAAG------------------- GGAA--CGTCGGAATCA (SEQ mutation ID NO. 29)..GACTCCACGT (SEQ ID NO. 30) T1-7 Heterozygous GAAAGACGTCGGAATCA (SEQ WT mutation ID NO. 31)..GACTCCACGT (SEQ ID NO. 32) T1-8 Heterozygous GAAAGGCGTCGGAATCA (SEQ WT mutation ID NO. 33)..GACTCCACGT (SEQ ID NO. 34) T1-9 Biallelic GAAAGTCGTCGGAATCA (SEQ GGGTCG--GGAATCA..GACTCC mutation ID NO. 35)..GACTCCACGT (SEQ ACGT (SEQ ID NO. 37) ID NO. 36) T1-10 Biallelic GAAAG--------------------------- GGGGCGTCGGAATCA (SEQ ID mutation NO. 38)..GACTCCACGT (SEQ ID NO. 39) T1-11 Homozygous GAAAGGCGTCGGAATCA (SEQ GGGGCGTCGGAATCA (SEQ ID mutation ID NO. 40)..GACTCCACGT (SEQ NO. 42)..GACTCCACGT (SEQ ID ID NO. 41) NO. 43) T1-12 Biallelic GAAAGGCGTCGGAATCA (SEQ GGG-GTCGGAATCA (SEQ ID mutation ID NO. 44)..GACTCCACGT (SEQ NO. 46)..GACTCCACGT (SEQ ID ID NO. 45) NO. 47) T1-13 Wild- WT WT type T1-14 Heterozygous GAAAGGCGTCGGAATCA (SEQ WT mutation ID NO. 8)..GACTCCACGT (SEQ ID NO. 49) T1-15 Biallelic GAAAG------------ GGGGCGTCGGAATCA (SEQ ID mutation NO. 50)..GACTCCACGT (SEQ ID NO. 51) T1-16 Heterozygous GAA-------(+49 bp)---TTCATGAA WT mutation T1-17 Wild- WT WT type T1-18 Heterozygous GAAA-CGTCGGAATCA (SEQ ID WT mutation NO. 52)..GACTCCACGT (SEQ ID NO. 53) T1-19 Biallelic GAAA-CGTCGGAATCA (SEQ ID GGG--------------------------- mutation NO. 54)..CTCCACGTG-ACTC T1-20 Heterozygous GAAAG--TCGGAATCA..GACTC WT mutation CACGT (SEQ ID NO. 55) T1-21 Heterozygous GAAAG-----------------GACTCGC WT mutation T1-22 Wild- WT WT type T1-23 Biallelic GAAAG------------ GGGTCGTCGGAATCA (SEQ ID mutation NO. 56) T1-24 Biallelic GAAAGGACTCGC GGGTCGTCGGAATCA (SEQ ID mutation NO. 57) T1-25 Biallelic GAAA-CGTCGGAATCA (SEQ ID GGG(+3 bp)CGTCGGAATCA (SEQ mutation NO. 58)..GACTCCACGT (SEQ ID ID NO. 60) NO. 59) T1-26 Wild- WT WT type T1-27 Biallelic GAAAG------------ GG-CGTCGGAATCA (SEQ ID mutation NO. 61) T1-28 Biallelic GAAAG----------------GACTCGC GG-CGTCGGAATCA (SEQ ID mutation NO. 62) T1-29 Wild- WT WT type T1-30 Biallelic GAAAGGCGTCGGAATCA (SEQ GGG---------------ACTCGC mutation ID NO. 63)..GACTCCACGT (SEQ ID NO. 64) T1-31 Heterozygous GAAAGACGTCGGAATCA (SEQ WT mutation ID NO.  65)..GACTCCACGT (SEQ ID NO.66) T1-32 Biallelic GAAAG----------------- GGGTCGTCGGAATCA (SEQ ID mutation NO. 67) T1-33 Heterozygous GAAAG------------(+202 bp)---- WT mutation T1-34 Biallelic GAAAG------------------GACTCGC GGGTCGTCGGAATCA (SEQ ID mutation NO. 68) T1-35 Biallelic GAAAGACGTCGGAATCA (SEQ GGGGCGTCGGAATCA (SEQ ID mutation ID NO. 69)..GACTCCACGT (SEQ NO. 71)..GACTCCACGT (SEQ ID ID NO. 70) NO. 72) T1-36 Heterozygous GAAAG-----------------GACTCGC WT mutation T1-37 Heterozygous GAAAGTCGTCGGAATCA (SEQ WT mutation ID NO. 73)--GACTCCACGT (SEQ ID NO. 74) T1-38 Homozygous GAAAG--------GTTTACA--CCAC GGG--------GTTTACA..CCACGT mutation GTGGACT (SEQ ID NO. 75) GG T1-39 Wild- WT WT ptye T1-40 Heterozygous GAAAG---------------------- WT mutation T1-41 Heterozygous GAAAGGCGTCGGAATCA (SEQ WT mutation ID NO. 76)..GACTCCACGT (SEQ ID NO. 77) Note: ″-” stands for the presence of base deletions, ″.″ stands for omitted bases.

TABLE-US-00004 TABLE 2 Gene AtDMP9 mutation types in T1 generation transgenic Arabidopsis thaliana Serial Number AtDMP9 T1-1 Biallelic GGAAAGACGTCGG (SEQ ID GGAAAG-GTCGG..GACGCCA mutation NO. 78)..GACGCCA T1-2 Wild- WT WT type T1-3 Homozygous GGAAA-CGTCGG..GACGCCA GGAAA-CGTCGG..GACGCCA mutation T1-4 Heterozygous GGAA-GCGTCGG..GACGCCA WT mutation T1-5 Wild- WT WT type T1-6 Homozygous GGAAAG(+16 bp) GGAAAG(+16 bp) mutation CGTCGGA..GACGCCA CGTCGG..GACGCCA T1-7 Heterozygous GGAAAGACGTCGG (SEQ ID WT mutation NO. 79)..GACGCCA T1-8 Wild- WT WT type T1-9 Wild- WT WT type T1-10 Biallelic GGAAAGCG------CAATGTC..GC GGAAAGACGTCGG (SEQ ID mutation CA NO. 80)..GACGCCA T1-11 Biallelic GGAAAGGCGTCGG (SEQ ID GGAAAG(+16 bp) mutation NO. 81).GACGCCA CGTCGG..GACGCCA T1-12 Heterozygous GGAAAGGCGTCGG (SEQ ID WT mutation NO. 82)..GACGCCA T1-13 Wild- WT WT type T1-14 Heterozygous GGAAAGACGTCGG (SEQ ID WT mutation NO. 83)..GACGCCA T1-15 Heterozygous GGAAAGGCGTCGG (SEQ ID WT mutation NO. 84)..GACGCCA T1-16 Heterozygous GGAAAG-GTCGG..GACGCCA WT mutation T1-17 Wild- WT WT type T1-18 Wild- WT WT type T1-19 Biallelic GGAAAG----------GGA GGAAAGTCGCGGTGTTC mutation (SEQ ID NO. 85) T1-20 Heterozygous GGA---CGTCGG..GACGCCA WT mutation T1-21 Heterozygous GGAAAGACGTCGG (SEQ ID WT mutation NO. 86)..GACGCCA T1-22 Heterozygous GGAAAG--------GGA WT mutation T1-23 Heterozygous GGAAAGACGTCGG (SEQ ID WT mutation NO. 87)..GACGCCA T1-24 Biallelic GGAAAG--------GGA GGAA--CGTCGG..GACGCCA mutation T1-25 Biallelic GGAAAG--TCGG.GACGCCA GGAAAGACGTCGG (SEQ ID mutation NO. 88)..GACGCCA T1-26 Heterozygous GGAAAG-GTCGG..GACGCCA WT mutation T1-27 Heterozygous GG----CGTCGG..GACGCCA WT mutation T1-28 Homozygous GGAAAGACGTCGG (SEQ ID GGAAAGACGTCGG (SEQ ID mutation NO. 89)..GACGCCA NO. 90).GACGCCA T1-29 Wild- WT WT type T1-30 Biallelic GGAAAG--------GGA GGAAA-CGTCGG..GACGCCA mutation T1-31 Heterozygous GGAAA-CGTCGG..GACGCCA WT mutation T1-32 Homozygous GGAAAG-GTCGG..GACGCCA GGAAAG-GTCGG..GACGCCA mutation T1-33 Heterozygous GGAAAGACG..CCACGTG(+401 WT mutation bp)GA T1-34 Wild- WT WT type T1-35 Heterozygous GGAA--CGTCGG..GACGCCA WT mutation T1-36 Heterozygous GGAAAGCGTCGG (SEQ ID WT mutation NO. 91)..GACGCCAA T1-37 Wild- WT WT type T1-38 Homozygous GGAAAGTCGTCGG (SEQ ID GGAAAGTCGTCGG (SEQ ID mutation NO. 92)..GACGCCACGTGGGA NO. 94)..GACGCCACGTGGGA (SEQ ID NO. 93) (SEQ ID NO. 95) T1-39 Wild- WT WT type T1-40 Wild- WT WT type T1-41 Wild- WT WT type Note: ″-” stands for the presence of base deletions, ″.″ stands for omitted bases.

[0137] The obtained T1 generation transgenic Arabidopsis thaliana gene AtDMP8 mutant lines comprised T1-34, and the specific mutations were as follows:

[0138] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic Arabidopsis thaliana gene AtDMP8 mutant lines T1-34 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurred in one chromosome at positions 115-512 of SEQ ID No. 1, and a base (T) insertion occurred in the other chromosome at positions 114-115 of SEQ ID No. 1.

[0139] The obtained T1 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 double mutant lines comprised T1-6, T1-11, T1-19, T1-24, T1-25, T1-28, and T 1-32, and the specific mutations were as follows:

[0140] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 double mutant lines T1-6 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurred in one chromosome at positions 115-512 of SEQ ID No. 1, and a fragment deletion occurred in the other chromosome at positions 113-114 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, a fragment insertion occurred at positions 160-161 of SEQ ID No. 3, with the nucleotide sequence of the inserted fragment shown as GTTTACACGGCGACTC (SEQ ID No. 13).

[0141] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 double mutant lines T1-11 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a base (T) insertion occurred at positions 114-115 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, a base (T) insertion occurred in one chromosome at positions 160-161 of SEQ ID No. 3, and a fragment insertion occurred in the other chromosome at positions 160-161 of SEQ ID No. 3, with the nucleotide sequence of the inserted fragment shown as GTTTACACGGCGACTC (SEQ ID No. 13).

[0142] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 double mutant lines T1-19 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a base (T) deletion occurred in one chromosome at position 114 of SEQ ID No. 1, and a fragment deletion occurred in the other chromosome at positions 115-511 of SEQ ID No. 1; and in a gene encoding protein AtDMP9, a fragment deletion occurred in one chromosome at positions 161-560 of SEQ ID No. 3, and a fragment deletion occurred in the other chromosome at positions 161-564 of SEQ ID No. 3.

[0143] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 double mutant lines T1-24 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurred in one chromosome at positions 115-512 of SEQ ID No. 1, and a base (T) insertion occurred in the other chromosome at positions 114-115 of SEQ ID No. 1; and in a gene encoding protein AtDMP9, a fragment deletion occurred in one chromosome at positions 161-560 of SEQ ID No. 3, and a fragment deletion occurred in the other chromosome at positions 159-160 of SEQ ID No. 3.

[0144] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 double mutant lines T1-25 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a base (T) deletion occurred in one chromosome at position 114 of SEQ ID No. 1, and a fragment CGT insertion occurred in the other chromosome at positions 114-115 of SEQ ID No. 1; and in a gene encoding protein AtDMP9, a fragment deletion occurred in one chromosome at positions 161-162 of SEQ ID No. 3, and a base (A) insertion occurred in the other chromosome at positions 160-161 of SEQ ID No. 3.

[0145] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 double mutant lines T1-28 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurred in one chromosome at positions 115-512 of SEQ ID No. 1, and a base (T) deletion occurred in the other chromosome at position 114 of SEQ ID No. 1; and in a gene encoding protein AtDMP9, a base (A) insertion occurred at positions 160-161 of SEQ ID No. 3.

[0146] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 double mutant lines T1-32 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurred in one chromosome at positions 115-511 of SEQ ID No. 1, and a base (T) insertion occurred in the other chromosome at positions 114-115 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, a base (C) deletion occurred at position 161 of SEQ ID No. 3;

[0147] 5. Identification of T2 Generation Transgenic Arabidopsis thaliana Genotyping

[0148] T1 generation transgenic Arabidopsis thaliana gene AtDMP8 and/or gene AtDMP9 mutant lines T1-19, T1-33, and T1-38 obtained in step 4 were selfed, seeds were sowed after harvesting to obtain T2 generation transgenic Arabidopsis thaliana. The specific method for identifying the genotypes of genes AtDMP8 and AtDMP9 of T2 generation transgenic Arabidopsis thaliana was as follows: with the genomic DNA of T2 transgenic Arabidopsis thaliana as a template, the genotypes of genes AtDMP8 and AtDMP9 in T2 transgenic Arabidopsis thaliana were identified by using mutant sequence detection primers of AtDMP8 (DMP8F1 and DMP8R1) and AtDMP9 (DMP9F1 and DMP9R2) according to the method in step 4, respectively.

[0149] The obtained T2 generation transgenic Arabidopsis thaliana gene AtDMP8 mutant homozygous lines comprised T2-33-1, T2-33-2, and T2-33-3 which have the same mutation sequences, and the specific mutations were as follows:

[0150] Sequencing identification showed that: the difference between the genomic DNA of T2 generation transgenic Arabidopsis thaliana gene AtDMP8 homozygosis mutant lines T2-33-1, T2-33-2, and T2-33-3 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in the gene encoding protein AtDMP8, a fragment at positions 115-511 of SEQ ID No. 1 was substituted with a fragment of size 202 bp. The nucleotide sequence of the fragment with the size of 202 bp was specifically as follows:

TABLE-US-00005 (SEQ ID NO. 96) GAAATTGACGAGCATTGATGTCTTCGAAACCGTTTTTTGAACTCCTTTC GCCACCATGCGACGTTTTCTACCTTTTCCTCCTCCCGCGGCGGCTCCTG CCGGAAGCATAGGCAGTGAAGAGAGAGGGACAGGTTTGGGCGACCGAGA CGATGTTGGTGACGGATTTTGCGTCGTTGTCGTCGTGTAAACTCTGATT CCGACG.

[0151] The obtained T2 generation transgenic Arabidopsis thaliana gene AtDMP9 homozygous lines comprised T2-33-4, T2-33-5, and T2-33-6 which have the same mutation sequences, and the specific mutations were as follows:

[0152] Sequencing identification showed that: the difference between the genomic DNA of T2 generation transgenic Arabidopsis thaliana gene AtDMP9 homozygosis mutant lines T2-33-1, T2-33-2, and T2-33-3 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in the gene encoding protein AtDMP9, a base (T) insertion occurred at positions 160-161 of SEQ ID No. 3, and a fragment insertion occurred at positions 561-562 of SEQ ID NO 3, with the nucleotide sequence shown as:

TABLE-US-00006 (SEQ ID NO 14) CGTCGGAATCAGAGTTTACACGGCGACTCCGCCGCAAAAACCATCACCA TCACCACCTTCTCGTTCACCAAAACCCGTCTTAATCTCTTCATTGCCTT CCCTCCCGTCAGGAGCCGCCGCTGGAGGAGGAAGAGGTCGAAAACGTCG CATGGTGGCGCAAGGAGTTCAAAAAACGGTTTCGAAGACATCAATGCTC GTCAACTTCCTTCCGACAGGAACACTCTTGATGTTCGAAATGGTTCTTC CATCAATATACCGTGACGGAGACTGTAACGGAATCAACACACTCATGAT TCATCTCCTCTTGCTTCTTTGCGCAATGTCTTGTTTCTTCTTCCATTTT ACCGACAGTTTCAAAGCATCCGATGGGAAGATCTACTACGGTTTCGTGA CGCCACGTG.

[0153] The obtained T2 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 homozygous mutant lines comprised T2-19, T2-38-1, and T2-38-2, with the mutation types of each line as follows:

[0154] Sequencing identification showed that: the difference between the genomic DNA of T2 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 homozygosis mutant lines T2-19 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurred at positions 115-511 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, a fragment deletion occurred at positions 161-564 of SEQ ID No. 3.

[0155] Sequencing identification showed that: the difference between the genomic DNA of T2 generation transgenic Arabidopsis thaliana genes AtDMP8 and AtDMP9 homozygosis mutant lines T2-38-1 and T2-38-2 and the genomic DNA of the wild-type Arabidopsis thaliana Col-0 only lies in that in a gene encoding protein AtDMP8, a fragment deletion occurred at position 115-127 of SEQ ID No. 1, and in a gene encoding protein AtDMP9, a fragment insertion occurred at positions 160-161 of SEQ ID No. 3 and positions 562-563 of SEQ ID No. 3.

[0156] The above T1 and T2 generation transgenic Arabidopsis thaliana mutant lines were selected for the following haploid induction capacity analysis experiments.

[0157] II. Application of Gene AtDMP8 and/or Gene AtDMP9 Knockout Arabidopsis thaliana Mutant in Inducing the Haploid Generation

[0158] (A) Identification of Haploid Selfing Induction Ability of AtDMP8 and AtDMP9 Knockout Arabidopsis thaliana Mutants

[0159] Three types of mutants obtained from genes AtDMP8 and AtDMP9 were respectively selfed to obtain selfed offspring, and haploid identification was carried out on the selfed offspring by the following method (since wild Arabidopsis thaliana Col was a homozygous selfed line, the mutant selfed offspring obtained by knocking out genes AtDMP8 and AtDMP9 on this background cannot identify haploids through molecular markers):

[0160] 1. Identification of Plant Phenotype

[0161] After the selfed seeds were planted, the phenotypes of a single plant were observed, with haploidy showed dwarf, narrow leaves growing upward, compact plant type, and male sterility, while diploid showed high plant, broad and scattered leaves, and normal fertility (FIG. 1, FIG. 2).

[0162] 2. Leaf Identification by Flow Cytometry

[0163] Flow cytometry was conducted on the plant with the haploid character obtained in step 1, wherein the specific method was as follows: cell nuclei of young leaves of a plant to be tested was extracted, and diploid Arabidopsis thaliana leaves were used as a control; the signal was then detected by a flow cytometry instrument, the diploid nuclear signal was firstly detected, and the diploid nuclear signal peak position was set at 50 (since the genetic materials in diploid cells were twice that in haploid cells, the haploid nuclear signal peak position appeared around 25). And if the nuclear signal peak position of the plant to be tested appears around 25, the plant to be tested is considered to be a haploid plant. If the signal peak of the plant to be tested appears around 50, it was considered that the signal intensity enrichment position of the plant to be tested is the same as that of the diploid nucleus, and the plant to be tested was diploid (FIG. 3).

[0164] The identification results were counted and the induction rate was calculated according to the following formula: induction rate (%)=(number of haploid plants/total number of plants)×100. As can be seen, after simultaneous mutation of the genes AtDMP8 and AtDMP9, haploids can be obtained in selfed offspring.

TABLE-US-00007 TABLE 3 Haploid induction rate statistics in selfed offspring of dmp mutants Total Haploid Plant plant Number of induction Genotype number number haploids rate (%) WT Col-0 523 0 0 dmp8 T2-33-1 270 0 0 dmp9 T2-33-4 183 0 0 dmp8dmp9 T2-38-1 165 6 3.64

[0165] A. Identification of Hybridization Induction Ability of AtDMP8 and AtDMP9 Knockout Arabidopsis thaliana Mutants

[0166] The three types of mutants obtained from genes AtDMP8 and AtDMP9 were crossed with Arabidopsis thaliana ms1 materials to obtain cross-species offspring, and the haploids in the cross-species offspring were identified by the following methods:

[0167] 1. Fluorescent Labeling Identification

[0168] The CRISPR/Cas9 vector carried the expression element of TagRFP (Entacmaea quadricolor) driven by the promoter AtOLEO1. Since the promoter AtOLEO1 was specifically expressed in mature seed embryos, the fluorescent signal of TagRFP may be observed by fluorescent light. Therefore, the mutant carrying the expression element as a male parent was hybridized with other non-fluorescent female parent materials to obtain seeds, wherein embryos of diploid seeds showed strong red fluorescence due to having the genome of the male parent, while embryos of haploid seeds showed no fluorescence or weak fluorescence due to being derived from the female parent (FIGS. 4A-4B).

[0169] 2. Molecular Marker Identification

[0170] The seeds with no fluorescence and weak fluorescence identified in step 1 were further planted, the genomic DNA was extracted, and PCR amplification was conducted adopting AtDMP8 and AtDMP9 knockout Arabidopsis thaliana mutant polymorphic primer 092B02-F(092B02-F: CAGCTGAGATGAACGAGTTGTCTT) (SEQ ID NO.97), 092B02-R (092B02-R: TCTTTTGAGTCACTCCGTATGTCC) (SEQ ID NO.98), and LB-o8474(LB-o8474: ATAATAACGCTGCGGACATCTACATTTT) (SEQ ID NO.99), and the amplified product was subjected to agarose banding pattern detection if the size of the amplified product of the individual plant to be tested was 500 bp, showing 1 band, it was considered the individual plant band to be the Arabidopsis thaliana ms1 banding pattern without banding pattern of the male parent material, the individual plant was female parent haploid. If the size of the amplification products of the individual plant to be tested was 500 bp and 1094 bp, showing 2 bands, the individual plant band was considered to be a heterozygous banding pattern of Arabidopsis thaliana ms1 and a transgenic Arabidopsis thaliana mutant line, the individual plant was an offspring of a normal hybrid and was diploid (FIG. 5).

[0171] 3. Identification of Mature Plants Phenotype

[0172] The phenotypes of the plants identified in steps 1 and 2 were further observed, with haploidy showed dwarf, narrow leaves growing upward, compact plant type, and male sterility, while diploid showed high plant, broad, and scattered leaves, and normal fertility.

[0173] 4. Leaf Identification by Flow Cytometry

[0174] Flow cytometry was conducted on the plant with the haploid character obtained in step 3, wherein the specific method was as follows: cell nuclei of young leaves of a plant to be tested was extracted, and diploid Arabidopsis thaliana leaves were used as a control; the signal was then detected by a flow cytometry instrument, the diploid nuclear signal was firstly detected, and the diploid nuclear signal peak position was set at 50 (since the genetic materials in diploid cells were twice that in haploid cells, the haploid nuclear signal peak position appeared around 25). And if the nuclear signal peak position of the plant to be tested appears around 25, the plant to be tested is considered to be a haploid plant. If the signal peak of the plant to be tested appears around 50, it was considered that the signal intensity enrichment position of the plant to be tested is the same as that of the diploid nucleus, and the plant to be tested was diploid

[0175] The identification results were counted and the induction rate was calculated according to the following formula: induction rate (%)=(number of maternal haploid plants/total number of plants)×100. As can be seen, after gene AtDMP8 mutation, gene AtDMP9 mutation, and simultaneous mutation of genes AtDMP8 and AtDMP9, they were subjected to hybridization with other materials, and female parent haploid may be obtained in an offspring.

TABLE-US-00008 TABLE 4 Haploid induction rate statistics in cross- species offspring of dmp mutants Total Haploid Hybridization Plant plant Number of induction combination number number haploids rate (%) ms1 × WT T1-13 1171 0 0.00 T1-17 1339 0 0.00 Total 2510 0 0.00 ms1 × dmp8 T1-34 1309 1 0.08 T2-33-1 1006 0 0.00 T2-33-2 719 0 0.00 Total 3034 1 0.03 ms1 × dmp9 T2-33-4 844 3 0.36 T2-33-5 598 3 0.50 T2-33-6 589 2 0.34 Total 2031 8 0.39 ms1 × dmp8dmp9 T1-6 146 2 1.37 T1-11 169 4 2.37 T1-19 194 6 3.09 T1-24 68 3 4.41 T1-25 361 11 3.05 T1-28 327 3 0.92 T1-32 31 1 3.23 T2-38-1 851 17 2.00 T2-38-2 559 10 1.79 Total 2706 57 2.11

Example 2. Preparation of SlDMP Knockout Tomato Mutants and Application Thereof

[0176] I. Gene SlDMP was Knocked Out Using the CRISPR/Cas9 System

[0177] Gene SlDMP in the tomato was knocked out by using a CRISPR/Cas9 system to obtain a gene SlDMP knockout tomato mutant. The specific steps were as follows:

[0178] 1. Selection of sgRNA Sequences

[0179] A target site sequence was designed on gene SlDMP and was 20 bp in length.

[0180] The target site 1 was located at positions 76-95 of SEQ ID No. 5, and the sequence of sgRNA target site 1 was TATCTCACTAATTACCACA (SEQ ID NO.100).

[0181] Target site 2 was located at positions 247-266 of SEQ ID No. 5, and the sequence of sgRNA target site 2 was TCTCCTTTTACCAAATACTGA (SEQ ID NO.101).

[0182] 2. Construction of CRISPR/Cas9 Vector

[0183] The CRISPR/Cas9 vector is a recombinant vector (vector structure diagram shown in FIG. 9A) obtained by connecting a DNA molecule represented by SEQ ID No. 8 (sgRNA expression element), a DNA molecule represented by SEQ ID No. 11 (Cas9 expression element), a DNA molecule represented by SEQ ID No. 10 (fluorescent protein expression element), and a DNA molecule represented by SEQ ID No. 12 (NptII expression element) to a pICSL4723 vector through a golden gate method. The DNA molecule shown in SEQ ID No. 8 sequentially comprised a coding sequence of sgRNA targeted to the target site 1, a coding sequence of sgRNA targeted to the target site 2, with an AtU6-26 promoter used for initiating the expression of the coding sequence of sgRNA found near the beginning of each sgRNA coding sequence.

[0184] 3. Acquisition of Transgenic Plants

[0185] The CRISPR/Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cells GV3101 through heat shock (Agrobacterium GV3101 competent cells were purchased from Beijing Aosen Dingxin Biotechnology Co., Ltd., and publicly available) to obtain a recombinant strain GV3101/CRISPR/Cas9.

[0186] Then the cotyledon explant of wild tomato AC was infected with the recombinant strain GV3101/CRISPR/Cas9 by adopting a transformation method of infecting tomato cotyledon explant with Agrobacterium (i.e. the recombinant Agrobacterium was subjected to expanding propagation at 28° C., and tomato cotyledon explant was infected with the propagated Agrobacterium solution), and T0 generation transgenic tomato cotyledon explant plant was obtained after kanamycin resistance screening.

[0187] 4. Identification of Transgenic Plants with Mutation of Gene SlDMP

[0188] Leaves of the T0 generation transgenic tomato plant obtained in step 3 were collected, genomic DNA was extracted as a template, and PCR amplification was conducted by adopting the following primers, to obtain PCR amplification products of different lines. The sequences of the primers for detecting gene SlDMP mutant sequence were as follows:

TABLE-US-00009 SlDMPF2: (SEQ ID NO. 102) ACTGCTTAGGATATTAACTGACCC; SlDMPR1: (SEQ ID NO. 103) TTTTGGCACATCGACACCAAG.

[0189] The PCR amplification products of different lines were subjected to Sanger sequencing, and the sequencing results were compared with gene SlDMP of wild-type tomato AC. The genotype of SlDMP was identified according to the following principles.

[0190] If the sequence had a doublet characteristic from the target site sequence, the genotype of the line was a heterozygous genotype (i.e. gene SlDMP mutated on one of the two homologous chromosomes, and unmutated on the other chromosome), and the line was a TO generation transgenic tomato heterozygous mutant line;

[0191] For a sequence with specific singlet characteristics from the target site sequence, if it was the same as the gene sequence of SlDMP of wild-type tomato AC, the genotype of the line was wild-type, that is there was no mutation on the gene sequence of SlDMP; if it was different from the gene sequence of SlDMP of the wild-type tomato AC, the genotype of the line is homozygous (the genes SlDMP mutated on both homologous chromosomes), the line was a T0 generation transgenic tomato homozygous mutant line.

TABLE-US-00010 TABLE 5 Gene SlDMP mutation types in T0 generation transgenic tomato Serial Number Genotype allele 1 allele2 T0-1 Wild-type WT WT T0-2 Wild-type WT WT T0-3 Wild-type WT WT T0-4 Wild-type WT WT T0-5 Wild-type WT WT T0-6 Wild-type WT WT T0-6 Wild-type WT WT T0-7 Wild-type WT WT T0-8 Wild-type WT WT T0-9 Heterozygous TATCCTACTAATTT WT mutation AC (SEQ ID NO. 104) (-3 bp)AAGGGG AAAAA (SEQ ID NO. 105) T0-10 Biallelic TATCCTACTA (SEQ TACTAATTTACC (SEQ ID NO. 108) mutation ID NO. 106) (-158 bp)TATTTGGTAA (SEQ ID (-167 bp)TTTGGT NO. 109) AAAGG (SEQ ID NO. 107) T0-11 Heterozygous WT TAATTTACC(C)ACAAGGT---ACT mutation TCCC(-3 bp) GTATTTG T0-12 Heterozygous WT TAATTTACC(C)ACAAGGT---TCC mutation CTCAGT(-3 bp) TGGTAAAG T0-12 Heterozygous WT TAATTTACC(C)ACAAGGT---TCC mutation CTCAGT(-3 bp) TGGTAAAG T0-13 Wild-type WT WT T0-14 Heterozygous ACTAATTTACC (SEQ WT mutation ID NO. 110) (-157 bp)GTATTT GGTAA (SEQ ID NO. 111) T0-15 Wild-type WT WT T0-16 Wild-type WT WT T0-16 Wild-type WT WT T0-17 Wild-type WT WT T0-17 Wild-type WT WT T0-18 Wild-type WT WT T0-18 Wild-type WT WT T0-19 Wild-type WT WT T0-20 Wild-type WT WT T0-21 Wild-type WT WT T0-21 Wild-type WT WT T0-22 Wild-type WT WT T0-22 Wild-type WT WT T0-24 Wild-type WT WT T0-24 Wild-type WT WT T0-25 Wild-type WT WT T0-26 Wild-type WT WT T0-27 Wild-type WT WT T0-28 Wild-type WT WT T0-29 Wild-type WT WT T0-31 Wild-type WT WT T0-32 Wild-type WT WT T0-33 Wild-type WT WT T0-34 Biallelic TACTAATTTACC AATTTACC(C)ACAAGGT---CTTC mutation (SEQ ID NO. 112) CCTCA(A) (-157 bp)GTATTT GTATT GGTAA (SEQ ID NO. 113) Note: ″-″ stands for base deletions.

[0192] 5. Identification of T1 Generation Transgenic Tomato Genotyping

[0193] T0 transgenic tomato gene SlDMP mutant lines T0-33 and T0-34 obtained in step 4 were selfed, seeds were sowed after harvesting to obtain T1 generation transgenic tomato. The specific method for identifying the genotype of gene SlDMP of T1 generation transgenic tomato was as follows: with the genomic DNA of T1 transgenic tomato as a template, the genotype of gene SlDMP of T1 transgenic tomato was identified by using mutant sequence detection primers of SlDMP (SlDMPF2 and SlDMPR1) according to the method in step 4, respectively.

[0194] The finally obtained T1 generation transgenic tomato gene SlDMP homozygous mutant lines comprised sldmp-1 and sldmp-2, with the mutation types of each line as follows:

[0195] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic tomato genes SlDMP homozygosis mutant lines sldmp-1 and the genomic DNA of the wild-type tomato AC only lies in that in a gene encoding SlDMP protein, a base (C) insertion occurred at positions 92-93 of SEQ ID No. 5.

[0196] Sequencing identification showed that: the difference between the genomic DNA of T1 generation transgenic tomato genes SlDMP homozygosis mutant lines sldmp-2 and the genomic DNA of the wild-type tomato AC only lies in that in a gene encoding SlDMP protein, a fragment deletion occurred at positions 93-249 of SEQ ID No. 5.

[0197] II. Application of Gene SlDMP Knockout Tomato Mutant Inducing the Haploid Generation

[0198] (A) Plant performance and seed setting rate of SlDMP knockout tomato mutants Comparing the performance of the tomato mutant plants with gene SlDMP knocked out in the context of wild-type tomato AC and AC, it was found that the knockout of the gene SlDMP does not affect the growth of the plant (FIGS. 6A-6D). The number of seeds per tomato selfed fruit was counted, with an average of about 79.5 seeds per selfed fruit for the wild-type, whereas the sldmp mutant produced only 17 seeds, significantly lower than that of the wild-type (Table 6). The results showed that the mutation of gene SlDMP resulted in the decrease of seed setting rate, suggesting that the sldmp mutant has the ability of haploid induction.

TABLE-US-00011 TABLE 6 Number of selfed seeds of sldmp mutants statistics Number of ears Number of average Materials statistics seed setting WT 12  79.5 ± 24.1 sldmp-1 14 19.7 ± 7.1 sldmp-2 23 15.3 ± 6.6 Note: WT is wild-type tomato AC.

[0199] (B) Identification of Hybridization Induction Ability of Gene SlDMP Knockout Tomato Mutants

[0200] The sldmp mutants were crossed with F.sub.1 generation material obtained by crossing tomato AC and Micro-Tom to obtain cross-species offspring, and the haploids in the cross-species offspring were identified by the following methods:

[0201] 1. Fluorescent Labeling Identification

[0202] The CRISPR/Cas9 vector carried the expression element of TagRFP (Entacmaea quadricolor) driven by the promoter AtOLEO1. Since the promoter AtOLEO1 was specifically expressed in mature seed embryos, the fluorescent signal of TagRFP may be observed by fluorescent light. Therefore, the mutant carrying the expression element as a male parent was hybridized with other non-fluorescent female parent materials to obtain seeds, wherein embryos of diploid seeds red fluorescence due to having the genome of the male parent, while embryos of haploid seeds showed no fluorescence or weak fluorescence due to being derived from the female parent (FIGS. 7A-7D).

[0203] 2. Molecular marker identification

[0204] The seeds with no fluorescence identified in step 1 were further planted, the genomic DNA was extracted, and PCR amplification was conducted adopting with polymorphic primers SlDMPF2+SlDMPR1 between the F.sub.1 generation obtained by crossing tomato AC with Micro-Tom and the gene SlDMP knockout tomato mutant, and the amplified product was subjected to agarose banding pattern detection or sequencing if the amplified product of the single plant to be tested showed 1 band or the sequencing result showed a single peak graph, it was considered the single plant band to be a female parent banding pattern without banding pattern of the male parent material, the single plant was the female parent haploid. And if the amplification product of the single plant to be tested showed two bands or the sequencing result showed a heterozygous peak graph, it was considered the single plant band to be a heterozygous banding pattern of the F.sub.1 generation obtained by crossing AC and the Micro-Tom of the tomato and the gene SlDMP knockout tomato mutant, and the single plant was a normal cross-species offspring and diploid.

[0205] 3. Identification of Mature Plants Phenotype

[0206] The phenotypes of the plants identified in steps 1 and 2 were further observed, with haploidy showed dwarf, narrow leaves growing upward, compact plant type, and male sterility, while diploid showed high plant, broad, and scattered leaves, and normal fertility.

[0207] 4. Leaf Identification by Flow Cytometry

[0208] Flow cytometry was conducted on the plant with the haploid character obtained in step 3, wherein the specific method was as follows: cell nuclei of young leaves of a plant to be tested was extracted, and diploid Arabidopsis thaliana leaves were used as a control; the signal was then detected by a flow cytometry instrument, the diploid nuclear signal was firstly detected, and the diploid nuclear signal peak position was set at 100 (since the genetic materials in diploid cells were twice that in haploid cells, the haploid nuclear signal peak position appeared around 50). And if the nuclear signal peak position of the plant to be tested appears around 50, the plant to be tested is considered to be a haploid plant. If the signal peak of the plant to be tested appears around 100, it was considered that the signal intensity enrichment position of the plant to be tested is the same as that of the diploid nucleus, and the plant to be tested was diploid (FIG. 8).

[0209] The identification results were counted and the induction rate was calculated according to the following formula: induction rate (%)=(number of maternal haploid plants/total number of plants)×100. After gene SlDMP mutation, crossing with other materials was conducted, a female parent haploid may be obtained in the cross-species offspring.

TABLE-US-00012 TABLE 7 Haploid induction rate statistics in cross- species offspring of sldmp mutants Total Haploid Hybridization plant Number of induction combination number haploids rate (%) F.sub.1 × WT 954 0 0.00 F.sub.1 × sldmp-1 323 2 0.62 F.sub.1 × sldmp-2 629 3 0.99 Note: F.sub.1 is the cross-species offspring of between tomato AC and Micro-Tom, and WT is wild-type tomato AC.

INDUSTRIAL APPLICATIONS

[0210] The parthenogenetic haploid induction genes AtDMP8 and AtDMP9 are cloned from Arabidopsis thaliana. Experiments have shown that mutations of AtDMP8 and AtDMP9 can produce parthenogenetic haploid inducibility, to enable dicotyledonous crops to be induced to produce haploids via parthenogenetic means. The present invention was further verified in tomatoes, and it was also found in tomatoes that the mutation of SlDMP can produce parthenogenetic haploid inducibility. The invention lays an important foundation for broadening the application of haploid breeding technology on dicotyledonous plants and revealing the biological mechanism of parthenogenetic haploid production. Given the universality of the utilization of haploid breeding technology in the current breeding industry, the invention has very wide application space and market prospects.