USE OF C1Q/TNF-RELATED PROTEIN-1 (CTRP1) TO TREAT FATTY LIVER DISEASE
20190191676 ยท 2019-06-27
Inventors
Cpc classification
A01K2267/0362
HUMAN NECESSITIES
A61K31/4402
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
International classification
A61K31/4402
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
Abstract
Methods for the treatment or prevention of disease, such as fatty liver disease and obesity, are described including the modulation the amount of CTRP1 in a subject. Novel mouse strains are also described.
Claims
1. A method of treating or preventing fatty liver disease in a subject comprising: administering to a subject an effective amount of an agent that changes the amount of CTRP1 in the subject; and treating or preventing fatty liver disease in the subject.
2. The method of claim 1, wherein the subject is on a low fat diet.
3. The method of claim 2, wherein the subject is given an agent that increases the amount of CTRP1 in the subject compared to the amount of CTRP1 in the subject before the agent is given.
4. The method of claim 3, wherein the agent is CTRP1 or a functional part thereof.
5. A method of treating or preventing obesity in a subject comprising: administering to a subject an effective amount of an agent that changes the amount of CTRP1 in the subject compared to the subject before the agent is given; and treating or preventing obesity in the subject.
6. The method of claim 5 wherein the subject is on a high fat diet.
7. The method of claim 6 wherein the subject is given an agent that changes the amount of CTRP1 in a subject by decreasing the amount of CTRP1 in the subject compared to the amount of CTRP1 in the subject before the agent is given.
8. The method of claim of claim 7, wherein the agent inhibits the expression of CTRP1.
9. A mouse comprising a null allele for Ctrp1 comprising a deleted functional region of the Ctrp1 gene that spans exon 4 replaced with a reporter and a drug resistant cassette.
10. The mouse of claim 9 wherein the functional region comprises a 679-bp of the Ctrp1 gene that spans exon 4
11. The mouse of claim 9 wherein the drug resistant cassette is a neomycin resistance cassette.
12. The mouse of claim 9 wherein the reporter is a lacZ reporter.
13. The method of claim 4 wherein a protein comprises the functional part of CTRP 1.
14. The method of claim 13 wherein the protein is a fusion protein.
15. The method of claim 3 wherein the agent is a recombinant CTRP1.
16. The method of claim 3 wherein the agent is rosiglitazone.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
DETAILED DESCRIPTION OF THE INVENTION
[0064] Secreted hormones control energy metabolism via inter-organ crosstalk, and their circulating levels are frequently dysregulated in the pathophysiological states of obesity and diabetes. In an effort to uncover novel metabolic regulators, we have characterized the C1q/TNF-related proteins (CTRP1-15), a highly conserved family of secreted proteins. Distinct and notable metabolic, cardiovascular, and inflammatory functions have been demonstrated for several members of this protein family based on in vivo functional studies. In vitro studies have also highlighted CTRP11's involvement in adipogenesis and CTRP13's role in antagonizing lipid-induced insulin resistance.
[0065] Similar to many CTRP family members, CTRP1 has a distinct expression profile, with the highest expression levels seen in adipose tissue. Adipose expression of CTRP1 and its circulating levels are modulated by the metabolic and inflammatory states of animals. Its expression is upregulated by the anti-diabetic drug, rosiglitazone, as well as in animals lacking the insulin-sensitizing hormone, adiponectin. Consistent with a metabolic role, administration of recombinant CTRP1 to wild-type mice acutely lowers blood glucose, and chronic overexpression of CTRP1 in transgenic mice enhances AMP-activated protein kinase (AMPK) activation and skeletal muscle fat oxidation, while attenuating insulin resistance induced by high-fat feeding.
[0066] The physiologic relevance of CTRP1 in the context of disease is highlighted by recent studies in humans with metabolic disorders. Circulating levels of CTRP1 are elevated in patients with type 2 diabetes and metabolic syndrome, as well as in patients with coronary artery disease and hypertension. Whether the observed upregulation of plasma CTRP1 seen in humans is a cause or a consequence of the disease remains to be established. In support of the notion that CTRP1 upregulation represents physiologic compensation, mice lacking CTRP1 protein have increased myocardial infarct size, cardiomyocyte apoptosis, and proinflammatory gene expression induced by ischemia/reperfusion injury, whereas systemic delivery of CTRP1 attenuated myocardial damage. In contrast, in an apolipoprotein E-deficient mouse model, CTRP1 appears to play an adverse role in promoting atherosclerosis and its deficiency attenuates disease severity. While earlier studies have demonstrated a positive metabolic role for CTRP1, the physiologic consequence of its deficiency on glucose and lipid metabolism has not been described. Given the significant caveats and limitations associated with previous recombinant protein infusion and transgenic overexpression studies, the present invention provides genetic evidence, using a knockout (KO) mouse model, that CTRP1 is indeed required for metabolic homeostasis and can be used as a therapeutic agent to treat or prevent disease such as liver steatosis (fatty liver).
[0067] Using a loss-of-function mouse model, the present invention provides critical genetic evidence that CTRP1 is required for metabolic homeostasis. Notably, though, the contributions of CTRP1 to energy metabolism depend on metabolic and dietary contexts. When mice are fed a low-fat diet, comparable to standard chow, loss of CTRP1 did not appear to affect body weight or metabolic rate (VO.sub.2). Its deficiency, however, promoted insulin resistance independent of adiposity. Mice lacking CTRP1 exhibited elevated hepatic gluconeogenic gene expression, as well as elevated fasting insulin levels, and reduced rates of glucose disposal in response to glucose and insulin challenge compared to WT littermate controls (
[0068] One of the most striking phenotypes revealed by this study was the enlargement of the liver and the development of prominent steatosis in Ctrp1-KO mice fed an LFD (
[0069] In our recent description of the CTRP1 transgenic mouse model, we illustrated that the protective role of CTRP1 was only revealed when mice were challenged with HFD to induce obesity and insulin resistance. We subjected the Ctrp1-KO animals to a HFD to determine whether the loss of Ctrp1 might amplify the effects of the HFD. Given that CTRP1 overexpression attenuates metabolic dysfunction induced by HFD and that Ctrp1-KO mice develop insulin resistance and fatty liver on a LFD, we expected the KO animals to develop pronounced glucose intolerance and an even greater degree of liver steatosis when challenged with a HFD. Surprisingly, we observed the opposite. Ctrp1-KO mice consuming a HFD were leaner, with reduced body weight and adiposity compared to WT littermate controls (
TABLE-US-00002 TABLE 3 Male Female Low-fat diet WT (n = 12) KO (n = 9) p-value WT (n = 13) KO (n = 10) p-value Food intake (g) 4.690 0.1986 4.551 0.2407 ns 4.691 0.2746 4.808 0.2631 ns VO.sub.2 (mL/kg-LM/hr) 4544 72.35 4786 114.9 ns 5537 116.9 5488 142.6 ns VCO.sub.2 (mL/kg-LM/hr) 4309 84.02 4484 95.31 ns 5252 105.5 5252 153.2 ns Respiratory exchange ratio (RER) 0.9484 0.01153 0.9376 0.008531 ns 0.9498 0.01204 0.9575 0.01583 ns Energy expanditure (kcal/kg-LM/hr) 22.64 0.3630 23.78 0.5492 ns 27.59 0.5587 27.41 0.7088 ns Physical activity (beam breaks) 42724 3313 39886 2106 ns 75971 4388 82086 6942 ns Male Female High-fat diet WT (n = 11) KO (n = 11) p-value WT (n = 13) KO (n = 10) p-value Food intake (g) 2.722 0.1088 2.865 0.08533 ns 2.388 0.09373 2.305 0.08192 ns VO.sub.2 (mL/kg-LM/hr) 4860 75.24 4758 58.97 ns 5382 90.54 5343 99.06 ns VCO.sub.2 (mL/kg-LM/hr) 3701 56.74 3610 47.73 ns 4330 61.52 4302 73.03 ns Respiratory exchange ratio (RER) 0.7616 0.002731 0.7587 0.002106 ns 0.8050 0.003875 0.8055 0.004440 ns Energy expanditure (kcal/kg-LM/hr) 23.10 0.3555 22.60 0.2828 ns 25.87 0.4191 25.68 0.4646 ns Physical activity (beam breaks) 27449 1736 37192 2563 ** 43631 3942 57716 5570 *
[0070] In contrast to the LFD-fed Ctrp1-KO mice that developed fatty liver, KO animals consuming a HFD unexpectedly had reduced hepatic steatosis compared to WT controls (
[0071] Adipose tissue inflammation and fibrosis, particularly in the context of obesity, are known to alter the expression and secretion of adipokines; this in turn has systemic effects on energy metabolism and insulin sensitivity. Given that CTRP1 is abundantly expressed in adipose tissue, we assessed the impact of CTRP1 deficiency on the expression of genes involved in lipid uptake and synthesis, inflammation, macrophage polarization, and tissue fibrosis. With the exception of reduced fibrotic collagen gene expression, loss of CTRP1 had a relatively minor impact on adipose tissue function when mice were fed an LFD (
[0072] Adiponectin is a widely studied insulin-sensitizing adipokine with pleiotropic metabolic function. Interestingly, serum adiponectin levels were lower in both LFD and HFD-fed Ctrp1-KO mice compared to WT controls. Although serum adiponectin levels were reduced in LFD-fed Ctrp1-KO mice (
[0073] Given the increasing appreciation of sex-dependent differences in metabolic disease phenotypes and severity (31, 49), we included female WT and KO animals in our studies. Unlike male mice, Ctrp1-KO female mice consuming a control LFD did not develop insulin resistance, glucose intolerance, or fatty liver. When challenged with a HFD, the metabolic phenotypes (body weight, adiposity, energy expenditure, physical activity, and glucose and insulin tolerance) of Ctrp1-KO female mice were indistinguishable from female WT littermate controls (Table 2). Thus, loss of CTRP1 likely contributes to dysregulated metabolism in a sex-dependent manner. Given the myriad physiological roles of sex hormones, this is neither unexpected nor surprising as the metabolic phenotypes of many loss-of-function mouse models are often manifested in male, but not female, animals.
TABLE-US-00003 TABLE 2 Male Female WT KO WT KO Low-fat diet (LFD) n = 12 n = 8 p-Value n = 17 n = 8 p-Value Body weight (g) 38.2825 0.694 36.92125 0.840 ns 29.01 0.780 29.72 1.210 ns Gonadal fat mass (g) 0.955 0.025 0.77875 0.036 *** 0.5159 0.04220 0.4400 0.05910 ns Gonadal fat mass/body weight 0.0249 0.0005604 0.02104 0.0006512 *** 0.01739 0.001096 0.01442 0.001489 ns Inguinal fat mass (g) 0.739 0.052 0.645 0.035 ns 0.3441 0.02919 0.3750 0.03423 ns Inguinal fat mass/body weight 0.01926 0.001213 0.01746 0.0008242 ns 0.01160 0.0007863 0.01248 0.0008185 ns Liver weight (g) 1.983 0.1271 2.445 0.1696 1.405 0.07098 1.653 0.1524 ns Liver weight/body weight 0.05155 0.002590 0.06592 0.003748 ** 0.04801 0.001372 0.05501 0.003409 * Gastrocnemius muscle (g) 0.121 + 0.005 0.116 + 0.005 ns ND ND NA Gastrocnemius muscle/body weight 0.003163 + 0.0001215 0.003148 + 0.0001273 ns ND ND NA Heart (g) 0.169 0.009 0.158 0.007 ns 0.1488 0.005871 0.1475 0.0075 ns Heart/tibia length 0.009313 0.0004806 0.008790 0.0003024 ns 0.008234 0.0003175 0.008154 0.0004050 ns Fasting blood glucose (mg/dL) 192.083 4.914 182 6.059 ns 158.0 4.263 155.4 8.181 ns Tibia length (mm) 18.147 0.190 17.890 0.181 ns 18.07 0.09276 18.09 0.2816 ns WT KO WT KO High-fat diet (HFD) n = 11 n = 10 p-Value n = 15 n = 10 p-Value Body weight (g) 55.04 1.089 48.85 0.4851 **** 53.53 1.816 50.20 1.278, ns n = 10 Gonadal fat mass (g) 0.6082 0.05129 0.600 0.6703 ns 2.199 0.09796 1.916 0.1258 ns Gonadal fat mass/body weight 0.01104 0.0009028 0.01229 0.001357 ns 0.04107 0.001234 0.03798 0.001984 ns Inguinal fat mass (g) 1.256 0.04535 0.9150 0.03198 **** 1.202 0.04528 1.112 0.06734 ns Inguinal fat mass/body weight 0.02281 0.0006551 0.01874 0.0006571 *** 0.02258 0.0007765 0.02222 0.001315 ns Liver weight (g) 3.810 0.1604 3.892 0.2103 ns 2.149 0.2036 2.174 0.1756 ns Liver weight/body weight 0.06920 0.002455 0.07957 0.004000 0.03911 0.002605 0.04286 0.002777 ns Heart (g) 0.2291 0.009672 0.2190 0.01602 ns 0.1540 0.007091 0.1470 0.002134 ns Heart/tibia length 0.01279 0.0004742 0.01223 0.0008627 ns 0.008605 0.0003912 0.008196 0.0001319 ns Fasting blood glucose (mg/dL) 175.7 4.357 176.5 9.165 ns 183.0 4.508 194.6 7.162 ns Tibia length (mm) 17.90 0.2372 17.89 0.08167 ns 17.89 0.1206 17.95 0.1503 ns
[0074] In summary, our results support an important role for CTRP1 in metabolic homeostasis. The contribution of CTRP1 to systemic glucose and lipid metabolism is sex-dependent and relies on the specific metabolic and dietary context. When fed an LFD, loss of CTRP1 impaired hepatic lipid metabolism (resulting in fatty liver) and systemic insulin sensitivity. In the context of HFD, CTRP1 deficiency attenuated diet-induced obesity and fatty liver. Our study underscores the complex regulation of whole-body metabolism by secreted regulators of the CTRP family.
[0075] Regarding the in vivo function of CTRP1, especially as it relates to lipid metabolism in liver using a genetic mouse model in which the Ctrp1 gene was deleted, the inventors made the following discovery. Specifically, CTRP1 knockout (KO) mice, were fed a control low-fat diet and fasted overnight. Observed was a dramatic and striking increase in liver weight, whether it was liver mass (
[0076] During the overnight fast, the inventors believe lipids from the adipose tissue get mobilized and shunted to the liver for oxidation. Energy derived from fat oxidation enables liver to make glucose during fasting to maintain normal blood glucose levels. One possible mechanism that can account for the enlargement of liver in response to the overnight fast is the reduction in fat oxidation. Indeed, expression of many of the fat oxidation genes in liver were significantly down-regulated in overnight fasted CTRP1 deficient animals (
[0077] The inventors believe, based on genetic mouse model data, there is an important role for CTRP1 hormone in regulating hepatic lipid metabolism and the therapeutic potential of using recombinant CTRP1 protein to reduce lipid accumulation in liver in the context of non-alcoholic fatty liver disease (NAFLD).
Examples/Methods
[0078] The following Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The following Examples are offered by way of illustration and not by way of limitation.
Animals
[0079] The Ctrp1 KO (/) mouse strain used for this research project (B6; 12955-C1qtnf1.sup.tm1Lex/Mmucd, identification number 032164-UCD) was obtained from the Mutant Mouse Regional Resource Center (MMRRC), an NCRR-NIH funded strain repository, and was donated to the MMRRC by Genentech, Inc. The Ctrp1 gene is located on mouse chromosome 11 and comprises 4 exons. The largest exon, exon 4 (which codes for 61% of the full-length protein), was targeted by homologous recombination. A total of 679 bp, spanning the coding region of exon 4 and a portion (162 bp) of the 3UTR, was deleted. Heterozygous mice were recovered from cryo-preserved embryos. Since the ES cells were derived from the 12955/Sv mouse strain, we backcrossed Ctrp1 KO mice to the C57BL/6J genetic background for >6 generations. The Ctrp1 KO mice were viable and fertile. Genotyping primers for the Ctrp1 wild-type (WT) allele were as follows: forward (DNA063-1), 5-GGTTCTACAGGTCC CAGGG-3 (SEQ ID NO: 2); and reverse (DNA063-2), 5-GTGATGTAGGTGTCGAACTCG-3 (SEQ ID NO: 3). The expected size of the WT amplification product was 458 bp. Genotyping primers for the Ctrp1-KO allele were as follows: forward (Neo-3a), 5-GCAGCGCATCGCCTTCTATCG-3 (SEQ ID NO: 4) and reverse (DNA063-31) 5-GGAAGTCCCTCTCACGTGTC-3 (SEQ ID NO: 5). The expected size of the KO amplification product was 1100 bp. To confirm the presence or absence of Ctrp1 mRNA in the adipose tissue of WT and KO mice, we performed semi-quantitative PCR analysis using the following primer pair: forward, 5-GTGAGGACCTCCCCACTTCT-3 (SEQ ID NO: 6) and reverse, 5-GACCAGGTAGCCA CTGAAGG-3 (SEQ ID NO: 7). The expected size of the amplification product was 632 bp. All Ctrp1-KO (/) and WT (+/+) littermate controls used in this study were generated by intercrossing Ctrp1 heterozygous (+/) mice. Male and female Ctrp1 KO mice and WT littermate controls were housed in polycarbonate cages on a 12-h light-dark photocycle with ad libitum access to water and food. Mice were fed a high-fat diet (HFD; 60% kcal derived from fat, Research diets; D12492) or a matched control low-fat diet (LFD; 10% kcal derived from fat, Research diets; D12450B). Diet was provided for a period of 24 weeks, beginning at 6 weeks of age. All animal protocols were approved by the Institutional Animal Care and Use Committee of The Johns Hopkins University School of Medicine.
CTRP1 ELISA
[0080] An ELISA specific for mouse CTRP1 was obtained from BioVendor R&D, Czech Republic. The assay was carried out according to manufacturer's instructions.
Body Composition Analysis
[0081] Body composition analyses for fat and lean mass were performed on mice at 19-24 weeks using Echo-MRI-100 (Echo Medical Systems, Waco, Tex.) at The Johns Hopkins University School of Medicine mouse phenotyping core facility. Lean mass was used to normalize the indirect calorimetry data.
Indirect Calorimetry
[0082] LFD-fed and HFD-fed WT and Ctrp1-KO mice at 19-24 weeks of age were used for simultaneous assessments of daily body weight change, food intake (corrected for spillage), physical activity, and whole-body metabolic profile in the Comprehensive Laboratory Animal Monitoring System (CLAMS) system (Columbus Instruments). Data were collected for 3-4 days to confirm that mice were acclimated to the calorimetry chambers (indicated by stable body weights, food intake, and diurnal metabolic patterns), and data were analyzed from the fourth day. Rates of oxygen consumption (VO.sub.2, normalized to mL.Math.lean kg.sup.1.Math.h.sup.1) and carbon dioxide production (VCO.sub.2; mL.Math.lean kg.sup.1.Math.h.sup.1) in each chamber were measured every 24 min throughout the studies. Respiratory exchange ratio (RER=VCO.sub.2/VO.sub.2) was calculated by CLAMS software (version 4.02) to estimate relative oxidation of carbohydrates (RER=1.0) vs. fats (RER 0.7), not accounting for protein oxidation. Energy expenditure (EE) was calculated as EE=VO.sub.2[3.815+(1.232RER)] (29) and normalized for lean body mass (kcal.Math.lean kg.sup.1.Math.h.sup.1) as recommended (2). Physical activities were measured by infrared beam breaks in the metabolic chamber. Average metabolic values were calculated per mouse and averaged across mice for statistical analysis by Student's t-test.
Intraperitoneal Glucose and Insulin Tolerance Test
[0083] Mice were fasted for 6 h before glucose injection. Glucose was injected intraperitoneally (i.p.) into mice at a dose of 1 mg/g body weight. Blood glucose was measured at 0, 15, 30, 60, and 120 min post glucose injection using a glucometer (BD Pharmingen, Franklin Lakes, N.J.). Fasting serum insulin levels were measured using an ELISA kit (Millipore, Billerica, Mass.). For insulin tolerance tests, food was removed 2 h before insulin injection. Insulin was injected i.p. at a dose of 0.75 U/kg body weight for LFD-fed mice and 1 or 1.5 U/kg body weight for HFD-fed mice, and blood glucose was measured at 0, 15, 30, 60, and 90 min post insulin injection as described above. The homeostatic model assessment of insulin resistance (HOMA-IR) was calculated based on fasting glucose and insulin concentrations as HOMA-IR=(fasting glucose [mM]fasting insulin [microunits/mL])/22.5 (27). This surrogate index provides a reasonable approximation of the degree of insulin resistance and has been validated against the reference standard glucose clamp for rats (5) and mice (21).
Lipid Tolerance Test
[0084] For lipid tolerance tests (LTT), mice were fasted for 12 h and then gavaged with 20% emulsified Intralipid (soybean oil; Sigma; 10 L/g of body weight). Sera were collected via tail bleed using a Microvette CB 300 (Sarstedt) at 0, 1, 2, 3, and 4 h post-injection. Serum levels of non-esterified free fatty acids (NEFA) and triglycerides were quantified using kits from Wako Diagnostics and Infinity Triglycerides (Thermo Scientific), respectively.
Hepatic VLDL-Triglyceride Quantification
[0085] To measure the hepatic VLDL-triglyceride production rate, a separate cohort of LFD-fed WT and Ctrp1-KO mice were given an intraperitoneal injection of 1000 mg/kg poloxamer 407 (Sigma) in saline 4 h into the light cycle, as described by Millar et al. (30) and our previous study (37). Poloxamer 407 inhibits lipoprotein lipase activity and blocks triglyceride hydrolysis, thus allowing VLDL-triglycerides to accumulate over time and enables the calculation of hepatic VLDL-triglyceride secretion rates (30). Serum samples were collected at 0, 1, 2, 4, and 8 h and analyzed for triglyceride concentration. Serum levels of triglycerides were quantified using the Infinity Triglycerides kit (Thermo Scientific).
Tissue Collection
[0086] Liver, white adipose tissue (perigonadal/visceral and inguinal/subcutaneous), and skeletal muscle samples were immediately harvested from euthanized mice and flash-frozen into liquid nitrogen. Homogenized tissue lysates were prepared in RIPA lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton100, and 0.25% deoxycholate) containing protease inhibitors (Complete Mini, Roche) and phosphatase inhibitors (PhosSTOP, Roche). Tissue lysates were centrifuged at 10,000 rpm for 20 minutes at 4 C. for 20 minutes. Supernatants were collected and protein content was quantified using the Pierce BCA Protein Assay Kit (Thermo Scientific).
Histology
[0087] WT and Ctrp1-KO mouse tissues were fixed overnight in 10% formalin at 4 C. Fixed tissues were embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H & E) at the Histology Reference Laboratory at The Johns Hopkins University School of Medicine.
Serum and Blood Chemistry Analysis
[0088] Mouse serum was harvested by retro-orbital bleeding at the time of euthanasia. Samples were separated using a Microvette CB 300 (Sarstedt, Numbrecht, Germany) and centrifuged at 10,000g for 5 min. Glucose concentrations were determined at the time of collection with a glucometer (BD Pharmingen). Serum lipid levels were measured by the Mouse Pathology and Phenotyping Core at The Johns Hopkins University School of Medicine. Insulin, adiponectin, leptin, TNF-, MCP-1, IL-1, and IL-6 were measured using Millipore kits. Serum TGF -1 was measured using an Abcam kit and CTRP1 was measured using a kit from BioVendor R&D.
Lipid Extraction from Liver Tissue
[0089] Lipid extraction was performed as previously described (37). In brief, liver (50 mg) was homogenized in 500 L of distilled water. 200 L of the homogenate was collected for lipid extraction, mixed with 1 mL of choloroform:methanol (2:1), and centrifuged at 1700 rpm for 5 min at 4 C., and the chloroform phase was collected and dried in a vacuum. Samples were re-suspended in tert-butanol:MeOH:Triton-X100 (3:1:1) before determining triacylglycerol and cholesterol content using commercially available colorimetric kits (Thermo Scientific).
Western Blot Analysis
[0090] Western blot analyses were carried out and quantified as previously described (41), using antibodies specific to GLUT4, AMPK, AKT, phospho-AKT (Ser-473), and phospho-AMPK (Thr-172) (Cell Signaling Technology). PGC1 antibody was obtained from Abcam (cat # ab54481).
Quantitative Real-Time PCR Analysis
[0091] Total RNA was isolated from tissues using Trizol (Thermo Scientific) and reverse transcribed using the GoScript Reverse transcription system (Promega). Real-time PCR primers for gluconeogenic genes (G6Pc, Pck1) (39), triglyceride synthesis genes (Gpat, Agpat, Dgat) (37), de novo lipogenesis, fat oxidation and adipokine genes (Acc1, Fasn, Srebp1, Acox1, Cpt1, Cpt2, Lcad, Mcad, Adipoq, Lep) (55), fibrotic genes (Col1, Col3, Col6) (22), and inflammatory genes (II-1, II-6, Tgf-) have been previously published. Other primer sequences used in this study are listed in Table 1. Quantitative real-time PCR analyses were performed on a CFX Connect system (Bio-Rad Laboratories, Hercules, Calif.). Samples were analyzed in 20 L reactions with SyBR Green PCR Master Mix (Applied Biosystems, Invitrogen) per the manufacturer's directions. Data were normalized to 36B4 (adipose tissue), 18S rRNA (skeletal muscle), and -actin (liver) and expressed as relative mRNA levels using the Ct method (23).
TABLE-US-00004 TABLE1 Gene Forwardprimer Reverseprimer 36B4 AGATTCGGGATATGCTGTTGGC TCGGGTCCTAGACCAGTGTTC (SEQIDNO:8) (SEQIDNO:9) Hmgcr CTTGTGGAATGCCTTGTGATTG AGCCGAAGCAGCACATGAT (SEQIDNO:10) (SEQIDNO:11) Sqle ATAAGAAATGCGGGGATGTCAC ATATCCGAGAAGGCAGCGAAC (SEQIDNO:12) (SEQIDNO:13) Abca1 GCTGCAGGAATCCAGAGAAT CATGCACAAGGTCCTGAGAA (SEQIDNO:14) (SEQIDNO:15) Apoc2 AGGTTCCGGCTTGATGAGAA AGTGGGTTGGCAGGCTTTAT (SEQIDNO:16) (SEQIDNO:17) Apoe CTGACAGGATGCCTAGCCG CGCAGGTAATCCCAGAAGC (SEQIDNO:18) (SEQIDNO:19) Vldlr GAGCCCCTGAAGGAATGCC CCTATAACTAGGTCTTTGCAGATATGG (SEQIDNO:20) (SEQIDNO:21) Cd36 ATGGGCTGTGATCGGAACTG AGCCAGGACTGCACCAATAAC (SEQIDNO:22) (SEQIDNO:23) Chrebp- CGACACTCACCCACCTCTTC TTGTTCAGCCGGATCTTGTC (SEQIDNO:24) (SEQIDNO:25) Chrebp- AGCGGATTCCAGGTGAGG TTGTTCAGGCGGATCTTGTC (SEQIDNO:26) (SEQIDNO:27) Fabp1 ATGAACTTCTCCGGCAAGTACC GGTCCTCGGGCAGACCTAT (SEQIDNO:28) (SEQIDNO:29) Fatp5 GTTCTCCCGTCCAAGACCATT GCTCCGTACAGAGTGTAGCAAG (SEQIDNO:30) (SEQIDNO:31) Fxr GCTTGATGTGCTACAAAAGCTG CGTGGTGATGGTTGAATGTCC (SEQIDNO:32) (SEQIDNO:33) Lxr- AGGAGTGTCGACTTCCGCAAA CTCTTCTTGCCGCTTCAGTTT (SEQIDNO:34) (SEQIDNO:35) Lxr- ATAGTGGGTCACGAAGCAGC AGGGCAACAGAGTCGGAGAC (SEQIDNO:36) (SEQIDNO:37) Scd1 CCCAGTCGTACACGTCATTTT CATCATTCTCATGGTCCTGCT (SEQIDNO:38) (SEQIDNO:39) Mlycd CTCGGGACCTTCCTCATAAAGAGA GAATAGTTCGTTCCTCCCATGCTC (SEQIDNO:40) (SEQIDNO:41) Lipc ATGGGAAATCCCCTCCAAATCT GTGCTGAGGTCTGAGACGA (SEQIDNO:42) (SEQIDNO:43) Lpl CCCTGAAGACACAGCTGAGG GGCTGTACCCTAAGAGGTGG (SEQIDNO:44) (SEQIDNO:45) Mcp-1 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT (SEQIDNO:46) (SEQIDNO:47) Ppar- CCAGAGTCTGCTGATCTGCG GCCACCTCTTTGCTCTGCTC (SEQIDNO:48) (SEQIDNO:49) Atgl TGTGGCCTCATTCCTCCTAC TCGTGGATGTTGGTGGAGCT (SEQIDNO:50) (SEQIDNO:51) Hsl GCTGGGCTGTCAAGCACTGT GTAACTGGGTAGGCTGCCAT (SEQIDNO:52) (SEQIDNO:53) Ccr7 TGTACGAGTCGGTGTGCTTC GGTAGGTATCCGTCATGGTCTTG (SEQIDNO:54) (SEQIDNO:55) Ccl3 TTCTCTGTACCATGACACTCTGC CGTGGAATCTTCCGGCTGTAG (SEQIDNO:56) (SEQIDNO:57) Ccl4 TTCCTGCTGTTTCTCTTACACCT CTGTCTGCCTCTTTTGGTCAG (SEQIDNO:58) (SEQIDNO:59) Nos2 GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC (SEQIDNO:60) (SEQIDNO:61) F4/80 CCCCAGTGTCCTTACAGAGTG GTGCCCAGAGTGGATGTCT (SEQIDNO:62) (SEQIDNO:63) Mgl2 GCATGAAGGCAGCTGCTATTGGTT TAGGCCCATCCAGCTAAGCACATT (SEQIDNO:64) (SEQIDNO:65) Cd206 CTCTGTTCAGCTATTGGACGC CGGAATTTCTGGGATTCAGCTTC (SEQIDNO:66) (SEQIDNO:67) Il-10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG (SEQIDNO:68) (SEQIDNO:69) Arg1 CTCCAAGCCAAAGTCCTTAGAG AGGAGCTGTCATTAGGGACATC (SEQIDNO:70) (SEQIDNO:71) Cd68 TTCTGCTGTGGAAATGCAAG CAATGATGAGAGGCAGCAAG (SEQIDNO:72) (SEQIDNO:73) Retnl CCAATCCAGCTAACTATCCCTCC ACCCAGTAGCAGTCATCCCA (SEQIDNO:74) (SEQIDNO:75) Mcad GTGCCCAGAGTGGATGTCT CCCCGCTTTTGTCATATTCCG (SEQIDNO:76) (SEQIDNO:77)
Statistical Analysis
[0092] Comparisons between two groups of data were performed using two-tailed Student's t-tests with 95% confidence intervals and ANOVA tests were used to make comparisons involving more than two groups. Values were considered to be statistically significant at p<0.05. For all data, * represents p<0.05, ** represents p<0.01, and *** represents p<0.005. All data are presented as meanstandard error of the mean (SEM).
[0093] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0094] The use of the terms a and an and the and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0095] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.