METHOD OF PRODUCING GINSENOSIDES 20(S)-RG3 AND 20(S)-RH2 USING GINSENOSIDE GLYCOSIDASES
20190194667 ยท 2019-06-27
Inventors
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
International classification
C12N15/74
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a method of producing ginsenoside 20(S)Rg3 or 20(S)Rh2 using a novel ginsenoside glycosidase in order to obtain ginsenoside 20(S)Rg3 or 20(S)Rh2 with high efficiency and high purity. According to the production method of the present invention, a large amount of 20(S)Rg3 or 20(S)Rh2, which is a minor form of rare ginsenoside present in very small amounts in ginseng or processed ginseng products, may be safely and efficiently produced. In particular, the method according to the present invention has an advantag5e in that it may produce a large amount of 20(S)Rg3 or 20(S)Rh2 for industrial applications, since the process is very simple and the production efficiency is very high.
Claims
1. A method of producing ginsenoside 20(S)Rg3 comprising treating ginseng crude saponin with a ginsenoside glycosidase isolated from Herbiconiux ginsengi, a transformant introduced with a vector comprising a nucleic acid encoding the ginsenoside glycosidase, or a culture of the transformant.
2. The method of claim 1, wherein the ginsenoside glycosidase comprises an amino acid sequence of SEQ ID NO: 3.
3. The method of claim 2, wherein the ginsenoside glycosidase is comprised in a culture of a transformant introduced with a vector comprising a nucleic acid encoding the ginsenoside glycosidase isolated from Herbiconiux ginsengi.
4. The method of claim 1, wherein producing the ginsenoside 20(S)Rg3 comprising treating the ginseng crude saponin comprises treating the ginseng crude saponin at a pH of 6.0 to 8.0 and a temperature of 28 to 40 C. for an incubation time of 12 to 72 hours.
5. A method of producing ginsenoside 20(S)Rh2 comprising the steps of: (a) treating ginseng crude saponin with a ginsenoside glycosidase isolated from Herbiconiux ginsengi, a transformant introduced with a vector comprising a nucleic acid encoding the ginsenoside glycosidase, or a culture of the transformant to prepare a reaction solution comprising ginsenoside 20(S)Rg3; and (b) treating the reaction solution prepared in the step (a) with a ginsenoside glycosidase isolated from Flavobacterium johnsoniae, a transformant introduced with a vector comprising a nucleic acid encoding the ginsenoside glycosidase, or a culture of the transformant to produce ginsenoside 20(S)Rh2.
6. The method of claim 5, wherein the ginsenoside glycosidase in the step (a) comprises an amino acid sequence of SEQ ID NO: 3, and the ginsenoside glycosidase in the step (b) comprises an amino acid sequence of SEQ ID NO: 4.
7. The method of claim 6, wherein the ginsenoside glycosidase in the step (a) is comprised in a culture of a transformant introduced with a vector comprising a nucleic acid encoding the ginsenoside glycosidase isolated from Herbiconiux ginsengi, and the ginsenoside glycosidase in the step (b) is comprised in a culture of a transformant introduced with a vector comprising a nucleic acid encoding the ginsenoside glycosidase isolated from Flavobacterium johnsoniae.
8. The method of claim 6, wherein the step (a) of treating the ginseng crude saponin to prepare the ginsenoside 20(S)Rg3, comprises treating the ginseng crude saponin at a pH of 6.0 to 8.0 and a temperature of 28 to 40 C. for an incubation time of 12 to 72 hours, and the step (b) of producing the ginsenoside 20(S)Rh2 comprises treating the reaction solution at a pH of pH 6.0 to 8.0 and a temperature of 28 to 40 C. for an incubation time of 12 to 72 hours.
9. The method of claim 8, further comprising, before the step (b), a step of performing deactivation of the ginsenoside glycosidase by heating at 70 C. to 90 C. for at least 4 hours.
10. A composition for converting crude saponin to 20(S)Rg3, the composition comprising a ginsenoside glycosidase comprising an amino acid sequence represented by SEQ ID NO: 3, a transformant introduced with a vector comprising a nucleic acid encoding the ginsenoside glycosidase protein, or a culture of the transformant.
11. A composition for converting crude saponin to 20(S)Rh2, the composition comprising: a ginsenoside glycosidase comprising an amino acid sequence represented by SEQ ID NO: 3, a transformant introduced with a vector comprising a nucleic acid encoding the ginsenoside glycosidase protein, or a culture of the transformant; and a ginsenoside glycosidase comprising an amino acid sequence represented by SEQ ID NO: 4, a transformant introduced with a vector comprising a nucleic acid encoding the ginsenoside glycosidase protein, or a culture of the transformant.
Description
DESCRIPTION OF DRAWINGS
[0047]
[0048]
[0049]
MODE FOR INVENTION
[0050] Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are merely to illustrate the present invention, and the scope of the present invention is not construed as being limited by these examples.
EXAMPLE 1
Extraction of Crude Saponin
[0051] The leaf and root of Panax ginseng C. A. Meyer was repeatedly extracted twice or more with a 20-fold volume of an ethanol having an alcohol content of 70% (v/v) at room temperature for 1 to 2 hours, followed by drying, thereby obtaining an extract. The extract was dissolved again in water, adsorbed onto HP-20 resin, and then washed with water to remove sugar. The washed extract was first washed with an ethanol having an alcohol content of 40% (v/v) to remove protopanaxatriol (PPT)-type ginsenoside Re and Rg1, and then washed with an ethanol having an alcohol content of 80% (v/v), and the fraction comprising eluted protopanaxadiol (PPD)-type ginsenoside Rb1, Rb2, Rc and Rd was collected and dried, thereby preparing a crude saponin extract.
EXAMPLE 2
Preparation of Novel Ginsenoside Glycosidases
EXAMPLE 2-1
Construction of Recombinant Expression Vectors and Transformed Microorganisms Comprising Novel Ginsenoside Glycosidase
[0052] In order to prepare novel ginsenoside glycosidases capable of converting major ginsenosides to minor ginsenosides, novel ginsenoside glycosidases were isolated from Herbiconiux ginsengi KACC 14262T and Flavobacterium johnsoniae KACC 11414.sup.T strains, respectively.
[0053] Specifically, Herbiconiux ginsengi KACC 14262.sup.T and Flavobacterium johnsoniae KACC 11414.sup.T strains were selected, and genomic DNAs were extracted therefrom. Using each of the genomic DNAs as a template, polymerase chain reaction (PCR) was performed using each set of forward and reverse primers. The sequences of the primers are shown in Table 1 below.
TABLE-US-00001 TABLE1 Primers Sequences(5.fwdarw.3) BglHg GGTTCCGCGTGGATCCACAACCACACCCTCACTCACA forward (SEQIDNO:5) primer BglHg GATGCGGCCGCTCGAGTTAGCCCTCGACCTCTTGTGA reverse (SEQIDNO:6) primer BglFj CGGGATCCAAAAACAAATTAGTCTTACTTTTTTTA forward (SEQIDNO:7) primer BglFj CCCCTCGAGCTATTTAGTTAACTCAAAACTAACTTT reverse (SEQIDNO:8) primer
[0054] Each of the fragments amplified by the reaction was sequenced, and as a result, the nucleotide sequence of the ginsenoside glycosidase derived from Herbiconiux ginsengi KACC 14262.sup.T was identified to have SEQ ID NO: 1, and the nucleotide sequence of the ginsenoside glycosidase derived from the Flavobacterium johnsoniae KACC 11414.sup.T strain was identified to have SEQ ID NO: 2. Each of the fragments amplified by the reaction was inserted into the plasmid vector pGEX4T-1 (GE Healthcare, USA) (having glutathione S-transferase inserted therein) using an EzCloning Kit (Enzynomics), thereby constructing two recombinant expression vectors, GST-BglHg (derived from Herbiconiux ginsengi) and GST-BglFj (derived from Flavobacterium johnsoniae). Each of the recombinant expression vectors was transformed into an E. coli BL21(DE3) strain by a conventional transformation method, thereby producing transformants comprising the ginsenoside glycosidase derived from the Herbiconiux ginsengi KACC 14262.sup.T or Flavobacterium johnsoniae KACC 11414.sup.T strain.
EXAMPLE 2-2
Isolation of Ginsenoside Glycosidase
[0055] In order to produce a large amount of a ginsenoside glycosidase from each of the transformants constructed in Example 2-1, each of the transformed strains was inoculated into an Erlenmeyer flask containing 100 ml of ampicillin-containing LB medium, and was seed-cultured in a shaking incubator at 200 rpm at 37 C. until the absorbance at 600 nm reached 0.6. In order to confirm expression of soluble protein at various temperatures (18, 22, 25, 30 and 37 C.), IPTG (isopropyl-beta-D-thiogalactoside) was added thereto to a final concentration of 0.1 mM in order to induce expression of a large amount of the ginsenoside glycosidase from each of the strains.
[0056] When each of the strain entered into the stationary phase, a culture of the strain was centrifuged at 6,000g at 4 C. for 10 minutes, and suspended in 100 mM sodium phosphate buffer (pH 7.0), after which the cell suspension was lysed with a sonicator. The cell lysate was centrifuged again at 13,000g at 4 C. for 15 minutes, and then a water-soluble ginsenoside glycosidase was isolated from the supernatant which could be used for ginsenoside production.
[0057] The isolated and purified ginsenoside glycosidases were analyzed by SDS-PAGE. The ginsenoside glycosidase derived from the Herbiconiux ginsengi KACC 14262.sup.T strain was named BglHg, and the ginsenoside glycosidase derived from the Flavobacterium johnsoniae KACC 11414.sup.T strain was named BglFj.
[0058] The ginsenoside glycosidase Bg1Hg was 740 amino acids in length, and the amino acid sequence thereof was represented by SEQ ID NO: 3. In addition, the ginsenoside glycosidase BglFj was 766 amino acids in length, and the amino acid sequence thereof was represented by SEQ ID NO: 4.
EXAMPLE 3
Examination of the Ability of Ginsenoside
Glycosidases BglHg and BglFj to Biotransform Ginsenosides
[0059] The crude saponin prepared in Example 1 above was dissolved in 50 mM sodium phosphate buffer (0.1% (w/v)), and then 0.2 U of the ginsenoside glycosidase (BglHg) was added thereto, followed by incubation under the conditions of pH 7.0 and 37 C. for 24 hours.
[0060] Meanwhile, in order to obtain ginsenoside 20(S)Rh2, a portion of sample was collected at 12-hour intervals during the entire period of the reaction performed using the ginsenoside glycosidase (BglHg), and the collected sample was treated with the ginsenoside glycosidase (BglFj) and incubated for 24 hours.
[0061] The reaction was terminated by adding the same volume of aqueous solution-saturated butanol to each of the incubated solutions. The n-butanol fraction was dried and evaporated, and the residue was dissolved in CH.sub.3OH.
[0062] The solution was analyzed by TLC (thin layer chromatography), and the results are shown in
[0063] As shown in
EXPERIMENTAL EXAMPLE
HPLC Analysis Conditions
[0064] HPLC was used to analyze the purities of ginsenosides 20(S)Rg3 and Rh2. Gradient elution was performed using Prodigy ODS(2) C.sub.18 column (5 m, 1504.6 mm I. D.; Phenomenex, USA) as a column, Eclips XDB C.sub.18 (5 m, 1504.6 mm I. D.) as a guard column, and water(A) and acetonitrile(B) as a mobile phase. Each separated material was dissolved in methanol at a concentration of 1 mg/ml, and then 25 l of the solution was injected, after which detection was performed at a flow rate of 1.0 ml/min and at 203 nm.
EXAMPLE 4
Production of Large Amount of Ginsenoside 20(S)Rg3 Using Novel Ginsenoside Glycosidase (BglHg)
EXAMPLE 4-1
Obtaining of Enzyme Solution Comprising Ginsenoside Glycosidase (BglHg)
[0065] To obtain a large amount of an enzyme solution for producing 20(S)Rg3 in large amounts of 100 g or more, a process of growing transformed E. coli cells in a 10-L unit fermentor was performed as follows. Prior to the main culture, transformed E. coli BL21(DE3) cells comprising GST-BglHg were inoculated and cultured in ampicillin-containing LB medium in 500-ml flask on the day before the main culture. On the next day, the cells were inoculated into a 6-L volume of LB (Luria-Bertani media) in a 10-L fermentor and cultured in a shaking incubator at 37 C. at 500 rpm until the absorbance at 600 nm reached 3. To induce expression of the water-soluble recombinant protein BglHg, the temperature of the fermentor was lowered to 25 C., and to facilitate the additional growth of the E. coli cells, 200 ml of a glucose solution (600 g/L) was added. 600 ml of 1 M sodium phosphate buffer was added to the thereto to keep the pH at around 7.0 under stable pH conditions. IPTG (isopropyl-beta-D-thiogalactoside) was added to thereto to a final concentration of 0.1 mM in order to induce expression of a large amount of ginsenoside glycosidase BglHg. The cells were cultured for 8 hours, and when the strain entered into the stationary phase, the culture medium of the strain was centrifuged at 6,000g at 4 C. for 15 minutes, and 200 g of the E. coli were collected (about 30 g/L). The collected cells were suspended in 100 mM sodium phosphate buffer (pH 7.0), and the cell suspension was lysed with a sonicator. The cell lysate was centrifuged at 13,000g at 4 C. for 15 minutes, thereby obtaining a large amount of the enzyme solution comprising BglHg expressed as a water-soluble protein.
EXAMPLE 4-2
Production of Large Amount of Ginsenoside 20(S)Rg3
[0066] 6 L of a PPD-type ginsenoside mixture (comprising Rb1, Rb2, Rc, Rd, etc.; crude saponin) having a maximum concentration of 5% was reacted with 2 L of the enzyme solution obtained in large amounts in Example 4-1 above at a temperature of 37 C. for 48 hours while stirring at 150 rpm.
[0067] Meanwhile, before the reaction, HPLC analysis of the PPD-type ginsenoside mixture was performed as described in the Experimental Example, and the results are shown in
[0068] HPLC analysis of the obtained ginsenoside 20(S)Rg3 was performed as described in the Experimental Example. The results are shown in
EXAMPLE 4-3
Production of Ginsenoside 20(S)Rg3 with 98% purity
[0069] To increase the purity of the ginsenoside 20(S)Rg3 obtained in Example 4-2 above, recycling preparative HPLC (Japan
[0070] Analytical Instrument) was used. Specifically, 500 mg of 20(S)Rg3 was dissolved in 75% ACN and fractionated using the solvent under the same conditions (75% ACN) at a rate of 7 ml/min on an ODS AP column (50500 mm), thereby obtaining 240 mg of ginsenoside 20(S)Rg3 having a purity corresponding to 99% based on the area ratio of the chromatogram.
EXAMPLE 5
Production of Large Amount of Ginsenoside 20(S)Rh2 Using Novel Ginsenoside Glycosidase (BglFj)
EXAMPLE 5-1
Obtaining of Enzyme Solution Comprising Ginsenoside Glycosidase (BglFj)
[0071] A BglFj enzyme solution was obtained in the same manner as described in Example 4-1 (the method of producing a large amount of Bg1Hg enzyme solution) above.
EXAMPLE 5-2
Production of Large Amount of Ginsenoside 20(S)Rh2
[0072] After completion of the reaction for conversion to 20(S)Rg3 as described in Example 4-2 above, the reaction solution was heat-treated at 80 C. for about 1 hour, and the remaining BglHg enzyme was deactivated. Thereafter, 2 L of the BglFj enzyme solution was added to the reaction solution in which 20(S)Rg3 dissolved, the mixture was reacted for 24 hours while stirring at 150 rpm at a temperature of 37 C. In order to stop the reaction and recover the converted 20(S)Rh2, ethanol was added to thereto as to be 70%, thereby deactivating the recombinant enzyme to bring down and dissolving the ginsenoside 20(S)Rh2. The alcohol concentration of the dissolved ginsenoside was again lowered, and the ginsenoside solution was adsorbed onto a HP20 porous resin, washed with water, desorbed with 80% ethanol, and then evaporated with a vacuum rotary evaporator, thereby obtaining highly pure ginsenoside 20(S)Rh2. Finally, 250 g of the PPD mixture was reacted, thereby obtaining 110 g of ginsenoside 20(S)Rh2 which was then identified by TLC.
[0073] HPLC analysis of the obtained ginsenoside 20(S)Rh2 was performed as described in the Experimental Example. The results are shown in
EXAMPLE 5-3
Production of Ginsenoside 20(S)Rh2 with 98% purity
[0074] To increase the purity of the ginsenoside 20(S)Rh2 obtained in Example 5-2 above, recycling preparative HPLC (Japan Analytical Instrument) was used. Specifically, 500 mg of 20(S)Rh2 was dissolved in 90% ACN and fractionated using the solvent under the same conditions at a rate of 7 ml/min on an ODS AP column (50500 mm), thereby obtaining 235 mg of ginsenoside 20(S)Rh2 having a purity corresponding to 99% based on the area ratio of the chromatogram.