TRANSPLANTATION EFFECT OF DOPAMINE NEURON ENGRAFTMENT BY CO-TRANSPLANTATION OF MIDBRAIN ASTROCYTES AND VM-NPCS
20190194612 ยท 2019-06-27
Assignee
Inventors
Cpc classification
A61K35/30
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
C12N5/00
CHEMISTRY; METALLURGY
C12N5/0622
CHEMISTRY; METALLURGY
International classification
A61K35/30
HUMAN NECESSITIES
Abstract
The present invention relates to: a cell therapeutic agent including ventral midbrain-derived astrocytes and dopamine neural progenitor cells; a method of treating a neurodegenerative disorder including administering a pharmaceutical composition comprising ventral midbrain-derived astrocytes and dopamine neural progenitor cells into a subject; and a method for differentiation into dopamine neurons, which includes preparing a mixture of ventral midbrain-derived astrocytes and dopamine neural progenitor cells and co-culturing or co-grafting the mixture. The co-grafting of ventral midbrain-derived astrocytes and dopamine neural progenitor cells (neural stem cells) improves the survival and differentiation of dopamine neurons and thus dramatically improves therapeutic outcomes in a neurodegenerative disorder including Parkinson's disease.
Claims
1. A cell therapeutic agent comprising: ventral midbrain-derived astrocytes and dopamine neural progenitor cells.
2. The cell therapeutic agent according to claim 1, wherein, in the astrocytes, Nurr1 (Nuclear receptor related 1) and Foxa2 (forkhead box protein A2) are overexpressed.
3. The cell therapeutic agent according to claim 1, wherein the astrocytes and the neural progenitor cells are mixed at a cell number ratio of 1:1.53.
4. The cell therapeutic agent according to claim 1, which inhibits -synuclein aggregation and transmission.
5. A method for differentiation into dopamine neurons, comprising: co-culturing or co-grafting ventral midbrain-derived astrocytes and dopamine neural progenitor cells by mixing.
6. The method according to claim 5, wherein, in the astrocytes, Nurr1 (Nuclear receptor related 1) and Foxa2 (forkhead box protein A2) are overexpressed.
7. The method according to claim 5, wherein the astrocytes and the neural progenitor cells are mixed at a cell number ratio of 1:1.53.
8. A method of treating a neurodegenerative disorder, comprising: administering a pharmaceutical composition comprising ventral midbrain-derived astrocytes and dopamine neural progenitor cells into a subject.
9. The method according to claim 8, wherein, in the astrocytes, Nurr1 (Nuclear receptor related 1) and Foxa2 (forkhead box protein A2) are overexpressed.
10. The method according to claim 8, wherein the astrocytes and the neural progenitor cells are mixed at a cell number ratio of 1:1.53.
11. The method according to claim 8, wherein the neurodegenerative disorder is selected from Parkinson's disease, dementia, Alzheimer' s disease, Huntington's disease, amyotrophic lateral sclerosis, memory impairment, myasthenia gravis, progressive supranuclear palsy, multiple system atrophy, essential tremor, cortico-basal ganglionic degeneration, diffuse Lewy body disease and Pick's disease.
12. A cell culture obtained by co-culturing ventral midbrain-derived astrocytes and dopamine neural progenitor cells.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0015] The above and other objects, features and advantages of the present invention will become more apparent to those of ordinary skill in the art by describing in detail exemplary embodiments thereof with reference to the attached drawings, in which:
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050] Expressions of selected immune/inflammatory, inhibitory ECMs and anti-oxidant genes are further shown in '
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0098] Hereinafter, exemplary embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments disclosed below and can be implemented in various forms. The following embodiments are described in order to enable those of ordinary skill in the art to embody and practice the present invention.
[0099] Although the terms first, second, etc. may be used to describe various elements, these elements are not limited by these terms. These terms are only used to distinguish one element from another. For example, a first element could be termed a second element, and, similarly, a second element could be termed a first element, without departing from the scope of exemplary embodiments. The term and/or includes any and all combinations of one or more of the associated listed items.
[0100] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting the exemplary embodiments. The singular forms a, an and the are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms comprises, comprising, includes and/or including, when used herein, specify the presence of stated features, integers, steps, operations, elements, components and/or groups thereof and do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and/or groups thereof.
[0101] With reference to the appended drawings, exemplary embodiments of the present invention will be described in detail below. To aid in understanding of the present invention, like numbers refer to like elements throughout the description of the figures, and the description of the same elements will not be iterated.
[0102] The terms used in the present invention are defined as follows.
[0103] The present invention provides a cell therapeutic agent including ventral midbrain-derived astrocytes and dopamine neural progenitor cells.
[0104] That is, ventral midbrain-derived astrocytes and dopamine neural progenitor cells are co-grafted and are differentiated into dopamine neurons, with an ultimate purpose to treat a neurodegenerative disorder.
[0105] The co-grafting used herein refers to the in vivo grafting of both of astrocytes and dopamine neural progenitor cells, and it includes separately storing the different types of cells, mixing the cells together immediately before use and administering the mixture to a subject to be treated through injection.
[0106] To confirm a therapeutic effectiveness of such co-grafting in vitro, in the exemplary embodiment, a co-culture of astrocytes and dopamine neural progenitor cells is used in an experiment.
[0107] The glia used herein refers to cells accounting for the largest portion of cells present in the brain, and it includes astrocytes or microglia. The astrocytes are also known as astroglia and are involved in the protection, nourishment, and inflammation of neuronal cells, and the microglia are cells responsible for inflammation in the brain.
[0108] The astrocytes may be obtained by differentiation from embryonic or adult stem cells, or by separation from the ventral midbrain, cerebral cortex or lateral ganglionic eminence (striatum anlage) of a mammal. In the present invention, as the astrocytes, ventral midbrain (VM)-type astrocytes are used.
[0109] The neural stem cells (NSCs) or neural progenitor cells (NPCs) are separated and cultured from embryonic stem cells, developing or adult brain tissue, and the cultured NPCs may be used in mass-production of dopamine neurons for research and drug screening.
[0110] The term neuron refers to a cell type of the central nervous system, and the terms neuron and neuronal cell may be interchangeably used herein.
[0111] In addition, it is preferable that VM-astrocytes and NPCs are mixed at a cell number ratio of 1:1.53 to adjust a practical co-grafting amount.
[0112] Particularly, in the present invention, it was also confirmed that the overexpression of Nurr1 and Foxa2 in donor astrocytes further promotes the neurotrophic action of grafted astrocytes in a cell-based therapy. That is, the survival and differentiation of dopamine neurons were enhanced by co-grafting of Nurr1+Foxa2-overexpressing VM-astrocytes and dopaminergic NSCs, and thus the therapeutic outcomes were dramatically improved. Here, NSCs or NPCs were transduced with FoxA2 and Nurr1 to overexpress the same.
[0113] The transduction is a phenomenon in which a genetic trait is transferred from a cell to another cell via a bacteriophage, thereby introducing the genetic trait to the latter. When a bacteriophage infects a certain type of bacterium, phage DNA binds to host DNA, and as the phage is removed from the bacterium due to bacteriolysis, it may take out a part of the host DNA while losing a part of its own DNA instead. When the phage infects another bacterium, the former host gene is newly introduced into the bacterium, and therefore, the bacterium exhibits a new trait. The term transduction used in biological research generally refers to the overexpression of a specific exogenous gene in a target cell using a viral vector. In other words, the transduction may be carried out using a viral vector, preferably, a lentivirus or retrovirus vector.
[0114] In addition, in an exemplary embodiment of the present invention, an inhibitory effect of -synuclein aggregation and transmission by astrocytes was confirmed. In addition, in an exemplary embodiment of the present invention, an effect of reducing and improving inflammation by human astrocytes differentiated from human embryonic cells was confirmed.
[0115] The present invention also provides a method for differentiation into dopamine neurons, which includes co-culturing or co-grafting ventral midbrain-derived astrocytes and dopamine neural progenitor cells by mixing.
[0116] The dopamine (DA) neuron refers to a neuron that expresses tyrosine hydroxylase (TH). The terms dopaminergic neuron, dopamine neuron, and DA are used interchangeably herein. The DA neuron is specifically located in the midbrain substantia nigra, and controls postural reflexes, motions and compensation-related behaviors by stimulating striatum, limbic system and neocortex in vivo.
[0117] The term differentiation refers to the phenomenon in which structures and functions are specialized while cells are proliferated by division and grown, and in other words, the change in form or function of cells or tissue of an organism to accomplish its given task.
[0118] The present invention also provides a pharmaceutical composition for preventing or treating a neurodegenerative disorder, which includes VM-derived astrocytes and dopamine NPCs.
[0119] The term prevention used herein means all actions of inhibiting a neurodegenerative disorder or delaying the onset thereof by administration of the composition of the present invention, and the term treatment used herein means all actions involved in alleviating or beneficially changing symptoms of a neurodegenerative disorder by administration of the composition of the present invention.
[0120] The treatment used herein refers to all actions involved in preventing, alleviating or beneficially changing clinical situations related to a disease. In addition, the treatment may refer to an increased survival compared with an expected survival rate when untreated. The treatment includes a preventive means in addition to a therapeutic means.
[0121] In this specification, the term subject may refer to a vertebrate to be tested for treatment, observation or experiments, preferably a mammal, for example, a cow, a pig, a horse, a goat, a dog, a cat, a rat, a mouse, a rabbit, a guinea pig, a human, etc.
[0122] The composition of the present invention is effective in the prevention or treatment of a neurodegenerative disorder. The neurodegenerative disorder may include various neurological diseases, for example, PD, dementia, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis, memory impairment, myasthenia gravis, progressive supranuclear palsy, multiple system atrophy, essential tremor, cortico-basal ganglionic degeneration, diffuse Lewy body disease and Pick's disease, but the present invention is not limited thereto.
[0123] The composition of the present invention may be applied as a cell therapeutic agent, and it may be formulated by further including a pharmaceutically acceptable carrier. The term pharmaceutically acceptable carrier used herein refers to a carrier or diluent which does not significantly irritate an organism and does not interfere with the biological activity and properties of an administered ingredient. In the present invention, a pharmaceutically acceptable carrier for the composition of the present invention that can be applied as a cell therapeutic agent may be any one known in the art such as a buffer, a preservative, an analgesic, a solubilizer, an isotonic agent, a stabilizer, a base, an excipient or a lubricant without limitation. The pharmaceutical composition of the present invention may be prepared in various formulations according to a technique commonly used. The composition of the present invention, which is the cell therapeutic agent, may be administered by any route as long as it can induce transmission to a disease lesion. In some cases, a method for loading the composition into a vehicle, which includes a means for directing stem cells to a lesion, may be considered. Therefore, the composition of the present invention may be administered by various routes including local administration (including buccal, sublingual, skin and intraocular administration), non-oral administration (including subcutaneous, intradermal, intramuscular, infusion, intravenous, intraarterial, intraarticular and intrathecal administration), and transdermal administration, and preferably, it is directly administered to a disease lesion. In an aspect, stem cells may be suspended in a suitable diluting agent and administered into a subject, and the diluting agent is used to protect and maintain cells, and to facilitate use in injection into desired tissue. The diluting agent may be a buffer solution such as a physiological saline, a phosphate buffered solution, or HBSS, or a cerebrospinal fluid. In addition, the pharmaceutical composition may be administered by a random device to transmit an active ingredient to target cells. A preferable administration method and type of preparation is an injection. The injection may be prepared using an aqueous solvent such as a physiological saline, a Ringer's solution, a Hank's solution or a sterilized aqueous solution, or a non-aqueous solvent such as a vegetable oil (e.g., olive oil), a higher fatty acid ester (e.g., ethyl oleate), ethanol, benzyl alcohol, propylene glycol, polyethylene glycol or glycerin, and for mucosal permeation, a non-permeable agent known in the art and suitable for a barrier to be permeated may be used, and ascorbic acid, sodium hydrogen sulfite, BHA, tocopherol or EDTA may be used as a stabilizer for preventing spoilage, and a pharmaceutical carrier such as an emulsifier, a buffer for pH adjustment, or a preservative for preventing microbial development such as mercury nitrate, thimerosal, benzalkonium chloride, phenol, cresol or benzyl alcohol may be additionally included.
[0124] The term cell therapeutic agent refers to a medicine (U.S. FDA regulations) used for the purpose of treatment, diagnosis and prophylaxis using cells and tissues prepared through isolation from a human, culturing and special homogenization, that is, a medicine used for the purpose of treatment, diagnosis and prophylaxis through a series of actions of proliferating and selecting living autologous, allogenic or xenogenic cells in vitro to restore the functions of cells or tissues, or changing biological characteristics of cells by another method. Cell therapeutic agents are mainly classified into somatic cell therapeutic agents and stem cell therapeutic agents, depending on a differentiation level of the cells.
[0125] In the present invention, the term administration means that a composition according to the present invention is introduced to a subject or a patient using any suitable method. In this case, the composition according to the present invention may be administered through various routes of oral or parenteral administration as long as the composition can reach target tissue. The composition may be intraperitoneally, intravenously, intramuscularly, subcutaneously, intradermally, orally, topically, intranasally, intrapulmonarily, and rectally administered, but the present invention is not limited thereto.
[0126] The term administration used herein means the introduction of the composition of the present invention to a patient by any suitable method, and an administration route of the composition of the present invention may vary as long as the composition can reach desired tissue, and it may be any one of various routes including oral and non-oral routes. The composition of the present invention may be administered intraperitoneally, intravenously, intramuscularly, subcutaneously, intradermally, orally, locally, intranasally, intrapulmonarily or intrarectally, but the present invention is not limited thereto.
[0127] In this specification, the term effective amount refers to a desired amount required to delay or completely interrupt the onset or progression of a certain disease to be treated. The cells may be administered at a daily dose of 1.010.sup.4 to 1.010.sup.10 cells/kg body weight, preferably at 1.010.sup.5 to 1.010.sup.9 cells/kg body weight once or several times a day. However, it should be understood that an actual dose of an active ingredient has to be determined by various related factors including a disease to be treated, the severity of a disease, an administration route, a patient's body weight, age and sex, and therefore, the dose does not limit the scope of the present invention in any aspect.
[0128] Therefore, the present invention provides a cell therapeutic agent including ventral midbrain-derived astrocytes and dopamine neural progenitor cells, a pharmaceutical composition for preventing or treating a neurodegenerative disorder, which includes cells or a cell culture obtained by co-culturing ventral midbrain-derived astrocytes and dopamine neural progenitor cells, and a method of treating a neurodegenerative disorder, which includes administering the composition to a subject.
[0129] The present invention also includes a cell culture obtained by co-culturing ventral midbrain-derived astrocytes and dopamine neural progenitor cells.
[0130] In the cell culture, an increase in the neurotrophic factors and survival of DA neurons and ventral midbrain-derived astrocytes, Nurr1 and Foxa2-induced reduction in inflammation and improvement in viability of DA neurons thereby were observed. Therefore, the cell culture may be used as an active ingredient of a cell therapeutic agent or pharmaceutical composition for a neurodegenerative disorder.
[0131] Hereinafter, the present invention will be described in detail with reference to examples thereof. However, it should be understood that the following examples are just preferred examples for the purpose of illustration only and is not intended to limit or define the scope of the invention. The following examples described herein are provided in order to make the present invention more comprehensive and complete and provide the scope of the present invention to those skilled in the art to which the present invention belongs and thus will be defined by the appended claims equivalents thereof.
EXAMPLES
[0132] [Materials and Methods]
[0133] 1. Cell Culture
[0134] NPC Culture
[0135] NPCs with DA neurogenic potential were cultured from the VMs of mouse embryos (imprinting control region, ICR) at E(embryonic day) 10.5 or Sprague-Dawley rat embryos at E12. The VM-NPCs were expanded in serum-free N2 medium supplemented with the mitogens basic fibroblast growth factor (bFGF; 20 ng/ml; R&D Systems, Minneapolis, Minn., USA) and epithelial growth factor (EGF; 20 ng/ml; R&D Systems, only for mouse cultures) to reach a confluency of >70% (usually for 3-4 days) and passaged. After an additional NPC expansion, cells were harvested for co-culture and other experiments or directly induced to differentiate by withdrawing the mitogens (in CM treatment experiments). NPCs were also cultured from the cortex, a non-dopaminergic brain region (mouse at E12 or rat at E14) and used as control cells in the following experiments.
[0136] Astrocyte Culture
[0137] Astrocytes were isolated from mouse or rat VMs or cortices (Ctx) on postnatal day 5-7 and cultured in astro-medium [Heinrich, C., Gascon, S., Masserdotti, G., Lepier, A., Sanchez, R., Simon-Ebert, T., Schroeder, T., Gotz, M., and Berninger, B. 2011. Generation of subtype-specific neurons from postnatal astroglia of the mouse cerebral cortex. Nat Protoc 6:214-228.]. In brief, VMs were removed, triturated in Dulbecco's modified Eagle's medium (DMEM; Life Technologies, Camarillo, Calif., USA) containing 10% fetal bovine serum (FBS; HyClone, Logan, Utah), and plated in 75-cm2 T-flasks. When cell confluence reached 80-90%, cells were harvested with 0.1% trypsin and sub-cultured on a culture surface coated with poly-D-lysine (PDL; Sigma, ST, Louis, Mo.). Four-6 days later, microglia were eliminated by shaking at 180 rpm on an orbital shaker. After culturing for 7 days, astrocytes were harvested for co-culture experiments or further cultured for an additional 8 days in N2 to prepare the conditioned medium (CM).
[0138] As described above, minor populations of microglia were present even after the microglia elimination procedure. The astrocyte culture containing a minor microglia population was used in this study. To estimate the effects of minor microglia contamination, microglia-free astrocyte culture was established by treating the cultures with 0.06% trypsin in DMEM/F12 for 20-30 min after the shaking procedure, and discarding floating cells.
[0139] Co-Culture
[0140] VM-NPCs with DA neurogenic potential were harvested and mixed with the Ctx-astrocytes or VM-astrocytes at a 2:1 ratio of VM-NPCs to astrocytes (310.sup.4 vs 210.sup.4 based on the 24-well plate). The mixed cells were plated and differentiation of VM-NPCs was directly induced in serum-free N2 medium. In the control cultures, VM-NPCs were mixed with non-dopaminergic Ctx-NPCs.
[0141] Human Ventral Midbrain Neural Progenitor Cells (or Human Ventral Midbrain Neural Stem Cells, Human VM NPC)
[0142] For direct differentiation into human ventral midbrain neural progenitor cells, hESCs (human Embryonic Stem cells, e.g., WA-09, H9 (purchased from WiCell)) were treated with LDN193189 (100 nM, Stemgent), SB431542 (10 M, Tocris), SHH (100 ng/ml, R&D), purmorphamine (2 M, Stemgent), FGF8 (100 ng/ml, R&D) and CHIR99021 (CHIR; 3 M, Stemgent) for 17 days in order of ventral mid-brain patterning. The cells were plated at a proper cell density (210.sup.6 cells per 6-cm dish), cultured in a Matrigel (BD)-coated dish for 20 days, and then cultured in a poly-L-ornithine (PLO)/fibronectin (FN)/laminin-coated dish at a proper cell density (310.sup.6 per 6-cm dish).
[0143] Culture of Human Ventral Midbrain Astrocytes
[0144] To culture human ventral midbrain astrocytes directly differentiated from human ventral midbrain neural progenitor cells as described above, cells were plated at a cell density (310.sup.6 cells per 6-cm dish), cultured in a Matrigel (BD)-coated dish for 20 days and subcultured in a poly-L-ornithine (PLO)/fibronectin (FN)/laminin-coated dish at a proper cell density (310.sup.6 per 6-cm dish) for approximately 120 days. To confirm the culture, a small amount of the cells was plated in a 24-well plate before use, and then differentiation was determined by GFAP immunocytochemistry.
[0145] Conditioned Medium (CM) Treatment
[0146] As described above, fresh N2 medium (or HBSS(Hank's balanced salt solution)) was added to the astrocyte cultures, and CM of the astrocyte was collected every other day for 8 days. The control CM was similarly prepared in the Ctx-NPC cultures during 6 days of differentiation. The volume of the CMs was adjusted to 0.1-0.15 mg of protein/ml, filtered at 0.45 m, and kept at 80 C. until use. The CMs were diluted with N2 medium (1:1, v:v) before adding to the cells in culture.
[0147] Nurr1+Foxa2 Transduction
[0148] Lentiviral vectors expressing Nurr1 or Foxa2 under the control of the CMV promoter were generated by inserting the respective cDNA into the multi-cloning site of pCDH (System Biosciences, Mountain View, Calif.). The empty backbone vector (pCDH) was used as a negative control. The lentiviruses were produced and used for transducing in vitro cultures as described [Yi, S. H., He, X. B., Rhee, Y. H., Park, C. H., Takizawa, T., Nakashima, K., and Lee, S. H. 2014. Foxa2 acts as a co-activator potentiating expression of the Nurr1-induced DA phenotype via epigenetic regulation. Development 141:761-772.]. Titers of the lentiviruses were determined using a QuickTiter HIV Lentivirus Quantitation Kit (Cell Biolabs, San Diego, Calif., USA), and 20 ul each of the Nurr1 and Foxa2 viruses with 10.sup.6 transducing units (TU)/mL were mixed with 2 mL of media and added to 1-1.510.sup.6 cells/6cm-dish for the transduction reaction.
[0149] Immunostaining
[0150] Cultured cells were fixed with 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS), and blocked in 0.3% Triton X-100 with 1% bovine serum albumin (BSA) for 40 minutes, then incubated with primary antibodies overnight at 4 C. Primary antibody information is shown in Table 1. The secondary antibodies used for visualization were: Cy3 (1:200, Jackson Immunoresearch Laboratories, West Grove, Pa., USA) or Alexa Fluor 488 (1:200, Life Technologies).
TABLE-US-00001 TABLE 1 Working Antibodies dilution Company Catalog numbers Mouse monoclonal Antibody (Ab) Bassoon 1:400 .sup.6Enzo life science ADI-VAM- PS003-D CD16/32 1:500 .sup.2BD Biosciences 553142 CD44 1:500 .sup.11Novus Biologicals .NBP1-31488 Gephyrin 1:500 .sup.16Synaptic Systems 147 011 GFAP 1:200 .sup.8MP Biomedicals 691102 GLAST 1:1000 .sup.9Miltenyl Biotec 130-095-821 HuC/D 1:100 .sup.7Chemicon A21271 iNOS 1:1000 .sup.2BD Biosciences 610432 NeuN 1:200 .sup.10Millipore MAB377 Nurr1 1:1000 .sup.13R&D Systems PP-N1404-00 Synapsin1 1:1000 .sup.2BD Biosciences 611392 SV2 1:50 .sup.5DHSB 2315387 Synaptophysin 1:1000 .sup.2BD Biosciences 611880 Tyrosine 1:200 .sup.7Immunostar T-1299 Hydroxylase (TH) Rabbit Polyclonal Ab CD206 1:500 .sup.1Abcam ab64693 GFAP 1:400 .sup.4DAKO Z0334 GLT-1 1:200 .sup.1Abcam ab106289 lba-1 1:200 .sup.15Wako 019-19741 Lmx1a 1:2000 .sup.10Millipore AB10533 Nurr1 1:500 .sup.14Santa Cruz sc-991 TH 1:1000 .sup.12Pel-freez P40101 S100 1:500 .sup.1Abcam ab868 Sox2 1:100 .sup.3Chemicon AB5603 vGAT 1:1000 .sup.16Synaptic Systems 131 003 Vglut2 1:1000 .sup.16Synaptic Systems 135 403 Goat Polyclonal Ab Arg1 1:500 .sup.11Novus Biologicals NB100-59740 Foxa2 1:500 .sup.14Santa Cruz sc-6554 PSD95 1:500 .sup.16Synaptic Systems 124 014 Rat Polyclonal Ab CD11B 1:500 .sup.10Millipore CBL1512 Chicken Polyclonal Ab Tyrosine 1:500 .sup.1Abcam ab76442 Hydroxylase (TH)
[0151] The stained cells were mounted with VECTASHIELD with DAPI mounting solution (Vector Laboratories, Calif., USA) and photographs were obtained by an epifluorescence microscope (Leica, Heidelberg, Germany) and confocal microscope (Leica PCS SP5).
[0152] Transplantation and Histological Procedures
[0153] Experiments were performed in accordance with National Institutes of Health (NIH) guidelines. Hemi-parkinsonian was induced in adult female Sprague-Dawley rats (220-250 g) by unilateral stereotactic injection of 3 l of 6-hydroxydopamine (6-OHDA, 8 g/l; Sigma) into the right side of the substantia nigra (AP4.8 mm, ML1.8 mm, V8.2 mm) and the median forebrain bundle (AP4.4 mm, ML1.2 mm, V7.8 mm). The incisor bar was set at 3.5 mm, and AP and ML coordinates are given relative to bregma. Rats with 300 turns/hr ipsilateral to the lesion in an amphetamine-induced rotation test were selected. For transplantation, rat E12 VM-NPCs were expanded and mixed with the Ctx-, VM-astrocytes, N+F-VM-astrocytes or E14 Ctx-NPCs (control) at a 2:1 ratio. Three ul of the mixed cells (1.510.sup.5 cells/ul) were injected over a 10 min period into each of two sites in the striatum (coordinates in AP, ML, and V relative to bregma and dura: [1] 0.07, 0.30, 0.55; [2] 0.10, 0.40, 0.50; incisor bar set at 3.5 mm below zero) under anesthesia induced by Zoletil 100 ul/100 g (50 mg/ml) mixed with Rompun 100 ul/100 g (23.32 mg/ml). The needle (22 gauge) was left in place for 5 min after the completion of each injection. Rats received daily injections of cyclosporine A (10 mg/kg, i.p.) starting 1 day before the grafting and continuing for 1 month and were maintained without the immunosuppressant for the rest of the post-transplantation period. Six months after transplantation, animals were anesthetized and perfused transcardially with 4% paraformaldehyde. Brains were removed and immersed in 30% sucrose in PBS overnight, frozen in TissueTek (Sakura Finetek, Torrance, Calif., USA), and then sliced on a freezing microtome (Leica). Free-floating brain sections (30 m thick) were subjected to immunohistochemistry as described above and images were obtained with a confocal microscope (Leica). In the experiment to examine host environments of the transplanted brains, animals were sacrificed at 1 month post-transplantation and grafted brains were sliced at a thickness of 1 mm on a rat brain slice matrix (ZIVIC Instruments, Pittsburgh, Pa.), and to observe a change after grafting, tissue was extracted from an engrafted site. 8-12 regions of the graft-host interface (ca 22 mm)/graft were dissected and subjected to qPCR analyses. Cells immunoreactive for neurotrophic and pro-inflammatory glial markers were also counted along the graft-host interfaces of cryosectioned brain slices at 7-10 days post-transplantation.
[0154] Behavior Tests
[0155] Animal behaviors were assessed using amphetamine-induced rotation, step adjustment, and cylinder tests as previously described [Oh, S. M., Chang, M. Y., Song, J. J., Rhee, Y. H., Joe, E. H., Lee, H. S., Yi, S. H., and Lee, S. H. 2015. Combined Nurr1 and Foxa2 roles in the therapy of Parkinson's disease. EMBO Mol Med 7:510-525].
[0156] Cell Counting and Statistical Analysis
[0157] Immunostained and DAPI-stained cells were counted in 9-20 random areas of each culture coverslip using an eyepiece grid at a magnification of 200 or 400. For every figure, data are expressed as the meanSEM and statistical tests are justified as appropriate. Statistical comparisons were made using the Student's t-test (unpaired), 2-tailed or one-way ANOVA followed by Bonferroni post hoc analysis using SPSS (Statistics 21; IBM Inc. Bentonville, Ark., USA). The n, p-values, and statistical analysis methods are indicated in the figure legends. A P value less than 0.05 was considered significant.
[0158] Study Approval
[0159] All procedures for animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at Hanyang College of Medicine, Seoul, Korea (approval number 2016-0113A).
[0160] Astrocyte Functional Assays
[0161] Electrophysiological Recording in Cultured Astrocytes
[0162] Cultured astrocytes were plated onto coverslips and maintained in DMEM supplemented with 10% fetal bovine serum and 10% horse serum for at least 24 h before electrophysiology experiments. For electrophysiological recording, the patch pipettes had an open-tip resistance of 4-7M when filled with a pipette solution containing (in mM): 150 KCl, 1 CaCl2, 1 MgCl2, 5 EGTA and 10 HEPES (pH 7.2 was adjusted with KOH). Standard bath solution contained (in mM): 150 NaCl, 3 KCl, 2 CaCl2, 1 MgCl2, HEPES, 5.5 D-glucose and 20 10 sucrose (pH 7.4was adjusted with NaOH). The mean membrane resistance of hippocampal astrocytes in culture was 7.450.76 mega ohms (means.e.m.), and the series resistance was <30 m, which we monitored throughout all experiments. Recording pipettes were fabricated from borosilicate glass capillaries (World Precision Instruments) using a P-97 Flaming/Brown micropipette puller (Sutter Instruments).Whole-cell membrane currents were amplified by the Axopatch 200A. Currents were elicited by 1-s ramps from 150 mV to +50mV (from a holding potential of 70 mV). Data acquisition was controlled by signals between amplifier and computer. Data were sampled at 5 kHz and filtered at 2 kHz. Cell membrane capacitance was measured by using the membrane test protocol built into pClamp10.0. The calculated and measured junction potentials were 2.6mV and 2.5 mV, respectively.
[0163] Scratch Injury Assay
[0164] Using a sterile pipette tip, scratches were made on the monoconfluent cell layer of astrocytes. The plates were then rinsed with sterile PBS to remove cell debris and replaced with fresh cell culture media. At 0, 1 and 2 days after scratch, the area occupied by astrocytes were measured between the two edges of the scratch using Image J software.
[0165] Growing Capacity in Inhibitory Proteoglycan Environment
[0166] Gradient spot glass coverslips (12 mm) were prepared as described previously [Tom, V. J., Steinmetz, M. P., Miller, J. H., Doller, C. M., and Silver, J. 2004. Studies on the development and 22 behavior of the dystrophic growth cone, the hallmark of regeneration failure, in an in vitro model of the glial 23 scar and after spinal cord injury. J Neurosci 24:6531-6539.]. Briefly, coverslips coated with poly-L-lysine (PLL; Sigma-Aldrich, St. Louis, Mo.) and nitrocellulose were spotted with 2 ul of a solution of aggrecan (0.7 mg/mL; Sigma-Aldrich) and laminin (5 ug/mL; Biomedical Technologies, Stoughton, Mass.) in Ca++, Mg++-free Hank's Balanced Salt Solution (CMF; Invitrogen, Gaithersburg, Md.). The spots were allowed to dry and were then covered with laminin (5 ug/mL) in CMF and kept at 37 until just before cell plating (for 3 h). The laminin solution was removed before plating astrocytes (2104 cells/well in 24-well plate). Migratory potentials of astrocytes inward the gradient aggrecan/laminin spots were determined by the areas covered by astrocytes in the spots during 2 days.
[0167] Morphometric Assessments
[0168] To estimate morphological maturation, total fiber length and soma size (perimeter) of randomly selected TH+ DA neurons were measured using an image analysis system (Leica LAS). TH+ DA neuron images were also reconstructed using Neurolucida 360 (MicroBrightfield, Inc.). Complexity of the fibers in TH+ cells was further assessed using the Sholl test. The number of intersections of the neurite tree with increasing perimeters from the center of the soma was counted every 15 m up to a distance of 200 m. The critical value of the radius at which there is a maximum number of neurites was also determined in the Sholl test. Neurite length and branching of TH+ DA neurons were further assessed using time-lapse imaging as described below.
[0169] Time-Lapse Imaging of Neuron Axonal Elongation
[0170] VM-NPCs from the mouse embryos at E10.5 were seeded at 4.0104 cells in each well of a 24-well plate and cultured. CMs were treated from 3 days after differentiation and diluted with N2 medium (1:1, v:v) to induce neurite elongation. Phase contrast microscopic images were automatically taken using the IncuCyte ZOOM Live Cell Imaging System (Essen Bioscience, Ann Arbor, Mich., USA) every 2 h for 42 hours. Neurite lengths and branch points of the neurites were automatically analyzed with IncuCyte's NeuroTrack software.
[0171] Messenger RNA Expression Analysis
[0172] Total RNA was prepared using the Trizol Reagent (Invitrogen, Carlsbad, Calif., USA) through the RNA isolation protocol. cDNA synthesis was carried out using a Superscript kit(Invitrogen). Real-time PCR was performed on a CFX96 Real-Time System using iQ SYBR green supermix (Bio-Rad, Hercules, Calif., USA) and gene expression levels were determined relative to GAPDH levels. The Mouse Oxidative Stress RT.sup.2 Profiler PCR Array (cat. 330231 PAMM-065ZA) was used to profile the expression of 84 genes related to oxidative stress using a RT2 Profiler PCR ArrayR (Qiagen, Gaithersburg, Md., USA). Primer information is shown in Table 2.
TABLE-US-00002 TABLE2 Gene PrimerSequence(Sense/Antisense) AHR GTCCTCAGCAGGAACGAAAG CCAGGGAAGTCCAACTGTGT (SEQIDNO:1) (SEQIDNO:2) AQP4 CGGTTCATGGAAACCTCACT CATGCTGGCTCCGGTATAAT (SEQIDNO:3) (SEQIDNO:4) ARG1 TATCGGAGCGCCTTTCTCTA ACAGACCGTGGGTTCTTCAC (SEQIDNO:5) (SEQIDNO:6) BDNF GTGACAGTATTAGCGAGTGGG GGGTAGTTCGGCATTGC (SEQIDNO:7) (SEQIDNO:8) CCL17 AATGTAGGCCGAGAGTGCTG CATGCTTGTCTTTGGGGTCT (SEQIDNO:9) (SEQIDNO:10) CCL22 TTCTTGCTGTGGCACTTCAG CTTCTTCACCCAGAGCATCC (SEQIDNO:11) (SEQIDNO:12) COL6A2 ATGGACAGAAGGGCAAACTG CTTGCCTCCTTTCACTCCTG (SEQIDNO:13) (SEQIDNO:14) CXCL9 CTCATGGGCATCATCTTCCT TCAGCTTCTTCACCCTTGCT (SEQIDNO:15) (SEQIDNO:16) CXCL10 TCGTGCTGCTGAGTCTGAGT GGCTCACCGCTTTCAATAAG (SEQIDNO:17) (SEQIDNO:18) CXCL11 TATGATCATCTGGGCCACAA CCAGGCACCTTTGTCCTTTA (SEQIDNO:19) (SEQIDNO:20) EPO CCAGCCACCAGAGAGTCTTC TGCAGAAAGTATCCGCTGTG (SEQIDNO:21) (SEQIDNO:22) FGF8 TGTTGCACTTGCTGGTTCTC ACTCGGACTCTGCTTCCAAA (SEQIDNO:23) (SEQIDNO:24) FIZZ1 ATCTGCGTCTTCCTTCTCCA CAGTAGCAGTCATCCCAGCA (SEQIDNO:25) (SEQIDNO:26) FN1 GAAAGGCAACCAGCAGAGTC CTGGAGTCAAGCCAGACACA (SEQIDNO:27) (SEQIDNO:28) Foxa2 GCTCCCTACGCCAATATCAA CCGGTAGAAAGGGAAGAGGT (SEQIDNO:29) (SEQIDNO:30) Foxg1 GAACGGCAAGTACGAGAAGC TCACGAAGCACTTGTTGAGG (SEQIDNO:31) (SEQIDNO:32) GDNF CGCCCGCCGAAGACCACTCC GTCGAAGGCGACCGGCCTGC (SEQIDNO:33) (SEQIDNO:34) GFAP GCAGACCTCACAGACGTTGCT AGGCTGGTTTCTCGGATCTGG (SEQIDNO:35) (SEQIDNO:36) GLT1 ATCCTGGGAGCAGTATGTGG CTGACAGCCCTGTGATGAGA (SEQIDNO:37) (SEQIDNO:38) GPC4 AGTGCCTTCAGTGCTCGATT CTTCCCGTTCCAACAGTCAT (SEQIDNO:39) (SEQIDNO:40) GPC6 AGCCAGATACCTGCCTGAGA TCATTGCCATTGTACGCATT (SEQIDNO:41) (SEQIDNO:42) GPX3 ACCAATTTGGCAAACAGGAG AGCGGATGTCATGGATCTTC (SEQIDNO:43) (SEQIDNO:44) Hevin ATTGGCAACCAGAAGGACAC GGTTCTCACTCTCGCCAGTC (SEQIDNO:45) (SEQIDNO:46) IFN- GGTGGTGGTGAGCTACTGGT TTGAGCCTTCTGGATCTGCT (SEQIDNO:47) (SEQIDNO:48) IFN- CTGCCCTCTCCATCGACTAC ACCCAGTGCTGGAGAAATTG (SEQIDNO:49) (SEQIDNO:50) IL-10 CCTGCTCTTACTGGCTGGAG TGTCCAGCTGGTCCTTCTTT (SEQIDNO:51) (SEQIDNO:52) IL-12b ACCCTCACCTGTGACAGTCC TTCTTGTGGAGCAGCAGATG (SEQIDNO:53) (SEQIDNO:54) IL-13 ATCGAGGAGCTGAGCAACAT CGAGGCCTTTTGGTTACAGA (SEQIDNO:55) (SEQIDNO:56) IL-19 AGAAGGCATGAAGGCACAGT TCACGCAGCACACATCTACA (SEQIDNO:57) (SEQIDNO:58) IL-1R2 CATGGGAGATGCAGGCTATT ACACCTTGCACGGGACTATC (SEQIDNO:59) (SEQIDNO:60) IL-1RN GAAAAGACCCTGCAAGATGC GATGCCCAAGAACACATTCC (SEQIDNO:61) (SEQIDNO:62) IL-1 CTGTGACTCGTGGGATGATG GGGATTTTGTCGTTGCTTGT (SEQIDNO:63) (SEQIDNO:64) IL-2RA CCAGAGAGTGAGGCTTCCTG ACTCAGGAGGAGGATGCTGA (SEQIDNO:65) (SEQIDNO:66) IL-4 TCCTTACGGCAACAAGGAAC GTGAGTTCAGACCGCTGACA (SEQIDNO:67) (SEQIDNO:68) IL-6 ATGGATGCTACCAAACTGGAT TGAAGGACTCTGGCTTTGTCT (SEQIDNO:69) (SEQIDNO:70) iNOS CACCTTGGAGTTCACCCAGT ACCACTCGTACTTGGGATGC (SEQIDNO:71) (SEQIDNO:72) ITGM TTACCGGACTGTGTGGACAA AGTCTCCCACCACCAAAGTG (SEQIDNO:73) (SEQIDNO:74) ITG4 GAAGGAACTGCAGGTGAAGC GCGATGCGGATATCTCATTT (SEQIDNO:75) (SEQIDNO:76) Lmx1a CCCCAAAATCCGGAATTACT CTCAGGGTCAGCAAAAGGAG (SEQIDNO:77) (SEQIDNO:78) NF1A ACCCGAGTACCGAGAGGATT ACTGTGGGGACTTCACAAGG (SEQIDNO:79) (SEQIDNO:80) NT3 GGTCAGAATTCCAGCCGATGA GGCACACACACAGGAAGTGTC (SEQIDNO:81) (SEQIDNO:82) Nurr1 ACCCTCTTCTGGACACATGG GCCATCACCACAAGACACAC (SEQIDNO:83) (SEQIDNO:84) PAX6 AACAACCTGCCTATGCAACC ACTTGGACGGGAACTGACAC (SEQIDNO:85) (SEQIDNO:86) Pitx3 CCACCCTACGAGGAGGTGTA GGGCGGTGAGAATACAGGT (SEQIDNO:87) (SEQIDNO:88) PRNP GTGGCTACATGTTGGGGAGT GTGAAGTTCTCCCCCTTGGT (SEQIDNO:89) (SEQIDNO:90) S100 GGCGGCAAAAGGTGACCAGGA GCCCTCATGTCTGCCACGGG (SEQIDNO:91) (SEQIDNO:92) SERPIN ACCCGAGTACCGAGAGGATT ACTGTGGGGACTTCACAAGG B1B (SEQIDNO:93) (SEQIDNO:94) SHH AAAAGCTGACCCCTTTAGCC TGCACCTCTGAGTCATCAGC (SEQIDNO:95) (SEQIDNO:96) SOD3 GACCTGGAGATCTGGATGGA GTGGTTGGAGGTGTTCTGCT (SEQIDNO:97) (SEQIDNO:98) SPO1 TACCATGTCGGAGTGGATCA ACTCACCCCACTCAGTCACC (SEQIDNO:99) (SEQIDNO:100) SPO2 AGTGGAGCCAGACAGCATTT CTCCTGCTGCTTCGATCTCT (SEQIDNO:101) (SEQIDNO:102) TGF-B ATACGCCTGAGTGGCTGTCT TGGGACTGATCCCATTGATT (SEQIDNO:103) (SEQIDNO:104) Thbs1 CCAGTTCAACCAACGTCCTT TTGCGAATGCTGTCCTGTAG (SEQIDNO:105) (SEQIDNO:106) TNF- AGATGTGGAACTGGCAGAGG CCCATTTGGGAACTTCTCCT (SEQIDNO:107) (SEQIDNO:108) TXNIP GGCACACTTACCTTGCCAAT ACTAGGGGCAGATCGAGGAT (SEQIDNO:109) (SEQIDNO:110) Vimentin AGATCGATGTGGACGTTTCC CACACTGTCTCCGGTATTCGT (SEQIDNO:111) (SEQIDNO:112) Wnt1 CTTCGGCAAGATCGTCAACC GCGAAGATGAACGCTGTTTCT (SEQIDNO:113) (SEQIDNO:114) Wnt3a GAACGCGACCTGGTCTACTACG GTTAGGTTCGCAGAAGTTGGGT (SEQIDNO:115) (SEQIDNO:116) Wnt4 GCCACGCACTAAAGGAGAAG GGCCTTAGACGTCTTGTTCG (SEQIDNO:117) (SEQIDNO:118) Wnt5a AATAACCCTGTTCAGATGTCA TACTGCATGTGGTCCTGATA (SEQIDNO:119) (SEQIDNO:120) Wnt7a CGAGAGCTAGGCTACGTGCT CTGAGGGGCTGTCTTATTGC (SEQIDNO:121) (SEQIDNO:122) YM1 TCGTGAGAAGCTCATTGTGG AACCCATACATTGCCCTGAA (SEQIDNO:123) (SEQIDNO:124)
[0173] RNA-Seq Analysis
[0174] RNA sequencing was carried out in Macrogen (Seoul, Korea). After trimming reads with a quality score less than 20 using FastQC and checking the mismatch ratio using Bowtie, all RNA-seq data were mapped to the mouse reference genome (GRCm38/mm 10) using STAR [Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T. R. 2013. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29:15-21.]. To measure expression levels of all 46,432 annotated genes, 107,631 transcripts, and 12 76,131 protein-coding (mRNA) records in the mouse genome (based on NCBI RefSeq annotations Release 105: February 2015), we counted reads mapped to the exons of genes using Htseq-count and calculated the Fragments Per Kilobase of exon per Million fragments mapped (FPKM) value. Quantile normalization was performed to reduce technical global bias of expression between groups [Bolstad, B. M., Irizarry, R. A., Astrand, M., and Speed, T. P. 2003. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19:185-193.]. All data have been deposited into GEO database (GEO: 17 GSE106216).
[0175] Determination of Intracellular ROS and Glutathione Levels
[0176] For measurement of intracellular ROS levels, cells were incubated with 10 M of 5-(and-6)-chloromethyl-2,7-dichlorodihydro-fluorescein diacetate [CM-H2DCF-DA (herein referred to as DCF) (Invitrogen)] for 10 min. The cells were then washed with D-PBS (in mM: 2.68 KCl, 1.47 KH2PO4, 136.89 NaCl, and 8.1 Na2HPO4), and fluorescence and phase-contrast images were taken using an Olympus microscope (IX71, Hicksville, N.Y., USA). Determination of intracellular glutathione levels was requested and carried out by Celltoin (Seoul, Korea).
[0177] DA Release Assay
[0178] The pre-synaptic activity of DA neurons was determined by measuring the levels of DA neurotransmitter released in the differentiated VM-NPC cultures. Media incubated for 24 hrs (differentiation day 12-13) was collected and used to determine the DA level using an ELISA kit (BA E-5300, LDN). In addition, DA release evoked by membrane depolarization was estimated by incubating the cultures (at differentiation day 12) in fresh N2 media in the presence or absence of 56 mM KCl for 30 min. The evoked DA release was calculated by subtracting the DA release without KCl from the DA level with KCl.
[0179] Glutamate Uptake
[0180] Cells were washed twice in Tissue Buffer (5 mM Tris, 320 mM sucrose, pH 7.4) and exposed to 10 uM glutamate in either Na+-containing Krebs buffer (120 mM NaCl, 25 mM NaHCO3, 5 mM KCl, 2 mM CaCl2, 1 mM KH2PO4, 1 mM MgSO4, and 10% glucose) or Na+-free Krebs (120 mM choline-Cl and 25 mM Tris-HCl) for 10 min at 37 C. Uptake was stopped by placing the cells on ice and washing them twice with Wash Buffer (5 mM Tris/160 mM NaCl, pH 7.4). Cells were collected and homogenized in 100 ul of assay buffer and the amount of glutamate in the cell homogenates was measured using a glutamate assay kit (Abcam, Cambridge, Mass., USA, ab83389). Na+-dependent uptake was determined by subtracting Na+-free counts from total counts in the presence of Na+.
[0181] Confirmation of -Synuclein Aggregation After Co-Culture of Astrocytes with -Synuclein-Overexpressing DA Neurons
[0182] Alpha-synuclein-overexpressing ventral midbrain DA neurons obtained by differentiation of ventral midbrain neural stem cells (VM-NPC) transduced with -synuclein-overexpressing lentiviruses were cultured by cell culture. Here, -synuclein-overexpressing DA neurons were co-cultured with (1) astrocytes isolated from the cortex (Ctx-astrocytes) or (2) astrocytes isolated from the ventral midbrain (VM-astrocytes), or with neural stem cells isolated from the cortex (Ctx-NPCs) as the control. In addition, during differentiation, pre-formed fibrils (PFF), that is, an -synuclein aggregate, was treated to induce -synuclein aggregation, and 20 days after differentiation, the -synuclein aggregation was identified by immunocytochemistry using thioflavin S (staining for detection of protein aggregation; Sigma Aldrich) and an -synuclein antibody and by western blotting, and observed through a change in protein size.
[0183] Confirmation of Intercellular Transmission of -Synuclein Aggregate by Factor Secreted from Astrocytes
[0184] Neuroblastoma-derived SH-SY5Y cells (provided by Prof. Sang-Myun Park of Ajou University) were used for overexpression of -synuclein and were co-cultured with non-overexpressed SH-SY5Y cells, followed by treatment of (1) astrocytes isolated from the cortex (Ctx-astrocytes), (2) astrocytes isolated from the ventral midbrain (VM-astrocytes), and neural stem cells isolated from the cortex (Ctx-NPCs) as the control with conditioned media to confirm -synuclein transmission through the fluorescence of -syn-GFP by immunocytochemistry using antibodies.
[0185] Confirmation of Intercellular -Synuclein Aggregation Effect by Factor Secreted from Astrocytes
[0186] Alpha-synuclein was overexpressed in SH-SY5Y cells, co-cultured with each of -syn-GFP and -syn-mCherry, and Ctx-astrocytes, VM-astrocytes and the control (Ctx-NPCs, which are neural stem cells isolated from the cortex) were treated with conditioned media to confirm -synuclein aggregation by determining expression levels of GFP and mCherry.
[0187] Analysis of Environment Improvement Effect by Human VM Astrocytes
[0188] Human VM NPCs and human VM astrocytes were cultured and injected into the left and right hemispheres, respectively, to observe and analyze an environment improvement effect by human astrocytes by immunohistochemistry for an M2 marker. Each type of cells (3 l, 1.510.sup.5 cells/l) were injected into each of two sites in the striatum (coordinates in AP, ML and V relative to bregma and dura: [1] 0.07, 0.30, 0.55; [2] 0.10, 0.40, 0.50; incision bar set at 3.5 mm below zero) for 10 minutes under of Zoletil (100 l/100 g; 50 mg/ml) mixed with of Rompun (100 l /100 g; 23.32 mg/ml) according to transplantation and histological procedures described above. Hereinafter, immunohistochemistry was performed according to transplantation and histological procedures described above.
[0189] [Results]
[0190] Immature and Brain Region-Specific Identities of Astrocytes Cultured from the Cortex and VM of Mouse Pups
[0191] The aim of the present invention is to improve NPC transplantation efficacy by utilizing neurotrophic actions of astrocytes. Based on brain region-dependent diversity of astrocytes and their potential region-specific roles, we cultured astrocytes from two brain regions including the classical non-dopaminergic brain region cortex (Ctx) and dopaminergic ventral midbrain (VM).
[0192] Along with high mRNA expression of astrocytic markers (
[0193] Along with abundant cells immunoreactive for the immature astrocytic markers GLAST and Sox2, the expression levels of the immature astrocytic genes (Sox2, Nestin, GLAST, and Vimentin) in the RNA-sequencing (RNA-seq) data were high (fragments per kilobase of exons per million reads (FPKM): 94-4180,
[0194] Interestingly, the current and conductance values of astrocytes cultured from VM at DIV14 were further lower compared to the cultured Ctx-astrocytes at DIV14, and those of VM-astrocytes increased after a longer culture period (at DIV35)(
[0195] Of note, it has been shown that transplanted immaturebut not matureastrocytes exert neurotrophic support in the injured CNS. In addition to a wound healing capacity superior to astrocytes at DIV33-35 (
[0196] Based on these findings, the following experiments were done using astrocyte cultures at DIV7-14, unless otherwise noted.
[0197] Positional identity, a fundamental organizing principle governing the generation of neuronal subtype diversity, is relevant to astrocyte diversification. Consistently, Ctx-astrocytes had high levels of expression of cortical region-specific genes (Emx2, Lhx2, FoxG1, and Pax6), whereas expression of the midbrain-specific makers (Foxa1/2, Lmx1a/b, and Ent1/2) was enriched in VM-astrocyte cultures (
[0198] This finding is consistent with the detection of Nurr1 expression not only in the midbrain, but also in cortical layer VI and hippocampus. These findings collectively verify immature astrocytic- and brain region-specific identities of the astrocyte cultures used in this study.
[0199] VM-Astrocytes Promote the Differentiation of NPCs into mDA Neurons with Enhanced Neuronal Maturity, Expression of Midbrain-Specific Markers, and Resistance Against a Toxic Stimulus
[0200] In order to attain therapeutic efficacy by NPC transplantation in PD, grafted NPCs must undergo differentiation into mDA neurons, neuronal maturation with synapse formation, and survival of the grafted mDA neurons in the hostile environment of the grafted brain.
[0201] We first assessed this series of the cellular events in the absence or presence of Ctx- or VM-astrocytes in vitro.
[0202] To this end, NPCs isolated from rodent embryonic VMs (mouse at E10.5 or rat at E12) were expanded in vitro for 4 days, harvested and mixed with the Ctx-astrocytes or VM-astrocytes at a cell number ratio of 2:1 VM-NPCs to astrocytes. The mixed cells were plated and differentiation of VM-NPCs was directly induced in serum-free N2 medium (schematized in
[0203] Since cell differentiation is affected by cell density, VM-NPCs in the control cultures were mixed with non-dopaminergic Ctx-NPCs and we determined that cell density (confluence) among the tested groups was not largely different during the assays.
[0204] When DA neuron differentiation was assessed at differentiation day 6 by the number of cells positive for tyrosine hydroxylase (TH), a key enzyme in DA biosynthesis, the number of TH+ cells was significantly greater in the cultures mixed with astrocytes compared to control cultures mixed with Ctx-NPCs (
[0205] In images captured by a confocal microscope, puncta positive for the synaptic vesicle-specific markers SV2, synapsin, and Bassoon were more abundantly localized in the neurites of the TH+ DA neurons differentiated with astrocytes, and the puncta densities were greatest in those co-cultured with VM-astrocytes (
[0206] Along with significantly more vGlut2+/PSD95+ clusters on TH+ cells co-cultured with VM-astrocytes than those with Ctx-astrocytes, the glutamatergic synapses on spine-like structures were also found only with VM-astrocytes, further indicating more mature neuronal morphology with VM-astrocytes. GABAergic inhibitory (vGAT+/Gephyrin+) synaptic puncta were also more abundantly localized in the fibers of TH+ DA neurons cultured with astrocytes (
[0207] We further observed that DA release, especially when evoked by KCl-induced depolarization, was significantly promoted in the cultures differentiated with astrocytes; the pre-synaptic DA release promoted by astrocytes was greater in the cultures with VM-astrocytes than in the cultures with Ctx-astrocytes (
[0208] However, we and others have recently shown that the expression of midbrain-specific markers in mDA neurons is largely affected by in vitro and in vivo environments, and thus easily lost during passages, long after differentiation in vitro and after transplantation in vivo.
[0209] Indeed, expression of Foxa2, Nurr1, and Lmx1a was detected only in 64, 44, and 46% of TH+ cells at day 12 of differentiation, respectively (
[0210] In addition, TH+ cells in the cultures mixed with astrocytes survived the toxin treatment and displayed healthy neuronal morphology with extensive neurite outgrowths, while most of the surviving TH+ cells in the control cultures had blunted or fragmented neurites (
[0211] Collectively, these findings suggest that cultured astrocytes facilitate VM-NPC differentiation towards authentic midbrain-type DA neurons which are morphologically, synaptically, and functionally mature and are resistant to toxic insults. In addition, our data show that astrocytes of VM-origin are superior to astrocytes from the Ctx in terms of their trophic actions on mDA neuron differentiation and survival.
[0212] Paracrine Manner of the Observed Astrocytic Actions
[0213] The observed astrocytic actions could be mediated by factors released from the astrocytes and/or cell-cell contact signaling. To test the possibility of paracrine effects, the medium was conditioned in the astrocyte cultures (or differentiated Ctx-NPC cultures as the control) for 2 days, and the conditioned medium (CM) was added to undifferentiated VM-NPC cultures (
[0214] We next sought to identify the paracrine factors responsible for the astrocyte-mediated neurotrophic actions. Consistent with neurotrophic factor secretion from astroglial cells, cultured astrocytes expressed elevated levels of mRNAs for various neurotrophic factors (
[0215] Of note, the expression of glial cell-derived neurotrophic factor (GDNF), sonic hedgehog (SHH), and fibroblast growth factor 8 (FGF8) was greatly elevated in VM-astrocytes compared to Ctx-astrocytes or control Ctx-NPCs. GDNF has physiologic neurotrophic roles specific for mDA neurons, and SHH, by establishing an auto-regulatory loop with Foxa2, is one of the most important factors in mDA neuron development and survival. The cooperative actions of FGF8 and SHH are critical for mDA neuron development and thus this cytokine combination is commonly being used for in vitro mDA neuron pattering from stem cells. In addition, crucial roles for Wnt/-catenin signaling from mDA neurogenesis to regeneration, and secretion of Wnt1 and Wnt5a proteins from VM-astrocytes have been reported.
[0216] Consistently, cultured VM-astrocytes abundantly expressed not only Wnt cytokines (Wnt1, 4, 5a), but also spondin-2 (SPO-2) (
[0217] In addition, cultured astrocytes exhibited an elevated expression of thrombospondin-1 (THBS-1), Glypicans (GPC) 4 and 6, and secretory extracellular matrix (ECM) proteins which promote synapse formation (53, 54); THBS-1 mRNA levels were higher in VM-astrocyte cultures than in Ctx-astrocytes, suggesting that these factors were responsible for the synaptic maturation of DA neurons in the presence of VM-astrocytes (
[0218] Differentially Expressed Genes Among the Differentiated NPCs, Ctx-Astrocytes, and VM-Astrocytes
[0219] To gain further molecular insight into the observed astrocyte functions, we performed RNA-sequencing (RNA-seq) analysis of the differentiated Ctx-NPCs (control), Ctx-astrocytes and VM-astrocytes used in the co-culture and CM experiments.
[0220] The genes that are differentially expressed (DEGs) in Ctx-astrocytes compared to differentiated Ctx-NPCs (FPKM>1, log 2>1) significantly overlapped with DEGs in VM-astrocytes compared to differentiated Ctx-NPCs (N-1, Chi square=9059.4, df=1, P<2.2e-16,
[0221] The gene sets enriched in cultured astrocytes (vs control NPCs) and VM-astrocytes (vs Ctx-astrocytes) were further confirmed in gene set enrichment analysis (GSEA) (
[0222] Cell adhesion/ECM that was annotated to one of the top ranked ontologies is of prime interest due to the importance of cell-to-cell and cell-to-ECM contacts in stem cell behaviors and regenerative processes in damaged tissues. The heat-map for the cell adhesion/ECM molecules exhibiting increased levels of expression in VM-astrocytes (compared to Ctx-astrocytes and/or control NPCs) is shown in
[0223] In addition, tenascin, another upregulated gene in VM-astrocytes, has been reported to augment grafted DA neuron attachment and survival after brain injury and transplantation.
[0224] Chondroitin sulfate proteoglycans (CSPGs) inhibit axonal regeneration and neurogenesis. Notably, the expression of Neurocan (CSPG3) and Brevican (CSPG7) was greatly down-regulated in the VM-astrocyte cultures compared to Ctx-astrocyte and control NPC cultures (
[0225] The enrichment of DEGs in the category of immune/inflammatory response in astrocytes compared to control NPCs is not surprising considering that astrocytes are commonly believed to be a cell-type mediating brain inflammation.
[0226] Expression of pro-inflammatory cytokine mRNAs were elevated in astrocyte cultures, and interestingly levels were higher in VM-astrocytes than Ctx-astrocytes (
[0227] Pro-inflammatory cytokines can trigger cellular defense mechanisms and are frequently linked to enhanced neuronal differentiation and survival (63-66). Despite these positive aspects, the common idea is that pro-inflammatory cytokines establish a cytotoxic inflammatory milieu. Along with the pro-inflammatory gene expression increase, gene expression of anti-inflammatory and neurotrophic glial markers also increased in the astrocyte cultures (
[0228] For example, the gene with the top ranked expression enriched in the VM-astrocyte cultures was IL-19, an anti-inflammatory cytokine from the IL-10 family. The mRNA expression levels of the other anti-inflammatory markers arginase 1 (Arg1, an enzyme inhibiting NO biosynthesis) and IL-1 receptor antagonist (IL1RN) were much higher in the cultured VM-astrocytes than in Ctx-astrocyte and control NPC cultures: FPKMs of ARG1 were 49.9, 5.5, and 0.03 and FPKMs of IL1RN were 14.0, 1.4, and 0.04 for VM-astrocytes, Ctx-astrocytes, and control NPCs, respectively (
[0229] Of note, along with the increase in type I IFN expression in qPCR analyses (
[0230] The increase in expression levels of pro- and anti-inflammatory genes was further confirmed by qPCR analyses (
[0231] The expression of multiple antioxidant genes was upregulated in the cultured astrocytes compared to control NPCs (
[0232] Another neuroprotective mechanism of astrocytes occurs via clearance of glutamate-induced toxicity (71). Along with enriched expression of the glutamate transporters GLAST and GLT-1 in cultured astrocytes (
[0233] Forced Nurr1+Foxa2 Expression Further Potentiates the Neuroprotective Actions of VM-Astrocytes
[0234] Next, we investigated if forced Nurr1+Foxa2 expression in VM-astrocytes further promotes the astrocyte-mediated dopaminotrophic actions.
[0235] VM-astrocytes were transduced with Nurr1+Foxa2-expressing lentiviruses or mock viruses (control). The VM-NPCs harvested were co-cultured with the transduced astrocytes and the NPC behaviors associated with their therapeutic capacity upon transplantation were assessed (
[0236] However, presynaptic DA neuronal functionality, as estimated by DA neurotransmitter release, was significantly greater in the cultures differentiated in the presence of N+F-astrocytes than in cultures differentiated with the control-astrocytes (
[0237] In addition, differentiated TH+ DA neurons in the presence of N+F-astrocytes were more resistant to the toxic insult induced by H.sub.2O.sub.2 treatment than differentiated TH+ DA neurons co-cultured with the control-astrocytes (
[0238] In RNA-seq analysis of the N+F-astrocytes compared to control-astrocytes, the top 10 ranked ontologies enriched by the DEGs included immune/inflammation, response of wound healing, and cell adhesion (
[0239] In addition, when we performed gene set analysis with genes with down-regulated expression in N+F-astrocytes vs. control-astrocytes (log 2<1), 4 out of the top 5 ontologies were related to immune/inflammation (
[0240] Specifically, decreased mRNA levels of pro-inflammatory cytokines (IL-1, IL-6, TNF-, and iNOS) and myelin-associated proteins (MBP, MAG, and MOG) were manifested in the RNA-seq data (
[0241] Further examination of the RNA-seq data identified multiple anti-oxidant enzymes with upregulated gene expression in N+F-astrocytes (
[0242] Consistent with the upregulated secretory ROS scavenging factors SOD3 and GPX3 (
[0243] These findings collectively indicated that the enhanced ROS scavenging capacity in VM-astrocytes by Nurr1+Foxa2 also contributed to N+F-astrocyte-mediated neuroprotective actions. Glutamate uptake activity, however, was indistinguishable between control and N+F-VM-astrocytes (
[0244] Co-Grafting of Astrocytes Potentiates the Cell Therapeutic Effects of VM-NPC Transplantation via Establishing a Neurotrophic Host Brain Environment
[0245] Although our in vitro data clearly supported the neurotrophic actions of cultured astrocytes, it remains to be identified if similar astrocyte-mediated effects occur after transplantation in the host brain in vivo, where the grafted cells are inevitably exposed to hostile inflammatory/immunogenic environments and interact with endogenous cells such as glia, neuronal cells, and peripheral blood cells that may enter through the disrupted blood-brain barrier (BBB) during the cell injection process. Of note, it has been reported that glia can be reactivated into the detrimental phenotype during a delayed injury phase, raising concerns that grafted astroglia may also convert into the harmful phenotype after transplantation. Thus, our first round of transplantation experiments was performed to determine if transplantation of cultured astrocytes could establish a neurotrophic environment.
[0246] Similar to the in vitro data, the expression of neurotrophic factors (GDNF, NT3, SHH, Wnt1, 3, 5), trophic ECM proteins (COL6A2, FN1, THBS-1), and antioxidant proteins (GPX3 and SOD3) was upregulated in the striatum transplanted with VM-astrocytes, compared with the striatum grafted with control Ctx-NPCs (or Ctx-astrocytes) at 1 month post-transplantation (
[0247] Notably, in contrast to the in vitro findings, the expression of pro-inflammatory phenotype genes did not increase, and some genes (iNOS, IL-1, CXCL11) were down-regulated in brains grafted with VM-astrocytes compared to brains grafted with control NPCs (
[0248] It is also possible that endogenous microglia/astrocytes were activated into the anti-inflammatory/neurotrophic phenotype due to their interaction with grafted VM-astrocytes. We further confirmed the astrocyte grafting effects by immunohistochemical analyses (
[0249] The phenotype transition by N+F-VM-astrocyte transplantation was further clarified in immunohistochemical analyses exhibiting downregulated expression of pro-inflammatory/cytotoxic phenotype markers and upregulated expression of anti-inflammatory/neurotrophic phenotype markers in the brains transplanted with N+F-VM-astrocytes compared to brains grafted with control VM-astrocytes (
[0250] Taken together, these findings indicate that transplantation of cultured VM-astrocytes could establish a neurotrophic brain environment, and that Nurr1+Foxa2 expression in the donor astrocytes potentiates the astrocyte transplantation effect.
[0251] We ultimately assessed if co-grafting astrocytes could improve cell therapeutic outcomes in PD. VM-NPCs mixed with cultured VM- or Ctx-astrocytes (or Ctx-NPCs as control) were intrastriatally transplanted into a hemi-parkinsonian rat model and PD-related behaviors were assessed for 6 months after transplantation.
[0252] An amphetamine-induced rotation test revealed only a minor reduction in rotation scores compared to pre-transplantation values in PD rats co-grafted with VM-NPCs+Ctx-NPCs (control), but greater behavioral recovery was achieved by co-grafting with astrocytes (
[0253] Especially, co-grafting of N+F-VM-astrocytes along with VM-NPCs resulted in an almost complete recovery in the rotation scores (>95% reduction in rotation score from 3 months post-transplantation, n=6).
[0254] We also assessed PD behaviors using non-pharmacological assays at 6 months post-transplantation.
[0255] Similar patterns of behavioral recovery among the animal groups were observed in the step adjustment (
[0256] Consistent with the data from the in vitro co-culture and CM experiments as well as the behavioral assays, histologic analyses performed 6 months post-transplantation exhibited formation of a much larger TH+ cell graft in rats co-transplanted with astrocytes than with control NPCs (
[0257] Surprisingly, the midbrain-specific markers Nurr1 and Foxa2, expression of which are easily lost in donor cells after transplantation, were faithfully co-localized in TH+ DA neurons in the grafts generated by astrocyte co-transplantation, especially by co-grafting with N+F-VM-astrocytes, even 6 months after transplantation (
[0258] The Iba1+ microglia were ramified with a resting or neuroprotective morphology, indicating that the neighboring and covering of the grafted DA neurons was protective. These findings collectively indicated that co-transplantation of VM-NPCs with astrocytes, especially with N+F-VM-astrocytes, ensured a long-term engraftment of mature authentic mDA neurons via astrocytic actions to improve host brain environments (schematized summary is shown in
[0259] The Transmission of -Synucleinopathy from the Host Brain of a Parkinsonian Patient to the Grafted Cells Through Cell Transplantation Had Become a Huge Issue in Cell Transplantation Therapy for PD.
[0260] Normally, -synuclein is a protein expressed in neuronal cells and playing a normal role of transmitting nerve signals, etc., but under circumstances in which an abnormal pathologic aggregate (called a Lewy body) is formed due to an increase in amounts of -synuclein or under a pathologic environment, it becomes the cause of a neurodegenerative disorder such as PD. Therefore, the clearance of -synucleinopathy due to the -synuclein aggregate is a solution to the prevention and treatment of PD.
[0261] However, the -synuclein aggregation has a characteristic of cell-to-cell transmission like a prion, and it has been observed in the brain of a patient with PD after death that -synuclein had transmitted from a host to a graft.
[0262] The inventors found from RNA-Seq analysis that the expression of genes related to the inhibition and clearance of -synuclein aggregation (INF-alpha and INF-beta) was increased in astrocytes, particularly, VM-astrocytes (VM-Ast) [
[0263] In addition, it was found that genes related to phagocytosis and autophagy are highly expressed in VM-astrocytes (
[0264] It has been known that inflammation promotes pathologic protein aggregation, and that anti-inflammatory, antioxidative and neurotrophic materials inhibit the formation of a pathologic protein aggregate, and the inventors discovered that neurotrophic, antioxidative and anti-inflammatory actions are highly increased in the proximity of a site engrafted with VM-astrocytes (
[0265] Based on the result of the above-mentioned research, it was investigated whether the occurrence of -synucleinopathy is prevented in grafted cells by the inhibition and clearance of -synuclein aggregation and inhibition of intercellular transmission when ventral midbrain neural stem cells and astrocytes are co-grafted into a mouse PD model experiencing -synucleinopathy.
[0266] 1) Confirmation of Effect of Co-Culture of Astrocytes with -Synuclein-Overexpressing DA Neurons on Reduction in -Synuclein Aggregation
[0267] Compared with the control, when DA neurons were co-cultured with astrocytes, particularly, VM-astrocytes, -synuclein aggregation was reduced, as confirmed by -synuclein/thioflavin S immunocytochemistry (thioflavin S: staining for detection of pathologic protein aggregates) and western blotting (
[0268] 2) Inhibitory Effect on Intercellular -Synuclein Transmission and Aggregation Due to Factor Secreted from Astrocytes
[0269] It was confirmed that a conditioned medium of astrocytes, particularly, VM-astrocytes, inhibited -synuclein transmission to neuronal cells more effectively than the control and cortex astrocytes (
[0270] 3) Effect of Factor Secreted from Astrocytes on Decomposition of -Synuclein Aggregate
[0271] By treating ventral midbrain astrocytes with PFF and then monitoring the remaining PFF, it was confirmed that -synuclein aggregates were decomposed (
[0272] 4) Effect of Co-Grafting of VM-Ast into -Synucleinopathy-Induced Mouse PD Model on Inhibition of -Synuclein Aggregation in Grafted Cells
[0273] Consequently, it was observed that a graft obtained by co-grafting of ventral midbrain neural progenitor cells (VM-NPC) and ventral midbrain-derived astrocytes (VM-Ast) had more DA neurons and a larger size than the graft in the control transplanted only with ventral midbrain neural progenitor cells (VM-NPC), and it was confirmed that whereas p-syn (aggregation form of -syn) neither permeated into the graft obtained by co-grafting nor was it observed in the proximity of the graft, p-syn was observed in the control transplanted only with ventral midbrain neural progenitor cells (VM-NPC) (
[0274] In addition, it was also observed that thioflavin S, which enables the observation of a protein aggregation form, is present in the proximity without being able to permeate into the graft in the case of the astrocyte group like p-syn, whereas in the control, thioflavin S permeated into the graft such that the DA neurons died (
[0275] To see that such an effect is caused by astrocytes, staining with GFAP, an astrocyte marker, and thioflavin S showed that many astrocytes are present in the graft formed with ventral midbrain neural progenitor cells (VM-NPC) and ventral midbrain-derived astrocytes (VM-Ast), and that whereas thioflavin S was not observed in such astrocytes, in the control transplanted only with ventral midbrain neural progenitor cells (VM-NPC), GFAP was hardly observed and thioflavin S was expressed in many cells of the graft (
[0276] 5) Effect of Co-Grafting with Human VM-Ast on Inhibition of Inflammation of Grafted Cells (Graft) in Inflammation-Induced Rat PD Model
[0277] To confirm possibility of anti-inflammatory effect of astrocytes, inhibition of inflammation of grafted cells (graft) after grafting with astrocytes was monitored with transplantation of human ventral midbrain neural progenitor cells (VM-NPC) to the left side of the rat striatum and human ventral midbrain-derived astrocytes (VM-Ast) to the right side thereof. It was confirmed that in human ventral midbrain-derived astrocytes (VM-Ast), inflammatory responses [CD11b (M1 type staining)/Iba1 (microglia staining)] are reduced compared with human ventral midbrain neural progenitor cells (VM-NPC) (
[0278] 6) Confirmation of Effect of Co-Grafting of VM Ast on Survival and Maintenance of Stable DM Neurons in -Synucleinopathy-Induced Mouse PD Model
[0279] It was confirmed that, in graft co-grafted with human VM-NPCs and VM-Asts, more DM neurons survived and well maintained than the control single-grafted with VM-NPCs, and a larger graft is formed (
[0280] [Discussion]
[0281] It has long been suggested that after transplantation, the host brain becomes hostile to grafted cells, and this detrimental host brain environment is mainly responsible for unsatisfactory cell transplantation therapeutic results with poor neuronal engraftment. Nevertheless, targeting the host brain to improve cell therapeutic effects has only been addressed in a few studies.
[0282] Furthermore, none of these studies used an approach to fundamentally correct inflammatory cytotoxic host brain environments. Based on the physiologic neurotrophic functions of astrocytes, utilization of this cell type is a potential strategy to modify pathologic brain environments.
[0283] However, few studies have examined developing an astrocyte-based therapy for neurologic disorders, mainly because of the potential reactivation of this cell type into a detrimental/neurotoxic phenotype in diseased brains.
[0284] However, cumulative studies have demonstrated that cultured astrocytes generally exhibit immature properties as verified in
[0285] Based on these findings, we attempted co-grafting with astrocytes to attain an improvement in therapeutic efficacy of cell transplantation for PD.
[0286] As shown in
[0287] To determine if microglia contamination affects neurotrophic functions of astrocytes, we generated microglia-free astrocyte cultures by modifying the culture protocol (including one round of mild trypsin treatment step, see Materials & Methods).
[0288] mDA neuronal differentiation, morphologic maturation, and toxin resistance promoted by CM derived from pure astrocyte cultures were comparable (or slightly lower) with those promoted by the CM from the astrocyte cultures containing the minor microglia population (
[0289] Whether further, higher levels of microglia contamination are detrimental or beneficial remains to be identified. Like neurons, astrocytes are also thought to have regional identities and play region-specific roles. Thus, astrocytes cultured from the VM neurogenic niche were expected to be dopaminotrophic. Previous studies have consistently demonstrated that astrocytes derived from the VM facilitate DA neuron differentiation and survival via secretion of GDNF, FGF2, and Wnts.
[0290] In this study, we carried out further systematic and comparative analyses both in vitro and in vivo after transplantation to test the dopaminotrophic functions of cultured VM-astrocytes, in comparison with astrocytes cultured from the non-dopaminergic region of the cortex, and the effects of priming the VM-astrocytes with Nurr1+Foxa2, which has potentiated the neurotrophic functions of glia.
[0291] In the niche established by the VM-astrocytes, grafted NPCs efficiently differentiated into morphologically, synaptically, and functionally mature mDA neurons and the differentiated mDA neuronal cells survived for long periods after transplantation while maintaining expression of midbrain-specific markers.
[0292] The expression of midbrain-specific factors such as Nurr1 and Foxa2 is a critical indicator for successful mDA neuron engraftment, as the expression of these genes is required for mDA neuron survival, function, and phenotype maintenance.
[0293] Considering that the expression of midbrain factors is easily lost in stressful conditions, sustained expression of midbrain markers in the presence of astrocytes is likely to be attained by the observed astrocyte actions which change the hostile inflammatory host brain milieu into a neurotrophic environment.
[0294] Mechanisms underlying the astrocyte-mediated dopaminotrophic niche included secretion of the reported neurotrophic factors, as well as other cytokines such as SHH and FGF8, which had much greater levels of expression in cultured VM-astrocytes than Ctx-astrocytes. It is likely that the expression of SHH and FGF8 is regulated by the midbrain-specific transcription factors Foxa2 and Lmx1a, respectively, expressions of which were maintained at high levels in cultured VM-astrocytes, in a positive regulatory loop in VM-astrocytes.
[0295] In addition, VM-astrocytes exhibited increased synthesis of various cell-cell contact and ECM molecules including synaptogenic ECMs thrombospondins and glypicans, and enhanced glutamate clearance activity, both of which were superior to cortex-derived astrocytes. Engineering of the midbrain-specific factors Nurr1+Foxa2 in the VM-astrocytes further improved their neuroprotective action mainly by reducing inflammation as well as by enhancing ROS scavenging activity. Based on the observed Nurr1+Foxa2 functions, priming these factor expressions in astrocytes is highly suggested prior to co-grafting. However, currently available methods for exogene expression including lentiviral transduction used in this study, are more and less toxic to cells, and thus may reduce naive cellular functions.
[0296] Indeed, a side-by-side comparative analysis has shown that DA release and resistance of DA neurons against H.sub.2O.sub.2 toxin were significantly lower in the mDA neuron cultures treated with the CM prepared in mock-transduced VM-astrocytes than those treated with CM from non-transduced VM-astrocytes, along with decreased neurotrophic factor expressions in the viral transduced astrocytes (
[0297] Forced Nurr1+Foxa2 expression effects were dramatic and sufficiently overcame the viral transduction-mediated reduction of astrocyte functions and showed significantly greater neurotrophic actions than the non-transduced control in all the assays. Nevertheless, development of an exogene expression system with minimal side effects is required to maximize the Nurr1+Foxa2-mediated trophic actions.
[0298] The effects of astrocyte co-grafting in this study were dramatic, with almost complete behavioral restoration and extensive DA neuron engraftments co-grafted for at least 6 months after transplantation in PD rats.
[0299] 3,762 and 3,916 TH+ DA neuronal cells per animal were detected in PD rats co-grafted with VM-astrocytes and N+F-VM-astrocytes, respectively (without any modifications to the donor cells) 6 months after transplantation, strongly indicating the necessity of a host brain modification strategy, especially for long-term donor cell survival and therapeutic efficacy.
[0300] In conclusion, we propose astrocyte co-grafting as a future option in cell therapeutic approaches for PD.
[0301] In addition, grafting astrocytes alone could exert therapeutic efficacy by improving brain environments, in which remaining endogenous mDA neurons in the SN extend axonal outgrowths to release DA into the striatum, and striatal GABAergic interneurons are rescued. Astrocytes exert pan-neuronal trophic actions, in which total neuronal yields including those of glutamatergic and GABAergic neurons are also promoted by factors released from cultured astrocytes (
[0302] Thus, the astrocyte co-grafting strategy could be utilized to treat other CNS disorders.
[0303] In addition, according to the in vitro and in vivo experiments of co-grafting of ventral midbrain astrocytes and dopamine neural progenitor cells, it was confirmed that a decrease in the transmission, aggregation and clearance of -synuclein is affected by VM-astrocytes.
[0304] That is, in the case of -synucleinopathy, through co-grafting of ventral midbrain-type dopamine neural progenitor cells and astrocytes, -synuclein aggregation and clearance, and transmission to grafted DA neurons were prevented, allowing DA neurons to survive and be maintaned. Therefore, the co-grafting will be an important solution for cell transplantation therapy for PD.
[0305] In the present invention, it was shown through animal PD models that, for at least 6 months after transplantation, the co-grafting of ventral midbrain-derived astrocytes with dopamine neural progenitor cells significantly improved the outcomes of cell transplantation therapy for PD models.
[0306] Particularly, it shows that the overexpression of Nurr1 and Foxa2 in astrocytes further promotes a neurotrophic action of grafted astrocytes in cell-based therapies. It is expected from this result that the astrocytes co-grafted with the dopamine neural progenitor cells will be very useful in the prevention or treatment of a neurodegenerative disorder.
[0307] While the invention has been shown and described with reference to certain exemplary embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.