Fungal cellobiohydrolases

10329548 ยท 2019-06-25

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed herein are chimeric Cel7A polypeptides useful for producing biofuels from lignocellulosic biomass.

Claims

1. A non-naturally occurring, mutated Cel7A polypeptide having increased hydrolase activity when compared to the naturally occurring Cel7A polypeptide from which the non-naturally occurring mutated Cel7A polypeptide was derived; and wherein said mutated Cel7A polypeptide has an amino acid sequence identity of at least 85% of SEQ ID NO: 2.

2. The non-naturally occurring mutated Cel7A polypeptide of claim 1 wherein the non-naturally occurring mutated Cel7A polypeptide comprises a L371M mutation of SEQ ID NO: 2.

3. The non-naturally occurring mutated Cel7A polypeptide of claim 1 wherein the non-naturally occurring mutated Cel7A polypeptide comprises a D92E mutation of SEQ ID NO: 2.

4. The non-naturally occurring mutated Cel7A polypeptide of claim 1 wherein the non-naturally occurring mutated Cel7A polypeptide comprises a A239V mutation of SEQ ID NO: 2.

5. The non-naturally occurring mutated Cel7A polypeptide of claim 1 wherein the non-naturally occurring mutated Cel7A polypeptide comprises a T481I mutation of SEQ ID NO: 2.

6. The non-naturally occurring mutated Cel7A polypeptide of claim 1 having up to 2.3 times the hydrolase activity when compared to the naturally occurring Cel7A polypeptide from which the non-naturally occurring mutated Cel7A polypeptide was derived.

7. The non-naturally occurring mutated Cel7A polypeptide of claim 1 having up to 2.3 times the hydrolase activity when compared to the naturally occurring Cel7A polypeptide from which the non-naturally occurring mutated Cel7A polypeptide was derived wherein the non-naturally occurring Cel7A polypeptide comprises a L371M mutation of SEQ ID NO: 2.

8. The non-naturally occurring mutated Cel7A polypeptide of claim 1 having up to 2.3 times the hydrolase activity when compared to the naturally occurring Cel7A polypeptide from which the non-naturally occurring mutated Cel7A polypeptide was derived wherein the non-naturally occurring Cel7A polypeptide comprises a D92E mutation of SEQ ID NO: 2.

9. The non-naturally occurring mutated Cel7A polypeptide of claim 1 having up to 2.3 times the hydrolase activity when compared to the naturally occurring Cel7A polypeptide from which the non-naturally occurring mutated Cel7A polypeptide was derived wherein the non-naturally occurring Cel7A polypeptide comprises a A239V mutation of SEQ ID NO: 2.

10. The non-naturally occurring mutated Cel7A polypeptide of claim 1 having up to 2.3 times the hydrolase activity when compared to the naturally occurring Cel7A polypeptide from which the non-naturally occurring mutated Cel7A polypeptide was derived wherein the non-naturally occurring Cel7A polypeptide comprises a T481I mutation of SEQ ID NO: 2.

11. An isolated nucleic acid molecule encoding the non-naturally occurring mutated Cel7A polypeptide of claim 1.

12. The isolated nucleic acid molecule of claim 11, further comprising a promoter operably linked to the nucleic acid molecule.

13. The isolated nucleic acid molecule of claim 12, wherein the promoter allows expression of the nucleic acid in a filamentous fungal host cell.

14. The isolated nucleic acid molecule of claim 13, wherein the nucleic acid is within an expression vector.

15. A host cell expressing a recombinant polypeptide encoded by the nucleic acid molecule of claim 11.

16. The host cell of claim 15, wherein the cell is a fungal cell.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) Exemplary embodiments are illustrated in referenced figures of the drawings. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than limiting.

(2) FIG. 1 depicts the experimental approach for screening mutants for pNP-L activity.

(3) FIGS. 2A and 2B depict the nucleotide (A) (SEQ ID NO: 1) and amino acid (B) (SEQ ID NO: 2) sequences of for the fusion CBH1 sequence prior to mutagenesis.

(4) FIGS. 3A through 3Q depict the nucleotide sequences (SEQ ID NOs: 3-19, respectively) of mutant library clones of the nucleotide sequence for the fusion CBH1 sequence (SEQ ID NO: 1), with the mutation sites highlighted.

(5) FIGS. 4A through 4Q depict the amino acid sequences (SEQ ID NOs: 20-36, respectively) of mutant library clones of the amino acid sequence for the fusion CBH1 sequence (SEQ ID NO: 2), with the mutated residues highlighted and the frame-shifted sequences underlined.

(6) FIG. 5 depicts the pNP-L activity of the yeast transformed with mutant sequences.

(7) FIG. 6 depicts the pNP-L activity of the yeast after retransformation with mutant sequences.

(8) FIG. 7 depicts the cellulase activity of purified Cel7A (WT and mutants) on pretreated corn stover.

(9) FIG. 8 depicts a portion of the amino acid sequence of the SDS1T mutant Cel7A compared to a portion of the full amino acid sequence of the wildtype T. reesei Cel7A parent (TrCel7A) SEQ ID NO: 37 as depicted in FIG. 19.

(10) FIG. 9 depicts a portion of the amino acid sequence of the SDS2T mutant Cel7A compared to a portion of the full amino acid sequence of the wildtype T. reesei Cel7A parent (TrCel7A) SEQ ID NO: 37 as depicted in FIG. 19.

(11) FIG. 10 depicts a portion of the amino acid sequence of the SDS3T mutant Cel7A compared to a portion of the full amino acid sequence of the wildtype T. reesei Cel7A parent (TrCel7A) SEQ ID NO: 37 as depicted in FIG. 19.

(12) FIG. 11 depicts a portion of the amino acid sequence of the SDS4T mutant Cel7A compared to a portion of the full amino acid sequence of the wildtype T. reesei Cel7A parent (TrCel7A) SEQ ID NO: 37 as depicted in FIG. 19.

(13) FIG. 12 depicts a portion of the amino acid sequence of the SDS5T mutant Cel7A compared to a portion of the full amino acid sequence of the wildtype T. reesei Cel7A parent (TrCel7A) SEQ ID NO: 37 as depicted in FIG. 19.

(14) FIG. 13 depicts a portion of the amino acid sequence of the SDS6T mutant Cel7A compared to a portion of the full amino acid sequence of the wildtype T. reesei Cel7A parent (TrCel7A) SEQ ID NO: 37 as depicted in FIG. 19.

(15) FIG. 14 depicts a portion of the amino acid sequence of the SDS7T mutant Cel7A compared to a portion of the full amino acid sequence of the wildtype T. reesei Cel7A parent (TrCel7A) SEQ ID NO: 37 as depicted in FIG. 19.

(16) FIGS. 15A, 15B, 15C, and 15D depict a ribbon diagram of Cel7A showing the areas where amino acid residues were altered in the indicated SDS mutants. FIG. 15A depicts a front view. FIG. 15B depicts a back view. FIG. 15C depicts SDS1. FIG. 15D depicts SDS3.

(17) FIG. 16 shows activity of exemplary mutant enzymes on pre-treated corn stover (PCS) compared to wildtype T. reesei Cel7A (TrCel7A wt). SDS-T1 and SDS-T3 mutants show increased activity over TrCel7A, while the combined double mutant SDS-T1/T3 shows a larger increase in activity. Activity of wildtype Cel7A from P. funiculosum (PfCel7A wt) is also included.

(18) FIG. 17 depicts the cellulase activity of purified Cel7A (WT and mutants) on Avicel. Tr 1-11 is a L371M mutation of wild type Cel7A from Trichoderma reesei (SEQ ID NO: 2).

(19) FIG. 18 depicts the location of the L371M mutation of Tr 1-11, also known as clone 1-11.

(20) FIG. 19 depicts the parent amino acid sequence (SEQ ID NO: 37) of Cel7A (TrCel7A) from Trichoderma reesei from which sequences of mutants depicted in part in FIGS. 8-14 were compared to.

DETAILED DESCRIPTION

(21) Disclosed herein are Cel7A mutants that exhibit higher cellulase activities on a range of cellulose-containing substrates. Also disclosed are methods for degrading cellulose in cellulose-containing materials such as biomass by contacting the cellulases described herein with the cellulose-containing materials. Further disclosed are methods for generating mutant Cel7A polypeptides and assays for determining cellulase activities. In an embodiment, the native protein sequence of T. reesei Cel7A is SEQ ID NO: 37 as depicted in FIG. 19.

(22) A random evolution approach was used to screen and identify Cel7A mutants with improved cellulase activities. Point mutations were introduced into the fusion CBH1 gene (SEQ ID NO: 1) (Talaromyces emersonii cat and Trichoderma reesei linker-cbm) using error-prone mutagenesis. The mutagenesis library was transformed into a yeast strain followed by selection on cellulosic substrates, as shown in FIG. 1. Transformants were screened using 4-nitrophenyl -D-lactopyranoside (pNP-L) conversion assay as a measure of cellobiohydrolase activity.

(23) S. cerevisiae cells were transformed with different -glucosidase constructs and were grown on cellobiose containing medium. Differences in size of the colonies indicate the relative -glucosidase activities of the individual -glucosidase enzyme. Two high expressing -glucosidases were identified from four tested different -glucosidase genes. -glucosidase from Aspergillus aculeatus was found to be most actively expressed one in the tested yeast strains. Higher activity of the A. aculeatus -glucosidase directly correlated with the levels of expression in the two yeast strains tested.

(24) Exemplary Mutations

(25) Two random mutagenesis libraries (high and medium mutation frequency), originating from 8000 clones was generated using the GeneMorph II kit. In one experiment, mutations ranging from 1-19 mutations were observed in the 17 clones suggesting successful Tecbh1-Trcbm1 library synthesis. Of the 17 clones, 12 of them had one/more mutations in the Tecbh1 domain.

(26) In another analysis, 600 yeast transformants were screened by pNP-L activity assay, of which 14 colonies showed significantly higher pNP-L activity, in comparison to the vector-only transformants. Three library clones were sequenced, and clone 1-11, which exhibited the highest pNP-L activity contains a L371M mutation. Clone 1-51 is a truncated Cel7A protein and Clone 1-59 has a single D92E mutation. The L371M mutation is located at the junction of the two catalytic arms of the fusion cbh protein, suggesting a possible important functional implication for the Cel7A enzyme.

(27) Mutant clones were identified that conferred high pNP-L activity to the extracellular yeast medium. The specific mutations were identified and were transferred to T. reesei (also called H. jecorina) Cel7A at the corresponding positions and were further studied for their ability to improve pNP-L activity of this protein. As discussed further in the Examples below, certain mutants exhibit higher pNP-L activity (e.g., up to 2.3-fold) when compared against native T. reesei Cel7A. Additionally, the mutants' activity towards cellulosic substrate was also assayed, which showed that some mutants exhibited higher substrate conversion efficiency, in comparison to the wild-type (WT) Cel7A.

(28) Clone 1-11 (also known as Tr 1-11) had one mutation (from the parent sequence SEQ ID NO: 2) L371M with the Tecbh1 catalytic domain being affected. The location of the L371M mutation is depicted in FIG. 18. Clone 1-51 had fifteen mutations; C43S, Y78Y, C79S, 99-stop, and 11 downstream mutations from SEQ ID NO: 2 with the Tecbh1 catalytic domain being affected. Clone 1-59 had one mutation (from SEQ ID NO: 2) D92E with the Tecbh1 catalytic domain being affected.

(29) Additional mutations were made and are described in the Examples below. Also included are sub-domain mutants in TrCel7A.

(30) SDS1removal of disulfide present in TrCel7A via two mutations: C4G and C72A.

(31) SDS2G427N mutation to add N-glycan attachment site present in PfCel7A.

(32) SDS3three, point deletions shorten the A1 loop as it is in PfCel7A: A100, Q101, K102.

(33) SDS4add extra loop into TrCel7A that is present in PfCel7A: insert sequence GTSTGSLS following residue G298 in TrCel7A.

(34) SDS5three, point mutations remove N-glycan attachment site: N64D, E65A, T66S.

(35) SDS6three, point mutations remove N-glycan attachment site: N270V, T271T, S272D.

(36) SDS7several point mutations made near the product sites to match the motif(s) found in PfCel7A. TrCel7A numbering, the string of mutations begins at residue 325 and at residue 337. ELNDDYCTAEEAE is changed to VINSDYCAAEIST.

(37) Yeast cells may be grown in any rich media (e.g., YPD) or minimum media conventionally used in the field. YPD medium contains about 1% yeast extract, 2% peptone and 2% dextrose. Yeast minimum media typically contains 0.67% of yeast nitrogen base (YNB) without amino acids supplemented with appropriate amino acids or purine or pyrimidine bases. An amount of sugar, typically 2% unless otherwise indicated, may be used as carbon source, including glucose (dextrose), xylose, galactose, maltose or L-arabinose, among others.

(38) In certain embodiments, a nucleic acid may be identical to the sequence represented herein. In other embodiments, the nucleic acids may be least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a nucleic acid sequence presented herein, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a nucleic acid sequence presented herein. Sequence identity calculations can be performed using computer programs, hybridization methods, or calculations. Exemplary computer program methods to determine identity and similarity between two sequences include, but are not limited to, the GCG program package, BLASTN, BLASTX, TBLASTX, and FASTA. The BLAST programs are publicly available from NCBI and other sources. For example, nucleotide sequence identity can be determined by comparing query sequences to sequences in publicly available sequence databases (NCBI) using the BLASTN2 algorithm.

(39) The nucleic acid molecules exemplified herein encode polypeptides with amino acid sequences represented herein. In certain embodiments, the polypeptides may be at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the reference amino acid sequence while possessing the function. The present disclosure encompasses yeast cells such as S. cerevisiae cells that contain the nucleic acid molecules described herein, have genetic modifications to the nucleic acid molecules, or express the polypeptides described herein.

(40) Suitable vectors for gene expression may include (or may be derived from) plasmid vectors that are well known in the art, such as those commonly available from commercial sources. Vectors can contain one or more replication and inheritance systems for cloning or expression, one or more markers for selection in the host, and one or more expression cassettes. The inserted coding sequences can be synthesized by standard methods, isolated from natural sources, or prepared as hybrids. Ligation of the coding sequences to transcriptional regulatory elements or to other amino acid encoding sequences can be carried out using established methods. A large number of vectors, including algal, bacterial, yeast, and mammalian vectors, have been described for replication and/or expression in various host cells or cell-free systems, and may be used with genes encoding the enzymes described herein for simple cloning or protein expression.

(41) Certain embodiments may employ promoters or regulatory operons. The efficiency of expression may be enhanced by the inclusion of enhancers that are appropriate for the particular cell system that is used, such as those described in the literature. Suitable promoters also include inducible promoters. Expression systems for constitutive expression in yeast cells are available from commercial sources. Inducible expression systems are also suitable for use.

(42) In exemplary embodiments, the host cell may be a microbial cell, such as a yeast cell or an algal cell, and may be from any genera or species of algae that is known to produce lipids or is genetically manipulable. Exemplary microorganisms include, but are not limited to, bacteria; fungi; archaea; protists; eukaryotes, such as algae; and animals such as plankton, planarian, and amoeba.

(43) Host cells may be cultured in an appropriate fermentation medium. An appropriate, or effective, fermentation medium refers to any medium in which a host cell, including a genetically modified microorganism, when cultured, is capable of growing and/or expressing recombinant proteins. Such a medium is typically an aqueous medium comprising assimilable carbon, nitrogen and phosphate sources, but can also include appropriate salts, minerals, metals and other nutrients. Microorganisms and other cells can be cultured in conventional fermentation bioreactors or photobioreactors and by any fermentation process, including batch, fed-batch, cell recycle, and continuous fermentation. The pH of the fermentation medium is regulated to a pH suitable for growth of the particular organism. Culture media and conditions for various host cells are known in the art. A wide range of media for culturing yeast cells, for example, are available from ATCC.

Example 1: Generation of Random Mutagenesis Library

(44) In order to generate a random mutagenesis library of our chimeric CBH protein, the GeneMorph II kit from Agilent Technologies was used. Two independent libraries were generated targeting different mutation frequencies: (1) a medium mutation frequency library (4.5-9 mutations per kb) and (2) a high mutation frequency library (>9 mutations per kb). To generate the medium and high frequency libraries, 100 ng and 0.1 ng of template DNA, respectively, was PCR amplified using primers SV-Tecbh1-EcoRI-F (CACTAAATCAAAGAATTCATGC) and SV-Trcbm1-XhoI-R (CTCTCGAGGGCGCGCCTA). Plasmid pMI529 was amplified with primers SV-pMI529-XhoI-F (CCCTCGAGAGCTTTTGAT) and SV-pMI529-EcoRI-R (TGAATTCTTTGATTTAGTGTTTGTG). Both the library and the plasmid backbone PCRs were digested with XhoI and EcoRI restriction enzymes and gel purified (Zymo Research, Zymoclean Gel DNA Recovery Kit). Both libraries were ligated into vector pMI529 using T4 DNA Ligase (NEB, Inc.). Ligations were diluted 1:5 in H2O and 2 L was electroporated into DH5 electromax cells (ThermoFisher), four times for each library. Transformations were plated onto LB-carbenicillin (100 g/mL) agar plates and approximately 4,000 colonies arose from each library (8,000 colonies total). Importantly, only 80 colonies formed on the no-insert ligation control suggesting a low background present in the library. Colonies from both libraries were harvested and pooled collectively by spreading LB broth atop the plates and pipetting into 250 mL of LB in a 1 L shake flask. Cells were allowed to grow for 2 hours at which point freezer aliquots were made and the remaining plasmid library was purified using a Maxiprep Kit (Qiagen).

Example 2: Mutation Rate Determination in the Mutagenesis Library

(45) In order to determine the rate of mutation introduced by this mutagenesis technique, 17 bacterial clones were selected (9 from the high mutation library and 8 from the medium mutation library) for sequencing. DNA sequencing revealed that 15 of the 18 clones had mutations ranging from 1-19 mutations. Three clones from the medium mutation library did not contain any mutations. The mutations ranged from 1-5 in numbers in this library. The types of mutations included missense (13) and silent (1) mutations. Clones M1, M5, M9 and M10 had mutations in the Tecbh1 domains, M6 and M7 had a single mutation in the Trcbh1 linker region, and M1 had a point mutation in the Trcbm domain. Conversely, mutations in the high mutation library ranged from 1-19 mutations. The types of mutations in this library included missense (47), silent (6) and nonsense (1) mutations. In addition, one clone had an insertion (clone H8) and a deletion (clone H2) mutation leading to a frame-shift downstream of the mutation. The nucleotide and the amino acid sequences of the unmutated sequences are presented in FIG. 2, while the mutant clones are presented in FIGS. 3 and 4, respectively. The nucleotide changes in each mutant clone, their respective position and the corresponding amino acid change resulting from the mutation and their respective positions are presented in Table 1.

(46) TABLE-US-00001 TABLE 1 Details of mutations and their respective locations in the nucleotide and the amino acid sequences in the representative E. coli mutant library clones. Library Change in Nucleotide position AA change at the respective AA position clone # nucleotides altered nucleotide position altered H1 (SEQ ID G-A 76 A-T 26 NOs: 3, 20) H2 (SEQ ID G-A 640 A-T 214 NOs: 4, 21) C-A 654 I-I 218 C 1254 Deletion 419 C-A 1512 NA (frame shift) NA (frame shift) H3 (SEQ ID G-A 340 V-I 114 NOs: 5, 22) A-T 602 E-V 201 G-A 674 C-Y 225 C-A 1089 D-E 363 A-G 1184 Q-R 395 A-G 1303 N-D 435 C-T 1391 T-I 464 G-A 1496 C-Y 499 G-A 1514 C-Y 505 H4 (SEQ ID T-A 109 C-S 37 NOs: 6, 23) A-T 383 D-V 128 G-A 442 V-M 148 T-A 474 A-A 158 C-A 860 S-Y 287 G-T 931 D-Y 311 H5 (SEQ ID C-A 285 D-E 96 NOs: 7, 24) A-T 744 P-P 247 G-A 805 G-S 269 T-A 832 F-I 278 C-T 938 T-I 313 A-C 960 E-D 320 T-A 1157 M-K 386 G-C 1204 D-H 402 A-C 1223 D-A 408 C-T 1229 T-I 410 G-A 1243 A-T 415 G-A 1250 G-D 417 C-A 1268 S-Y 423 T-A 1354 F-I 452 A-T 1367 N-I 456 G-T 1376 G-V 459 A-T 1384 R-stop 462 A-T 1419 T-T 473 G-T 1456 G-C 486 H6 (SEQ ID G-T 11 R-I 4 NO: 8) C-A 116 A-D 39 G-A 302 G-D 101 T-C 393 T-T 131 G-A 756 M-I 252 G-A 1126 A-T 376 A-G 1417 T-A 473 H8 (SEQ ID T-A 630 S-S 210 NOs: 9, 25) A 1051 Insert 351 G-A 1167 NA (frame shift) NA (frame shift) C-T 1203 NA (frame shift) NA (frame shift) T-C 1363 NA (frame shift) NA (frame shift) C-A 1370 NA (frame shift) NA (frame shift) A-T 1396 NA(frame shift) NA(frame shift) T-A 1447 NA (frame shift) NA (frame shift) T-G 1495 NA (frame shift) NA (frame shift) H10 (SEQ C-T 146 A-V 49 ID NOs: 10, 27) G-A 190 G-S 64 A-G 352 N-D 118 T-A 559 C-S 187 T-A 593 I-N 198 C-A 629 S-Y 210 G-A 671 C-Y 224 G-A 1090 D-N 364 T-A 1416 T-T 472 M1 (SEQ ID A-G 1049 E-G 350 NOs: 11, 28) G-A 1124 G-D 375 C-T 1170 D-D 390 C-T 1442 T-I 481 M3 (SEQ ID No mutations NOs: 12, 29) M4 (SEQ ID No mutations NOs: 13, 30) M5 (SEQ ID G-A 142 G-S 48 NOs: 14, 31) C-A 938 T-N 313 M6 (SEQ ID C-T 1433 P-L 478 NOs: 15, 32) M7 (SEQ ID T-C 1429 S-P 477 NOs: 16, 33) M8 (SEQ ID No mutations NOs: 17, 34) found M9 (SEQ ID C-A 743 P-Q 248 NOs: 18, 35) M10 (SEQ C-T 113 T-I 38 ID NOs: 19, 36) T-A 511 S-T 171 G-C 676 A-P 226 G-A 935 G-D 312 G-A 1079 G-D 360

(47) Overall, 82% of the clones in the sequenced library had mutations at different frequencies. A table summarizing the types of mutations in the different clones is shown in Table 2.

(48) TABLE-US-00002 TABLE 2 Details of the sequenced clones from the Tecbh1-Trcbm1 random mutagenesis library. Mutant Total Missense Silent Nonsense Mutations Mutations Mutations clone # mutation mutation mutation Insertion Deletion in Tecbh1 in Trlinker in Trcbm H1 1 1 0 0 0 0 1 0 0 H2* 4 1 1 0 0 1 2 0 1 H3 9 9 0 0 0 0 6 1 2 H4 6 5 1 0 0 0 6 0 0 H5 19 16 2 1 0 0 14 4 1 H6 7 6 1 0 0 0 6 1 0 H8 9 1 0 0 1 0 7 1 1 H10 9 8 1 0 0 0 9 0 0 M1 4 3 1 0 0 0 3 0 1 M3 0 0 0 0 0 0 0 0 0 M4 0 0 0 0 0 0 0 0 0 M5 2 2 0 0 0 0 2 0 0 M6 1 1 0 0 0 0 0 1 0 M7 1 1 0 0 0 0 0 1 0 M8 0 0 0 0 0 0 0 0 0 M9 1 1 0 0 0 0 1 0 0 M10 5 5 0 0 0 0 5 0 0 *indicates the sum of different types of mutations does not add up to the total number of mutations, since the deletion results in change of amino acid sequence downstream of the deletion site. H and M represent individual clones from the high and medium library. Te represents Talaromyces emersonii. Tr represents Trichoderma reesei.

Example 3: Screening and Identification of Improved Cel7A Mutants

(49) The library of CBH mutants was transformed into the yeast strain Y294 expressing a heterologous -glucosidase from Aspergillus aculeatus and selected on synthetic complete medium lacking tryptophan and uracil (SCD-trp-ura). A total of 2000 clones were transferred to 96 well plates containing SCD-trp-ura medium. pNP-L activity assay was performed on the extracellular broth to identify transformants that displayed higher pNP-L activity than the vector-only transformed control. Twenty-two yeast transformants were identified that showed higher pNP-L activity than the controls (FIG. 5). Each of these transformants was subjected to DNA extraction using Quick-DNA Fungal/Bacterial Miniprep kit. Each of the 22 DNA preparations were transformed into E. coli Zymo 5 cells to select for the individual plasmids that confer the improved pNP-L activity to the yeast cells. Plasmid DNA was then extracted from the E. coli transformants and sequenced to identify the Cel7A mutations in these plasmids.

(50) DNA sequencing of the plasmids revealed 0-11 mutations in these mutants. These mutations included two plasmids with no mutations, 11 plasmids with 1 mutation, two plasmids with 2 mutations, 4 plasmids with 3 mutations, and one plasmids each with 4, 8, and 11 mutations. One of the 22 mutants involved a frameshift which led to truncation of the protein. A table summarizing the types of mutations in each of the mutant plasmids are presented in Table 3.

(51) TABLE-US-00003 TABLE 3 Summary of mutations in the high pNP-L active yeast clones. # of Mis- Silent Inser- Dele- Non- Frame- Mutants mutations sense mutations tions tions sense shift 19-47a 0 0 0 0 0 0 None 13-77b 0 0 0 0 0 0 None 1-11 1 0 0 0 0 0 None 1-59 1 1 0 0 0 0 None 2-4c 1 1 0 0 0 0 None 2-69c 1 1 0 0 0 0 None 19-17b 1 1 0 0 0 0 None 19-29b 1 0 1 0 0 0 None 19-60b 1 1 0 0 0 0 None 13-78a 1 1 0 0 0 0 None 12-77 1 1 0 0 0 0 None 11-35a 1 1 0 0 0 0 None 4-83b 1 0 1 0 0 0 None 1-1d 2 1 1 0 0 0 None 4-56a 2 1 1 0 0 0 None 2-27a 3 2 1 0 0 0 None 6-87a 3 1 2 0 0 None 6-53a 3 3 0 0 0 0 None 2-18c 3 2 1 0 0 0 None 1-51 4 3 1 0 0 1 None 2-72b 8 6 1 0 1 0 Yes 6-90a 11 10 1 0 0 0 None

Example 4: Down-Selection of Mutants for Testing in T. reesei Cel7A

(52) Each of the 22 plasmids that were extracted from high-pNP-L active clones were retransformed into the yeast strain Y294 expressing a heterologous -glucosidase from Aspergillus aculeatus in order to verify the mutant's ability to confer higher pNP-L activity to the yeast broth. Ten individual colonies were picked for determining the pNP-L activity of each mutant. The activity of each of the yeast colonies towards pNP-L substrate is presented in FIG. 6. Of the 22 mutants, we identified 10 mutants that showed high pNP-L activity tested from the extracellular medium. These mutants were designated 1-1d, 1-11, 4-56a, 6-90c, 6-87a, 12-77, 11-35a, 4-83b, 6-53a, and 2-18c. Mutant 4-83b contained only a silent mutation, so this mutant was not subjected to further analysis.

Example 4: Transferring Mutations to T. reesei Cel7A for Activity Analysis

(53) The wild-type (wt) TrCel7A sequence was aligned with all the high-pNP-L activity sequences in order to identify the corresponding positions of mutations in TrCel7A. Without being bound by theory, these mutations should result in improving pNP-L activity of TrCel7A. PCR-based point mutagenesis or gene synthesis was used to generate the corresponding 9 TrCel7A mutants. A table representing the positions and the type of mutations in Tecbh1-Trcbm1 and TrCel7A are presented in Table 4.

(54) TABLE-US-00004 TABLE 4 Point mutations in Tecbh1-Trlnk-Trcbm1 clones and corresponding mutations in the TrCel7A sequence. Location Location of mutations of mutations in TrCel7A Location of mutations in TrCel7A (without in Tecbh1TrlnkTrcbm (with secretion secretion Mutants (with secretion signal) signal) signal) 1-11 L371M L366M L349M 1-1d A239V A241V A224V 4-56a T481I T479I T462I 6-87a D272V D274V D257V 12-77 V385A V380A V363A 11-35a G463D G461D G444D 6-53a L111M I110M I93M Y281N Y283N Y266N T464I T462I T445I 2-18c T411S T406S T389S A394V A389V A372V

(55) The mutation 6-90a (10 missense and one silent mutation) is not included in the table. The TrCel7A constructs were introduced into the vector pTrEno, such that they were under the control of the ENO gene promoter and the TrCBH2 terminator. Plasmids were transformed into the cbhl deleted strain AST1116 (derived from QM6a) by electroporation. Briefly, competent spores were prepared as described in Linger et al., Biotechnol Biofuels 8:45 (2015), which involved time-specific sporulation on PDA, followed by re-sporulation, collection and washing of spores before freezing at 80 C. as electro-competent spore stocks. Five g of plasmid was linearized with SbfI and further purified using DNA clean and concentrator-5 kit (Zymo Research Corp, Irvine, Calif.). Frozen competent spores were thawed on ice and mixed with 1.0 g of the linearized plasmid. Electroporation was carried out using a BioRad Gene Pulser (BioRad Laboratories, Inc., Hercules, Calif.) using the following conditions: 1.8 kV, 25 F, 800, and incubated for a few minutes on ice. One mL of complete medium lactose medium was then added to the transformation mixture and transferred to six-well tissue culture plates and incubated at room temperature for 18 hours to allow recovery and germination of spores. Two hundred L of this cell suspension was then plated on to potato dextrose agar containing 100 g/mL hygromycin and 0.1% (v/v) Triton X-100 for colony size restriction (PDHX) and incubated at 30 C. in lighted incubator for 2-3 days to allow colony development.

Example 5: Screening of Transformants for Cel7A Expression by Western Blotting

(56) A small piece of mycelial fragment from transformant colonies grown on PDHX plates was transferred to 2 mL of Mandels Andreotti minimal medium containing 5% glucose (MAG) and hygromycin (100 g/mL) in a 24-well microtiter plate and incubated statically in a lighted 30 C. incubator for 3 days until a mycelial mat was observed on the liquid medium. Fifteen L of cell free culture broth (containing secreted proteins) was transferred to microcentrifuge tubes containing 5 L SDS-PAGE loading buffer and subjected to boiling at 95 C. for 10 min. This protein extract was separated on 4-12% NuPAGE gel in MOPS buffer, 200V constant for 50 minutes. Post-separation, proteins were electro-transferred onto PVDF membrane for Western blot analysis using an iBlot2 (Thermo Fisher Scientific, Inc. Grand Island, N.Y.). For hybridization of Cel7A protein, a P. funiculosum anti-Cel7A polyclonal antibody raised in rabbit was used as primary antibody at a dilution of 1:20,000. Detection of Cel7A was carried out using alkaline phosphatase-conjugated anti-rabbit secondary antibody (Thermo Fisher Scientific, Inc. Grand Island, N.Y.). Colonies displaying hybridization were subjected to clonal isolation by restreaking a spore suspension from the transformants onto hygromycin selection plates. Five individual colonies arising from this restreak were inoculated into MAG medium containing hygromycin, followed by Western blotting again to confirm the expression of Cel7A in these individual colonies.

Example 6: Cel7A Purification

(57) Cel7A was purified as described in Linger et al., Biotechnol Biofuels 8:45 (2015). Briefly, fermentation broths (8 to 10 L) were harvested, vacuum filtered, concentrated, and then loaded onto a 26/10 Phenyl Sepharose Fast Flow column. Buffer A was 20 mM Bis-Tris pH 6.5 and buffer B was 20 mM Bis-Tris pH 6.5, 2.0 M (NH.sub.4).sub.2SO.sub.4. After binding and washing, a descending gradient of 80% B (1.6 M (NH.sub.4).sub.2SO.sub.4) to 0% B over eight column volumes was used to elute the bound proteins from the column. Active fractions were identified by a p-nitrophenyl--(1-4)-D-lactopyranoside (pNP-L) activity assay. The pNP-L-active fractions were pooled and concentrated as needed. Protein was desalted and exchanged into 20 mM Bis-Tris buffer pH 6.5. This sample was then loaded onto a Tricorn 10/100 anion exchange column packed with Source 15Q and eluted with a 0-50% salt gradient over 30 column volumes. Buffers were 20 mM Bis-Tris pH 6.5 (A) and the same supplemented with 1.0 M NaCl (B). pNP-L activity was followed again to identify the active fractions. Active fractions were pooled, brought to 1.5 M (NH.sub.4).sub.2SO.sub.4 in 20 mM Bis-Tris pH 6.5, loaded onto a Tricorn 10/100 Source-Iso column, washed, and eluted with a descending gradient from 1.6 to 0.4 M (NH.sub.4).sub.2SO.sub.4. Active fractions were concentrated to <10 mL and subjected to size exclusion chromatography using a 26/60 Superdex 75 column and 20 mM sodium acetate buffer pH 5.0 containing 100 mM NaCl as the mobile phase. All chromatography buffers contained 0.02% (w/v) NaN.sub.3 as a microbial inhibitor. SDS-PAGE and anti-Cel7A immunoblotting were performed to assess purity.

Example 7: pNP-Lactopyranoside Assay

(58) The pNP-L assay was performed by incubating 150 L of 2 mM pNP-L with 25 L of sample at 45 C. for 30 minutes. Reactions were quenched with 25 L of 1 M Na.sub.2CO.sub.3, and the absorbance at 405 nm was measured. Standard curve concentrations range from 0 to 250 M pNP-L. For kcat and kM evaluation, the assay was performed with substrate concentration in the range 8 mM-0.133 mM. Reported values were obtained using GraphPad Prism version 7.00 for Mac (GraphPad Software, La Jolla Calif. USA) and are representative of three experiments (Table 5).

(59) TABLE-US-00005 TABLE 5 Activity assay of Cel7A mutants on pNP-L substrate. Relative Specific specific Activity activity Protein (U/mg) (ratio) k.sub.cat (min.sup.1) K.sub.M (mM) TrCel7A WT 256 24 1 20 1 1,930 112 TrCel7A 1-11 170 3 0.7 10.9 0.2 1,065 81 TrCel7A 1-1d 592 18 2.3 56 4 2,403 338 TrCel7A 4-56a n.a. n.a. n.a. n.a. TrCel7A 6-87a 212 24 0.8 24 4 1,968 116 TrCel7A 12-77 298 21 1.2 n.a. n.a. TrCel7A 11-35a 199 3 0.8 11 987 TrCel7A 6-53a 326 11 1.3 21 3 2,100 213 TrCel7A 2-18c 388 32 1.5 28 7 1,980 180

(60) We observed that among the 8 tested mutants, 4 mutants (1-1d, 12-77, 6-53a and 2-18c) showed higher pNP-L activity in comparison to the wild-type TrCel7A. The increase in specific activity in these mutants ranged from 1.2- to 2.3-fold. The highest specific activity was observed in 1-1d with a specific activity of 59218 U/mg, which corresponded to 2.3-fold improved pNP-L conversion to pNP.

Example 8: Cel7A Enzyme Activity Measurement

(61) The biomass substrate used in this work is dilute acid-pretreated corn stover (PCS) P120927 prepared and analyzed by the standard National Renewable Energy Laboratory (NREL) laboratory analytical procedures (Chen et al., Bioresour Technol. 401-8 (2013)). The substrate was suspended in 20 mM acetic acid/sodium acetate buffer at pH 5.0. Digestions were conducted at 40 C. in high-performance liquid chromatography (HPLC) vials placed in a rotator at 10 rpm up to 96 hours. An amount of substrate equivalent to 8.5 mg of glucan was added to the enzymatic cocktail made of TrCel7A (wild-type or mutant), endoglucanase I from Trichoderma longibrachiatum (Megazyme Co., Bray Ireland), and -glucosidase from Aspergillus niger (Megazyme Co., Bray Ireland) at a concentration of 28.008, 1.894, and 0.5 mg protein/g of glucan, respectively. Adjustment of the biomass assay aliquots to a 1.7 mL final volume resulted in a cellulose concentration of 5.0 mg/mL. Experiments were performed in duplicate. Sugar analyses were performed on an Agilent 1100 LC system equipped with a G1362A refractive index detector (RID). Each sample was injected at a volume of 20 L into the HPLC-RID system, with the RID held at 55 C. Compounds were separated using a BioRad Aminex HPX-87H column 9 m, 7.8300 mm column (BioRad, Hercules, Calif.) at a column temperature of 55 C. The HPLC solvent regime consisted of an isocratic flow of 0.01 N H.sub.2SO.sub.4 in water at 0.6 mL/min for a total run time of 27 minutes. A four-point calibration curve ranging from 0.05 mg/mL to 40 mg/mL was used to quantitate the samples. The PCS hydrolysis assay results are presented in FIG. 7. The mutants 1-11 and 2-18 showed higher hydrolysis of the substrate, in comparison to the wild-type TrCel7A, during the initial incubation periods (up to 48 hours). Mutant 1-11 was further tested on the substrate avicel, which showed 7% higher activity than the wild-type TrCel7A (FIG. 17).

Example 9: Construction of Sub-Domain Swap Library

(62) The PfCel7A crystal structure was solved, and eight areas of the enzyme wherein the structure differed significantly from that of TrCel7A were identified. Each of these motifs was swapped into the corresponding region of the TrCel7A parent (see FIGS. 8-15).

(63) Two of these sub-domain swaps, SDS-T1 (removal of the tenth disulfide bridge) and SDS-T3 (three-residue deletion in the A1 loop), exhibited higher activity on pre-treated corn stover than the WT TrCel7A parent enzyme (FIG. 16), representing a successful instance of cellulase engineering. Combining these two sub-domain swaps into the same mutant enzyme produces an augmented result: with the mutation of two localized regions of the parent enzyme TrCel7A, hydrolytic activity was demonstrated to match that of the PfCel7A WT, representing an improvement of more than 100%, as measured by the time to 80% conversion.

(64) The Examples discussed above are provided for purposes of illustration and are not intended to be limiting. Still other embodiments and modifications are also contemplated.

(65) While a number of exemplary aspects and embodiments have been discussed above, those of skill in the art will recognize certain modifications, permutations, additions and sub combinations thereof. It is therefore intended that the following appended claims and claims hereafter introduced are interpreted to include all such modifications, permutations, additions and sub-combinations as are within their true spirit and scope.