TRANSGENIC SILKWORMS CAPABLE OF PRODUCING CHIMERIC SPIDER SILK POLYPEPTIDES AND FIBERS

20190185528 ยท 2019-06-20

    Inventors

    Cpc classification

    International classification

    Abstract

    Transgenic silkworms comprising at least one nucleic acid encoding a chimeric silk polypeptide comprising one or more spider silk elasticity and strength motifs are disclosed. Expression cassettes comprising nucleic acids encoding a variety of chimeric spider silk polypeptides (Spider 2, Spider 4, Spider 6, Spider 8) are also disclosed. A piggyBac vector system is used to incorporate nucleic acids encoding chimeric spider silk polypeptides into the mutant silkworms to generate stable transgenic silkworms. Chimeric silk fibers having improved tensile strength and elasticity characteristics compared to native silkworm silk fibers are also provided. The transgenic silkworms greatly facilitate the commercial production of chimeric silk fibers suitable for use in a wide variety of medical and industrial applications.

    Claims

    1. A chimeric spider silk polypeptide, comprising in an N- to C-terminal orientation: an N-terminal domain of a Bombyx mori fibroin heavy chain (fhc) silk polypeptide; one or more repeated spider silk motifs, wherein each repeated spider silk motif comprises, in a N- to C-terminal orientation: one or more copies of an elasticity motif, an optional linker, and one or more copies of a strength motif; and a C-terminal domain of the Bombyx mori fhc silk polypeptide, wherein the elasticity motif comprises one or more of: a Flagelliform-like elasticity motif comprising a repeated amino acid motif in a consensus sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 29, or a GPGGA motif of SEQ ID NO: 2; a major ampullate spidroin-like (MaSp-like) elasticity motif comprising a repeated amino acid motif in a consensus sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: 23; or a minor ampullate spidroin-like (MiSp-like) elasticity motif comprising a repeated amino acid motif in a consensus sequence selected from the group consisting of SEQ NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26.

    2. The chimeric spider silk polypeptide of claim 1, wherein the elasticity motif comprises one or more MaSp-like elasticity motifs, each MaSp-like elasticity motif comprising one or more MaSp1 or MaSp2 elasticity motifs, the MaSp1 elasticity motif being a repeated amino acid motif in a consensus sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20, and the MaSp2 elasticity motif being a repeated amino acid motif in a consensus sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: 23.

    3. The chimeric spider silk polypeptide of claim 1, wherein the one or more spider silk motifs comprise about 14-42 repeated segments of the spider silk motif, each repeated segment comprising, in an N- to C-terminal orientation, about 4-16 copies of the elasticity motif, the optional linker, and the strength motif, wherein the elasticity motif comprises a Flagelliform-like elasticity motif in an amino acid consensus sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 29.

    4. The chimeric spider silk polypeptide of claim 3, wherein the strength motif comprises a polypeptide of SEQ ID NO: 3.

    5. The chimeric spider silk polypeptide of claim 4, wherein the elasticity motif is the amino acid consensus sequence of SEQ ID NO: 2.

    6. The chimeric spider silk polypeptide of claim 5, wherein the chimeric spider silk polypeptide comprises a functionally-similar variant chimeric spider silk polypeptide having one or more conservative amino acid substitutions.

    7. The chimeric spider silk polypeptide of claim 3, wherein the chimeric spider silk polypeptide comprises a functionally-similar variant chimeric spider silk polypeptide having one or more conservative amino acid substitutions.

    8. The chimeric spider silk polypeptide of claim 3, wherein one repeated segment of the about 14-42 repeated segments of spider silk motif is selected from the group consisting of, in an N- to C-terminal orientation: about 16 copies of the elasticity motif, the optional linker, and the strength motif; and about 8 copies of the elasticity motif, the optional linker, and the strength motif.

    9. The chimeric spider silk polypeptide of claim 1, further comprising one or more marker polypeptide domains.

    10. The chimeric spider silk polypeptide of claim 9, wherein the one or more marker polypeptide domains is fused in frame between the N-terminal domain of the Bombyx mori fhc silk polypeptide and a first spider silk motif of the one or more repeated spider silk motifs.

    11. The chimeric spider silk polypeptide of claim 10, wherein the one or more marker polypeptide domains comprise a fluorescent polypeptide domain.

    12. The chimeric spider silk polypeptide of claim 11, wherein the fluorescent polypeptide domain is selected from the group consisting of: green fluorescent protein (GFP), an Enhanced GFP (EGFP), an enhanced cyan fluorescent protein (ECFP), and a Discosoma sp. red fluorescent protein (DsRed).

    13. The chimeric spider silk polypeptide of claim 1, wherein the chimeric spider silk polypeptide further comprises one or more polypeptide domains having one or more therapeutic activities.

    14. The chimeric spider silk polypeptide of claim 13, wherein at least one of the one or more polypeptide domains having one or more therapeutic activities is selected from the group consisting of: a domain conferring an anti-infective activity, a chemotherapeutic activity, an anti-rejection activity, an analgesic activity, an anti-inflammatory activity, a hormone activity, and a growth promoting activity.

    15. The chimeric spider silk polypeptide of claim 14, wherein the at least one of the one or more polypeptide domains confers growth promoting activity.

    16. A composite fiber comprising the chimeric spider silk polypeptide of claim 1.

    17. The composite fiber of claim 16, wherein the composite fiber has a tensile strength greater than a silk fiber derived from a non-chimeric Bombyx mori silkworm.

    18. A composite fiber comprising the chimeric spider silk polypeptide of claim 5, wherein the composite fiber has a tensile strength greater than a silk fiber derived from a non-chimeric Bombyx mori silkworm.

    19. A polypeptide, comprising about 14-42 repeated segments of spider silk motifs, each repeated segment comprising, in an N- to C-terminal orientation: about 4-16 copies of an elasticity motif as set forth in SEQ ID NO: 2; an optional linker; and a strength motif as set forth in SEQ ID NO: 3.

    20. The polypeptide of claim 19, wherein the polypeptide comprises a functionally-similar variant polypeptide having one or more conservative amino acid substitutions.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0023] Other objects and advantages of the present invention will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments, in conjunction with the accompanying drawings, wherein like reference numerals have been used to designate like elements, and wherein:

    [0024] FIG. 1 presents the amino acid sequences (SEQ ID NOS 18-23, respectively, in order of appearance) of the two major ampullate silk proteins from divergent orb weaving or derived orb weaving spiders (Gatesy, et al. 2001). Comparison reveals a high level of sequence conservation, particularly within the sequence motifs described above, which has been maintained over the 125 million years since these species diverged from one another. Consensus repetitive amino acid sequences of the major ampullate silk proteins in various orb weaving species () indicates an amino acid not present when compared to the other sequences. Spiders are: Nep.c., Nephila clavipes; Lat.g., Lactrodectus geometricus; Arg.t., Argiope trifasciata.

    [0025] FIG. 2 presents consensus amino acid sequences (SEQ ID NOS 24-26, respectively, in order of appearance) of minor ampullate silk proteins from orb weaving spiders. Soon after the initial major ampullate silk protein sequences were published, cDNAs representing minor ampullate silk (Mi) protein transcripts from N. clavipes were isolated and sequenced (Colgin and Lewis, 1998). The MiSp sequence provided in this figure has both similar and conspicuously different sequences relative to the MaSp proteins. MiSp includes GGX and short polyAla sequences, but the longer polyAla motifs in the MaSps are replaced by (GA)n repeats. The consensus repeats have similar organizations but the number of GGX and GA repeats varies greatly.

    [0026] FIG. 3 presents flagelliform silk protein cDNA consensus sequences (SEQ ID NOS 27-29, respectively, in order of appearance). These silk protein cDNAs encode the catching spiral silk protein from the N. clavipes flagelliform gland (FIG. 3; Hayashi and Lewis, 2000). These cDNAs contained sequences encoding a 5 untranslated region and a secretory signal peptide, numerous iterations of a five amino acid motif, and the C-terminal end. Northern blotting analysis indicated an mRNA size of .sup.15 kb, encoding a protein of nearly 500 Kd. The amino acid sequence predicted from the gene sequence suggested a model of protein structure that helps to explain the physical basis for the elasticity of spider silk, which also is consistent with the properties of MaSp2 (further described herein).

    [0027] FIG. 4 presents a computer model of a spiral. This is a model of an energy minimized (GPGGQGPGGY)2 (SEQ ID NO: 1) sequence, with a starting configuration of Type II -turns at each pentamer sequence.

    [0028] FIG. 5 presents several variations on a basic Bombyx mori silk fibroin heavy chain expression cassette that were constructed. The design involved the assembly of constructs designed to express fibroin heavy chain (fhc)-spider silk chimeras, in which the synthetic spider silk protein sequence is flanked by N- and C-terminal fragments of the B. mori fhc protein. The functionally relevant genetic elements in each expression cassette, from left to right, include: the major promoter, upstream enhancer element (UEE), basal promoter, and N-terminal domain (NTD) from the B. mori fhc gene, followed by various synthetic spider silk protein sequences positioned in-frame with the translational initiation site located upstream in the NTD, followed by the fhc C-terminal domain (CTD), which includes translational termination and RNA polyadenylation sites.

    [0029] FIG. 6 presents the scheme for subcloning the cassettes into piggyBac. Each of the eight different versions of the expression cassette pictured were excised from a parent plasmid using Ascl and Fsel and subcloned into the corresponding sites of pBAC[3P3-DSRedaf]. A map of this piggyBac vector is shown.

    [0030] FIG. 7 presents a Western blot of transgenic silkworm silks. These silks were analyzed for the presence of the spider silk chimeric protein by Western blotting of both the silkworm silk gland protein contents and the silk fibers from transgenic silkworm cocoons using a spider silk-specific antibody. In both cases, transgenic silkworms were verified as producing the chimeric proteins, and differential extraction studies showed that these proteins were integral components of the transgenic silk fibers of their cocoons. Furthermore, expression of each of the chimeric green fluorescent protein fusions was apparent in both silk glands and fibers by direct examination of the silk glands or silk fibers using a fluorescent dissecting microscope. In most cases the amount of fluorescent protein in the fibers was high enough to be visualized by the green color the cocoons under normal lighting.

    [0031] FIG. 8 presents a parent plasmid pSL-Spider #4, a size of 17,388 bp. This parent plasmid carries the chimeric spider silk protein #4 cassette, Spider silk (A2S8)42.

    [0032] FIG. 9 presents a parent plasmid pSL-Spider#4+EGFP. EGFP is Enhanced Green Fluorescent Protein. This vector has a size of 18,102 bp. This parent plasmid carries the chimeric spider silk protein #4 with the marker protein, EGFP, cassette, Spider silk (A2S8)42.

    [0033] FIG. 10 presents a parent plasmid pSL-Spider#6. This parent plasmid has a size of 12,516 bp. This parent plasmid carries the chimeric spider silk protein #6 cassette, Spider silk (A2S8)14).

    [0034] FIG. 11 presents a parent plasmid pSL-Spider#6+EGFP. EGFP is Enhanced Green Fluorescent Protein. This parent plasmid has a size of 13,230 bp. This parent plasmid carries the chimeric spider silk protein #6 with the marker protein, EGFP, cassette, Spider silk (A2S8)14.

    [0035] FIGS. 12A and 12B present the piggyBac plasmids. FIG. 12A depicts the pXLBacII-ECFP NTD CTD maspX16 construct having a size of 10,458 bp. FIG. 12B depicts the pXLBacII-ECFP NTD CTD maspX24 construct, and has a size of 11,250 bp.

    [0036] FIGS. 13A-13F present the sequence for pSL-Spider#4 (SEQ ID NO: 30).

    [0037] FIGS. 14A-14F present the sequence for pSL-Spider#4+EGFP (SEQ ID NO: 31)

    [0038] FIGS. 15A-15E present the sequence for pSL-Spider#6 (SEQ ID NO: 32).

    [0039] FIGS. 16A-16E present the sequence for pSL-Spider#6+EGFP (SEQ ID NO: 33).

    [0040] FIGS. 17A-17D present the piggyBac vector designs. FIG. 17A illustrates a graphical representation of the A2S8.sub.14 synthetic spider silk gene; FIG. 17B illustrates a graphical representation of the Spider 6 chimeric silkworm/spider silk gene; FIG. 17C illustrates a graphical representation of the Spider silk 6-GFP chimeric silkworm/spider silk gene; FIG. 17D illustrates a graphical representation of the piggyBac vectors; FIG. 17E illustrates a legend of the symbols used in the graphical representations of FIGS. 17A-17C, namely symbols for: Flagellum elastic motif (A2; 120 bp); Major ampullate spidroin-2; Spider motif (S8; 55 bp) Fhc major promoter (1,157 bp), Fhc enhancer (70 bp); Fhc basal promoter, Fhc 5 translated region (Exon 1/intron/Exon 2; Fhc N-terminal cds)=1,744 bp; EGFP (720 bp); A2S8.sub.14, spider silk sequence (2,462 bp), Fhc C-terminal cds (180 bp), Fhc polyadenylation signal (300 bp).

    [0041] FIG. 18 presents expression of the chimeric silkworm/spider silk/EGFP protein in (18A) cocoons, (18B, 18C) silk glands, and (18D) silk fibers from spider 6-GFP silkworms. Expression and localization of a chimeric silkworm/spider silk protein in silkworm silk glands. Silk glands were excised, bombarded with the spider 6 or spider 6-GFP piggyBac vectors, and examined under a fluorescence microscope, as described in Methods.

    [0042] FIG. 19 Sequential extraction of silk fibers. Cocoons produced by pnd-w1 (lanes 3-6), spider 6 (lanes 8-11), or spider 6-GFP (lanes 13-16) silkworms were degummed and subjected to a sequential extraction protocol, as described herein. Proteins solubilized in each extraction step were analyzed by SDSPAGE and (19A) Coomassie Blue staining or (19B) immunoblotting with a spider silk protein-specific antiserum. M: Molecular weight markers. +: A2S814 spider silk protein expressed and purified in E. coli. Lanes 3, 8, and 13: saline extractions. Lanes 4, 9, and 14: SDS extractions. Lanes 5, 10, and 15: 8M LiSCN/2% mercaptoethanol extractions. Lanes 6, 11, and 16: 16M LiSCN/5% mercaptoethanol extractions. The arrows mark the chimeric spider silk proteins. The apparent molecular weights were .sup.75 kDa for A2S8.sub.14 from E. coli, .sup.106 kDa for spider 6, and .sup.130 kDa and .sup.110 kDa for spider 6-GFP.

    [0043] FIG. 20 A comparison of the best mechanical performances observed for the composite fibers from the transgenic silkworms, the native fibers from the parental silkworm, and a representative native (dragline) spider silk fiber is shown. Fiber toughness is defined by the area under the stress/strain curves. Mechanical properties of degummed native and composite silk fibers. The best mechanical performances measured for the native silkworm (pnd-w1) and representative spider (N. clavipes dragline) silk fibers are compared to those obtained with the composite silk fibers produced by transgenic silkworms. All fibers were tested under the same conditions. The toughest values are: spider 6 line 7 (86.3 MJ/m3); spider 6-GFP line 1 (98.2 MJ/m3), spider 6-GFP line 4 (167.2 MJ/m3); and N. clavipes dragline (138.7 MJ/m3), as compared to native silkworm pnd-w1 (43.9 MJ/m3). These data show that all of the composite silk fibers from transgenic silkworms were tougher than the native fibers from the non-transgenic silkworm.

    [0044] FIGS. 21A-21D depict the nucleic acid sequence of construct pXLBacII-ECFP NTD CTD maspX16 (10,458 bp) (SEQ ID NO: 34).

    [0045] FIGS. 22A-22D depict the nucleic acid sequence of construct pXLBacII-ECFP NTD CTD maspX24 (11,250 bp) (SEQ ID NO: 35).

    DETAILED DESCRIPTION OF THE INVENTION

    [0046] The method for inserting a gene into silkworm chromosomes used in the present invention should enable the gene to be stably incorporated and expressed in the chromosomes, and be stably propagated to offspring, as well, by mating. Although a method using micro-injection into silkworm eggs or a method using a gene gun can be used, a method that is used preferably consists of the micro-injection into silkworm eggs with a target gene containing vector for insertion of an exogenous gene into silkworm chromosomes and helper plasmid containing a transposon gene (Nature Biotechnology 18, 81-84, 2000) simultaneously.

    [0047] The target gene is inserted into reproductive cells in a recombinant silkworm that has been hatched and grown from the micro-injected silkworm eggs. Offspring of a recombinant silkworm obtained in this manner are able to stably retain the target gene in their chromosomes. The gene in the recombinant silkworm obtained in the present invention can be maintained in the same manner as ordinary silkworms. Namely, up to fifth instar silkworms can be raised by incubating the eggs under normal conditions, collecting the hatched larva to artificial feed and then raising them under the same conditions as ordinary silkworms.

    [0048] The recombinant silkworm obtained in the present invention can be raised in the same manner as ordinary silkworms and is able to produce exogenous protein by raising under ordinary conditions, to maximize silkworm development and growth.

    [0049] Gene recombinant silkworms obtained in the present invention are able to pupate and produce a cocoon in the same manner as ordinary silkworms. Males and females are distinguished in the pupa stage, and after having transformed into moths, males and females mate and eggs are gathered on the following day. The eggs can be stored in the same manner as ordinary silkworm eggs. The gene recombinant silkworms of the present invention can be maintained on subsequent generations by repeating the breeding as described above and can be increased to large numbers.

    [0050] Although there are no particular limitations on the promoter used here, and any promoter originating in any organism can be used provided its acts effectively within silkworm cells, a promoter that has been designed to specifically induce protein in silkworm silk glands is preferable. Examples of silkworm silk gland protein promoters include fibroin H chain promoter, fibroin L chain promoter, p25 promoter and sericin promoter.

    [0051] In the present invention, a gene cassette for expressing a chimeric spider silk protein refers to a set of DNA required for a synthesis of the chimeric protein in the case of being inserted into insect cells. This gene cassette for expressing a chimeric spider silk protein contains a promoter that promotes expression of the gene encodes the chimeric spider silk protein. Normally, it also contains a terminator and poly A addition region, and preferably contains a promoter, exogenous protein structural gene, terminator and poly A addition region. Moreover, it may also contain a secretion signal gene coupled between the promoter and the exogenous protein structural gene. An arbitrary gene sequence may also be coupled between the poly A addition sequence and the exogenous protein structural gene. In addition, an artificially designed and synthesized gene sequence can also be coupled.

    [0052] In addition, a gene cassette for inserting a chimeric spider silk/silkworm gene refers to a gene cassette for expressing a chimeric spider silk/silkworm gene having an inverted repetitive sequence of a pair of piggyBac transposons on both sides and consisting of a set of DNA inserted into insect cell chromosomes through the action of the piggyBac transposons.

    [0053] A vector in the present invention refers to that having a cyclic or linear DNA structure. A vector capable of replicating in E. coli and having a cyclic DNA structure is particularly preferable. This vector can also incorporate a marker gene such as an antibiotic resistance gene or jellyfish green fluorescence protein gene for the purpose of facilitating selection of transformants.

    [0054] Although there are no particular limitations on the insect cells used in the present invention, they are preferably lepidopteron cells, more preferably Bombyx mori cells, and even more preferably silkworm silk gland cells or cells contained in Bombyx mori eggs. In the case of silk gland cells, posterior silk gland cells of fifth instar silkworm larva are preferable because there is active synthesis of fibroin protein and they are easily handled.

    [0055] There are no particular limitations on the method used to incorporate a gene cassette for expression of a chimeric spider silk protein by the insect cells. Methods using a gene gun and methods using micro-injection can be used for incorporation into cultured insect cells, in the case of incorporating into silkworm silk gland cells, for example, a gene can be easily incorporated into posterior silk gland tissue removed from the body of a fifth instar silkworm larvae using a gene gun.

    [0056] Gene incorporation into the posterior silk gland using a gene gun can be carried out by, for example, bombarding gold particles coated with a vector containing a gene cassette for expressing exogenous protein into a posterior silk gland immobilized on an agar plate and so forth using a particle gun (Bio-Rad, Model No. PDS-1000/He) at an He gas pressure of 1,100 to 1,800 psi.

    [0057] In the case of incorporating a gene into cells contained in eggs of Bombyx mori, a method using micro-injection is preferable. Here, in the case of performing micro-injection into eggs, it is not necessary to micro-inject into the cells of the eggs directly, but rather a gene can be incorporated by simply micro-injecting into the eggs.

    [0058] A recombinant silkworm containing the gene cassette for expressing a chimeric spider silk protein of the present invention in its chromosomes can be acquired by micro-injecting a vector having a cassette for inserting a chimeric spider silk gene into the eggs of Bombyx mori. For example, a first generation (G1) silkworm is obtained by simultaneously micro-injecting a vector having a gene cassette for inserting a chimeric spider silk gene and a plasmid in which a piggyBac transposase gene is arranged under the control of silkworm actin promoter into Bombyx mori eggs according to the method of Tamara, et al. (Nature Biotechnology 18, 81-84, 2000), followed by breeding the hatched larva and crossing the resulting adult insects (G0) within the same group. Recombinant silkworms normally appear at a frequency of 1 to 2% among this G1 generation.

    [0059] Selection of recombinant silkworms can be carried by PCR using primers designed based on the exogenous protein gene sequence after isolating DNA from the G1 generation silkworm tissue. Alternatively, recombinant silkworms can be easily selected by inserting a gene encoding green fluorescence protein coupled downstream from a promoter capable of being expressed in silkworm cells into a gene cassette for inserting a gene in advance, and then selecting those individuals that emit green fluorescence under ultraviolet light among G1 generation silkworms at first instar stage.

    [0060] In addition, in the case of the micro-injection of a vector having a gene cassette for inserting a gene into Bombyx mori eggs for the purpose of acquiring recombinant silkworms containing a gene cassette for expressing an exogenous protein in their chromosomes, recombinant silkworms can be acquired in the same manner as described above by simultaneously micro-injecting a piggyBac transposase protein.

    [0061] A piggyBac transposon refers to a transfer factor of DNA having an inverted sequence of 13 base pairs on both ends and an ORF inside of about 2.1 k base pairs. Although there are no particular limitations on the piggyBac transposon used in the present invention, examples of those that can be used include those originating in Trichoplusia ni cell line TN-368, Autographa californica NPV (AcNPV) and Galleria mellonea NPV (GmMNPV). A piggyBac transposon having gene and DNA transfer activity can be preferably prepared using plasmids pHA3PIG and pPIGA3GFP having a portion of a piggyBac originating in Trichoplusia ni cell line TN-368 (Nature Biotechnology 18, 81-84, 2000). The structure of the DNA sequence originating in a piggyBac is required to have a pair of inverted terminal sequences containing a TTAA sequence and has an exogenous gene such as a cytokine gene inserted between those DNA sequences. It is more preferable to use a transposase in order to insert an exogenous gene into silkworm chromosomes using a DNA sequence originating in a transposon. For example, the frequency at which a gene is inserted into silkworm chromosomes can be improved considerably by simultaneously inserting DNA capable of expressing a piggyBac transposase to enable the transposase transcribed and translated in the silkworm cells to recognize the two pairs of inverted terminal sequences, cut out the gene fragment between them, and transfer it to silkworm chromosomes.

    [0062] The invention may be even more fully appreciated by the description that follows.

    Chimeric Silk Proteins in the Biomedical Arena

    [0063] Chimeric spider silk fibers are provided as part of a widely used material for a subset of procedures, such as ocular surgeries, nerve repairs, and plastic surgeries, which require extremely thin fibers. Additional uses include scaffolding materials for regeneration of bone, ligaments and tendons as well as materials for drug delivery.

    [0064] The recombinant spider silk fibers produced by the processes of the present invention may be used in a variety of medical applications such as wound closure systems, including vascular wound repair devices, hemostatic dressings, patches and glues, sutures, drug delivery and in tissue engineering applications, such as, for example, scaffolding, ligament prosthetic devices and in products for long-term or bio-degradable implantation into the human body. A preferred tissue engineered scaffold is a non-woven network of the fibers prepared with the recombinant spider silk/silkworm fibers described herein.

    [0065] Additionally, the recombinant chimeric silk fibers of the present invention can be used for organ repair, replacement or regeneration strategies that may benefit from these unique scaffolds, including but are not limited to, spine disc, cranial tissue, dura, nerve tissue, liver, pancreas, kidney, bladder, spleen, cardiac muscle, skeletal muscle, tendons, ligaments and breast tissues.

    [0066] In another embodiment of the present invention, the recombinant spider silk fiber materials can contain therapeutic agents. To form these materials, the therapeutic agent may be engineered into the fiber prior to forming the material or loaded into the material after it is formed. The variety of different therapeutic agents that can be used in conjunction with the recombinant chimeric silk fibers of the present invention is vast. In general, therapeutic agents which may be administered via the pharmaceutical compositions of the invention include, without limitation: anti-infectives such as antibiotics and antiviral agents; chemotherapeutic agents (i.e., anticancer agents); anti-rejection agents; analgesics and analgesic combinations; anti-inflammatory agents; hormones such as steroids; growth factors (bone morphogenic proteins (i.e., BMP's 1-7), bone morphogenic-like proteins (i.e., GFD-5, GFD-7 and GFD-8), epidermal growth factor (EGF), fibroblast growth factor (i.e., FGF 1-9), platelet derived growth factor (PDGF), insulin like growth factor (IGF-I and IGF-II), transforming growth factors (i.e., TGF-.beta.I-III), vascular endothelial growth factor (VEGF)); and other naturally derived or genetically engineered proteins, polysaccharides, glycoproteins, or lipoproteins. These growth factors are described in The Cellular and Molecular Basis of Bone Formation and Repair by Vicki Rosen and R. Scott Thies, published by R. G. Landes Company hereby incorporated herein by reference.

    [0067] The recombinant spider silk/silkworm fibers containing bioactive materials may be formulated by mixing one or more therapeutic agents with the fiber used to make the material. Alternatively, a therapeutic agent could be coated on to the fiber preferably with a pharmaceutically acceptable carrier. Any pharmaceutical carrier can be used that does not dissolve the fiber. The therapeutic agents, may be present as a liquid, a finely divided solid, or any other appropriate physical form.

    [0068] The amount of therapeutic agent will depend on the particular drug being employed and medical condition being treated. Typically, the amount of drug represents about 0.001 percent to about 70 percent, more typically about 0.001 percent to about 50 percent, most typically about 0.001 percent to about 20 percent by weight of the material. Upon contact with body fluids or tissue, for example, the drug will be released.

    [0069] The tissue engineering scaffolds made with the recombinant spider silk/silkworm fibers can be further modified after fabrication. For example, the scaffolds can be coated with bioactive substances that function as receptors or chemoattractors for a desired population of cells. The coating can be applied through absorption or chemical bonding.

    [0070] Additives suitable for use with the present invention include biologically or pharmaceutically active compounds. Examples of biologically active compounds include cell attachment mediators, such as the peptide containing variations of the RGD integrin binding sequence known to affect cellular attachment, biologically active ligands, and substances that enhance or exclude particular varieties of cellular or tissue ingrowth. Such substances include, for example, osteoinductive substances, such as bone morphogenic proteins (BMP), epidermal growth factor (EGF), fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), insulin-like growth factor (IGF-I and II), TGF-, YIGSR peptides, glycosaminoglycans (GAGs), hyaluronic acid (HA), integrins, selectins and cadherins.

    [0071] The scaffolds are shaped into articles for tissue engineering and tissue guided regeneration applications, including reconstructive surgery. The structure of the scaffold allows generous cellular ingrowth, eliminating the need for cellular preseeding. The scaffolds may also be molded to form external scaffolding for the support of in vitro culturing of cells for the creation of external support organs.

    [0072] The scaffold functions to mimic the extracellular matrices (ECM) of the body. The scaffold serves as both a physical support and an adhesive substrate for isolated cells during in vitro culture and subsequent implantation. As the transplanted cell populations grow and the cells function normally, they begin to secrete their own ECM support.

    [0073] In the reconstruction of structural tissues like cartilage and bone, tissue shape is integral to function, requiring the molding of the scaffold into articles of varying thickness and shape. Any crevices, apertures or refinements desired in the three-dimensional structure can be created by removing portions of the matrix with scissors, a scalpel, a laser beam or any other cutting instrument. Scaffold applications include the regeneration of tissues such as nervous, musculoskeletal, cartilaginous, tendenous, hepatic, pancreatic, ocular, integumenary, arteriovenous, urinary or any other tissue forming solid or hollow organs.

    [0074] The scaffold may also be used in transplantation as a matrix for dissociated cells, e.g., chondrocytes or hepatocytes, to create a three-dimensional tissue or organ. Any type of cell can be added to the scaffold for culturing and possible implantation, including cells of the muscular and skeletal systems, such as chondrocytes, fibroblasts, muscle cells and osteocytes, parenchymal cells such as hepatocytes, pancreatic cells (including Islet cells), cells of intestinal origin, and other cells such as nerve cells, bone marrow cells, skin cells, pluripotent cells and stem cells, and combination thereof, either as obtained from donors, from established cell culture lines, or even before or after genetic engineering. Pieces of tissue can also be used, which may provide a number of different cell types in the same structure.

    [0075] The cells are obtained from a suitable donor, or the patient into which they are to be implanted, dissociated using standard techniques and seeded onto and into the scaffold. In vitro culturing optionally may be performed prior to implantation. Alternatively, the scaffold is implanted, allowed to vascularize, then cells are injected into the scaffold. Methods and reagents for culturing cells in vitro and implantation of a tissue scaffold are known to those skilled in the art.

    [0076] The recombinant spider silk/silkworm fibers of the present intention may be sterilized using conventional sterilization process such as radiation-based sterilization (i.e., gamma-ray), chemical based sterilization (ethylene oxide) or other appropriate procedures. Preferably the sterilization process will be with ethylene oxide at a temperature between 52-55 C. for a time of 8 hours or less. After sterilization the biomaterials may be packaged in an appropriate sterilize moisture resistant package for shipment and use in hospitals and other health care facilities.

    [0077] The chimeric silk fibers of the resent invention may also be sued in the manufacture of various forms of athletic and protection garments, such as in the manufacture/fabrication of athletic clothing and bulletproof vests. The chimeric spider silk fibers disclosed herein may also be used in the automobile industry, such as in improved airbag fabrication. Airbags employing the disclosed chimeric silk fibers provide greater impact energy in a car crash, much as a spider web absorbs the energy of flying insects that fall prey to the web.

    Definitions

    [0078] As used herein, biocompatible means that the silk fiber or material prepared there from is non-toxic, non-mutagenic, and elicits a minimal to moderate inflammatory reaction. Preferred biocompatible polymer for use in the present invention may include, for example, polyethylene oxide (PEO), polyethylene glycol (PEG), collagen, fibronectin, keratin, polyaspartic acid, polylysine, alginate, chitosan, chitin, hyaluronic acid, pectin, polycaprolactone, polylactic acid, polyglycolic acid, polyhydroxyalkanoates, dextrans, and polyanhydrides. In accordance with the present invention, two or more biocompatible polymers can be added to the aqueous solution.

    [0079] As used herein, a flexibility and/or elasticity motif and/or domain sequence is defined as an identifiable genetic sequence of a gene or protein fragment that encodes a spider silk that is associated with imparting a characteristic of elasticity and/or flexibility to a material, such as to a silk fiber. By way of example, a flexibility and/or elasticity motifs and/or domain is GPGGA (SEQ ID NO: 2).

    [0080] As used herein, a strength motif is defined as an identified genetic sequence of a gene or protein fragment encoding spider silk that is associated with imparting a characteristic of strength to a material, such as to increase and/or enhance the tensile strength to a silk fiber. By way of example, some of these spider strength motifs are: GGPSGPGS(A) 8 (when A is a poly alanine sequence) (SEQ ID NO: 3).

    [0081] The invention will be further characterized by the following examples which are intended to be exemplary of the invention.

    Example 1Materials and Methods

    [0082] The present example is provided to describe the materials and methods/techniques employed in the creation of the transgenic silkworms, the general procedures employed in the creation of the genetic constructs employed, as well as reference tables used in the assessment of tensile strength of the transgenic spider silk fibers.

    [0083] 1. The gene sequences used. The gene sequences used are provided in the FIGS. 13-16 provided herein. Variations of these are also envisioned as part of the present invention, as it is contemplated that shorter and/or longer versions of these sequences may be employed having conservative substitutions, for example, with substantially the same chimeric spider silk protein properties.

    [0084] 2. The chimeric spider silk proteins and the fibers obtained with these chimeric silk proteins will be assessed for tensile strength. Table 1 provides a general reference against with the chimeric spider silk fibers will be assessed. The chimeric spider silk fibers of the present invention were found to posses tensile and other mechanical strength characteristics similar to those of native spider silk.

    TABLE-US-00001 TABLE 1 Comparisons of Mechanical Properties of Spider Silk.sup.a Strength Elongation Energy to Break Material (N m.sup.2) (%) (J kg.sup.1) Dragline silk 4 10.sup.9 35 4 10.sup.5 Minor ampullate silk 1 10.sup.9 5 3 10.sup.4 Flagelliform silk 1 10.sup.9 >200 4 10.sup.5 Tubulliform silk 1 10.sup.9 20 1 10.sup.5 Aciniform 0.7 10.sup.9 80 6 10.sup.9 KEVLAR 4 10.sup.9 5 3 10.sup.4 Rubber 1 10.sup.6 600 8 10.sup.4 Tendon 1 10.sup.6 5 5 10.sup.3 .sup.aData derived from (Gosline, et al. 1984).

    Example 2Analysis of the Tensile Strength Properties of Individual Transformed Silkworm Silks

    [0085] Transgenic silkworm silks were analyzed for the presence of the spider silk chimeric protein by Western blotting of both the silkworm silk gland protein contents and the silk fibers from transgenic silkworm cocoons using a spider silk-specific antibody. In both cases transgenic silkworms were verified as producing the chimeric proteins, and differential extraction studies showed that these proteins were integral components of the transgenic silk fibers of their cocoons. Furthermore, expression of each of the chimeric green fluorescent protein fusions was apparent in both silk glands and fibers by direct examination of the silk glands or silk fibers using a fluorescent dissecting microscope. In most cases the amount of fluorescent protein in the fibers was high enough to be visualized by the green color the cocoons under normal lighting.

    [0086] Table 2 shows an analysis of transgenic silks produced from individual transgenic silkworms. These analyses definitely show that the transgenic lines transformed with the Spider-4 or Spider-6 constructs produce chimeric spider silk/silkworm fibers with improved strengths compared to silk fibers from the untransformed silkworms. Significantly, these fibers are in some cases nearly twice as strong as the native silk. A two-fold improvement in the strength of a silkworm/spider silk chimeric fiber approximates the improvement deemed necessary to make silkworm silk as strong and flexible as spider silk. Thus, these results prove that that the silkworm may be genetically engineered to produce a chimeric spider silk/silkworm fiber that can compete favorably with native spider silk by using piggyBac vectors encoding specified strength and/or flexibility domains of spider silks to construct Bombyx/spider silk chimeric proteins.

    TABLE-US-00002 TABLE 2 Analysis of tensile strengths for transgenic silkworm fibers compared to non-transformed pnd-w1 and a commercial silkworm strain. CGS unit CGS unit compen- converted converted sated tensile tensile Fold tensile strength strength Improve- Sample Silkworm strength (dyn/21 (dyn/ ment No. lines (N) denier) denier) Over pnd-w1 1 pnd-w1 0.531 53131.1 2530.1 1 control 2 P6 + 0 0.809 80947.7 3854.7 1.52 3 P6 + 1 0.552 55155.2 2626.4 1.03 4 P6 + 3 0.542 54218.2 2581.8 1.02 5 P6 + 4 0.815 81496.7 3880.8 1.53 6 P6 + 5 0.656 65594.1 3123.5 1.23 7 P4 + 1 0.965 96460.6 4593.4 1.82 8 P4 + 3 0.630 63000.0 3000.0 1.18 9 Korean 0.676 67584.5 3218.3 1.27 commercial

    Example 3Silkworm Chimeric Gene Expression Cassettes and piggyBac Vectors for Chimeric Spider Silk/Silkworm Protein Expression in Transgenic Silkworms

    [0087] The present example is provided to demonstrate the utility and scope of the present invention in providing a vast variety of silkworm chimeric spider silk gene expression cassettes. The present example also demonstrates the completion of piggyBac vectors shown to successfully transform silk worms, and result in the successful production of commercially useful chimeric spider silk proteins suitable for the production of fibers of commercially useful lengths in manufacturing.

    The Expression Cassettes.

    [0088] Several variations on the basic expression cassettes shown below were constructed. These constructs reflect an assembly of constructs designed to express fibroin heavy chain (fhc)-spider silk chimeras, in which the synthetic spider silk protein sequence is flanked by N- and C-terminal fragments of the B. mori fhc protein. In this regard, several variations on a basic Bombyx mori silk fibroin heavy chain expression cassette shown in FIG. 5 were constructed. The design involves the assembly of constructs designed to express fibroin heavy chain (fhc)-spider silk chimeras, in which the synthetic spider silk protein sequence is flanked by N- and C-terminal fragments of the B. mori fhc protein. The functionally relevant genetic elements in each expression cassette, from left to right, include: the major promoter, upstream enhancer element (UEE), basal promoter, and N-terminal domain (NTD) from the B. mori fhc gene, followed by various synthetic spider silk protein sequences (see below) positioned in-frame with the translational initiation site located upstream in the NTD, followed by the fhc C-terminal domain (CTD), which includes translational termination and RNA polyadenylation sites.

    [0089] There are eight different versions of the expression cassette pictured in FIG. 5, which encode four different synthetic spider silk/silworm proteins with or without EGFP inserted in-frame between the NTD and spider silk sequences. These sequences have been designated as Spider 2, Spider 4, Spider 6, and Spider 8 and they are defined as follows: [0090] a) Spider 2: 7,104 bp, consisting of (A458)24. A1 indicates 4 copies of the putative flagelliform silk elastic motif (GPGGA) (SEQ ID NO: 2); hence A4 indicates 16 copies of this same sequence. S8 indicates the putative dragline silk strength motif [GGPSGPGS(A)8] (SEQ ID NO: 3), also described as the linker-polyalanine sequence. Approximate size of EGFP (Enhanced Green Florescent Protein) fusion protein is 161.9+50.4=212.3 Kd. [0091] b) Spider 4: 7,386 bp, consisting of (A258)42. A2 indicates 8 copies of the putative flagelliform silk elastic motif (GPGGA) (SEQ ID NO: 2). S8 indicates the putative dragline silk strength motif [GGPSGPGS(A)8] (SEQ ID NO: 3), as above. Approximate size of EGFP fusion protein is 169.4+50.4=219.8 Kd. [0092] c) Spider 6: 2,462 bp, consisting of (A258)14. A2 indicates 8 copies of the elastic motif (GPGGA) (SEQ ID NO: 2) and S8 indicates the strength motif [GGPSGPGS(A)8] (SEQ ID NO: 3), as above. Approximate size of EGFP fusion protein is 56.4+50.4=106.8 Kd. [0093] d) Spider 8: 4,924 bp, consisting of (A258)28. A2 indicates 8 copies of the elastic motif (GPGGA) (SEQ ID NO: 2) and S8 indicates the strength motif [GGPSGPGS(A)8] (SEQ ID NO: 3), as above. Approximate size of EGFP fusion protein is 112.8+50.4=163.2 Kd.

    [0094] The sizes of NTD exon I & II (1625+15161); eGFP (27135); CTD (6470)=50,391 Kd.

    Example 4Subcloning the Expression Cassettes into piggyBac

    [0095] Each of the eight different versions of the expression cassette pictured in FIG. 5 (and described in Example 3) above were excised from a parent plasmid using Ascl and Fsel and subcloned into the corresponding sites of pBAC[3P3-DSRedaf]. A map of this piggyBac vector is shown in FIG. 6.

    [0096] All the piggyBac vectors described above, with and without EGFP, were tested by PCR for the individual components and displayed the expected sized products.

    [0097] Each of the piggyBac vectors encoding spider silk proteins fused to EGFP were functionally assessed by assaying their ability to induce EGFP expression in B. mori silk glands. Briefly, silk glands were removed from silkworms and a particle gun was used to bombard the glands with tungsten particles coated with the piggyBac DNA (or controls). The bombarded tissue was then cultured in Grace's medium in culture dishes and a dissecting microscope equipped for EGFP fluorescence available in a colleague's lab was used to examine the silk glands for EGFP expression two and three days later. Each vector was shown to induce EGFP fluorescence.

    [0098] The set of four piggyBac vectors encoding Spider 4 and 6 with and without an EGFP insertion were used to produce transgenic silkworms.

    Example 5Isolation of Transgenic Silkworms

    [0099] Generally, silkworm transformation involves introducing a mixture of the piggyBac vector and a helper plasmid, encoding the piggyBac transposase, into pre-blastoderm embryos by microinjecting silkworm eggs. Blastoderm formation does not occur for as long as 4 h after eggs are laid. Thus, collection and injection of embryos can be done at room temperature over a relatively long time period. The technical hurdle for microinjection is the need to breach the egg chorion, which poses a hard barrier. Tamura and coworkers perfected the microinjection technique for silkworms by piercing the chorion with a sharp tungsten needle and then precisely introducing a glass capillary injection needle into the resulting hole. This is now a relatively routine procedure, accomplished with an Eppendorf robotic needle manipulator calibrated to puncture the chorion, remove the tungsten needle, insert the glass capillary, and inject the DNA solution. The eggs are then re-sealed using a small drop of Krazy glue and maintained under normal rearing conditions of 28 degrees C. and 70% humidity until the larvae hatch. The surviving injected insects are then mated to generate F1 generation embryos for the subsequent identification of putative transformants, based on expression of the DS-Red eye marker. Putative male and female transformants identified by this method are then mated to produce homozygous lineages for more detailed genetic analyses.

    [0100] Specifically, silkworm transformation for the current project involved injecting a mixture of the piggyBac vector and helper plasmid DNAs into eggs of a clear cuticle silkworm mutant, Bombyx mori pnd-w1. This mutant silkworm is described by Tamura, et al. 2000, which reference is specifically incorporated herein by reference. This mutant has a melanization deficiency that makes screening using fluorescent genes much easier. Once red-eyed, putative F1 transformants were identified, homozygous lineages were established and bona fide transformants were confirmed using Western blotting of silk gland proteins and harvested cocoon silk.

    Example 6Analysis of Chimeric Spider Silk/Silkworm Production by Transgenic Silkworms

    [0101] Transgenic silkworm silks were analyzed for the presence of the spider silk chimeric protein by Western blotting of both the silkworm silk gland protein contents and the silk fibers from transgenic silkworm cocoons using a spider silk-specific antibody. In both cases transgenic silkworms were verified as producing the chimeric proteins, and differential extraction experiments showed that these proteins were integral components of the transgenic silk fibers of their cocoons.

    [0102] Furthermore, expression of each of the chimeric green fluorescent protein fusions was apparent in both silk glands and fibers by direct examination of the silk glands or silk fibers using a fluorescent dissecting microscope. (FIG. 7). In most cases the amount of fluorescent protein in the fibers was high enough to be visualized by the green color the cocoons under normal lighting.

    Example 7piggyBac Vector Design

    [0103] piggyBac was the vector of choice for this project because it can be used to efficiently transform silkworms.sup.4, 11, 43. The specific piggyBac vectors used in this project were designed to carry genes with several crucial features. As highlighted in FIG. 17, these included the B. mori fibroin heavy chain (fhc) promoter, which would target expression of the foreign spider silk protein to the posterior silk gland.sup.91, 92, and an fhc enhancer, which would increase expression levels and facilitate assembly of the foreign silk protein into fibers.sup.93. The piggyBac vectors also encoded A2S8.sub.14 (FIG. 17A), a relatively large, synthetic spider silk protein with both elastic (GPGGA).sub.8 (SEQ ID NO: 4) and strength (linker-alanine.sub.8) motifs (alanine.sub.8 disclosed as SEQ ID NO: 5). The synthetic spider silk protein sequence was embedded within sequences encoding N- and C-terminal domains of the Bombyx mori fhc protein (FIGS. 17B-17C). This chimeric silkworm/spider silk design had been used previously to direct incorporation of foreign proteins into nascent, endogenous silk fibers in the B. mori silk gland and produce composite silk fibers.sup.91, 92.

    [0104] One of the piggyBac vectors constructed in this study encoded the chimeric silkworm/spider silk protein alone (FIG. 17B), while the other encoded this same protein with an N-terminal enhanced green fluorescent protein (EGFP) tag (FIG. 17C). The latter construct facilitated the analysis of silk fibers produced by transformed offspring and also was used for preliminary ex vivo silk gland bombardment assays to examine chimeric spider silk protein expression in silk glands, as described in herein.

    Methods:

    [0105] Several gene fragments were isolated by polymerase chain reactions (PCR) with genomic DNA isolated from the silk glands of Bombyx mori strain P50/Daizo and the gene-specific primers shown in FIG. 17. These fragments included the fhc major promoter and upstream enhancer element (MP-UEE), two versions of the fhc basal promoter (BP) and N-terminal domain (NTD; exon 1/intron 1/exon 2) with different 5- and 3-flanking restriction sites, the fhc C-terminal domain (CTD; 3 coding sequence and poly A signal), and EGFP. In each case, the amplification products were gel-purified, and DNA fragments of the expected sizes were excised and recovered. Subsequently, the fhc MP-UEE, fhc CTD, and EGFP fragments were cloned into pSLfa1180fa (pSL) (Y. Miao), the two different NTD fragments were cloned into pCR4-TOPO (Invitrogen Corporation, Carlsbad, Calif.), and E. coli transformants containing the correct amplification products were identified by restriction mapping and verified by sequencing.

    [0106] These fragments were then used to assemble the piggyBac vectors used in this study as follows. The synthetic A2S8.sub.14 spider silk sequence was excised from a pBluescript SKII+ plasmid precursor (F. Teul and R. V. Lewis) with BamHI and BspEI, gel-purified, recovered, and subcloned into the corresponding sites upstream of the CTD in the pSL intermediate plasmid described above. This step yielded a plasmid designated pSL-spider6-CTD. A NotI/BamHI fragment was then excised from one of the pCR4-TOPO-NTD intermediate plasmids described above, gel-purified, recovered, and subcloned into the corresponding sites upstream of the spider 6-CTD sequence in pSLspider 6-CTD to produce pSL-NTD-spider 6-CTD. In parallel, a NotI/XbaI fragment was excised from the other pCR4-TOPO-NTD intermediate plasmid described above, gelpurified, recovered, and subcloned into the corresponding sites upstream of the EGFP amplimer in the pSL-EGFP intermediate plasmid described above. This produced a plasmid containing an NTD-EGFP fragment, which was excised with NotI and BamHI and subcloned into the corresponding sites upstream of the spider6-CTD sequences in pSL-spider 6-CTD. The MP-UEE fragment was then excised with SfiI and NotI from the pSL intermediate plasmid described above, gel-purified, recovered, and subcloned into the corresponding sites upstream of the NTD-spider 6-CTD and NTD-EGFP-spider 6-CTD sequences in the two different intermediate pSL plasmids described above. Finally, the completely assembled MP-UEE-NTD-A2S8.sub.14-CTD or MP-UEE-NTD-EGFP-A2S8.sub.14-CTD cassettes were excised with Ascl and Fsel from the respective final pSL plasmids and subcloned into the corresponding sites of pBAC[3XP3-DsRedaf].sup.98. This final subcloning step yielded two separate piggyBac vectors that were designated spider 6 and spider 6-EGFP to denote the absence or presence of the EGFP marker. These vectors were used for ex vivo silk gland bombardment assays and silkworm transgenesis, as described below.

    Results:

    [0107] The ex vivo assay results showed that the piggyBac vector encoding the GFP-tagged chimeric silkworm/spider silk protein induced green fluorescence in the posterior silk gland region. Immunoblotting assays with a GFP-specific antibody further demonstrated that the bombarded silk glands contained an immunoreactive protein with an apparent molecular weight (M.sub.r) of .sup.116 kDa. Only slightly larger than expected (106 kDa), these results validated the basic design of the present piggyBac vectors and prompted the isolation of transgenic silkworms using these constructs.

    Example 8Transgenic Silkworm Isolation

    [0108] Each piggyBac vector was mixed with a plasmid encoding the piggyBac transposase and the mixtures were independently microinjected into eggs isolated from Bombyx mori pnd-w1.sup.43. This silkworm strain was used because it has a melanization deficiency resulting in a clear cuticle phenotype, which facilitated detection of the EGFP-tagged chimeric silkworm-spider silk protein in transformants. Putative F1 transformants were initially identified by a red eye phenotype resulting from expression of DS-Red under the control of the neural-specific 3XP3 promoter.sup.27 included in each piggyBac vector (FIG. 17D). These animals were used to establish several homozygous transgenic silkworm lineages, as described in Methods, which were designated spider 6 and spider 6-GFP, denoting the piggyBac vector used for their transformation.

    Methods:

    Ex-Vivo Silk Gland Bombardment Assays

    [0109] Live Bombyx mori strain pnd-w1 silkworms entering the third day of fifth instar were sterilized by immersion in 70% ethanol for a few seconds and placed in 0.7% w/v NaCl. The entire silk glands were then aseptically dissected from each animal and transferred to Petri dishes containing Grace's medium supplemented with antibiotics, where they were held in advance of the DNA bombardment process. In parallel, tungsten microparticles (1.7 m M-25 microcarriers; Bio-Rad Laboratories, Hercules, Calif.) were coated with DNA for bombardment, as follows. The microparticles were pre-treated according to the manufacturer's instructions and held in 3 mg/50 l aliquots in 50% glycerol at 20 C. Just prior to each bombardment experiment, the 3 mg microparticle aliquots were coated with 5 g of the relevant piggyBac DNA in a maximum volume of 5 l, according to the manufacturer's instructions. Some microparticle aliquots were coated with distilled water for use as DNA-negative controls. Each bombardment experiment included six replicates and each individual bombardment included one pair of intact silk glands. For bombardment, the glands were transferred from holding status in Grace's medium onto 90 mm Petri dishes containing 1% w/v sterile agar and the Petri dishes were placed in the Bio-Rad Biolistic PDS-1000/He Particle Delivery System chamber. The chamber was evacuated to 20-22 in Hg and the silk glands were bombarded with the pre-coated tungsten microparticles using 1,100 psi of helium pressure at a distance of 6 cm from the particle source to the target tissues, as described previously.sup.26. After bombardment, the silk glands were placed in fresh Petri plates containing Grace's medium supplemented with 2 antibiotics and incubated at 28 C. Transient expression of the EGFP marker in the spider 6-GFP piggyBac vector was assessed by fluorescence microscopy at 48 and 72 hours post-bombardment. Images were taken with an Olympus FSX100 microscope at a magnification of 4.2, a phase of 1/120 sec, and green fluorescence of 1/110 sec (capture). In addition, transient expression of the EGFP-tagged and untagged chimeric silkworm/spider silk proteins was assessed by immunoblotting bombarded silk gland extracts with EGFP- or spider silk-specific antisera, as described below.

    Silkworm Transformation

    [0110] Eggs were collected 1 hour after being laid by pnd-w1 moths and arranged on a microscope slide. Vector and helper plasmids were resuspended in injection buffer (0.1 mM sodium phosphate, 5 mM KCl, pH 6.8) at a final concentration of 0.2 g/ul each, and 1-5 nl was injected into each preblastoderm silkworm embryo using an injection system consisting of a World Precision Instruments PV820 pressure regulator (USA), a Suruga Seiki M331 micromanipulator (Japan), and a Narishige HD-21 double pipette holder (Japan). The punctured eggs were sealed with Helping Hand Super Glue gel (The Faucet Queens, Inc., USA) and then placed in a growth chamber at 25 C. and 70% humidity for embryo development. After hatching, the larvae were reared on an artificial diet (Nihon Nosan Co., Japan) and subsequent generations were obtained by mating siblings within the same line. Transgenic progeny were tentatively identified by the presence of the DsRed fluorescent eye marker using an Olympus SXZ12 microscope (Tokyo, Japan) with filters between 550 and 700 nm.

    Results:

    [0111] Even by visual inspection under white light, without specific EGFP excitation, EGFP expression was observed in cocoons produced by the spider 6-GFP transformants (FIG. 18A). Strong EGFP expression when silk glands (FIGS. 18B-18C) and cocoons (FIG. 18D) from these animals were examined under a fluorescence microscope was also observed. The cocoons appeared to include at least some silk fibers with integrated EGFP signals. Expression of the EGFP-tagged chimeric silkworm/spider silk proteins in the spider 6-GFP silk glands and cocoons was confirmed by immunoblotting silk gland and cocoon extracts with EGFP- and spider silk protein-specific antisera (FIG. 19). Similar results were obtained with spider 6 silk gland and cocoon extracts by immunoblotting with the spider silk protein-specific antiserum (FIG. 19). These results indicated that we had successfully isolated transgenic silkworms encoding EGFP-tagged or untagged forms of the chimeric silkworm/spider silk protein and that these proteins were associated with the silk fibers produced by those transgenic animals.

    Example 9Analysis of the Composite Silk Fibers

    [0112] A sequential protein extraction approach was used to analyze the association of the chimeric silkworm/spider silk proteins with the composite silk fibers produced by the transgenic silkworms. After removing the loosely associated sericin layer, the degummed silk fibers were subjected to a series of increasingly harsh extractions, as described in Methods.

    Methods:

    Sequential Extraction of Silkworm Cocoon Proteins

    [0113] Cocoons produced by the parental and transgenic silkworms were harvested and the sericin layer was removed by stirring the cocoons gently in 0.05% (w/v) Na.sub.2CO.sub.3 for 15 minutes at 85 C. with a material:solvent ratio of 1:50 (w/v).sup.40. The degummed silk was removed from the bath and washed twice with hot (50-60 C.) water with careful stirring and the same material:solvent ratio. The degummed silk fibers were then lyophilized and weighed to estimate the efficiency of sericin layer removal. The degummed fibers were used for a sequential protein extraction protocol, with rotation on a mixing wheel to ensure constant agitation, as follows. Thirty mg of the degummed silk fibers were treated with 1 ml of phosphate buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na.sub.2PO.sub.4, 1.8 mM KH.sub.2PO.sub.4) for 16 hours at 4 C. The material was separated into insoluble and soluble fractions by centrifugation, the supernatant was removed and held at 20 C. as the PBSsoluble fraction, and the pellet was subjected to the next extraction. This pellet was resuspended in 1 ml of 2% (w/v) SDS and incubated for 16 hours at room temperature. Again, the material was separated into insoluble and soluble fractions by centrifugation, the supernatant was removed and held at 20 C. as the SDS-soluble fraction, and the pellet was subjected to the next extraction. This pellet was resuspended in 1 ml of 9 M LiSCN containing 2% (v/v) -mercaptoethanol and incubated for 16-48 hours at room temperature. After centrifugation, the supernatant was held at 20 C. as the 9 M LiSCN/BME-soluble fraction. The final pellet obtained at this step was resuspended in 1 ml of 16 M LiSCN containing 5% (v/v) BME and incubated for about an hour at room temperature. This resulted in complete dissolution and produced the final extract, which was held as the 16 M LiSCN/BME-soluble fraction at 20 C until the immunoblotting assays were performed.

    Analysis of Silk Proteins

    [0114] Silk glands from the ex vivo bombardment assays and also from the untreated parental and transgenic silkworms were homogenized on ice in sodium phosphate buffer (30 mM Na.sub.2PO.sub.4, pH 7.4) containing 1% (w/v) SDS and 5 M urea, then clarified for 5 minutes at 13,500 rpm in a microcentrifuge at 4 C. The supernatants were harvested as silk gland extracts and these extracts, as well as the sequential cocoon extracts described above were diluted 4 with 10 mM Tris-HCl/2% SDS/5% BME buffer and samples containing .sup.90 g of total protein were mixed 1:1 with SDS-PAGE loading buffer, boiled at 95 C. for 5 minutes, and loaded onto 4-20% gradient gels (Pierce Protein Products; Rockford, Ill.). After separation, proteins were transferred from the gels to PVDF membranes (Immobilon; Millipore, Billerica, Mass.) using a Bio-Rad transfer cell, according to the manufacturers' instructions. Immunodetection was performed using a spider silk protein specific polyclonal rabbit antiserum produced against the Nephila clavipes flagelliform silk-like A2 peptide (GenScript Corporation, Piscataway, N.J.) or a commercial EGFP-specific mouse monoclonal antibody (Living Colors GFP, Clontech Laboratories, Mountain View, Calif.) as the primary antibodies. The secondary antibodies were goat antirabbit IgG-HRP (Promega Corporation, Madison, Wis.) or goat anti-Mouse IgG H+L HRP conjugate (EMD Chemicals, Gibbstown, N.J.), respectively. All antibodies were used at 1:10,000 dilutions in a standard blocking buffer (1PBST/0.05% nonfat dry milk) and antibody-antigen reactions were visualized by chemiluminescence using a commercial kit (ECL Western Blotting Detection Reagents; GE Healthcare).

    Results:

    [0115] After each step in this procedure, the soluble and insoluble fractions were separated by centrifugation, the soluble fraction was held for immunoblotting, and the insoluble fraction was used for the next extraction. The final extraction solvent completely dissolved the remaining silk fibers. The immunoblotting controls verified that the spider silk protein-specific antiserum did not recognize any proteins in pnd-w1 silk fibers (FIG. 19B, lanes 3-6), but recognized the chimeric silkworm/A2S8.sup.14 spider silk protein produced in E. coli (FIG. 19B, lane 2). Sequential extraction of degummed cocoons from the transgenic animals using saline (FIG. 19B, lanes 8 and 13), SDS (FIG. 19B, lanes 9 and 14), and 8M LiSCN/2% -mercaptoethanol (FIG. 19B, lanes 10 and 15) failed to release any detectable immunoreactive proteins. However, subsequent extraction of the residual silk fibers with 16M LiSCN/5% -mercaptoethanol released an immunoreactive protein with a M.sub.r of .sup.106 kDa from the residual spider 6 (FIG. 19, lane 11) and two immunoreactive proteins with M.sub.rs of .sup.130 and .sup.110 kDa from the residual spider 6-GFP fibers (FIG. 19, lane 16). All of these proteins were larger than expected (78 kDa and 106 kDa for spider 6 and spider 6-GFP, respectively). Possible explanations for these differences include transcriptional/translational stuttering due to the highly repetitive nature of the spider silk sequences, anomalous migration of the protein products on SDS-PAGE, and/or post-translational modifications of the chimeric silkworm/spider silk proteins. The chimeric silkworm/A2S8.sub.14 spider silk protein produced in E. coli, which was the positive control for immunoblotting, also had a larger M.sub.r (.sup.75 kDa) than expected (60 kDa). The 16M LiSCN/5% -mercaptoethanol extracts from the degummed cocoons of both transgenic silkworm lines also included immunoreactive smears with M.sub.rs from .sup.40 to .sup.75 kDa, possibly reflecting degradation of the chimeric silkworm/spider silk proteins and/or premature translational terminations. Irrespective of the sizes of the transgene products or the reasons for their appearance, the sequential extraction results clearly demonstrated that the transgenic silkworms provided as described here expressed chimeric silkworm/spider silk proteins that were extremely stably incorporated into composite silk fibers.

    Example 10Mechanical Properties of Composite Silk Fibers

    [0116] The mechanical properties of degummed native and composite silk fibers of the composite silk fibers produced by the transgenic silkworms is described here.

    [0117] The methods by which the composite silk fibers were prepared for testing, and how the testing was conducted, is presented below in Methods.

    Methods:

    [0118] The degummed silkworm silk fibers used for mechanical testing had initial lengths (L.sub.0) of 19 mm. Single fiber testing was performed at ambient conditions (20-22 C. and 19-22% humidity) using an MTS Synergie 100 system (MTS Systems Corporation, Eden Prairie Minn.) mounted with both a standard 50 N cell and a custom-made 10 g load cell (Transducer Techniques, Temecula Calif.). The mechanical data (load and elongation) were recorded from both load cells with TestWorks 4.05 software (MTS Systems Corporation, Eden Prairie, Minn.) at a strain rate of 5 mm/min and frequency of 250 MHz, which allowed for the calculation of stress and strain values. The stress/strain curves from the data set gathered for each fiber were plotted using MATLAB (Version 7.1) to determine toughness (or energy to break), Young's Modulus (initial stiffness), maximum stress, and maximum extension (=maximum % strain).

    Results:

    [0119] The results demonstrated that degummed composite fibers containing either the EGFP-tagged or untagged chimeric silkworm/spider silk proteins had significantly greater extensibility and slightly improved strength and stiffness than the native fibers from pnd-w1 silkworms (Table 3 and FIG. 20). Table 3: The mechanical properties of 12-15 silk fibers produced by the parental and transgenic silkworms were measured under precisely matched conditions of temperature, humidity, and testing speeds and the average values and standard deviations are presented in the Table. The average mechanical properties of spider (Nephila clavipes) dragline silk fiber determined in parallel under the exact same conditions are included for comparison.

    TABLE-US-00003 TABLE 3 Mechanical Properties of Degummed Native and Composite Silk Fibers Spider 6-GFP Spider 6-GFP Dragline Pnd-w1 Spider 6 (line1) (line4) (Spider) Mechanical Property Avg SD Avg SD Avg SD Avg SD Avg Max Stress (MPa) 198.0 28.1 315.3 65.8 281.9 57.7 338.4 87.0 744.5 Max Strain (%) 22.0 5.8 31.8 5.2 32.5 4.3 31.1 4.5 30.6 Toughness MJ/m.sup.3 32.0 10.0 71.7 13.9 68.9 16.2 77.2 29.5 138.7 Young's modulus (MPa) 3705.0 999.6 5266.8 1656.5 4860.9 1269.2 5498.1 1181.2 9267.7 The mechanical properties of 12-15 silk fibers produced by the parental and transgenic silkworms were measured and the average values and standard deviations are presented in the Table. The optimal mechanical properties of spider (Nephila clavipes) dragline silk fiber determined under the same conditions are included for comparison.

    [0120] Thus, these composite fibers are tougher than the native silkworm silk fibers. The mechanical properties of the composite silks produced by the transgenic animals were more variable than those of native fibers produced by the parental strain. In addition, the composite fibers produced by two different spider 6-GFP lines had similar extensibility, but different tensile strengths. The variations observed in the mechanical properties of composite silk fibers within an individual transgenic line and the line-to-line variation may reflect heterogeneity in the composite fibers, the heterogeneity may be due to differences in the chimeric silkworm/spider silk protein ratios and/or the localization of these proteins along the fiber. One can see evidence of heterogeneity in the composite fibers in FIG. 18D. A comparison of the best mechanical performances observed for the composite fibers from the transgenic silkworms, native fibers from the parental silkworm, and a representative dragline spider silk fiber is shown in FIG. 20. The results showed that all of the composite fibers were tougher than the native silk fiber from pnd-w1 silkworms. Furthermore, the composite fiber from the transgenic spider 6-GFP line 4 silkworms was even tougher than a native spider dragline silk fiber tested under the same conditions. These results demonstrate that the incorporation of chimeric silkworm/spider silk proteins can significantly improve the mechanical properties of composite silk fibers produced using the transgenic silkworm platform.

    [0121] The best mechanical performances measured with native silkworm (pnd-w1) and spider (N. clavipes dragline) silk fibers are compared to those obtained with the composite silk fibers produced by transgenic silkworms. All fibers were tested under the same conditions. The toughest values are: silkworm pnd-w1 (blue line, 43.9 MJ/m3); spider 6 line 7 (orange line, 86.3 MJ/m3); spider 6-GFP line 1 (dark green line, 98.2 MJ/m3), spider 6-GFP line 4 (light green line, 167.2 MJ/m3); and N. clavipes dragline (red line, 138.7 MJ/m3). (See Table 3).

    Example 11Stably Incorporated Chimeric Silkworm/Spider Silk Protein-Containing Composite Fibers

    [0122] Spider silks have enormous use as biomaterials for many different applications. Previously, serious obstacles to spider farming crippled such as a natural manufacturing effort. The need to develop an effective biotechnological approach for spider silk fiber production is presented in the platform provided in the present disclosure. While other platforms have been described for use in the production of recombinant spider silk proteins, it has been difficult to efficiently process these proteins into useful fibers. The requirement to manufacture fibers, not just proteins, positions the silkworm as a qualified platform for this particular biotechnological application.

    [0123] A transgenic silkworm engineered to produce a spider silk protein was isolated using a piggyBac vector encoding a native Nephila clavipes major ampullate spidroin-1 silk protein under the transcriptional control of a Bombyx mori sericin (Ser1) promoter. The spidroin sequence was fused to a downstream sequence encoding a C-terminal fhc peptide. The transgenic silkworm isolated using this piggyBac construct produced cocoons containing the chimeric silkworm/spider silk protein, but this protein was only found in the loosely associated sericin layer. In contrast, the chimeric silkworm/spider silk protein produced by the presently disclosed transgenic silkworms was an integral component of composite fibers. The relatively loose association of the chimeric silkworm/spider silk protein designed by others, may, among other things, reflect the absence of an N-terminal silkworm fhc domain. Alternatively, the use of the Ser1 promoter in a piggyBac vector may, among other things, be inconsistent with proper fiber assembly, as this promoter is transcriptionally active in the middle silk gland, whereas the fhc, flc, and fhx promoters, which control expression of the fhc, fibroin light chain, and hexamerin proteins, respectively, are active in the posterior silk gland. The assembly of silkworm silk proteins into fibers is controlled, in part, by tight spatial and temporal regulation of silk gene expression. Thus, the presently disclosed vectors are engineered with the fhc promoter to drive accumulation of the chimeric silkworm/spider silk protein in the same place and at the same time as the native silk proteins, in order to facilitate stable integration of the chimeric protein into newly assembled, composite silk fibers. Others have described minor increases in the elasticity and tensile strength of fibers from the cocoons produced by some transgenic silkworms. However, the sericin layer was not removed prior to mechanical testing, and this degumming step is essential in the processing of cocoons for commercial silk fiber production. Thus, if cocoons had been processed in conventional fashion, the recombinant spider silk/silkworm protein would be removed, and the resulting silk fibers would not be expected to have improved mechanical properties.

    [0124] Transgenic silkworms producing spider silk proteins were reported as a relatively minor component of other studies, which focused on the regeneration of fibers from silk proteins dissolved in hexafluoro solvents. Nevertheless, this study described two transgenic silkworms produced with piggyBac vectors encoding extremely short, synthetic, silk-like sequences from Nephila clavipes major ampullate spidroin-1 or flagelliform silk proteins. Both silk-like peptides were embedded within N- and C-terminal fhc domains. Mechanical testing showed that the silk fibers produced by these transgenic animals had slightly greater tensile strength (41-73 MPa), and no change in elasticity. These workers also report that the relatively small changes observed in the mechanical properties of their composite fibers reflected a low level of recombinant protein incorporation. It is also possible that the specific spider silk-like peptide sequences used in those constructs and/or their small sizes may account, at least in part, for the relatively small changes in the mechanical properties of the composite fibers produced by those transgenic silkworms.

    [0125] The present transgenic silkworms and composite fibers are the first to yield transgenic silkworm lines that produce composite silk fibers containing stably integrated chimeric silkworm/spider silk proteins that significantly improve their mechanical properties. The composite spider silk/silkworm fiber produced by the present transgenic silkworm lines was even tougher than a native dragline spider silk fiber. Among other factors, this may at least in part be due to the use of the 2.4 kbp A2S8.sub.14 synthetic spider silk sequence encoding repetitive flagelliform-like (GPGGA).sub.4 (SEQ ID NO: 6) elastic and major ampullate spidroin-2 [linker-alanine.sub.8] crystalline motifs (alanine.sub.8 disclosed as SEQ ID NO: 5). This relatively large synthetic spider silk protein may be spun into fibers by extrusion after being produced in E. coli, indicating that it retained the native ability to assemble into fibers. However, this protein would be expressed in concert and would have to interact with the endogenous silkworm fhc, flc, and fhx proteins in order to be incorporated into silk fibers. Thus, the A2S8.sub.14 spider silk sequence was embedded within N- and C-terminal fhc domains to direct the assembly process. Together with the ability of the fhc promoter to drive their expression in spatial and temporal proximity to the endogenous silkworm silk proteins, these features may at least in part account for the ability of the chimeric silkworm/spider silk proteins to participate in the assembly of composite silk fibers and contribute significantly to their mechanical properties.

    Example 12piggyBac Vector Constructs and PCR Amplification of Components of piggyBac Vectors

    [0126] Several gene fragments were isolated by polymerase chain reactions with genomic DNA isolated from the silk glands of Bombyx mori strain P50/Daizo and the gene-specific primers shown in Table 4. These fragments included the fhc major promoter and upstream enhancer element (MP-UEE), two versions of the fhc basal promoter (BP) and N-terminal domain (NTD; exon 1/intron 1/exon 2) with different 5- and 3-flanking restriction sites, the fhc C-terminal domain (CTD; 3 coding sequence and poly A signal), and EGFP. In each case, the amplification products were gel-purified, and DNA fragments of the expected sizes were excised and recovered. Subsequently, the fhc MP-UEE, fhc CTD, and EGFP fragments were cloned into pSLfa1180fa, the two different NTD fragments were cloned into pCR4-TOPO (Invitrogen Corporation, Carlsbad, Calif.), and E. coli transformants containing the correct amplification products were identified by restriction mapping and verified by sequencing. These fragments were than used to assemble the piggyBac vectors used in this study as follows. The synthetic A2S8.sub.14 spider silk sequence was excised from a pBluescript SKII+ plasmid precursor with BamHI and BspEL, gel-purified, recovered, and subcloned into the corresponding sites upstream of the CTD in the pSL intermediate plasmid described above. This step yielded a plasmid designated pSL-spider6-CTD. A NotI/BamHI fragment was then excised from one of the pCR4-TOPO-NTD intermediate plasmids described above, gel-purified, recovered, and subcloned into the corresponding sites upstream of the spider 6-CTD sequence in pSL-spider 6-CTD to produce pSL-NTD-spider 6-CTD. In parallel, a NotI/XbaI fragment was excised from the other pCR4-TOPO-NTD intermediate plasmid described above, gel-purified, recovered, and subcloned into the corresponding sites upstream of the EGFP amplimer in the pSL-EGFP intermediate plasmid described above. This produced a plasmid containing NTD-EGFP fragment, which was excised with NotI and BamHI and subcloned into the corresponding sites upstream of the spider6-CTD sequences in pSL-spider 6-CTD. The MP-UEE fragment was then excised with SfiI and NotI from the pSL intermediate plasmid described above, gel-purified, recovered, and subcloned into the corresponding sites upstream of the NTD-spider 6-CTD and NTD-EGFP-spider 6-CTD sequences in the two different intermediate pSL plasmids described above. Finally, the completely assembled MP-UEE-NTD-A2S8.sub.14-CTD or MP-UEE-NTD-EGFP-A2S8.sub.14-CTD cassettes were excised with AScl and Fsel from the respective final pSL plasmids and subcloned into the corresponding sites of pBAC[3XP3-DsRedaf] (Horn, et al. (2002), Insect Biochem. Mol. Biol., 32:1221-1235). This final subcloning step yielded two separate piggyBac vectors that were designated spider 6 and spider 6-EGFP to denote the absence or presence of the EGFP marker. The following table provides a listing of some of the key components of the piggyBac vectors used. Table 4 discloses SEQ ID NOS 7-17, respectively, in order of appearance.

    TABLE-US-00004 TABLE4 PCRPrimers Amplifi- Restr Tem- Primer cation Site(s) plate combination Products& # Name Sequence(5 to3) Added DNA forPCRs Sizes 1 Major TAACTCGAGGCTCAAAGCCTCATCCCAATT 5 Xho FhcMajor pro TGGAG I Promoter (SP) 2 Major ATACCGCGGTGCAGAAGACAAGCCATCGCA 3 Sac 1&2 5,000to pro ACGGTG II 3,844 (ASP) (1,157bp) 3 UEE ATACCGCGGAAAGATGTTTTGTACGGAAAG 5 Sac 3&4 Fhc (SP) TTTGAA II Enhancer 1,659to 1,590 (70bp) 4 UEE TTAGCGGCCGCCGAACCCTAAAACATTGTT 3 Not B.mori (ASP) ACGTTACGTTACTTG I genomic 5 Fhc TAAGCGGCCGCGGGAGAAAGCATGAAGTAA 5 Not DNA 5&65&7 Spider6 pro+ GTTCTTTAAATATTACAAAAA I ()(+) EGFP NTD ()or(+) (SP) expression cassettes 6 Fhc ATAGGATCCACGACTGCAGCACTAGTGCTG 3 Bam FhcBasal Pro+ CTGAAATCGC HI Promoter& NTD 5 cds (ASP) 7 Fhc ATATCTAGAACGACTGCAGCACTAGTGCTG 3 Xba +62,118to Pro+ CTGAAATCGC I +63,816 NTD (1,744bp) (ASP for EGFP) 8 EGFP CAATCTAGACGTGAGCAAGGGCGAGGAGCT 5 Xba pEGFP-N1 8&9 EGFP (SP) GTTCACC I plasmid (720bp) 9 EGFP TAAGGATCCAGCTTGTACAGCTCGTCCATG 3 Bam DNA (ASP) CCGAGAG HI 10 FHc ATACCCGGGAAGCGTCAGTTACGGAGCTGG 5 Xma B.mori 10&11 Fhc3 CTD CAG I genomic cds& (SP) poly-A signal 11 Fhc CAAGCTGACTATAGTATTCTTAGTTGAGAA 3 Sal DNA +79,021to CTD GGCATAC I +79,500 (ASP) (480bp)

    Example 13masp Cloning

    [0127] The present example demonstrates the utility of the present invention by providing genetic constructs that contain the NTD region within a plasmid, and in particular, the pXLBacII-ECFP plasmid.

    [0128] Potential positive clones containing the NTD region with the pXLBacII-ECFP plasmid are shown by colony screening with PCR.

    [0129] The genetic construct masp for the pXLBacII-ECFP NTD CTD maspX16 (10,458 bp) (FIG. 12A) and pXLBacII-ECFP NTD CTD maspX24 (11,250 bp) (FIG. 12B) were created.

    [0130] It will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit and scope of the invention. Thus, it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents.

    BIBLIOGRAPHY

    [0131] The present references are hereby specifically incorporated herein by reference. [0132] 1. Berghammer, A., Bucher, G., Maderspacher, F., and Klingler, M. (1999), Dev. Genes Evol., 209: 382-389. [0133] 2. Birnboim, H. C., and Doly, J. (1979), Nucl. Acids Res., 7: 1513-1523. [0134] 3. Brooks, A. E., Creager, M., and Lewis, R. V. (2005), Altering the Mechanics of Spider Silk Through Methanol Post-spin Draw. In Biomedical Sciences Instrumentation, Vol. 41, pp. 1-6. [0135] 4. Cary, L. C., et al. (1989), Virology, 172: 156-169. [0136] 5. Choudary, P. V., Kamita, S. G., and Maeda, S. (1995), Expression of foreign genes in Bombyx mori larvae using baculovirus vectors. In Baculovirus expression protocols (C. D. Richardson, Ed.), Vol. 39, pp. 243-264. Humana Press, Clifton, N.J. [0137] 6. Colgin, M., and Lewis, R. V. (1998), Protein Science, 7: 667-672. [0138] 7. Denny, M. W. (1980), Symp. Soc. Exp. Biol., 34: 247-272. [0139] 8. Dooling, D. (2005), Growing your own spare parts: NASA assists ligament replacement research. [0140] 9. Elick, T. A., Bauser, C. A., Principe, N. M., and Fraser, M. J., Jr. (1996), Genetica, 97: 127-139. [0141] 10. Fahnestock, S. R., and Bedzyk, L. A. (1997), Appl. Microbiol. Biotechnol., 47: 33-39. [0142] 11. Fraser, M. J. (2000), The TTAA-specific family of transposable elements. In Insect Transgenesis: Methods and Applications. (A. A. James, and A. H. Handler, Eds.). CRC Press, Orlando. [0143] 12. Fraser, M. J., Brusca, J. S., Smith, G. E., and Summers, M. D. (1985), Virology, 145: 356-361. [0144] 13. Fraser, M. J., Cary, L., Boonvisudhi, K., and Wang, H. G. (1995), Virology, 211: 397-407. [0145] 14. Fraser, M. J., Smith, G. E., and Summers, M. D. (1983), J. Virol., 47: 287-300. [0146] 15. Gatesy, J., Hayashi, C., Motriuk, D., Woods, J., and Lewis, R. (2001), Science, 291: 2603-2605. [0147] 16. Gosline, J. M., Denny, M. W., and DeMont, M. E. (1984), Nature 309: 551-552. [0148] 17. Handler, A. M., and Gomez, S. P. (1995), Mol. Gen. Genet., 247: 399-408. [0149] 18. Handler, A. M., and Gomez, S. P. (1996), Genetics, 143: 1339-1347. [0150] 19. Handler, A. M., and Harrell, R. A., 2nd (1999), Insect Mol. Biol., 8: 449-457. [0151] 20. Handler, A. M., and Harrell, R. A., 2nd (2001), Insect Biochem. Mol. Biol., 31: 199-205. [0152] 21. Handler, A. M., McCombs, S. D., Fraser, M. J., and Saul, S. H. (1998), Proc. Natl. Acad. Sci. U.S.A., 95: 7520-7525. [0153] 22. Hayashi, C. Y., and Lewis, R. V. (2000), Science, 287: 1477-1479. [0154] 23. Hayashi, C. Y., Shipley, N. H., and Lewis, R. V. (1999), Int. J. Biol. Macromol., 24: 271-275. [0155] 24. Hinman, M. B., and Lewis, R. V. (1992), J. Biol. Chem., 267: 19320-19324. [0156] 25. Holland, C., Terry, A. E., Porter, D., and Vollrath, F. (2006), Nat. Mater., 5: 870-874. [0157] 26. Horard, B., Mange, A., Pelissier, B., and Couble, P. (1994), Insect Mol. Biol., 3: 261-265. [0158] 27. Horn, C., Jaunich, B., and Wimmer, E. A. (2000), Dev. Genes Evol., 210: 623-629. [0159] 28. Huemmerich, D., et al. (2004), Curr., Biol. 14: 2070-2074. [0160] 29. Imamura, M., et al. (2003), Genetics, 165: 1329-1340. [0161] 30. Inoue, S., et al. (2005), Insect Biochem. Mol. Biol., 35: 51-59. [0162] 31. Inoue, S., et al. (2000), J. Biol. Chem., 275: 40517-40528. [0163] 32. Lazaris, A., et al. (2002), Science 295: 472-476. [0164] 33. Lewis, R. V., et al. (1996), Prot. Expr. Purif., 7: 400-406. [0165] 34. Lobo, N., Li, X., and Fraser, M. J., Jr. (1999), Mol. Gen. Genet., 261: 803-810. [0166] 35. Maeda, S., et al. (1985), Nature, 315: 592-594. [0167] 36. Mori, K., et al. (1995). J. Mol. Biol. 251: 217-228. [0168] 37. O'Brochta, D. A., Gomez, S. P., and Handler, A. M. (1991), Mol. Gen. Genet. 225: 387-394. [0169] 38. Peloquin, J. J., et al. (2000), Insect Mol. Biol., 9: 323-333. [0170] 39. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989), Molecular Cloning: A Laboratory Manual. 2nd edition ed. Cold Spring Harbor Press, Cold Spring Harbor, N.Y. [0171] 40. Scheller, J., Guhrs, K. H., Grosse, F., and Conrad, U. (2001), Nat. Biotechnol., 19: 573-577. [0172] 41. Southern, E. M. (1975), J. Mol. Biol., 98: 503-517. [0173] 42. Takei, F., et al. (1984), J. Cell Biol., 99: 2005-2010. [0174] 43. Tamura, T., et al. (2000), Nat. Biotechnol., 18: 81-84. [0175] 44. Thibault, S. T., Luu, H. T., Vann, N., and Miller, T. A. (1999), Insect Mol. Biol., 8: 119-123. [0176] 45. Thomas, J. L., et al. (2002), Insect Biochem. Mol. Biol., 32, 247-253. [0177] 46. Tomita, M., et al. (2003), Nat. Biotechnol., 21: 52-56. [0178] 47. Towbin, H., et al. (1979), Proc. Natl. Acad. of Sci. U.S.A., 76: 4350-4354. [0179] 48. Urry, D. W. (2002), Philosophical Transactions of the Royal Society of London B 357:169-184. [0180] 49. Wang, H. G., and Fraser, M. J. (1993), Insect Mol. Biol., 1: 109-116. [0181] 50. Wang, H. H., Fraser, M. J., and Cary, L. C. (1989), Gene., 81: 97-108. [0182] 51. Wong Po Foo, C., et al. (2006), Appl. Phys. A., 82: 223-233. [0183] 52. Wurm, F. M. (2003), Nat. Biotechnol., 21: 34-35. [0184] 53. Xu, M., and Lewis, R. V. (1990), Proc. Natl. Acad. Sci. U.S.A., 87: 7120-7124. [0185] 54. Yamao, M., et al. (1999), Genes. Dev., 13: 511-516. [0186] 55. Yun, et al. (2001), Altering fibrin heavy chain gene of silkworm Bombyx mori by homologous recombination, Shengwu Huaxe yu Shengwu Wuli Xuebao 33(1): 112-116. [0187] 56. GenBank Acc. No. AF226688, Zhou, et al. Bombyx mori fibroin heavy chain Fib-H (fib-H) gene, complete cds., US Natl. Library of Medicine, Bethesda, Md., USA, Jun. 19, 2000. [0188] 57. Zhao, et al. (2001), Acta Biochimica et Biophysica Sinica, 33(1): 112-116. [0189] 58. Zhang, et al. (1999), Acta Biochimica et Biophysica Sinica, 31(2): 119-123. [0190] 59. Zhou, C. Z., et al. (2000), Nucleic Acids Res., 28. (12): 2413-2419. [0191] 60. Tomita, M., et al. (2003), Nat. Biotechnol., 21 (1): 52-56. [0192] 61. Yoshizato, Katsutoshi, A Proposal for Application of Recombinant Insects (Kumikaetai Konchu Riyo Eno Teigen), Sanshi Konchuken Shiryo, No. 28, pp. 93-95. [0193] 62. Toshiki, et al. (2000), Nature Biotechnology, 16: 81-85. [0194] 63. Okano, et al. (2000), Journal of Interferon and Cytokine Research, 20: 1015-1022. [0195] 64. Xiao-Hui, et al. (2000), Acta Pharmacol. Sin., 21 (9): 797-801. [0196] 65. Ishihara, et al. (1999), Biochimica et Biophysica Acta, 1451: 48-58. [0197] 66. T. Tamura, Construction and utilization of transgenic silkworm using transposon, Fiber Preprints, Japan, Vol. 56, No. 2, 2001, p. 38-41. [0198] 66b. A. Yanai, et al. (2002), Research Journal of Food and Agriculture, 25 (2): 30-33. [0199] 67. T. Tamura, et al. (2000), Agriculture and Horticulture, 75 (8): 17-24. [0200] 68. Yoshizato, Katsutoshi (2001), A Proposal for Application of Recombinant Insects (Kumikaetai Konchu Riyo Eno Teigen), Sanshi Konchuken Shiryo, 28: 93-95. [0201] 69. U.S. Pat. No. 7,674,882Kaplan, et al. [0202] 70. U.S. Pat. No. 7,659,112Hiramatsu, et al. [0203] 71. U.S. Pat. No. 7,521,228Lewis, et al. [0204] 72. U.S. Pat. No. 6,268,169Fahnestock. [0205] 73. U.S. Pat. No. 5,994,099Lewis. [0206] 74. U.S. Pat. No. 5,989,894Lewis. [0207] 75. U.S. Pat. No. 5,756,677Lewis [0208] 76. U.S. Pat. No. 5,733,771Lewis. [0209] 77. Kluge, J. A., Rabotyagova, O., Leisk, G. G. & Kaplan, D. L. (2008), Trends Biotechnol., 26:244-251. [0210] 78. Scheibel, T. (2004), Microb. Cell. Fact. 3, 14. [0211] 79. MacIntosh, A. C., Kearns, V. R., Crawford, A. & Hatton, P. V. (2008), J. Tiss. Engr. Reg. Med., 2:71-80. [0212] 80. Gosline, J. M., Guerette, P. A., Ortlepp, C. S. & Savage, K. N. (1999), J. Exp. Biol., 202:3295-3303. [0213] 81. Lewis, R. V. (2006), Chem. Rev., 106:3762-3774. [0214] 82. Hardy, J. G., L. M., R. & T. R. (2008), S., Polymer, 49:4309-4327. [0215] 83. Teul, F., et al. (2007), J. Mat. Sci., 42:8974-8985. [0216] 84. Teul, F., et al. (2009), Nat. Protoc. 4:341-355. [0217] 85. Fahnestock, S. R. & Irwin, S. L. (1997), Appl. Microbiol. Biotechnol., 47:23-32. [0218] 86. Fahnestock, S. R. & Bedzyk, L. A. (1997), Appl. Microbiol. Biotechnol., 47:33-39. [0219] 87. Zhang, Y., et al. (2008), Mol. Biol. Rep. 35:329-335. [0220] 88. Miao, Y., et al. (2006), Appl. Microbiol. Biotechnol., 71:192-199. [0221] 89. Kato, T., Kajikawa, M., Maenaka, K. & Park, E. Y. (2010), Appl. Microbiol. Biotechnol., 85:459-470. [0222] 90. Royer, C., et al. (2005), Transgenic Res., 14:463-472. [0223] 91. Kojima, K., et al. (2007), Biosci. Biotechnol. Biochem. 71, 2943-2951. [0224] 92. Kurihara, H., Sezutsu, H., Tamura, T. & Yamada, K. (2007), Biochem. Biophys. Res. Commun., 355:976-980. [0225] 93. Shimizu, K., et al. (2007), Insect Biochem. Mol. Biol., 37:713-725. [0226] 94. Yanagisawa, S., et al. (2007), Biomacromolecules, 8:3487-3492. [0227] 95. Wen, H., et al. (2010), Mol. Biol. Rep., 37:1815-1821. [0228] 96. Zhu, Z., et al. (2010), J. Biomater. Sci. olym. Ed., 21:395-411. [0229] 97. Sehnal, F. & Akai, H. (1990), Int. Insect Morph. Embryol., 19:79-132. [0230] 98. Horn, C., et al. (2002), Insect Biochem. Mol. Biol., 32:1221-1235. [0231] 99. Yamada, H., Nakao, H., Takasu, Y. & Tsubouchi, K. (2001), Mat. Sci. Engr. C, 14:41-46. [0232] 100. U.S. Pat. No. 5,728,810 Lewis.