INHIBITORS

Abstract

The invention provides a portion of multimerin 2 (MMRN2) or a variant thereof, that inhibits the interaction between CLEC14A and MMRN2, in addition to a portion of MMRN2 or a variant thereof, that inhibits the interaction between CD93 and MMRN2. The invention provides compounds comprising said portions and either a cytotoxic moiety or a detectable moiety.

Claims

1. A portion of multimerin 2 (MMRN2) or a variant thereof, that inhibits the interaction between CLEC14A and MMRN2.

2. A portion of MMRN2 according to claim 1, wherein the portion binds to CLEC14A, optionally wherein the portion binds to a region of CLEC14A corresponding to the region spanning amino acid residues 97-108 of the human CLEC14A polypeptide.

3. A portion of MMRN2 according to claim 1 or 2, wherein the portion does not bind to a mutant CLEC14A polypeptide in which the cysteine corresponding to cysteine-103 of human CLEC14A is mutated and/or the cysteine corresponding to cysteine-138 of human CLEC14A is mutated.

4. An agent that inhibits the interaction between CD93 and MMRN2, optionally wherein the portion is as defined in any of claims 1-3.

5. An agent according to claim 4, wherein the agent is a polypeptide, a peptide, a polynucleotide, a peptidomimetic, a natural product, a carbohydrate, an aptamer or a small molecule.

6. An agent according to claim 4 or 5, wherein the agent is a portion of MMRN2 or a variant thereof.

7. A portion of MMRN2 according to claim 6, wherein the portion binds to CD93, optionally wherein the portion binds to a region of CD93 corresponding to the region spanning amino acid residues 97-108 of the human CD93 polypeptide.

8. A portion of MMRN2 according to claim 6 or 7, wherein the portion does not bind to a mutant CD93 polypeptide in which the cysteine corresponding to cysteine-104 of human CD93 is mutated and/or the cysteine corresponding to cysteine-136 of human CD93 is mutated.

9. A portion of MMRN2 according to any of claims 1-3, 7 and 8, wherein the portion comprises or consists of the coiled-coil domain of MMRN2, or part thereof.

10. A portion of MMRN2 according to claim 9, wherein the coiled-coil domain of MMRN2 corresponds to amino acid residues 133-820 of human MMRN2.

11. A portion of MMRN2 according to any of claims 1-3 and 7-10, wherein the portion comprises or consists of a region of MMRN2 corresponding to the region spanning amino acid residues 487-820 or 487-674 or 495-678 or 495-674 or 530-624 or 588-620 of human MMRN2, or a part thereof.

12. A portion of MMRN2 according to claim 11, wherein the portion comprises or consists of a region corresponding to the region spanning amino acid residues 495-674 of human MMRN2, or a part thereof.

13. A portion of MMRN2 according to any of claims 1-3 and 7-12, wherein the portion is 400 amino acids in length or less, such as 300 amino acids or less, or 200 amino acids or less, or 100 amino acids or less.

14. A portion of MMRN2 according to any of claims 1-3 and 7-13, wherein the portion comprises the structure BnX.sup.1[V/L]X.sup.2X.sup.3LX.sup.4X.sup.5X.sup.6FX.sup.7X.sup.8LLX.sup.9DAX.sup.10RHX.sup.11X.sup.12X.sup.13LX.sup.14X.sup.15LX.sup.16GEEX.sup.17X.sup.18X.sup.19J.sub.r wherein B is a first chemical moiety, X.sup.1-X.sup.19 are any amino acid, J is a second chemical moiety, n=0 or 1, and r=0 or 1 (Formula I), optionally wherein: X.sup.1 is any basic amino acid, such as Glu, Asp, Lys or His; X.sup.2 is Arg or Lys or Gln; X.sup.3 is any amino acid; X.sup.4 is His or Glu or Ser or Asn; X.sup.5 is Ser or Gly or Ala; X.sup.6 is Ala or Ser or Thr; X.sup.7 is any amino acid; X.sup.8 is Ala or Thr or Ser; X.sup.9 is Glu or Gln or Asn; X.sup.10 is Leu or Thr or Val or Met;) X.sup.11 is Glu or Gln or Ser; X12 is Ala or Asp or Glu; X.sup.13 is Val or Ala; X.sup.14 is Ala or Glu; X.sup.15 is Ala or Ile or Val; X.sup.16 is Phe or Leu; X.sup.17 is Val or Met or Phe; X18 is Leu or Met or Val or Ile; and X.sup.19 is Glu or Asp.

15. A portion of MMRN2 according to any of claims 1-3 and 7-14, wherein the portion comprises one or more or all amino acids corresponding to any of the following amino acids according to the numbering of human MMRN2 in FIG. 15: Leu-536, Val-575, Leu-578, Val-589, Leu-592, Phe-596, Leu-599, Leu-600, Asp-602, Ala-603, Arg-605, His-606, Leu-610, Leu-613, Gly-615, Glu-616, Glu-617, and Leu-658.

16. A portion of MMRN2 according to any of claims 1-3 and 7-15, wherein the portion comprises one or more or all amino acids corresponding to any of the following amino acids according to the numbering of human MMRN2 in FIG. 15: Leu-497, Glu-506, Gln-527, Val-540, Ala-546, Val-609, Glu-620, Gln-636, Ile-637, Leu-641, Leu-648 and Glu-666.

17. A portion of MMRN2 according to any of claims 1-3 and 7-16, wherein the portion has at least 50% sequence identity to the region spanning amino acid residues 495-674 of human MMRN2.

18. A portion of MMRN2 according to any of claims 1-3 and 7-17, wherein the portion comprises or consists of the amino acid sequence of any of the MMRN2 portions listed in FIG. 8, or any part or variant of said portions.

19. A portion of MMRN2 according to any of claims 1-3 and 7-18, wherein the portion inhibits angiogenesis in an angiogenesis assay, optionally wherein the angiogenesis assay is an aortic ring assay, a sponge angiogenesis assay, an assay of endothelial cell proliferation, an assay of endothelial cell migration and/or an assay of endothelial cell invasion.

20. A portion of MMRN2 according to any of claims 1-3 and 7-19, wherein the portion inhibits tumour growth in an assay of tumour growth.

21. A portion of MMRN2 according to any of claims 1-3 and 7-20, wherein the portion comprises a stabilising moiety at one or both termini.

22. A portion of MMRN2 according to claim 21, wherein the stabilising moiety is any of a amido, acetyl, benzyl, phenyl, tosyl, alkoxycarbonyl, alkyl carbonyl, or benzyloxycarbonyl moiety.

23. A portion of MMRN2 according to any of claims 1-3 and 7-22, wherein the portion is a portion of a variant of MMRN2.

24. A portion of MMRN2 according to claim 23, wherein the variant of MMRN2 has at least 30% sequence identity to the amino acid sequence of human MMRN2.

25. A fusion protein comprising a portion of MMRN2 according to any of claims 1-3 and 7-24, wherein the fusion protein does not comprise wild type MMRN2.

26. An antibody that selectively binds to a portion of MMRN2 according to any of claims 1-3 and 7-24.

27. An antibody according to claim 26, wherein the antibody selectively binds to the coiled-coil domain of MMRN2, or part thereof, optionally wherein the coiled-coil domain of MMRN2 corresponds to amino acid residues 133-820 of human MMRN2.

28. An antibody according to claim 27, wherein the antibody selectively binds to a region of MMRN2 corresponding to the region spanning amino acid residues 487-820 or 487-674 or 495-678 or 495-674 or 530-624 or 588-620 of human MMRN2, or a part thereof.

29. An antibody according to claim 28, wherein the antibody selectively binds to a region corresponding to the region spanning amino acid residues 495-674 of human MMRN2, or a part thereof.

30. A nucleic acid molecule encoding the portion of MMRN2 of any of claims 1-3 and 7-24, or the fusion protein of claim 25, or the antibody of any of any of claims 26-29.

31. A vector, such as an expression vector, comprising the nucleic acid molecule of claim 30.

32. A host cell comprising the nucleic acid molecule of claim 30 or the vector of claim 31.

33. A compound comprising (i) a portion of MMRN2 according to any of claims 1-3 and 7-24 and (ii) a detectable moiety.

34. A compound according to claim 33, wherein the detectable moiety comprises an enzyme, a radioactive atom, a fluorescent moiety, a chemiluminescent moiety or a bioluminescent moiety.

35. A compound according to claim 34, wherein the detectable moiety comprises an affinity tag, such as a histidine tag or an Fc tag or a BirA tag.

36. A compound comprising (i) a portion of MMRN2 according to any of claims 1-3 and 7-24, and (ii) a cytotoxic moiety.

37. A compound according to claim 36 wherein the cytotoxic moiety is selected from a directly cytotoxic chemotherapeutic agent, a directly cytotoxic polypeptide, a moiety which is able to convert a prodrug into a cytotoxic drug, a radiosensitizer, a directly cytotoxic nucleic acid, an antibody (eg an antibody that binds to a cytotoxic immune cell such as a T cell) a nucleic acid molecule that encodes a directly or indirectly cytotoxic polypeptide, or a radioactive atom

38. A compound according to claim 37 wherein the radioactive atom is phosphorus-32, iodine-125, iodine-131, indium-111, rhenium-186, rhenium-188 or yttrium-90.

39. A chimeric antigen receptor (CAR) comprising (a) a portion of MIVIRN2 or a variant thereof that binds to CLEC14A and/or CD93; (b) a transmembrane domain; and (c) an intracellular signalling domain.

40. A CAR according to claim 39, wherein the portion of MMRN2 is as defined in any of claims 3 and 7-24.

41. A CAR according to claim 39 or 40, wherein the transmembrane domain comprises the transmembrane domain of a protein, optionally wherein the transmembrane domain of the protein is selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD8, CD45 and CD4.

42. A CAR according to any of claims 39-41, wherein the portion of MMRN2 is connected to the transmembrane domain by a hinge region.

43. A CAR according to any of claims 39-42, wherein the intracellular signalling domain comprises one or more immunoreceptor tyrosine-based activation motifs (ITAMs).

44. A CAR according to any of claims 39-43, wherein the intracellular signalling domain comprises a signalling domain of CD3 zeta, Fc receptor gamma, Fc receptor beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b and CD66d.

45. A CAR according to any of claims 39-44, wherein the CAR further comprises one or more costimulatory domains.

46. A CAR according to claim 45, wherein the costimulatory domain is a functional signalling domain obtained from a protein selected from the group consisting of CD28, 41BB, OX40, ICOS and DAP10.

47. A CAR according to any of claim 39-46, wherein the intracellular portion of the CAR comprising the signalling domain of CD3 zeta and the signalling domain of CD28.

48. A CAR according to any of claims 39-47, wherein the CAR further comprises a leader sequence.

49. A CAR according to claim 48, wherein the leader sequence comprises the oncostatin M leader sequence MGVLLTQRTLLSLVLALLFPSMAS.

50. A nucleic acid molecule encoding the CAR of any of claims 39-49.

51. A vector comprising a nucleic acid molecule of claim 50.

52. A cell comprising the nucleic acid molecule of claim 50 or the vector of claim 51.

53. A cell comprising a CAR according to any of claims 39-49.

54. A method of producing a cell comprising introducing a nucleic acid molecule of claim 50 or the vector of claim 51 into a cell.

55. A cell according to claim 52 or 53 or a method according to claim 54, wherein the cell is a T cell or natural killer cell.

56. A pharmaceutical composition comprising an MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49; and a pharmaceutically acceptable diluent, carrier or excipient.

57. A composition comprising an MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49, which composition further comprises at least one additional anti-cancer agent and/or at least one additional anti-angiogenic agent.

58. An MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-37, or a CAR according to any of claims 39-49; for use in medicine.

59. A method of inhibiting angiogenesis in an individual, the method comprising administering to the individual an MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49.

60. An MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49; for use in inhibiting angiogenesis in an individual.

61. Use of an MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49, in the preparation of a medicament for inhibiting angiogenesis in an individual.

62. A method of combating a disease or condition in an individual, selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation, the method comprising administering to the individual an MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49.

63. Use of an MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49 in the preparation of a medicament for combating a disease or condition in an individual selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation.

64. An MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49 for use in the preparation of a medicament for combating a disease or condition in an individual selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation.

65. A method of targeting a cytotoxic moiety to neovasculature in the body of an individual, the method comprising: administering to the individual a compound comprising (i) a MMRN2 portion according to any of claims 1-3 and 7-24; and (ii) a cytotoxic moiety.

66. A compound comprising (i) a MMRN2 portion according to any of claims 1-3 and 7-24; and (ii) a cytotoxic moiety, for use in targeting a cytotoxic moiety to neovasculature in the body of an individual.

67. Use of a compound comprising (i) a MMRN2 portion according to any of claims 1-3 and 7-24; and (ii) a cytotoxic moiety, in the preparation of a medicament for targeting a cytotoxic moiety to neovasculature in the body of an individual.

68. A method according to any of claims 59, 62 and 65, or a use according to any of claims 60, 61, 63, 64, 66 and 67, wherein at least one further anticancer agent and/or at least one further anti-angiogenesis agent is administered to the individual.

69. A method according to any of claims 59, 62, 65 and 68, or a use according to any of claims 60, 61, 63, 64, and 66-68, wherein the individual is one who is administered at least one further anticancer agent and/or at least one further anti-angiogenesis agent.

70. A method or use according to claim 68 or 69, wherein the at least one further anticancer agent is selected from cisplatin; carboplatin; 5-flurouracil; paclitaxel; mitomycin C; doxorubicin; gemcitabine; tomudex; pemetrexed; methotrexate; irinotecan, fluorouracil and leucovorin; oxaliplatin, 5-fluorouracil and leucovorin; and paclitaxel and carboplatin and/or wherein the at least one further anti-angiogenesis agent is bevacizumab (Avastin).

71. A method of imaging neovasculature in the body of an individual the method comprising: administering to the individual a compound comprising (i) an MMRN2 portion according to any of claims 1-3 and 7-24; and (ii) a detectable moiety, and imaging the detectable moiety in the body.

72. A method according to claim 71 further comprising the step of detecting the location of the compound in the individual.

73. A method according to claim 71 or 72 wherein the detectable moiety comprises iodine-123, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, technetium-99m, gadolinium, manganese or iron.

74. A method or use according to any of the preceding claims wherein the individual is a human.

75. A method or a use according to any of the preceding claims wherein the individual has a solid tumour.

76. A method or a use according to claim 75, wherein the solid tumour is a tumour of the colon, rectum, ovary, liver, bladder, prostate, breast, kidney, pancreas, stomach, oesophagus, lung or thyroid.

77. An ex vivo or in vitro method of inhibiting angiogenesis, the method comprising administering an MMRN2 portion according to any of claims 1-3 and 7-24 or an agent according to any of claims 4-6, or an antibody according to any of claims 26-29, to endothelial cells or to an angiogenesis model, ex vivo or in vitro.

78. A complex comprising: a MMRN2 portion according to any of claims 1-3 and 7-24; and (ii) (a) CLEC14A or a portion or variant thereof, said portion or variant being capable of binding to MMRN2, and/or (b) CD93 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.

79. A kit of parts comprising: (i) a MMRN2 portion according to any of claims 1-3 and 7-24; and (ii) (a) CLEC14A or a portion or variant thereof, said portion or variant being capable of binding to MMRN2, and/or (b) CD93 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.

80. A nucleic acid molecule capable of expressing: (i) a MMRN2 portion according to any of claims 1-3 and 7-24; and (ii) (a) CLEC14A or a portion or variant thereof, said portion or variant being capable of binding to MMRN2, and/or (b) CD93 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.

81. A complex according to claim 78, a kit of parts according to claim 79, and a nucleic acid molecule according to claim 80, wherein the portion or variant of CLEC14A comprises or consists of the C-type lectin domain of CLEC14A or a variant thereof

82. A complex according to any of claim 78 or 81, a kit of parts according to claim 79 or 81, and a nucleic acid molecule according to claim 80 or 81, wherein the portion or variant of CLEC14A comprises or consists of a region of CLEC14A corresponding to the region spanning amino acid residues 97-108 of human CLEC14A or a variant thereof

83. A complex according to any of claims 78, 81 and 82, a kit of parts according to any of claims 79, 81 and 82, and a nucleic acid molecule according to any of claims 80-82, wherein the portion or variant of CD93 comprises or consists of the region corresponding to the region spanning amino acid residues 97-108 of human CD93 or a variant thereof.

84. A mutant MMRN2 polypeptide which has reduced binding to CLEC14A relative to wild type MMRN2.

85. A mutant MMRN2 polypeptide according to claim 84, wherein the mutant MMRN2, when compared to the corresponding wild type MMRN2, comprises one or more different amino acids in the region of MMRN2 corresponding to the region spanning amino acid residues 588-620 of human MMRN2.

86. A mutant MMRN2 polypeptide according to claim 84 or 85, wherein the mutant MMRN2 is a portion of MMRN2 consisting of the region of MMRN2 corresponding to the region spanning amino acid residues 495-603 or 487-603 or 604-674 of human MMRN2.

87. A mutant MMRN2 polypeptide according to any of claims 84-86, wherein the mutant MMRN2, when compared to the corresponding wild type MMRN2, has a different amino acid at a position which corresponds to any one or more of the following positions according to the numbering of the human MMNR2 as set out in FIG. 15: Leu-536, Val-575, Leu-578, Val-589, Leu-592, Phe-596, Leu-599, Leu-600, Asp-602, Ala-603, Arg-605, His-606, Leu-610, Leu-613, Gly-615, Glu-616, Glu-617, and Leu-658.

88. A mutant MMRN2 polypeptide according to any of claims 84-87, wherein the mutant MMRN2, when compared to the corresponding wild type MMRN2, has a different amino acid at a position which corresponds to any one or more of the following positions according to the numbering of the human MMNR2 as set out in FIG. 15: Leu-497, Glu-506, Gln-527, Val-540, Ala-546, Val-609, Glu-620, Gln-636, Ile-637, Leu-641, Leu-648 and Glu-666.

89. A mutant CLEC14A polypeptide which has reduced binding to MMRN2 relative to wild type CLEC14A, wherein the cysteine corresponding to cysteine-103 of human CLEC14A is mutated and/or the cysteine corresponding to cysteine-138 of human CLEC14A is mutated.

90. A mutant CD93 polypeptide which has reduced binding to MMRN2 relative to wild type CD93.

91. A mutant CD93 polypeptide according to claim 90, wherein the mutant CD93, when compared to the corresponding wild type CD93, comprises one or more different amino acids in the region of CD93 corresponding to the region spanning amino acid residues 97-108 of human CD93; and/or wherein, when compared to the corresponding wild type CD93, the cysteine corresponding to cysteine-104 of human CD93 is mutated and/or the cysteine corresponding to cysteine-136 of human CD93 is mutated.

92. A nucleic acid molecule encoding the mutant MMRN2 polypeptide of any of claims 84-88, the mutant CLEC14A polypeptide of claim 89, or the mutant CD93 polypeptide of claim 90 or 91.

93. A vector, such as an expression vector, comprising a nucleic acid molecule of claim 92.

94. A cell comprising the nucleic acid molecule of claim 92 or the vector of claim 93.

95. A kit of parts comprising: (i) an MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49, and (ii) at least one additional anti-cancer agent and/or at least one additional anti-angiogenic agent.

96. A kit of parts comprising: (i) an MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49; and (ii) a cytotoxic moiety, optionally wherein the cytotoxic moiety is as defined in claim 33 or 34.

97. A kit of parts comprising (i) an MMRN2 portion according to any of claims 1-3 and 7-24, an agent according to any of claims 4-6, a fusion protein according to claim 25, an antibody according to any of claims 26-29, a nucleic acid molecule according to claim 30 or 50, a vector according to claim 31 or 51, a cell according to any of claims 32, 52, 53 and 55, a compound according to any of claims 33-38, or a CAR according to any of claims 39-49; and (ii) a detectable moiety, optionally wherein the detectable moiety is as defined in claim 30 or 31.

98. A method of identifying a portion of MMRN2 or a variant thereof, which portion may be useful in modulating angiogenesis or in combating cancer, or a lead compound for the identification of an agent that may be useful in modulating angiogenesis or in combating cancer, the method comprising: providing CLEC14A or a portion or variant thereof, said portion or variant being capable of binding to MMRN2; providing a candidate portion of MMRN2 or a variant thereof; and determining whether the candidate portion modulates binding of CLEC14A or the portion or variant thereof, to MMRN2, or a portion or variant thereof, said portion or variant being capable of binding to CLEC14A.

99. A method according to claim 98, wherein the method further comprises: determining whether the candidate portion of MMRN2 or variant thereof, modulates binding of CD93, or a portion or variant thereof, said portion or variant being capable of binding to MMRN2, to MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD93.

100. A method of identifying an agent that may be useful in modulating angiogenesis or in combating cancer, or a lead compound for the identification of an agent that may be useful in modulating angiogenesis or in combating cancer, the method comprising: providing CD93 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2; providing a candidate agent; and determining whether the candidate agent modulates binding of CD93 or the portion or variant thereof, to MMRN2, or a portion or variant thereof, said portion or variant being capable of binding to CD93; optionally wherein the candidate agent is an antibody, a peptide, a peptidomimetic, a natural product, a carbohydrate, an aptamer or a small molecule.

101. A method according to claim 100, wherein the method further comprises: determining whether the candidate agent modulates binding of CLEC14A, or a portion or variant thereof, said portion or variant being capable of binding to MMRN2, to MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CLEC14A.

102. A method according to any of claims 98-101, further comprising the step of testing the candidate portion or agent in an angiogenesis assay.

103. A method for preparing an anticancer compound or anti-angiogenesis compound that may be useful in the treatment of a solid tumour, the method comprising identifying a compound using the method according to any of claims 98-102, and synthesising, purifying and/or formulating the identified compound.

Description

EXAMPLE 1

CLEC14A and CD93 Binding Fragment of Multimerin-2 Inhibits Angiogenesis and Tumour Growth

[0441] Summary

[0442] The C-type lectin domain containing group 14 family members CLEC14A and CD93 are proteins expressed by endothelium and implicated in tumour angiogenesis. Endosialin/CD248 is also a member of this family and is expressed by tumour associated fibroblasts and pericytes. Multimerin-2 (MMRN2) is an endothelial specific extracellular matrix (ECM) protein that is associated with angiogenesis and tumour progression. We show that CLEC14A and CD93 directly bind to MMRN2 whereas the C-type lectin family 14 member thrombomodulin does not. Binding to MMRN2 is dependent on a predicted long loop region in the C-type lectin domain and is diminished by mutations within this domain. We show that CLEC14A and CD93 bind to the same non-glycosylated coiled-coil region of MMRN2. A recombinant peptide of MMRN2 which contains the CLEC14A and CD93 binding region, blocks CLEC14A extracellular domain binding to the endothelial cell surface and increases adherence of HUVEC when the peptide is coated on plates. The MMRN2 peptide is anti-angiogenic in in vitro angiogenesis assays and reduces tumour growth in mouse models. Our findings identify CLEC14A and CD93 interactions with the MMRN2 as targetable components of tumour angiogenesis and growth.

[0443] Introduction

[0444] Angiogenesis is the growth of new blood vessels from existing ones and is an integral part of normal embryonic development, wound healing and reproduction. It is also a key process in many pathological conditions such as tumourigenesis, diabetic retinopathy and atherosclerosis amongst others (1). The targeting of key molecules involved in angiogenesis offers a strategy for controlling it and a potential for new therapies (2).

[0445] The identification of proteins involved in tumour angiogenesis is an essential route to the development of potential anti-cancer agents. The endothelial specific cell surface glycoprotein CLEC14A is known as a tumour endothelial marker, meaning its expression is higher in the vasculature within tumours compared to those in healthy tissue (3). CLEC14A is shed from the cell membrane and has essential roles in endothelial function and angiogenesis (4;5). The related family member CD93 has also been described to be highly expressed in tumour endothelium and recent studies suggest it is a key molecule involved in tumour angiogenesis (6-8).

[0446] There is currently little known about the molecular functions of CLEC14A and CD93 in angiogenesis. We and others have previously described CLEC14A as binding to an endothelial specific extracellular matrix (ECM) protein named multimerin-2 (MMRN2) (4;10). The expression of both CLEC14A and MMRN2 is upregulated with tumour progression in two different spontaneous mouse tumour models (10). Antibodies disrupting the CLEC14A-MMRN2 interaction retard angiogenesis and tumour growth, reinforcing the importance of this occurrence (4).

[0447] We now show that CD93 as well as CLEC14A can directly bind to MMRN2. Binding of CLEC14A and CD93 has been mapped to a non-glycosylated coiled-coil region of MMRN2. CLEC14A and CD93 interactions are dependent upon the C-type lectin domain and mutations within a predicted binding loop of CLEC14A and CD93 can disrupt interactions with MMRN2. Through this process we have also discovered the epitope for our previously described CLEC14A-MMRN2 blocking antibody C4 (4). A recombinant CLEC14A and CD93 binding fragment of MMRN2 can disrupt in vitro angiogenesis assays and increases adherence of HUVEC. Furthermore, an Fc tagged version of this MMRN2 fragment expressed by Lewis lung carcinoma cells inhibited their growth in vivo but not in vitro. Our findings propose previously unknown protein-protein interactions that occur in endothelium and the surrounding stroma that could provide new targets in anti-angiogenic treatment.

[0448] Results

[0449] C-Type Lectin Group 14 Family Members CLEC14A and CD93 Directly Bind MMRN2

[0450] We previously identified MMRN2 as a binding partner of CLEC14A, one of the members of the C-type lectin domain (CTLD) group 14 family (4). To test whether any of the other CTLD group 14 family members also bind to MMRN2, we employed far western blotting using MMRN2 protein probe as a surrogate for a primary antibody in a standard western blot set up. The CTLD group 14 family members CLEC14A, CD93 and thrombomodulin were all constructed with a C-terminal green fluorescent protein (GFP) tag (FIG. 1A). Constructs were transfected into HEK293T cells and lysates were separated by SDS-PAGE under non-reducing conditions to keep disulphide bonds intact, then transferred to PVDF membranes and blotted using HEK293T lysates overexpressing full-length human MMRN2 with a polyhistidine (His) tag. MMRN2 protein binding was detected by staining with an anti-His tag antibody. This revealed MMRN2 binding to both CLEC14A and CD93 (FIG. 1B). Anti-GFP staining revealed expression of each test protein.

[0451] In order to validate the CD93-MMRN2 interaction in endothelial cells, HUVEC lysate was immunoprecipitated with either polyclonal MMRN2 antibodies or the previously validated CD93 monoclonal antibody R139 (13;14). This resulted in enrichment of MMRN2 in CD93 immunoprecipitations (FIG. 10) and enrichment of CD93 in MMRN2 immunoprecipitations (FIG. 1D) but no enrichment in either of the mouse IgG control immunoprecipitations.

[0452] CLEC14A and CD93 Bind to a Non-Glycosylated Coiled-Coil Region of MMRN2

[0453] MMRN2 is a 949 amino acid glycoprotein that consists of three structural domains, the N-terminal EMI domain, a central coiled-coil domain and a C-terminal C1q domain (15). To further characterise the region of MMRN2 responsible for binding CLEC14A, various MMRN2 constructs were made, each lacking major domains and each including a His tag (FIG. 2A). These included MMRN2 full-length (MMRN2.sup.FL), the EMI and coiled-coil (MMRN2.sup.EMI-CC), coiled-coil and C1q (MMRN2.sup.CC-C1q), coiled-coil domain alone (MMRN2.sup.CC) and half of the coiled-coil domain)(MMRN2.sup.487-820). These constructs were transfected into HEK293T cells, lysed and separated by SDS-PAGE under reducing conditions. Upon probing with human CLEC14A extracellular domain fused to an Fc tag (CLEC14A-ECD-Fc) (16), binding was observed in all MMRN2 proteins except MMRN2.sup.FL (FIG. 2B). This is surprising as the non-reduced form of MMRN2.sup.FL does bind CLEC14A (FIG. 7). Despite this the CLEC14A binding region is clearly within the C-terminal half of the coiled-coil domain of MMRN2.

[0454] To further characterise the CLEC14A binding domain of MMRN2 smaller fragments of MMRN2 were constructed. Initially, the MMRN2.sup.487-820 region was further divided in half revealing binding to the MMRN2.sup.487-674. Subsequently, this region was further sub-divided and revealed binding of CLEC14A within the MMRN2.sup.530-624 region but binding was not observed for either of the truncations MMRN2.sup.487-603 or MMRN2.sup.604-674 (FIG. 2C). Interestingly, there is a highly conserved region within this portion of MMRN2 (amino acids 588-620) with conservation existing in the two zebrafish orthologues MMRN2a and MMRN2b, suggesting a potential CLEC14A binding motif (FIG. 8). Due to low expression levels and the failure of the MMRN2.sup.530-624 fragment to be efficiently expressed and purified from HEK293T cells or E. coli, this fragment was not pursued further. We looked to the second smallest fragment MMRN2.sup.487-674, as this fragment forms disulphide-linked high molecular weight complexes under non-reduced conditions, which could interfere in downstream assays, the two N-terminal cysteine residues were removed and a new fragment was constructed comprising residues MMRN2.sup.495-674. This fragment could still bind to CLEC14A (FIG. 2C and FIG. 9).

[0455] To test whether this binding domain existed in mouse, the corresponding regions in mouse MMRN2 (495-678) were also expressed in HEK293T and mouse CLEC14A-ECD-Fc far western blotting showed positive binding (FIG. 10). The human MMRN2.sup.495-674 fragment along with the non-CLEC14A binding fragment MMRN2.sup.495-603 was expressed in E. coil with a His tag for purification and a BirA tag for specific biotinylation (17). Biotinylated proteins could bind to streptavidin in western blots (FIG. 2D) and MMRN2.sup.495-674 could bind to cell surface expressed CLEC14A and CD93 but not thrombomodulin detected by flow cytometry. This confirmed the CLEC14A and CD93 interactions likely occur in the same region of MMRN2 (FIG. 2E).

[0456] Binding to MMRN2 is Dependent on the CTLD of CLEC14A and CD93

[0457] We have previously shown that our C4 monoclonal CLEC14A antibody can block interactions with MMRN2 but the C2 antibody cannot, these provide useful tools in determining important regions for CLEC14A-MMRN2 binding (4). To test whether monoclonals C1, C3 or C5 could also exhibit these blocking effects, pull down assays utilising CLEC14A-ECD-Fc blocked with either PBS, mouse IgG control or one of the five CLEC14A antibodies were performed on HEK293T cells overexpressing MMRN2.sup.FL protein. This revealed blocking by C1, C4 and C5 monoclonal antibodies but not C2 or C3 (FIG. 3A). These antibodies (C1, C4 and C5) could also block CLEC14A-ECD-Fc from binding to the HUVEC cell surface (FIG. 3B). Furthermore, as these antibodies only bind in flow cytometry and not western blots under reducing conditions they offer a good tool for probing the correct conformational folding of CLEC14A.

[0458] To establish which residues of CLEC14A bind to MMRN2, CLEC14A mutant constructs (16) and far western blots were utilised as described for the CTLD group 14 family members. This revealed that CLEC14A lacking the CTLD or sushi domain could no longer bind MMRN2 (FIG. 3C). This was possibly due to the binding region being dependent on both of these regions or CLEC14A cannot fold correctly when lacking one of these domains. To test the latter, chimeric CLEC14A constructs were generated using the CTLD of the non-MMRN2 binding protein thrombomodulin (denoted chimera 1 CLEC14A.sup.THBD(CTLD)) and the sushi of thrombomodulin (chimera 2 CLEC14A.sup.THBD(sushi)) inserted into the full-length CLEC14A with a GFP tag. Flow cytometry revealed lack of binding of all CLEC14A antibodies to chimera 1 CLEC14A.sup.THBD(CTLD) except C2 and positive binding of all antibodies except C2 to chimera 2 CLEC14A.sup.THBD(sushi) (FIG. 3D). This confirmed that the chimeric proteins were correctly folded and present on the cell surface. It also suggested that binding epitopes for all anti-CLEC14A antibodies were within the CTLD except for C2. Similarly, the MMRN2.sup.495-674 fragment could bind chimera 2 CLEC14A.sup.THBD(sushi) but not chimera 1 CLEC14A.sup.THBD(CTLD) (FIG. 3d). This confirmed that the CLEC14A CTLD is required for binding to MMRN2.

[0459] To ensure that all wild-type and chimeric proteins were expressed at the cell surface, HEK293T cells expressing each were cell surface biotinylated before immunoprecipitation with an anti-GFP antibody. Immunoprecipitates were probed with streptavidin-HRP and this revealed that all chimeras and the wild-type proteins CLEC14A, CD93 and thrombomodulin were expressed at the cell surface.

[0460] MMRN2 Binding is Dependent Upon Residues in Long Loop Region of CTLD in CLEC14A and CD93

[0461] In order to better understand the CLEC14A CTLD structure and to predict the MMRN2 or antibody epitope recognition surface, a predicted molecular model of the CLEC14A CTLD was generated using the iTASSER server (19). This predicted model exhibited characteristics of the CTLD fold, of a loop in a loop structure with a hydrophobic core (20). The predicted structure also revealed that canonical CTLD cysteine residues C31, C37, C54, C143, C162 and C171 were in close proximity to form disulphide bonds as is the case in many solved structures of CTLDs (FIG. 4A). There are also two non-canonical cysteine residues within the long loop region that are distal in this predicted model (C103 and C138). The predicted model displays a similar overall structure to the X-ray crystal structure of human tetranectin (21) (FIG. 4A).

[0462] A recent study demonstrated that CTLD-specific CLEC14A antibodies had similar anti-angiogenic effects as observed with our C4 blocking antibody, we hypothesised that these too could block the CLEC14A-MMRN2 interaction (22). These CTLD specific antibodies have been described to bind epitopes spanning amino acids 1-42 or 122-142 of CLEC14A (23). These regions were mapped onto the predicted CTLD model, revealing 1-42 is proximal to the sushi domain boundary and 122-142 is on the so called long loop region. There also existed another region (97-108) which was semi-conserved in CD93 and part of the predicted long loop region (FIGS. 4A and 12). To test whether epitopes for our antibodies or regions important for MMRN2 binding were within these regions, CLEC14A chimeras were generated by swapping with corresponding regions of the non-MMRN2 binding protein thrombomodulin. The 97-108 region spans residues upstream of the hydrophobic core and terminates at residue 109 as this is conserved in all family members and unlikely to be involved in binding. The CLEC14A.sup.THBD(1-42) and CLEC14A.sup.THBD(122-142) chimeras failed to bind antibodies C1-C5 suggesting they were incorrectly folded (data not shown). In contrast, the CLEC14A.sup.THBD(97-108) mutant could bind C2 and C3 but not the MMRN2 interaction blocking antibodies C1, C4 or C5, indicating the binding epitopes for these antibodies are likely within this region. The MMRN2.sup.495-674 fragment failed to bind to this CLEC14A.sup.THBD(97-108) mutant as expected (FIG. 4B). This long loop region contained the amino acids 97ERRRSHCTLENE108 (SEQ ID NO: 5). To test whether the cysteine residue within the 97-108 region formed disulphide bonds that are important for MMRN2 binding, the mutant CLEC14A.sup.C103S was generated along with a mutant of the other non-canonical cysteine (CLEC14A.sup.C138S). These mutants could bind all CLEC14A monoclonals C1-C5 but failed to bind to MMRN2.sup.495-674 (FIGS. 4B). This highlighted the importance of these residues for CLEC14A-MMRN2 interactions but not CLEC14A antibody binding, suggesting these mutants are correctly folded.

[0463] As CD93 also contains two cysteines in the predicted long loop region, the mutants CD93.sup.C104S and CD93.sup.C136S were generated. The monoclonal R139 anti-CD93 antibody is conformation-sensitive and was used to validate correct folding of CD93 mutants and expression at the cell surface. Both of these mutants along with CD93 wild type (wt) could bind R139 but failed to bind MMRN2.sup.495-674 (FIG. 4C). This confirmed the necessity of these cysteines for CD93-MMRN2 interactions.

[0464] The CLEC14A and CD93 Binding Fragment of MMRN2 Inhibits Angiogenesis In Vitro

[0465] In order to test whether blocking CLEC14A and CD93 interacting with MMRN2 can have effects on angiogenesis; the MMRN2.sup.495-674 fragment and the non-binding MMRN2.sup.495-603 fragment were expressed with His tags and purified from E. coli lysates (FIG. 12). As the CLEC14A monoclonal antibodies were shown to inhibit CLEC14A-ECD-Fc binding to the HUVEC cell surface, the same experiment was performed, blocking with MMRN2.sup.495-674 or MMRN2.sup.495-603. This resulted in significant blocking with MMRN2.sup.495-674 (FIG. 5A and 5B).

[0466] MMRN2 has previously been shown to increase HUVEC adherence (24). To test whether the MMRN2.sup.495-674 fragment could also have this effect, wells in a 96 well plate were coated with MMRN2.sup.495-674, MMRN2.sup.495-603 or BSA as a control. This resulted in HUVEC adherence to MMRN2.sup.495-674 but lack of adherence to MMRN2.sup.495-603 or BSA, suggesting an adhesive function for CLEC14A or CD93 or both (FIGS. 5C and 5D).

[0467] The MMRN2.sup.495-674 and MMRN2.sup.495-603 fragments were examined in angiogenesis assays. As we have previously shown the CLEC14A-ECD-Fc protein to have anti-angiogenic effects (16), this was included in all assays as a positive control, along with a human IgG Fc alone to account for any effects the Fc tag may have. Recombinant proteins were added to HUVEC in Matrigel tube formation assays which resulted in significant decreases in tubule mesh formation with both CLEC14A-ECD-Fc and MMRN2.sup.495-674 compared to Fc and MMRN2.sup.495-603 respectively (FIGS. 5E and 5F). The recombinant proteins were then tested in the organotypic human dermal fibroblast-HUVEC co-culture tube formation assay (25). This resulted in modest reductions in tubules and junctions when treated with MMRN2.sup.495-674 but in this case not when treated with CLEC14A-ECD-Fc (FIGS. 5G and 5H). Intriguingly, the CLEC14A-ECD-Fc treatments in the co-culture induced formation of knot-like areas with high density of tubules.

[0468] The CLEC14A and CD93 Binding Peptide of MMRN2 Reduces Tumour Growth

[0469] To test whether disrupting CLEC14A and CD93 interactions had an effect on tumour growth in vivo, the mouse MMRN2.sup.495-678 fragment and the mouse CLEC14A-ECD were fused to a mouse IgG Fc tag. These were constructed so as to include the signal peptide of mouse CLEC14A (mCLEC14A) to allow successful secretion along with a murine Fc control (FIG. 6A). LLC were separately lentivirally transduced with these constructs, achieving greater than 90% transduction efficiency (FIG. 13). This Fc-fusion strategy was utilised to increase serum half-life of these expressed proteins and to allow them to be expressed at local sites of neo angiogenesis by cells of mouse origin. Western blots of conditioned media confirmed secretion of fusion proteins (FIG. 6B). The cells were also shown to have no differences in proliferation in vitro (FIG. 14). Transduced LLC were implanted subcutaneously into the flanks of C57BL6 mice and tumour growth was monitored by daily calliper measurements, revealing a slower growth rate in mMMRN2.sup.495-678mFc LLC implants compared to mFc (FIG. 6C). Mice were culled after 2 weeks or until the tumour size limit of 1.2 cm.sup.3 was reached. Wet weights were analysed revealing a significant reduction in tumour weight in LLC expressing mMMRN2.sup.495-678mFc (FIGS. 6D and 6E). There was no significant difference in the weights or growth rates of mCLEC14A-ECD-mFc expressing tumours.

[0470] Discussion

[0471] CLEC14A and CD93 are emerging as important molecules in angiogenesis, particularly in the tumour setting. Our present study has demonstrated CD93 as being able to bind the CLEC14A ECM ligand MMRN2. These interactions have been dissected and found to involve a predicted loop in the CTLD of CLEC14A and CD93 and regions of MMRN2 within its coiled-coil domain. The CLEC14A and CD93 binding fragment of MMRN2 had anti-angiogenic effects presumably by disrupting normal CLEC14A and CD93 function. We also show that MMRN2 can associate with fibronectin in HUVEC likely dependent on a non-disulphide bonded region of fibronectin, due to binding being observed under reducing conditions.

[0472] The observation of the CD93-MMRN2 interaction could explain some observations reported in the literature, such as CD93 CTLD-Fc being able to stain endothelium in human tonsils and descriptions of CD93 being involved in cell adhesion (26;27). Interestingly, expression of CD93 in mouse embryos has been reported to occur at embryonic day 9 and expression of MMRN2 has been observed at embryonic day 9.5, both show expression within the intersomitic vessels (27;28). CLEC14A expression can be detected in brain and intersomitic vessels at embryonic day 10.5 (5), posing a likely role in developmental angiogenesis for MMRN2 and its interactors. The fact that neither CLEC14A nor CD93 knockout mice display gross defects in developmental blood vessel formation suggest the presence of proteins compensating their roles. Double gene knockout of CLEC14A and CD93 may have more dramatic effects on angiogenesis.

[0473] A recently described monoclonal antibody recognising CD93 has shown anti-angiogenic properties (29). This antibody epitope has been mapped between the CTLD and sushi domains of CD93. We have shown that this region is not involved in MMRN2 interactions, although it is possible that this antibody indirectly blocks CD93-MMRN2 interactions by CD93 internalisation, alternatively binding of this antibody could sterically hinder CD93 binding to MMRN2. CD93 has also been shown to be important in endothelial migration and tube formation in vitro, phenocopying observations made of CLEC14A (3;5). Furthermore this study showed CD93 deficient mice exhibit defects in tumour angiogenesis in glioblastoma models (7). This too phenocopies anti-tumour effects seen with CLEC14A deficient animals (4), it can be hypothesised that these CLEC14A and CD93 dependent effects are due to them no longer being present to interact with MMRN2. It is interesting to note that more cleaved CD93 is co-immunoprecipitated with MMRN2, suggesting a role for the soluble form. This could explain why less soluble CD93 is detected in colorectal cancer patients, possibly being sequestered by overexpressed MMRN2 in the ECM of the tumour vasculature (8).

[0474] We also show that the CLEC14A-ECD can bind to the HUVEC surface, as CLEC14A can be shed at the plasma membrane this provides information on the liberated soluble CLEC14A-ECD. Binding is likely due to MMRN2 being held on the surface, as the MMRN2 interaction blocking antibodies and MMRN2.sup.495-674 could inhibit this effect.

[0475] In this study we have dissected the molecular characteristics of these interactions, revealing a critical predicted long loop region within both CTLDs of CLEC14A and CD93 where two conserved cysteine residues are essential for interactions with MMRN2. These cysteines are either involved in making direct contacts to MMRN2 or are involved in the tertiary structure of the CTLD long loop. In the predicted structure of the CLEC14A CTLD, cysteine 103 and 138 are distant and unlikely to form disulphide bonds in this model, furthermore as the conformation sensitive anti-CLEC14A antibodies bind to both of these cysteine mutants, disulphide bond formation is unlikely. Nevertheless, while these residues are not important for antibody binding they are vital for binding to MMRN2. These described mutant versions of CLEC14A and CD93 lacking binding to MMRN2 can be tested for other known functions of these proteins.

[0476] We hypothesise that critical residues involved in CLEC14A and CD93 binding are present within a highly conserved area of MMRN2. As the murine CLEC14A-ECD fused to a human Fc tag was able to bind both mouse and human MMRN2 fragments, binding sites would need to be fairly conserved, indeed the MMRN2 588-620 region contains 76% homology between human and mouse. Furthermore the non-binding fragment MMRN2.sup.495-603 terminates within this highly conserved region.

[0477] We have shown that by interrupting both CLEC14A and CD93 normal functions with the MMRN2.sup.495-674 fragment, angiogenesis can be blocked in vitro and tumour growth can be reduced in vivo. This offers a new route to targeting this interaction and antibodies raised against the MMRN2.sup.495-674 fragment may have potent anti-angiogenic effects.

[0478] The relevance of MMRN2 in angiogenesis has been demonstrated numerous times, with two studies from the same group describing it as an angiostatic molecule, acting by sequestering VE.G.F-A (24;31). However, our studies and those by Zanivan et al. describe MMRN2 as a pro-angiogenic molecule binding to cell surface proteins. These conflicting roles could be context dependent, where CLEC14A and CD93 interactions are separate from those of VE.G.F-A. Our observations of HUVEC adhering to MMRN2.sup.495-674 could explain the calcium independent adhesion described for the full-length protein, with CLEC14A, CD93 or both eliciting this adhesive effect (24).

[0479] It seems that the related family members CLEC14A and CD93 may be having similar roles in ECM interactions although it is unclear at present whether these interactions have distinct signalling outcomes or whether they have compensatory roles. It is worth mentioning that CLEC14A is upregulated in response to low shear stress, but CD93 is not shear regulated (Bicknell unpublished data). It is possible that each gene is expressed under different circumstances and this explains similarities in binding MMRN2. As CD93 is expressed by other cell types such as haematopoietic cells and platelets, these are also likely to bind MMRN2 and the endothelial ECM. CD93 has recently been found on a subset of non-quiescent leukaemia stem cells and is important for development of acute myeloid leukaemia (32). Future studies will likely shed light on the roles of CLEC14A and CD93 and the signalling of these understudied molecules in angiogenesis.

[0480] Materials and Methods

[0481] Antibodies and Reagents

[0482] Antibodies used: anti-CLEC14A mouse monoclonals C1-C5 were generated in our laboratory (4), anti-CLEC14A sheep polyclonal antisera (R&D Systems, Abingdon, UK #AF4968), anti-polyhistidine tag mouse clone AD1.1.10 (R&D Systems #MAB050), anti-GFP mouse clone 3E1 (Cancer Research UK), anti-MMRN2 polyclonal mouse (Abnova, Taoyuan City, Taiwan/Novus Biologicals, Colorado, USA #H00079812-1301P), anti-CD93 mouse clone R139 (eBioscience, Hatfield, UK #14-0939), anti-CD93 goat polyclonal (R&D Systems #AF2379), anti-CD31 mouse clone JC70A (Dako, Cambridge, UK #M0823), anti-Tubulin mouse clone DM1A (Sigma-Aldrich, Dorset, UK #T9026), anti-fibronectin sheep polyclonal (R&D Systems #AF1918), mouse IgG isotype control (Thermo Scientific, Loughborough, UK #10400C), purified human IgG Fc (Bethyl Laboratories #P80-104) (dialysed against PBS before use in functional assays to remove sodium azide), anti-human IgG Fc peroxidase conjugated (Sigma-Aldrich #A0170), anti-mouse horse radish peroxidase (HRP) conjugated (Dako #P0447), anti-sheep HRP (R&D Systems #HAF016), anti-goat HRP (Dako #P0449), streptavidin HRP conjugated (GE Healthcare #RPN1231) anti-mouse alexafluor 555 (Thermo Scientific #), anti-human IgG Fc FITC conjugated (Sigma-Aldrich #F9512), streptavidin R-phycoerthrin (PE) conjugate (Thermo Scientific #S-866), purified fibronectin (Sigma #F2006).

[0483] Plasmid Construction

[0484] All type 14 family members, mutants and chimeras were inserted between the EcoRI restriction site in pE.G.FPN1 (Addgene), using the Gibson assembly reaction with a 1:3 vector:insert ratio according to manufacturer's instructions (New England Biolabs), using PCR products by amplification with the following primers CLEC14A wt forward GATCTCGAGCTCAAGCTTCGATGAGGCCGGCGTICGCC (SEQ ID NO: 6), CLEC14A wt reverse TACCGTCGACTGCAGTGCATCACTAGAGCCAAG (SEQ ID NO: 7), CD93 wt forward CGAGCTCAAGCTTCGATGGCCACCTCCATGGGC (SEQ ID NO: 8), CD93 wt reverse TACCGTCGACTGCAGGCAGTCTGTCCCAGGTGTCG (SEQ ID NO: 9), THBD wt forward CGAGCTCAAGCTTCGATGCTTGGGGTCCTGGTC (SEQ ID NO: 10), THBD wt reverse TACCGTCGACTGCAGGAGTCTCTGCGGCGTCCG (SEQ ID NO: 11). For chimeras two PCR products or more were assembled together using the following primers; (chimera 1 CLEC14A.sup.THBD(CTLD); THBD wt forward and THBD-CTLD fused to CLEC14A-sushi reverse CTCAAACTGGAACTCGCAGAGGAAGCC (SEQ ID NO: 12), THBD-CTLD fused to CLEC14A-sushi forward GCGAGTTCCAGTTTGAGGTCTTGTGTC (SEQ ID NO: 13) and CLEC14A wt reverse). (Chimera 2 CLEC14A.sup.THBD(sushi); CLEC14A wt forward and CLEC14A-CTLD fused to THBD-sushi reverse TACCGTCGACTGCAGTGCATCACTAGAGCCAAG (SEQ ID NO: 14), CLEC14A-CTLD fused to THBD-sushi forward GTGCAAGTACCACTTCCCAGCCACCTGCAGGC (SEQ ID NO: 15) and THBD-sushi fused to CLEC14A-E.G.F reverse TCCCGGGGCAAGCGCCCGGCGCCTCCCT (SEQ ID NO: 16), THBD-sushi fused to CLEC14A-E.G.F forward GCCGGGCGCTTGCCCCGGGAGGTACCTC (SEQ ID NO: 17) and CLEC14A wt reverse). (CLEC14A.sup.C103S; CLEC14A wt forward and CLEC14A.sup.C103S reverse CTCGTTCTCCAGGGTTGAGTGGGAACGCCTGCGCTC (SEQ ID NO: 18), CLEC14A.sup.C103S forward GAGCGCAGGCGTTCCCACTCAACCCTGGAGAACGAG (SEQ ID NO: 19) and CLEC14A wt reverse). (CLEC14A.sup.S138S; CLEC14A wt forward and CLEC14A.sup.C138S reverse CGCGCATCTCCGCGCGGTGGAGGAGCGTTGGGGCTCCTC (SEQ ID NO: 20), CLEC14A.sup.C138S forward GAGGAGCCCCAACGCTCCTCCACCGCGCGGAGATGCGCG (SEQ ID NO: 21) and CLEC14A WT reverse).

[0485] Human and mouse MMRN2 fragments were amplified from IMAGE clones using the following primers; (MMRN2.sup.EMI-CC; MMRN2.sup.FL Forward CCGGACCGGTCAGGCTTCCAGTACTAGCC (SEQ ID NO: 22) and MMRN2.sup.820 Reverse CTACTAGGTACCCCAGAGCGCCGCGCCC (SEQ ID NO: 23)). (MMRN2.sup.CC-C1q; MMRN2.sup.133 Forward CCGGACCGGTGATTCCATGGCAATCCCTGA (SEQ ID NO: 24) and MMRN2.sup.FL Reverse CGGGGTACCGGTCTTAAACATCAGGAAGC (SEQ ID NO: 25)). (MMRN2.sup.CC; MMRN2.sup.133 Forward and MMRN2.sup.820 reverse). (MMRN2.sup.487-820; MMRN2.sup.487 Forward CCGGACCGGTTACGTGAAGGACTGCAATTG (SEQ ID NO: 26) and MMRN2.sup.820 Reverse), (MMRN2.sup.487-674; MMRN2.sup.487 Forward and MMRN2.sup.674 Reverse CTACTAGGTACCCGGCCGCGGGGGCTCCG (SEQ ID NO: 27)) (MMRN2.sup.675-820; MMRN2.sup.675 Forward CCGGACCGGTGCAGAGCACCTGGAGCC (SEQ ID NO: 28) and MMRN2.sup.820 Reverse) (MMRN2.sup.487-603; MMRN2.sup.487 Forward and MMRN2.sup.603 Reverse CTACTAGGTACCCGCGTCCTCCAGCAGGG (SEQ ID NO: 29)) (MMRN2.sup.604-674; MMRN2.sup.604 Forward CCGGACCGGTCTGCGGCACGAGGCGGTG (SEQ ID NO: 30) and MMRN2.sup.674 Reverse) (MMRN2.sup.530-624; MMRN2.sup.530 Forward CCGGACCGGTGGCTCCTCCCTGCAGGCC (SEQ ID NO: 31) and MMRN2.sup.624 Reverse CTACTAGGTACCCTCAGACATCTCCTCCAGC (SEQ ID NO: 32)) (MMRN2.sup.495-674; MMRN2.sup.495 Forward TAGTAGACCGGTCAGAAGCTCTATTTAGACCTG (SEQ ID NO: 33) and MMRN2.sup.674 Reverse). (Mouse MMRN2.sup.495-678; mouse MMRN2.sup.495 Forward CCGGACCGGTCAAAGGGTCAACTCTGACGTG (SEQ ID NO: 34) and mouse MMRN2.sup.678 Reverse CTACTAGGTACCCAACTGTGGGTGCTGCTCC (SEQ ID NO: 35)). All PCR products were digested with Agel and Kpnl and ligated into mammalian expression vector pHL-Avitag3 containing an N-terminal signal peptide and C-terminal BirA and His tags (33).

[0486] Codon optimised versions of MMRN2.sup.495-674 and MMRN2.sup.495-603 DNA were synthesised as gBlocks (IDT Technologies, Leuven, Belgium) with ends complementary to pET23a expression vector and inserted in using Gibson assembly reactions in between Ndel and Notl restriction sites. The BirA sequence was used as following GGTGGTGGTCTGAACGATATTITTGAAGCTCAGAAAATCGAATGG (SEQ ID NO: 36).

[0487] All mouse Fc fusion proteins were inserted into the lentiviral vector pWPi by Gibson reaction between Pmel restriction sites. Mouse CLEC14A-ECD was amplified with the following primers forward ACTAGCCTCGAGG I I I AAACATGAGGCCAGCGCTTGCC (SEQ ID NO: 37) and reverse CACTCGATGAGGATCCGGAAGAGGTGTCGAAAGTCAGAGAAAC (SEQ ID NO: 38), mouse Fc for fusion to mCLEC14A forward CCTCTTCCGGATCCTCATCGAGTGTGCCCAGGGATTGTGGT (SEQ ID NO: 39) and reverse CTGCAGCCCGTAGTTTTCATTTACCAGGAGAGTGGG (SEQ ID NO: 40). Mouse Fc alone was fused to CLEC14A signal peptide with primers; mouse CLEC14A signal peptide forward AGACTAGCCTCGAGG III AAACATGAGGCCAGCGCTTGC (SEQ ID NO: 41) and mouse CLEC14A signal peptide reverse TGAGGATCCCTCCCCATTCCCTGGCCG (SEQ ID NO: 42), and mouse Fc fused to signal peptide forward AATGGGGAGGGATCCTCATCGAGTGTG (SEQ ID NO: 43) and reverse TCCTGCAGCCCGTAG I I I I CATTTACCAGGAGAGTGG (SEQ ID NO: 44). Mouse MMRN2.sup.495-678 was Gibson cloned in between the unique engineered BamHI restriction site separating the signal peptide and the mouse Fc and amplified with primers forward CAGGGAATGGGGAGGGATCCCAAAGGGTCAACTCTGACG (SEQ ID NO: 45) and reverse GGCACACTCGATGAGGATCCCAACTGTGGGTGCTGCTC (SEQ ID NO: 46). Mouse MMRN2 and mouse CLEC14A were amplified from IMAGE clones, mouse IgG Fc was amplified from cDNA of hybridomas expressing anti-CLEC14A monoclonal C3.

[0488] Protein Expression and Purification

[0489] Human CLEC14A-ECD-Fc was expressed in HEK293T cells and purified as described (4). Human MMRN2.sup.495-674 and MMRN2.sup.495-603 with His tag alone or BirA and His tag were expressed in E. coli strain BL21 DE3 pLysS (Prome.g.a, Southampton, UK) by induction with 0.5 mM IPTG at OD.sub.600 0.6 and grown at 18 C. overnight. Bacterial pellets were homogenised in buffer containing 50 mM Na.sub.2PO.sub.4 pH7.4 400 mM NaCl, 10% (v/v) glycerol, 50 mM imidazole, 0.5 mM TCEP and complete EDTA-free protease inhibitors (Roche) by high pressure lysis in an Emulsiflex-C3 system (17,000 psi) at 4 C. (Avestin), then loaded onto Nickel-NTA affinity columns (GE Healthcare, Hatfield, UK), fractions were eluted using 500 mM imidazole in homogenisation buffer and then purified by size exclusion chromatography using a superdex 200 column and an AKTA fast protein liquid chromatography machine (GE healthcare) in buffer 20 mM Tris pH8.0, 50 mM NaCl. Upon elution, protein samples were buffer exchanged into PBS and endotoxin removed using high capacity endotoxin removal spin columns (Thermo Scientific). Protein samples were filter sterilised and used in various assays.

[0490] Cell Culture and Plasmid Transfections

[0491] HUVEC were isolated from fresh umbilical cords collected at the Birmingham Women's to Hospital with informed consent as described previously (3). HUVEC were cultured in medium M199 supplemented with 10% (v/v) foetal bovine serum (FBS) (Life technologies), 4 mM L-glutamine, 90 g/mL heparin (Sigma-Aldrich) and bovine brain extract was prepared as described (34). HEK293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Sigma-Alrdrich), supplemented with 10% (v/v) FBS and 4 mM L-glutamine. 310.sup.6 HEK293T cells in a 10 cm dish were transfected with 9 pg of DNA and polyethylenimine (PEI) as described (4) and allowed 24-48 hours to express proteins.

[0492] Cell Surface Biotinylation

[0493] HEK293T (310.sup.5) cells were transfected with various constructs using 1 g DNA and 4 g PEI in 6 well plates. The next day cells were washed twice with PBS containing Mg.sup.2+ and Ca.sup.2+ and then EZ-Link Sulfo-NHS-Biotin (Thermo Scientific # 21217) was incubated at 1 mg/mL in PBS for 30 minutes, biotinylation reaction was quenched using 100 mM glycine and cells were washed twice more with PBS. Then immunoprecipitations were performed as described below.

[0494] Structure Prediction Modelling

[0495] The i-TASSER (Iterative Threading ASSEmbly Refinement) server was used to predict the 3D molecular structure of CLEC14A CTLD from residues 21-173 (Accession number Q86T13). The predicted structure with the highest C score (0.05) and an organised structure was chosen.

[0496] Lentiviral Transduction

[0497] HEK293T cells were PEI transfected as above with pWPI containing gene of interest (4.39 g), psPax2 (3.29 g) and pMD2G (1.32 g). Five 10 cm dishes of HEK293T were allowed to generate lentiviral particles for 24 hours, virus containing media was then concentrated using Corning Spin-X UF concentrators with 5 kDa molecular weight cut off (Sigma-Aldrich) and added to 10.sup.6 LLC for 48 hours. Transduction efficiency was determined using flow cytometry and untransduced LLC as a control for background fluorescence.

[0498] Western Blotting, Far Western Blotting

[0499] Whole cell protein lysates were made by incubating with lysis buffer (1% (v/v) NP40, 10 mM Tris pH7.5, 150 mM NaCl and 1 mM EDTA) and pelleting insoluble material. Standard protocols for western blotting were used. Far western blotting involved incubating PVDF membranes for 1 hour with protein of interest hCLEC14A-ECD-Fc (2 g/mL) or lysates of 610.sup.6 HEK293T cells/mL of lysis buffer transfected with MMRN2 FL with His tag (diluted 1:50). The epitope tag of each probed protein was detected with secondary antibody incubation (anti-His or anti-Fc HRP conjugate) and then tertiary anti-mouse HRP for the case of anti-His.

[0500] Immunoprecipitation

[0501] For immunoprecipitation (IP) experiments HUVEC were lysed in 200 L of IP lysis buffer (30 mM Tris pH 7.5, 1% (v/v) Triton-X-100, 10% (v/v) glycerol, 100 mM NaCl, 20 mM NaF, 10 mM KH.sub.2PO.sub.4) with protease inhibitors and phosphatase inhibitors (final concentration 5 mM NaF, 1 mM Na3VO4, 10 mM Na -glycero phosphate, 1 mM EDTA and 5 mM Na pyrophosphate). Lysates were diluted by adding 200 L of IP binding buffer (50 mM Tris pH 7.5, 20 mM KCl, 1 mg/mL BSA, 2.5% (v/v) glycerol with protease and phosphatase inhibitors) then 2-5 pg of antibodies or hCLEC14A-ECD-Fc were then added. The same quantity of control antibodies or control Fc was added to a separate IP and all mixtures were incubated on a rotator at 4 C. for 4 hours or overnight. Next 30 L of protein A (for human Fc) or protein G (for mouse and sheep IgG) sepharose beads (Sigma-Aldrich #P9424 #P3296) were washed three times in PBS and then antibody lysate mixtures were added to beads. This was incubated on a rotator at 4 C. for 4 hours or overnight. Each IP was washed four times with 400 L of IP wash buffer (100 mM Tris pH 7.5, 200 mM NaCl, 0.5% (v/v) NP40). On the last wash, beads and wash buffer was added to a fresh microcentrifuge tube, to minimise non-specific proteins present in original tube. Proteins were eluted from beads by boiling in SDS reducing buffer and then samples were subjected to SDS-PAGE and western blot.

[0502] Flow Cytometry

[0503] HUVEC or transfected HEK293T cells were detached from tissue culture plates using cell dissociation buffer or scraped and 510.sup.5 cells were stained with 20 ug/mL of antibody of interest or 20 g/mL of recombinant protein. In blocking experiments, hCLEC14A-ECD-Fc was incubated with 2 molar excess of antibody or recombinant protein on ice for 1 hour. Flow cytometry buffer (PBS with 0.2% (w/v) BSA and 0.02% (w/v) sodium azide) was used for all wash and incubation steps. Samples were analysed on a FACSCalibur machine (BD Biosciences). In experiments involving overexpression of GFP proteins, highly GFP positive cells were gated and used in analysis. Isotype control staining or human Fc alone was used as background fluorescence and this was subtracted from the geometric mean fluorescence intensity of each sample. The following detection reagents were used; Fc binding; anti-human IgG Fc FITC (1:100), biotinylated proteins; streptavidin-PE (1:100), mouse antibodies; anti-mouse alexafluor 555 (1:100).

[0504] Adhesion Assay

[0505] MMRN2.sup.495-674, MMRN2.sup.495-603 or BSA (2 ug) were coated on 96 well plates overnight in PBS at 37 C. Then blocked in 3% BSA PBS for 1 hour and then dissociated HUVEC (50,000/well) were added and allowed to attach for 4 hours at 37 C. HUVEC were washed 5 times, then fixed with 4% paraformaldehyde and stained with 0.5% crystal violet solution (Sigma-Aldrich). Pictures were taken (Leica DM IL microscope and 2M Xli camera) in the centre of each well and absorbance was measured at 590 nm.

[0506] Matrigel Tube Formation and Co-Culture Assay

[0507] Matrigel and co-culture assays as described (35), except recombinant proteins were added at 20 g/mL in PBS.

[0508] Mouse Tumour Implantation Assays

[0509] 10.sup.6 transduced LLC were subcutaneously injected into the right flank of male C57BL/6 mice aged 8-10 weeks old. After two weeks or when tumour size limit of 1200 mm.sup.3 was reached animals were culled, tumours excised and wet weights were determined. Mice were housed at the Birmingham Biomedical Services Unit (Birmingham, UK). All animal experimentation was carried out in accordance with Home Office License number PPL 70/8704 held by RB.

REFERENCES

[0510] (1) Carmeliet P. Angiogenesis in health and disease. Nat Med 2003 June; 9(6):653-60. [0511] (2) Khan K A, Bicknell R. Anti-angiogenic alternatives to VE.G.F blockade. Clin Exp Metastasis 2015 Nov. 30. [0512] (3) Mura M, Swain RK, Zhuang X, Vorschmitt H, Reynolds G, Durant S, et al. Identification and angiogenic role of the novel tumor endothelial marker CLEC14A. Oncogene 2012 Jan. 19; 31(3):293-305. [0513] (4) Noy P J, Lodhia P, Khan K, Zhuang X, Ward D G, Verissimo A R, et al. Blocking CLEC14A-MMRN2 binding inhibits sprouting angiogenesis and tumour growth. Oncogene 2015 Nov. 19; 34(47):5821-31. [0514] (5) Rho S S, Choi H J, Min J K, Lee H W, Park H, Park H, et al. Clec14a is specifically expressed in endothelial cells and mediates cell to cell adhesion. Biochem Biophys Res Commun 2011 Jan. 7; 404(1):103-8. [0515] (6) Masiero M, Simoes F C, Han H D, Snell C, Peterkin T, Bridges E, et al. A core human primary tumor angiogenesis signature identifies the endothelial orphan receptor ELTD1 as a key re.g.ulator of angiogenesis. Cancer Cell 2013 Aug. 12; 24(2):229-41. [0516] (7) Langenkamp E, Zhang L, Lugano R, Huang H, Elhassan T E, Georganaki M, et al. Elevated Expression of the C-Type Lectin CD93 in the Glioblastoma Vasculature Re.g.ulates Cytoskeletal Rearrangements That Enhance Vessel Function and Reduce Host Survival. Cancer Res 2015 Nov. 1; 75(21):4504-16. [0517] (8) Olsen R S, Lindh M, Vorkapic E, Andersson R E, Zar N, Lofgren S, et al. CD93 gene polymorphism is associated with disseminated colorectal cancer. Int J Colorectal Dis 2015 July; 30(7):883-90. [0518] (9) Kontsekova S, Polcicova K, Takacova M, Pastorekova S. Endosialin: molecular and functional links to tumor angiogenesis. Neoplasma 2016 Jan. 17. [0519] (10) Zanivan S, Maione F, Hein M Y, Hernandez-Fernaud J R, Ostasiewicz P, Giraudo E, et al. SILAC-based proteomics of human primary endothelial cell morphogenesis unveils tumor angiogenic markers. Mol Cell Proteomics 2013 December; 12(12):3599-611. [0520] (11) Naylor A J, Azzam E, Smith S, Croft A, Poyser C, Duffield J S, et al. The mesenchymal stem cell marker CD248 (endosialin) is a ne.g.ative re.g.ulator of bone formation in mice. Arthritis Rheum 2012 October; 64(10):3334-43. [0521] (12) Opaysky R, Haviernik P, Jurkovicova D, Garin M T, Copeland N G, Gilbert D J, et al. Molecular characterization of the mouse Tem1/endosialin gene re.g.ulated by cell density in vitro and expressed in normal tissues in vivo. J Biol Chem 2001 Oct. 19; 276(42):38795-807. [0522] (13) Guan E N, Burgess W H, Robinson S L, Goodman E B, McTigue K J, Tenner A J. Phagocytic cell molecules that bind the collagen-like region of C1q. Involvement in the C1q-mediated enhancement of phagocytosis. J Biol Chem 1991 Oct. 25; 266(30):20345-55. [0523] (14) Bohlson S S, Silva R, Fonseca M I, Tenner A J. CD93 is rapidly shed from the surface of human myeloid cells and the soluble form is detected in human plasma. J Immunol 2005 Jul. 15; 175(2):1239-47. [0524] (15) Christian S, Ahorn H, Novatchkova M, Garin-Chesa P, Park J E, Weber G, et al. Molecular cloning and characterization of EndoGlyx-1, an EMILIN-like multisubunit glycoprotein of vascular endothelium. J Biol Chem 2001 Dec. 21; 276(51):48588-95. [0525] (16) Noy P J, Swain R K, Khan K, Lodhia P, Bicknell R. Sprouting angiogenesis is re.g.ulated by shedding of the C-type lectin family 14, member A (CLEC14A) ectodomain, catalyzed by rhomboid-like 2 protein (RHBDL2). FASEB J 2016 Mar. 3. [0526] (17) O'callaghan C A, Byford M F, Wyer J R, Willcox B E, Jakobsen B K, McMichael A J, et al. BirA enzyme: production and application in the study of membrane receptor-ligand interactions by site-specific biotinylation. Anal Biochem 1999 Jan. 1; 266(1):9-15. [0527] (18) Simonavicius N, Ashenden M, van W A, Lax S, Huso D L, Buckley C D, et al. Pericytes promote selective vessel re.g.ression to re.g.ulate vascular patterning. Blood 2012 Aug. 16; 120(7):1516-27. [0528] (19) Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y. The I-TASSER Suite: protein structure and function prediction. Nat Methods 2015 January; 12(1):7-8. [0529] (20) Zelensky A N, Gready J E. The C-type lectin-like domain superfamily. FEBS J 2005 December; 272(24):6179-217. [0530] (21) Kastrup J S, Nielsen B B, Rasmussen H, Holtet T L, Graversen J H, Etzerodt M, et al. Structure of the C-type lectin carbohydrate recognition domain of human tetranectin. Acta Crystallogr D Biol Crystallogr 1998 Sep. 1; 54(Pt 5):757-66. [0531] (22) Ki M K, Jeoung M H, Choi J R, Rho S S, Kwon Y G, Shim H, et al. Human antibodies targeting the C-type lectin-like domain of the tumor endothelial cell marker clecl4a re.g.ulate angiogenic properties in vitro. Oncogene 2013 Nov. 28; 32(48):5449-57. [0532] (23) Lee S. M, Ki M. K, Jeoung M H, Choi J. R, inventors; Novel antibody specific for clec14a and uses thereof.WO2013187724 A1. 2013 Dec. 19. [0533] (24) Lorenzon E, Colladel R, Andreuzzi E, Marastoni S, Todaro F, Schiappacassi M, et al. MULTIMERIN2 impairs tumor angiogenesis and growth by interfering with VE.G.F-A/VE.G.FR2 pathway. Oncogene 2012 Jun. 28; 31(26):3136-47. [0534] (25) Donovan D, Brown N J, Bishop E T, Lewis C E. Comparison of three in vitro human angiogenesis assays with capillaries formed in vivo. Angiogenesis 2001;4(2):113-21. [0535] (26) McGreal E P, Ikewaki N, Akatsu H, Morgan B P, Gasque P. Human C1qRp is identical with CD93 and the mNI-11 antigen but does not bind C1q. J Immunol 2002 May 15; 168(10):5222-32. [0536] (27) Petrenko O, Beavis A, Klaine M, Kittappa R, Godin I, Lemischka I R. The molecular characterization of the fetal stem cell marker AA4. Immunity 1999 June; 10(6):691-700. [0537] (28) Leimeister C, Steidl C, Schumacher N, Erhard S, Gessler M. Developmental expression and biochemical characterization of Emu family members. Dev Biol 2002 Sep. 15; 249(2):204-18. [0538] (29) Orlandini M, Galvagni F, Bardelli M, Rocchigiani M, Lentucci C, Anselmi F, et al. The characterization of a novel monoclonal antibody against CD93 unveils a new antiangiogenic target. Oncotarget 2014 May 15; 5(9):2750-60. [0539] (30) Zhang M, Bohlson S S, Dy M, Tenner A J. Modulated interaction of the ERM protein, moesin, with CD93. Immunology 2005 May; 115(1):63-73. [0540] (31) Colladel R, Pellicani R, Andreuzzi E, Paulitti A, Tarticchio G, Todaro F, et al. MULTIMERIN2 binds VE.G.F-A primarily via the carbohydrate chains exerting an angiostatic function and impairing tumor growth. Oncotarget 2015 Dec. 9. [0541] (32) Iwasaki M, Liedtke M, Gentles A J, Cleary M L. CD93 Marks a Non-Quiescent Human Leukemia Stem Cell Population and Is Required for Development of MLL-Rearranged Acute Myeloid Leukemia. Cell Stem Cell 2015 Oct. 1; 17(4):412-21. [0542] (33) Aricescu A R, Lu W, Jones E Y. A time- and cost-efficient system for high-level protein production in mammalian cells. Acta Crystallogr D Biol Crystallogr 2006 October; 62(Pt 10):1243-50. [0543] (34) Maciag T, Cerundolo J, Ilsley S, Kelley P R, Forand R. An endothelial cell growth factor from bovine hypothalamus: identification and partial characterization. Proc Natl Acad Sci USA 1979 November; 76(11):5674-8. [0544] (35) Wilson E, Leszczynska K, Poulter N S, Edelmann F, Salisbury V A, Noy P J, et al. RhoJ interacts with the GIT-PIX complex and re.g.ulates focal adhesion disassembly. J Cell Sci 2014 Jul. 15; 127(Pt 14):3039-51. [0545] (36) Simossis V A, Heringa J. PRALINE: a multiple sequence alignment toolbox that inte.g.rates homology-extended and secondary structure information. Nucleic Acids Res 2005 Jul. 1; 33(Web Server issue):W289-W294.