USE OF SERINE PROTEASE INHIBITORS IN THE TREATMENT OF SKIN DISEASES

20190183989 ยท 2019-06-20

Assignee

Inventors

Cpc classification

International classification

Abstract

This invention relates to therapeutic compounds which are inhibitors of serine proteases, to pharmaceutical compositions thereof and to their use in the treatment of the human or animal body. More specifically, the present invention relates to a method for the treatment, diagnosis or prognosis of skin diseases comprising the administration to a subject in need thereof of a therapeutically effective amount of a Serine protease inhibitor.

Claims

1-11. (canceled)

12. A method of treating a skin disease or undesirable skin condition selected from Netherton syndrome, atopic dermatitis, psoriasis, rosacea, pruritus, and peeling skin syndrome, comprising administering to a patient in need thereof an effective amount of a pharmaceutical composition comprising a serine protease inhibitor having an amino acid sequence including reactive site loop (RSL) SEQ ID NO:160, wherein the serine protease inhibitor is an inhibitor of human kallikrein 2 (hK2).

13. The method of claim 12, wherein the serine protease inhibitor has the amino acid sequence of SEQ ID NO:8 or a fragment thereof that includes RSL SEQ ID NO:160.

14. The method of claim 12, wherein the serine protease inhibitor has the amino acid sequence of SEQ ID NO:8 or a fragment thereof sharing more than 80% in length thereof, wherein the fragment includes RSL SEQ ID NO:160.

15. The method of claim 12, wherein the serine protease inhibitor has the amino acid sequence of SEQ ID NO:8 or a fragment thereof sharing more than 90% in length thereof, wherein the fragment includes RSL SEQ ID NO:160.

16. The method of claim 12, wherein the amino acid sequence of the serine protease inhibitor includes the amino acid sequence of residues 13-412 of SEQ ID NO:8.

17. The method of claim 12, wherein the amino acid sequence of the serine protease inhibitor includes SEQ ID NO:8.

18. The method of claim 12, wherein the amino acid sequence of the serine protease inhibitor is SEQ ID NO:8.

19. The method of claim 12, wherein the serine protease inhibitor inhibits hK2 by 100% after incubation at a molar ratio of inhibitor to hK2 of 100:1 at 25 C. for 30 minutes under physiological pH and ionic strength conditions.

20. The method of claim 12, wherein the serine protease inhibitor is administered systemically.

21. The method of claim 12, wherein the serine protease inhibitor is administered topically.

Description

BRIEF OF THE FIGURES

[0022] FIG. 1 represents the DNA and protein sequences of hK2 protease inhibitor MD 820

[0023] FIG. 2 represents the DNA and protein sequences of hK2 protease inhibitor MD 62

[0024] FIG. 3 represents the DNA and protein sequences of hK2 protease inhibitor MD 83

[0025] FIG. 4 represents the DNA and protein sequences of hK2 protease inhibitor MD 67

[0026] FIG. 5 represents the DNA and protein sequences of hK2 protease inhibitor MD 61

[0027] FIG. 6 represents the DNA and protein sequences of hK2 protease inhibitor MD 518

[0028] FIG. 7 represents the DNA and protein sequences of hK2 protease inhibitor MDCI

[0029] FIG. 8 represents the DNA and protein sequences of ACT-wildtype.

[0030] FIG. 9 represents the DNA and protein sequences of hK14 protease inhibitor ACT-G1.

[0031] FIG. 10 represents the DNA and protein sequences of hK14 protease inhibitor ACT-G1G

[0032] FIG. 11 represents the DNA and protein sequences of hK14 protease inhibitor ACT-C11.

[0033] FIG. 12 represents the DNA and protein sequences of hK14 protease inhibitor ACT-C11G.

[0034] FIG. 13 represents the DNA and protein sequences of hK14 protease inhibitor ACT-E5.

[0035] FIG. 14 represents the DNA and protein sequences of hK14 protease inhibitor ACT-E8.

[0036] FIG. 15 represents the DNA and protein sequences of hK14 protease inhibitor ACT-F11.

[0037] FIG. 16 represents the DNA and protein sequences of hK14 protease inhibitor ACT-F3.

[0038] FIG. 17 represents the DNA and protein sequences of hK14 protease inhibitor ACT-G9.

[0039] FIG. 18 represents the DNA and protein sequences of AAT-wildtype.

[0040] FIG. 19 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G1.

[0041] FIG. 20 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G1G

[0042] FIG. 21 represents the DNA and protein sequences of hK14 protease inhibitor AAT-C11.

[0043] FIG. 22 represents the DNA and protein sequences of hK14 protease inhibitor AAT-C11G.

[0044] FIG. 23 represents the DNA and protein sequences of hK14 protease inhibitor AAT-E5.

[0045] FIG. 24 represents the DNA and protein sequences of hK14 protease inhibitor AAT-E8.

[0046] FIG. 25 represents the DNA and protein sequences of hK14 protease inhibitor AAT-F11.

[0047] FIG. 26 represents the DNA and protein sequences of hK14 protease inhibitor AAT-F3.

[0048] FIG. 27 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G9.

[0049] FIG. 28 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G1V.

[0050] FIG. 29 represents the DNA and protein sequences of hK14 protease inhibitor AAT-C11D.

[0051] FIG. 30 shows the grading system for skin lesions on transgeninc hKLK5 mouse Netherton Model.

[0052] FIG. 31 shows the skin lesion size development on Netherton Syndrom mouse model. Monitoring of lesion sizes and lesion grade after 1, 15 and 28 days of topical application of 2% NATROSOL (hydroxyethylcellulose (HEC)) (group 1, control) or MDPK67b in 2% NATROSOL (hydroxyethylcellulose (HEC)) (group 2).

DETAILED DESCRIPTION OF THE INVENTION

[0053] The present invention relates to the use of a Serine protease inhibitor in the preparation of a medicament for the treatment of a skin disease. Biologically active fragments of a Serine protease inhibitor are also useful in the preparation of said medicament.

[0054] Some of the serine proteases of the chymotrypsin superfamily, including t-PA, plasmin, u-PA and the proteases of the blood coagulation cascade are large molecules that contain, in addition to the serine protease catalytic domain, other structural domains responsible in part for regulation of their activity (Barrett, 1986; Gerard et al, 1986; Blasi et al., 1986). Among important serine proteases are trypsin-like enzymes, such as trypsin, tryptase, thrombin, kallikrein, and factor Xa. The serine protease targets are associated with processes such as blood clotting; complement mediated lysis, the immune response, glomerulonephritis, pain sensing, inflammation, pancreatitis, cancer, regulating fertilization, bacterial infection and viral maturation. By inhibiting serine proteases which have high specificity for a particular target, one can inhibit in vivo numerous biological processes, which may have dramatic effects on a host.

[0055] Serine proteinase inhibitors (serpins) comprise a diverse group of proteins that form a superfamily already including more than 100 members, from such diverse organisms as viruses, plants and humans Serpins have evolved over 500 million years and diverged phylogenetically into proteins with inhibitory function and non-inhibitory function (Hunt and Dayhoff, 1980). Non-inhibitory serpins such as ovalbumin lack protease inhibitory activity (Remold-O'Donnell, 1993). The primary function of serpin family members appears to be neutralizing overexpressed serine proteinase activity (Potempa et al., 1994). Serpins play a role in extracellular matrix remodeling, modulation of inflammatory response and cell migration (Potempa et al., 1994).

[0056] Serine protease inhibitors are divided into the following families: the bovine pancreatic trypsin inhibitor (Kunitz) family, also known as basic protease inhibitor (Ketcham et al., 1978); the Kazal family; the Streptomyces subtilisin inhibitor family; the serpin family; the soybean trypsin inhibitor (Kunitz) family; the potato inhibitor family; and the Bowman-Birk family (Laskowski et al., 1980; Read et al., 1986; Laskowski et al., 1987). Serine protease inhibitors belonging to the serpin family include the plasminogen activator inhibitors PAI-1, PAI-2 and PAI-3, Cl esterase inhibitor, alpha-2-antiplasmin, contrapsin, alpha-1-antitrypsin, antithrombin III, protease nexin I, alpha-1-antichymotrypsin, protein C inhibitor, heparin cofactor II and growth hormone regulated protein (Carrell et al., 1987; Sommer et al., 1987; Suzuki et al., 1987; Stump et al., 1986).

[0057] Many of the serine protease inhibitors have a broad specificity and are able to inhibit both the chymotrypsin superfamily of proteases, including the blood coagulation serine proteases, and the Streptomyces subtilisin superfamily of serine proteases (Laskowski et al., 1980). The inhibition of serine proteases by serpins has been reviewed in Travis et al. (1983); Carrell et al. (1985); and Sprengers et al. (1987). Crystallographic data are available for a number of intact inhibitors including members of the BPTI, Kazal, SSI, soybean trypsin and potato inhibitor families, and for a cleaved form of the serpin alpha-1-antitrypsin (Read et al., 1986). Despite the fact that these serine protease inhibitors are proteins of diverse size and sequence, the intact inhibitors studied to date all have in common a characteristic loop, termed the reactive site loop, extending from the surface of the molecule that contains the recognition sequence for the active site of the cognate serine protease (Levin et al., 1983). The structural similarity of the loops in the different serine protease inhibitors is remarkable (Papamokos et al., 1982). The specificity of each inhibitor is thought to be determined primarily by the identity of the amino acid that is immediately amino-terminal to the site of potential cleavage of the inhibitor by the serine protease. This amino acid, known as the Pi site residue, is thought to form an acyl bond with the serine in the active site of the serine protease (Laskowski et al., 1980). Whether or not a serpin possesses inhibitory function depends strongly on the consensus sequence located in the hinge region of the reactive site loop near the carboxy-terminus of the coding region. Outside of the reactive site loop, the serine protease inhibitors of different families are generally unrelated structurally, although the Kazal family and Streptomyces subtilisin family of inhibitors display some structural and sequence similarity.

[0058] As used herein, the following definitions are supplied in order to facilitate the understanding of the present invention.

[0059] A or an means at least one or one or more.

[0060] The term comprise is generally used in the sense of include, that is to say permitting the presence of one or more features or components.

[0061] As used herein, the terms protein, polypeptide, polypeptidic, peptide and peptidic or peptidic chain are used interchangeably herein to designate a series of amino acid residues connected to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.

[0062] Preferably, the Serine protease inhibitor is a recombinant Serine protease inhibitor and is selected from the group comprising the SEQ ID NOS:2, 4, 6, 8, 10, 12 and 14 or a biologically active fragment thereof having a Serine protease inhibitor activity.

[0063] Preferably also the recombinant Serine protease inhibitor is selected from the group comprising the SEQ ID NOS:39 to 59 or a biologically active fragment thereof having a Serine protease inhibitor activity.

[0064] Amino acid residue means any amino acid residue known to those skilled in the art. This encompasses naturally occurring amino acids (including for instance, using the three-letter code, Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Be, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val), as well as rare and/or synthetic amino acids and derivatives thereof (including for instance Aad, Abu, Acp, Ahe, Aib, Apm, Dbu, Des, Dpm, Hyl, McLys, McVal, Nva, and the like).

[0065] Said amino acid residue or derivative thereof can be any isomer, especially any chiral isomer, e.g. the L- or D-isoform.

[0066] By amino acid derivative, we hereby mean any amino acid derivative as known in the art. For instance, amino acid derivatives include residues derivable from natural amino acids bearing additional side chains, e.g. alkyl side chains, and/or heteroatom substitutions.

[0067] Biologically active fragments refer to sequences sharing at least 40% amino acids in length with the respective sequence of the substrate active site. These sequences can be used as long as they exhibit the same properties as the native sequence from which they derive. Preferably these sequences share more than 70%, preferably more than 80%, in particular more than 90% amino acids in length with the respective sequence the substrate active site.

[0068] The present invention also includes variants of a Serine protease inhibitor sequence. The term variants refer to polypeptides having amino acid sequences that differ to some extent from a native sequence polypeptide that is amino acid sequences that vary from the native sequence by conservative amino acid substitutions, whereby one or more amino acids are substituted by another with same characteristics and conformational roles. The amino acid sequence variants possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence of the native amino acid sequence. Conservative amino acid substitutions are herein defined as exchanges within one of the following five groups:

I. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, Gly
II. Polar, positively charged residues: His, Arg, Lys
III. Polar, negatively charged residues: and their amides: Asp, Asn, Glu, Gln
IV. Large, aromatic residues: Phe, Tyr, Trp
V. Large, aliphatic, nonpolar residues: Met, Leu, He, Val, Cys.

[0069] Administering, as it applies in the present invention, refers to contact of a pharmaceutical, therapeutic, diagnostic agent or composition, to the subject, preferably a human.

[0070] The term kallikrein relates to glandular or tissue kallikreins. Glandular or tissue kallikreins are a sub-family of serine proteases, with a high degree of substrate specificity and diverse expression in various tissues and biological fluids. The term kallikrein appeared in the literature for the first time in the 1930s, when large amounts of protease enzymes were found in pancreas isolates (pancreas is Kallikreas in Greek) (Kraut et al. 1930, Werle 1934). Nowadays kallikrein enzymes are divided into two groups, plasma and tissue kallikreins, which differ significantly in their molecular weight, substrate specificity, immunological characteristics, gene structure, and type of the kinin released.

[0071] Kallikreins comprise a family of 15 homologous single chain, secreted serine endopeptidases of 25-30 kDa, with orthologues present in species from at least six mammalian orders. These kallikreins are hK2, hK3, hK2, hK5, hK6, hK7, hK8, hK9 hK10, hK11, hK12, hK13, hK14 and hK15. Preferably, kallikreins to be inhibited are selected from the group comprising hK2, hK5, hK7, and hK14.

[0072] Disease, as used herein, refers to a pathological condition of a part, organ, or system of an organism resulting from various causes, such as infection, genetic defect, or environmental stress, and characterized by an identifiable group of signs or symptoms.

[0073] The epidermis has been shown to express several serine proteases including kallikrein, urokinase, plasmin, typtase-like and neutrophile elastase enzymes. These serine proteases are involved in multiple activities in the skin including epidermal cell proliferation, cell differentiation, skin and lipid barrier homeostasis and tissue remodelling. Most importantly, proteolysis of stratum corneum (SC) corneodesmosomes by serine proteases together with other enzymes is a crucial event prior to shedding of the outermost skin layer, called desquamation. Furthermore, increased protease activity, including kallikrein, plasmin and urokinase enzymes are implicated in inflammatory reactions of the skin. A list with inflammatory skin diseases is shown in TABLE XX.

[0074] Increased protease activity was also observed as stress response to various stimuli including environmental factors as ultraviolet radiation exposure and temperature changes or as reaction to different surfactants.

[0075] Several kallikreins, notably hK5, hK7 and hK14 have been implicated in the proteolytic cascade in skin desquamation. This proteolytic process is controlled through a complex inhibition and activation process and its deregulation can cause serious skin disorders. Rare genetic diseases (Netherton Syndrome, peeling skin syndrome) as well as more common skin diseases like atopic dermatitis or psoriasis are characterized by increased desquamation of the skin caused at least in part by an increased kallikrein activity.

[0076] The present invention also relates to the use of a Serine protease in the preparation of a cosmetic or cosmeceutical agent for the treatment or improvement of an undesirable skin condition. Biologically active fragments of a Serine protease inhibitor are also useful in the preparation of said cosmetic or cosmeceutical agent.

[0077] An undesirable skin condition refers, in the present invention, to a problem affecting the skin or the appearance of the skin which might not always be considered as a disease.

[0078] As used herein Cosmetics are compositions used to enhance or protect the appearance of the human skin. Cosmetics include skin-care creams, lotions, powders, perfumes, lipsticks, fingernail and toenail polishes, eye and facial makeup, permanent waves, hair colors, hair sprays and gels, deodorants, baby products, bath oils, bubble baths, bath salts, butters and many other types of products.

[0079] Cosmeceuticals are cosmetic products that are thought to have drug-like benefits. Examples of products typically labeled as cosmeceuticals include anti-aging creams and moisturizers. Cosmeceuticals may contain purported active ingredients such as vitamins, phytochemicals, enzymes, antioxidants, and essential oils.

[0080] As used herein, Skin disease relates to conditions affecting the skin. Usually, the skin disease is selected from Table XX. Preferably, the invention is suitable for treatment of skin diseases, such as atopic dermatitis, contact dermatitis (allergy), contact dermatitis (irritant), eczema, psoriasis, acne, epidermal hyperkeratosis, acanthosis, epidermal inflammation, dermal inflammation or pruritus, rosacea, netherton syndrome, peeling skin syndrome type A and B, hereditary ichtyosis, hidradenitis suppurativa and erythroderma (generalized exfoliative dermatitis). Most preferably, the skin disease is selected from the group comprising Netherton syndrome, Atopic dermatitis, Psoriasis and Peeling Skin Syndrome.

[0081] Netherton syndrome (NS) is a rare autosomal recessive genodermatosis caused by mutations in SPINK5 (LEKTI) one of the major inhibitor of the skin kallikrein cascade. Increased kallikrein activities have been shown to be causative for its clinical symptoms.

NS, a multisystem ichthyosiform syndrome, is characterized by ichthyosis, erythroderma, hair shaft defects and atopic features. Multiple infections due to the seriously impaired barrier function of the skin are very common.
NS is very rare, but little data on frequency is available, probably in part due to the difficulty to identify NS. Currently, less than 10 cases per million are diagnosed.
Treatment options are very limited and non-curative. They concentrate mainly on management of the various cutaneous infections and reduction of itching and pain (e.g. corticosteroid).
Excessive kallikrein activity (hK5, hK7, hK14) was proven causative for symptoms of the skin disorder. Decreased activity of the natural kallikrein inhibitor (LEKTI) could be replaced by alternative kallikrein inhibitors.

[0082] Surprisingly, Applicants have shown, e.g. in example 4, that the application of Serine protease inhibitors including MD67 (SEQ ID NO:8) mouse model (orthotopic hK5 overexpressing) considerably decreased the severity of the symptoms, which were observed in the untreated skin disease (e.g. NS) models. The symptoms are characterized by severe peeling of the skin, due to premature desmosomal protein degradation resulting in splitting of corneodesmosomes and stratum corneum detachment. This causes a severe loss of skin barrier functions leading to severe dehydratation, erythema and intense scratching.

[0083] Atopic dermatitis (AD) is a pruritic disease of not well defined origin that usually starts in early infancy and is typified by itching, eczematous lesions and dry, thick skin. AD is associated with other atopic diseases (eg, asthma, allergic reactions in about 30% of patients) and cutaneous infections are common.

[0084] The pathophysiology of AD is poorly understood. There appears to be a genetic component. An immune defect involving an abnormality of TH2 cells is suggested and a dysregulation of protease activity was found to be involved in the disease. This dysregulation is believed to cause a defective barrier function in the stratum corneum leading to the entry of antigens, which results in the production of various inflammatory cytokines. The prevalence rate in US is 10-12% in children and 0.9% in adults. In other developed countries the prevalence rate is as high as 18% and is rising, especially in developed countries. The disease is chronic, but the majority of patients improve from childhood to adult age.

No curative treatment is available yet. Depending on the severity of the symptoms topical steroids, antihistamines and immunomodulators or antibiotics, antiviral and antifungal agents are usually prescribed.

[0085] Psoriasis is a chronic disease, it is noncontagious and commonly appears as inflamed, edematous skin lesions, but also occurs on the oral mucosa. Joints (arthritis) also are affected in 10% of patients. Flares are related to various systemic and environmental factors including stress events or infections. There is a genetic predisposition for psoriasis and there is mounting evidence for signs of an autoimmune disorder. Increased protease (e.g. kallikrein) activity is involved in the typical excessive desquamation of the skin. In the US 2 to 3% of the population are affected and over 200,000 new cases occur annually. Approximately 1.5 million people with psoriatic arthritis seek medical care each year and 400 hundred people die annually from psoriasis-related causes. Incidence of psoriasis in other countries is similar but dependent on the climate and genetic heritage of the population. It is less common in the tropics and in dark-skinned persons.

[0086] Currently, there is no curative treatment. Depending on severity of symptoms topical corticosteroids, coal tar, keratolytic agents or retinoids are prescribed.

[0087] Mammal for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, monkeys etc. Preferably, the mammal is human.

[0088] Treatment refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. Hence, the mammal to be treated herein may have been diagnosed as having the disorder or may be predisposed or susceptible to the disorder.

[0089] The term subject refers to patients of human or other mammal and includes any individual it is desired to examine or treat using the methods according to the present invention. However, it will be understood that patient does not automatically imply that symptoms or diseases are present.

[0090] The phrase pharmaceutically acceptable refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.

[0091] As used herein, the term protease refers to a class of enzymes which recognizes a molecule and cleaves an activation sequence in the molecule. The protease can be an endopeptidase which cleaves internal peptide bonds. Alternatively, the protease can be an exopeptidase which hydrolyzes the peptide bonds from the N-terminal end or the C-terminal end of the polypeptide or protein molecule. The protease folds into a conformation to form a catalytic site which receives and cleaves the activation sequence.

[0092] Inhibitors refer to a polypeptide, or a chemical compound, that specifically inhibit the function of a kallikrein or serine protease by, preferably, binding to said kallikrein or serine protease.

[0093] Reactive Serpin Loop or Reactive Site Loop or RSL refers to an exposed flexible reactive-site loop found in serpin and which is implicated in the interaction with the putative target protease. From the residue on the amino acid side of the scissile bond, and moving away from the bond, residues are conventionally called P1, P2, P3, etc. Residues that follow the scissile bond are called P1, P2, P3, etc. Usually, the RSL is composed of 6 to 12 amino acid residues.

[0094] Serine protease inhibitors or serpin according to the invention can be selected from the group comprising the -1antichymotrypsin (ACT), protein C inhibitor (PCI), -1antiproteinase (AAT), human -1antitrypsin-related protein precursor (ATR), -2-plasmin inhibitor (AAP), human anti-thrombin-III precursor (ATIII), protease inhibitor 10 (PI10), human collagen-binding protein 2 precursor (CBP2), protease inhibitor 7 (PI7), protease inhibitor leuserpin 2 (HLS2), human plasma protease C1 inhibitor (C1 INH), monocyte/neutrophil elastase inhibitor (M/NEI), plasminogen activator inhibitor-3 (PAI3), protease inhibitor 4 (PI4), protease inhibitor 5 (PI5), protease inhibitor 12 (PI12), human plasminogen activator inhibitor-1 precursor endothelial (PAI-1), human plasminogen activator inhibitor-2 placental (PAI2), human pigment epithelium-derived factor precursor (PEDF), protease inhibitor 6 (PI6), protease inhibitor 8 (PI8), protease inhibitor 9 (PI9), human squamous cell carcinoma antigen 1 (SCCA-1), human squamous cell carcinoma antigen 2 (SCCA-2), T4-binding globulin (TBG), Megsin, and protease inhibitor 14 (PI14), fragments thereof, molecular chimeras thereof, combinations thereof and/or variants thereof.

[0095] Since most of these serpins have different names, Applicant includes below a table I summarizing their specifications:

TABLE-US-00001 TABLEI Accession Serpin Number RSLsequence PIorAAT,A1AT_HUMANALPHA-1-ANTITRYPSINPRECURSOR sp|P01009| GTEAAGAMFLEAIPMSIPPE (ALPHA-1PROTEASEINHIBITOR)(ALPHA-1-ANTIPROTEINASE) SEQIDNO:85 PILorATR,A1AU_HUMANALPHA-1-ANTITRYPSIN-RELATED sp|P20848| GTEATGAPHLEEKAWSKYQT PROTEINPRECURSOR SEQIDNO:86 PLIORAAP,A2AP_HUMANALPHA-2-ANTIPLASMIN sp|P08697| GVEAAAATSIAMSRMSLSSF PRECURSOR(ALPHA-2-PLASMININHIBITOR)(ALPHA-2-PI) SEQIDNO:87 (ALPHA-2-AP) AACT,AACT_HUMANALPHA-1-ANTICHYMOTRYPSIN sp|P01011| GTEASAATAVKITLLSALVE PRECURSOR(ACT) SEQIDNO:88 AT3,ANT3_HUMANANTITHROMBIN-IIIPRECURSOR(ATIII) sp|P01008| GSEAAASTAVVIAGRSLNPN SEQIDNO:89 PI10,BOMA_HUMANBOMAPIN(PROTEASEINHIBITOR10) sp|P48595| GTEAAAGSGSEIDIRIRVPS SEQIDNO:90 CBP2,CBP2_HUMANCOLLAGEN-BINDINGPROTEIN2 sp|P50454| GNPFDQDIYGREELRSPKLF PRECURSOR(COLLIGIN2) SEQIDNO:91 PI7orPN1,GDN_HUMANGLIADERIVEDNEXINPRECURSOR sp|P07093| GTKASAATTAILIARSSPPW (GDN)(PROTEASENEXINI)(PN-1)(PROTEASEINHIBITOR7) SEQIDNO:92 HCF2,HEP2_HUMANHEPARINCOFACTORIIPRECURSOR sp|P05546| GTQATTVTTVGFMPLSTQVR (HC-II)(PROTEASEINHIBITORLEUSERPIN2)(HLS2) SEQIDNO:93 C1NHorC1IN,IC1_HUMANPLASMAPROTEASEC1INHIBITOR sp|P05155| GVEAAAASAISVARTLLVFE PRECURSOR(C1INH) SEQIDNO:94 ELANH2orPI2,ILEU_HUMANLEUKOCYTEELASTASE sp|P30740| GTEAAAATAGIATFCMLMPE INHIBITOR(LEI)(MONOCYTE/NEUTROPHILELASTASE SEQIDNO:95 INHIBITOR)(M/NEI)(EI) PCIorPLANH3orPROCI,IPSP_HUMANPLASMASERINE sp|P05154| GTRAAAATGTIFTFRSARLN PROTEASEINHIBITORPRECURSOR(PCI)(PROTEINC SEQIDNO:96 INHIBITOR)(PLASMINOGENACTIVATORINHIBITOR-3)(PAI3) PI4orKST,KAIN_HUMANKALLISTATINPRECURSOR sp|P29622| GTEAAAATTFAIKFFSAQTN (KALLIKREININHIBITOR)(PROTEASEINHIBITOR4) SEQIDNO:97 PI5,MASP_HUMANMASPINPRECURSOR(PROTEASE sp|P36952| GGDSIEVPGARILQHKDELN INHIBITORS) SEQIDNO:98 PI12,NEUS_HUMANNEUROSERPINPRECURSOR(PROTEASE sp|Q99574| GSEAAAVSGMIAISRMAVLY INHIBITOR12) SEQIDNO:99 PAI1orPLANH1,sp|P05121|PAI1_HUMANPLASMINOGEN sp|P05121| GTVASSSTAVIVSARMAPEE ACTIVATORINHIBITOR-1PRECURSOR,ENDOTHELIAL(PAI-1) SEQIDNO:100 PAI2orPLANH2,PAI2_HUMANPLASMINOGENACTIVATOR sp|P05120| GTEAAAGTGGVMTGRTGHGG INHIBITOR-2,PLACENTAL(PAI-2)(MONOCYTEARG-SERPIN) SEQIDNO:101 (UROKINASEINHIBITOR) PEDF,PEDF_HUMANPIGMENTEPITHELIUM-DERIVEDFACTOR sp|P36955| GAGTTPSPGLQPAHLTFPLD PRECURSOR(PEDF)(EPC-1) SEQIDNO:102 PI6orPTI,PTI6_HUMANPLACENTALTHROMBININHIBITOR sp|P35237| GTEAAAATAAIMMMRCARFV (CYTOPLASMICANTIPROTEINASE)(CAP)(PROTEASE SEQIDNO:103 INHIBITOR6) PI8,PTI8_HUMANCYTOPLASMICANTIPROTEINASE2(CAP2) sp|P50452| GTEAAAATAVVRNSRCSRME (CAP-2)(PROTEASEINHIBITOR8) SEQIDNO:104 PI9,PTI9_HUMANCYTOPLASMICANTIPROTEINASE3(CAP3) sp|P50453| GTEAAAASSCFVVAECCMES (CAP-3)(PROTEASEINHIBITOR9) SEQIDNO:105 SCCA1,SCC1_HUMANSQUAMOUSCELLCARCINOMA sp|P29508| GAEAAAATAVVGFGSSPAST ANTIGEN1(SCCA-1)(PROTEINT4-A) SEQIDNO:106 SCCA2,SCC2_HUMANSQUAMOUSCELLCARCINOMA sp|P48594| GVEAAAATAVVVVELSSPST ANTIGEN2(SCCA-2)(LEUPIN) SEQIDNO:107 TBG,THBG_HUMANTHYROXINE-BINDINGGLOBULIN sp|P05543| GTEAAAVPEVELSDQPENTF PRECURSOR(T4-BINDINGGLOBULIN) SEQIDNO:108 MEGSIN gi|4505149|ref| GTEATAATGSNIVEKQLPQS NP_003775.1| SEQIDNO:109 PI14,pancpin,TSA2004 gi|3724282|dbj| GSEAATSTGIHIPVIMSLAQ BAA33766.11| SEQIDNO:110

[0096] Advantageously, the serine protease inhibitor of the invention may be a serine protease trypsin-like enzyme and preferably a Kallikrein inhibitor. Kallikrein inhibitors of the invention are selected amongst hK2, hK3, hK4, hK5, hK6, hK7, hK8, hK9 hK10, hK11, hK12, hK13, hK14 or hK15 inhibitors. Preferably kallikreins inhibitors are selected among hK2, hK5, hK7, and hK14 inhibitors.

[0097] In case the kallikrein inhibitor is an inhibitor directed against hK2, said inhibitor can be selected among those disclosed in International Patent Application PCT/IB2004/001040, which content is incorporated herein by reference in its entirety. Preferably, the kallikrein inhibitor of the invention may be selected from the group comprising MD820, MD62, MD61, MD67 and MDCI. Most preferably this inhibitor is MD67. This application discloses a recombinant inhibitor protein of a protease comprising an inhibiting polypeptidic sequence and at least one polypeptidic sequence of a substrate-enzyme interaction site specific for a protease as well as a method for producing the recombinant inhibitor protein of a protease. Preferably the recombinant Serine protease inhibitor is selected from the group comprising the SEQ ID NOS:2, 4, 6, 8, 10, 12 and 14 or a biologically active fragment thereof having a Serine protease inhibitor activity.

[0098] As an example of serine protease inhibitor according to the invention, Applicants have surprisingly found 7 new recombinant inhibitor proteins specific for the protease hK2 as resumed below in table II, these inhibitors are:

TABLE-US-00002 TABLE II SEQ Recombinant ID NO: inhibitors Other name (protein) rACT.sub.8.20 MD820 2 rACT.sub.6.2 MD62 4 rACT.sub.8.3 MD83 6 rACT.sub.6.7 MD67 8 rACT.sub.6.1 MD61 10 ACT.sub.5.18 MD518 12 ACT.sub.PCI MDCI 14

[0099] These inhibitor proteins have been obtained by modifying the RSL of 1-antichymotrypsin (rACT), which is known to inhibit a large panel of human enzymes such as chymotrypsin, mast cell chymase, cathepsin G, prostatic kallikreins hK2 and PSA (hK3), in order to change the specificity of this serpin. Peptide sequences, selected as substrates for the enzyme hK2 by phage display technology as explained in International Patent Application PCT/IB2004/001040, have been used to replace the scissile bond and neighbour amino acid residues of the RSL. Usually, recombinant inhibitors were produced in bacteria and purified by affinity chromatography.

[0100] Additionally, Applicants have also found that replacing residues P3-P3 located in RSL structure of rACT.sub.WT by substrate pentapeptide coding for the RSL of Protein C inhibitor (PCI) lead to the production of a recombinant inhibitor (MDCI) which is able to inhibit kallikreins hK2 and hK3.

[0101] In case the kallikrein inhibitor is an inhibitor directed against hK14, then said inhibitor can be selected among those disclosed in the International Patent Application PCT/IB2005/000504, which content is incorporated herein by reference in its entirety. Preferably, said recombinant inhibitor may be selected from the group comprising AAT.sub.G1, AAT.sub.G1G, AAT.sub.C11, AAT.sub.C11G, AAT.sub.E5, AAT.sub.E8, AAT.sub.F11, AAT.sub.F3, AAT.sub.G9, ACT.sub.G1, AcT.sub.G1G, ACT.sub.C11, ACT.sub.C11G, ACT.sub.E5, ACT.sub.E8, ACT.sub.F11, ACT.sub.F3, ACT.sub.G9, ACT.sub.G1V, ACT.sub.WT and ACT.sub.C11D. Preferably, said inhibitor protein of an hK14 protease is AAT.sub.G1 AAT.sub.G1G, AAT.sub.C11, AAT.sub.C11G, AAT.sub.E5, AAT.sub.E8, AAT.sub.F3, AAT.sub.G9, ACT.sub.G1G, ACT.sub.C11, ACT.sub.C11G, ACT.sub.E5, ACT.sub.E8, AGT.sub.F11, ACT.sub.F3, ACT.sub.G9, ACT.sub.G1V, or ACT.sub.C11D.

[0102] This application discloses a recombinant inhibitor protein of an hK14 protease having an inhibiting polypeptidic sequence and at least a polypeptidic sequence of a substrate-enzyme interaction site specific for said hK14 protease. Preferably, said recombinant inhibitor protein of an hK14 protease has, under physiological conditions, [0103] i) a stochiometry of inhibition (SI) equal or below to 11.7 after at least 4 hours of incubation, [0104] ii) an association rate (Ka) of at least 7,500 M.sup.1 s.sup.1, [0105] iii) an inhibitory activity of 100% after at least 30 minutes of incubation.

[0106] In addition, the inhibiting polypeptidic sequence of the protease inhibitor may also be selected from a cysteine protease since there are now a number of well-documented instances of inhibition of cysteine proteases by serpins (Gettins P. G. W., 2002 Serpin structure, mechanism, and function in Chem. Rev, 102, 4751-4803). These examples include inhibition of cathepsins K, L and S by the serpin squamous cell carcinoma antigen1, inhibition of prohormone thiol proteinase by the -1antichymotrypsin, and inhibition of members of the caspase family, including caspase 1 (interleukine 1 converting enzyme), caspase 3, and caspase 8 by the viral serpin crmA and caspases 1, 4 and 8 by the human serpin PI9.

[0107] Usually, the serine protease inhibitor is a recombinant inhibitor protein. Thus, when recombinant techniques are employed to prepare a Serine protease inhibitor, nucleic acid molecules or fragments thereof encoding the polypeptides are preferably used.

[0108] Therefore the present invention also relates to a purified and isolated DNA sequence encoding the Serine protease inhibitor as described above.

[0109] A purified and isolated DNA sequence refers to the state in which the nucleic acid molecule encoding the recombinant inhibitor protein of a protease of the invention, or nucleic acid encoding such recombinant inhibitor protein of a protease will be, in accordance with the present invention. Nucleic acid will be free or substantially free of material with which it is naturally associated such as other polypeptides or nucleic acids with which it is found in its natural environment, or the environment in which it is prepared (e. g. cell culture) when such preparation is by recombinant DNA technology practiced in vitro or in vivo.

[0110] DNA which can be used herein is any polydeoxynuclotide sequence, including, e.g. double-stranded DNA, single-stranded DNA, double-stranded DNA wherein one or both strands are composed of two or more fragments, double-stranded DNA wherein one or both strands have an uninterrupted phosphodiester backbone, DNA containing one or more single-stranded portion(s) and one or more double-stranded portion(s), double-stranded DNA wherein the DNA strands are fully complementary, double-stranded DNA wherein the DNA strands are only partially complementary, circular DNA, covalently-closed DNA, linear DNA, covalently crosslinked DNA, cDNA, chemically-synthesized DNA, semi-synthetic DNA, biosynthetic DNA, naturally-isolated DNA, enzyme-digested DNA, sheared DNA, labeled DNA, such as radiolabeled DNA and fluorochrome-labeled DNA, DNA containing one or more non-naturally occurring species of nucleic acid.

[0111] DNA sequences that encode the Serine protease inhibitor, or a biologically active fragment thereof having a Serine protease inhibitor activity, can be synthesized by standard chemical techniques, for example, the phosphotriester method or via automated synthesis methods and PCR methods.

[0112] The purified and isolated DNA sequence encoding the Serine protease inhibitor according to the invention may also be produced by enzymatic techniques. Thus, restriction enzymes, which cleave nucleic acid molecules at predefined recognition sequences can be used to isolate nucleic acid sequences from larger nucleic acid molecules containing the nucleic acid sequence, such as DNA (or RNA) that codes for the recombinant inhibitor protein or for a fragment thereof.

[0113] Encompassed by the present invention is also a nucleic acid in the form of a polyribonucleotide (RNA), including, e.g., single-stranded RNA, double-stranded RNA, double-stranded RNA wherein one or both strands are composed of two or more fragments, double-stranded RNA wherein one or both strands have an uninterrupted phosphodiester backbone, RNA containing one or more single-stranded portion(s) and one or more double-stranded portion(s), double-stranded RNA wherein the RNA strands are fully complementary, double-stranded RNA wherein the RNA strands are only partially complementary, covalently crosslinked RNA, enzyme-digested RNA, sheared RNA, mRNA, chemically-synthesized RNA, semi-synthetic RNA, biosynthetic RNA, naturally-isolated RNA, labeled RNA, such as radiolabeled RNA and fluorochrome-labeled RNA, RNA containing one or more non-naturally-occurring species of nucleic acid.

[0114] The purified and isolated DNA sequence encoding a Serine protease inhibitor is preferably selected from the group comprising SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:16 to SEQ ID NO:37.

[0115] The present invention also includes variants of the aforementioned sequences, that is nucleotide sequences that vary from the reference sequence by conservative nucleotide substitutions, whereby one or more nucleotides are substituted by another with same characteristics.

[0116] Also encompassed in the present invention is the use of a purified and isolated DNA sequence encoding a Serine protease inhibitor in the preparation of a medicament for the treatment of a skin disease.

[0117] Alternatively, the Kallikrein inhibitors or the serine protease inhibitors of the invention comprise a detectable label or bind to a detectable label to form a detectable complex.

[0118] Detectable labels are detectable molecules or detection moiety for diagnostic purposes, such as enzymes or peptides having a particular binding property, e.g. streptavidin or horseradish peroxidase. Detection moiety further includes chemical moieties such as biotin which may be detected via binding to a specific cognate detectable moiety, e. g. labelled avidin.

[0119] Preferably, detectable labels include fluorescent labels and labels used conventionally in the art for MRI-CT imagine. A number of fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow.

[0120] The Kallikrein inhibitors or the serine protease inhibitors of the invention may carry a radioactive label as the detection moiety, such as the isotopes 3H, 14C, 32P, 35S, 36Cl, 51Cr, 57Co, 58Co, 59Fe, 90Y, 121I, 124I, 125I, 131I, 111In, 211At, 198Au, 67Cu, 225Ac, 213bu, 99Tc and 186Re. When radioactive labels are used, known currently available counting procedures may be utilized to identify and quantitate the specific binding members.

[0121] In the instance where the label is an enzyme, detection may be accomplished by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques known in the art.

[0122] The radioactive labels are useful in in vitro diagnostics techniques, ex vivo and in in vivo radioimaging techniques. In a further aspect, the radioactive labels are useful in radioimmuno-guided surgery techniques, wherein they can identify and indicate the presence and/or location of cancer cells, precancerous cells, tumor cells, and hyperproliferative cells, prior to, during or following surgery to remove such cells.

[0123] In the instance of in vivo imaging, the labels of the present invention may be conjugated to an imaging agent rather than a radioisotope(s), including but not limited to a magnetic resonance image enhancing agent. Examples of chelating groups include EDTA, porphyrins, polyamines crown ethers and polyoximes.

[0124] Examples of paramagnetic ions include gadolinium, iron, manganese, rhenium, europium, lanthanium, holmium and erbium.

[0125] The present invention is also directed to a pharmaceutical composition comprising the serine protease inhibitor as described herein as an active agent, optionally in combination with one or more pharmaceutically acceptable carriers.

[0126] Preferably the composition, as a pharmaceutical composition, according to the invention is to be administered to a patient in need of treatment via any suitable route, usually by injection into the bloodstream or CSF, or directly into the site of the disease, or close to this site. The precise dose will depend upon a number of factors, including whether the composition is for diagnosis, prognosis, prophylaxis of or for treatment, the size and location of, for example, desquamation, the precise nature of the composition, and the nature of the detectable or functional label attached to the Kallikrein inhibitor or the serine protease inhibitor.

[0127] The present pharmaceutical composition comprises as an active substance a pharmaceutically effective amount of the composition as described, optionally in combination with pharmaceutically acceptable carriers, diluents and adjuvants.

[0128] A pharmaceutically effective amount refers to a chemical material or compound which, when administered to a human or animal organism induces a detectable pharmacological and/or physiologic effect.

[0129] The pharmaceutically effective amount of a dosage unit of the polypeptide usually is in the range of 0.001 ng to 100 g per kg of body weight of the patient to be treated.

[0130] The pharmaceutical composition may contain one or more pharmaceutically acceptable carriers, diluents and adjuvants.

[0131] Acceptable carriers, diluents and adjuvants which facilitates processing of the active compounds into preparation which can be used pharmaceutically are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl orbenzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, hydroxyethylcellulose (NATROSOL (hydroxyethylcellulose (HEC)) or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic surfactants such as TWEEN (polysorbate or polyoxyethylene sorbitol ester), PLURONIC (polyoxyalkylene ether) or polyethylene glycol (PEG).

[0132] The form of administration of the pharmaceutical composition may be systemic or topical. For example, administration of such a composition may be various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, transdermal, buccal routes or via an implanted device, and may also be delivered by peristaltic means.

[0133] The pharmaceutical composition, as described herein, may also be incorporated or impregnated into a bioabsorbable matrix, with the matrix being administered in the form of a suspension of matrix, a gel or a solid support. In addition the matrix may be comprised of a biopolymer such as NATROSOL (hydroxyethylcellulose (HEC)).

[0134] Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semi permeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and [gamma] ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-()-3-hydroxybutyric acid.

[0135] The formulations to be used for in vivo administration must be sterile. This is readily accomplished for example by filtration through sterile filtration membranes.

[0136] It is understood that the suitable dosage of the present composition will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any and the nature of the effect desired.

[0137] The appropriate dosage form will depend on the disease, the inhibitor, and the mode of administration; possibilities include tablets, capsules, lozenges, dental pastes, suppositories, inhalants, solutions, ointments and parenteral depots.

[0138] Since amino acid modifications of the amino acids (of the inhibitor for example) are also encompassed in the present invention, this may be useful for cross-linking the inhibitor to a water-insoluble matrix or the other macromolecular carriers, or to improve the solubility, adsorption, and permeability across the blood brain barrier. Such modifications are well known in the art and may alternatively eliminate or attenuate any possible undesirable side effect of the peptide and the like.

[0139] Another subject matter of the present invention is to provide a kit for the diagnosis, prognosis, prophylaxis or treatment of skin disease in a mammal, said kit comprising a recombinant serine protease, optionally with reagents and/or instructions for use.

[0140] The kit of the present invention may further comprise a separate pharmaceutical dosage form comprising other pharmaceutical compositions and combinations thereof.

[0141] Generally, the Kit comprises a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is effective for treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The label or package insert indicates that the composition is used for treating the condition of choice, such as cancer.

[0142] Alternatively, or additionally, the Kit may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.

[0143] The present invention also discloses the use of the composition of the invention, as a pharmacological tool in the development and standardization of in vitro and in vivo test systems for the diagnosis, prognosis, prophylaxis or treatment of skin diseases in mammals.

[0144] Also encompassed by the present invention is a detection assay for the diagnosis, prognosis, prophylaxis or treatment of skin diseases in a tissue sample comprising contacting the tissue sample with the composition of the invention, determining and measuring the amount of detected label and correlating this amount to the presence or absence of a disease in said tissue sample.

[0145] Yet another object of the present invention is to provide a method for killing a skin cell expressing kallikrein molecules, comprising contacting the cell with the composition of the invention so as to kill the cell, destroying or avoiding the survival of cells expressing kallikrein molecules.

[0146] It is also an object of the present invention to provide a method for inhibiting skin cell expressing serine protease and in particular kallikrein molecules, comprising contacting said skin cell with the composition of the invention.

[0147] Yet another object of the present invention is to provide a cosmetic composition comprising a Serine protease inhibitor, or a biologically active fragment thereof having a Serine protease inhibitor activity as described herein as well as the use of this composition for the improvement of an undesirable skin condition.

[0148] Preferably, the Serine protease inhibitor is a recombinant inhibitor protein of the invention.

[0149] Usually, the Serine protease is selected from the group comprising kallikrein, plasmin, chymotrypsin (Chtr), urokinase (uPA), tryptase and neutrophile elastase (HNE) enzymes and/or a combination thereof.

[0150] Preferably, the kallikrein is selected from the group comprising hK2, hK5, hK7, and hK14 and/or a combination thereof.

[0151] The invention also provides the use of a Serine protease inhibitor, or a biologically active fragment thereof having a Serine protease inhibitor activity, in the preparation of cosmetic composition for the improvement of an undesirable skin condition.

[0152] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications without departing from the spirit or essential characteristics thereof. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features. The present disclosure is therefore to be considered as in all aspects illustrated and not restrictive, the scope of the invention being indicated by the appended Claims, and all changes which come within the meaning and range of equivalency are intended to be embraced therein.

[0153] Various references are cited throughout this Specification, each of which is incorporated herein by reference in its entirety.

[0154] The foregoing description will be more fully understood with reference to the following Examples. Such Examples, are, however, exemplary of methods of practicing the present invention and are not intended to limit the scope of the invention.

EXAMPLES

Example 1

Development of Recombinant ACT Inhibitors Specific to Human hK2 Using Phage Display Selected Substrates.

[0155] The content of Application PCT/IB2004/001040 (Universit de Lausanne) is incorporated herein by reference in its entirety

Material

[0156] hK2 and hK3 (PSA) were purified from human semen as previously described (Frenette G, Gervais Y, Tremblay R R, Dube J Y. 1998 Contamination of purified prostate-specific antigen preparations by kallikrein hK2 J Urol 159, 1375-8), anti-hK2 and anti-PSA monoclonal antibodies were a gift from Professor R R Tremblay, Laval University, Canada. Human chymotrypsin (Chtr), urokinase plasminogen activator (uPA), human kallikrein hK1, human plasma kallikrein (PK), human neutrophil elastase (HNE) and commercial ACT (human plasma -1-antichymotrypsin) were purchased from Calbiochem. Z-Phe-Arg-AMC, Suc-Ala-Ala-Pro-Phe-AMC, Z-Gly-Gly-Arg-AMC, MeOSuc-Ala-Ala-Pro-Val-AMC were purchased from Calbiochem. CFP-TFRSA-YFP (TFRSA SEQ ID NO:137)fluorescent substrate was developed as previously described (Mahajan N P et al. 1999 Novel mutant green fluorescent protein protease substrates reveal the activation of specific caspases during apoptosis Chem Biol 6, 401-9). The cDNA for human 1-antichymotrypsin (ACT) was a generous gift from Dr. Harvey Rubin (University of Pennsylvania).

Site-Directed Mutagenesis

[0157] Following the subcloning of ACT cDNA into pQE-9 expression vector (Qiagen, Germany,) and the introduction of an His.sub.6 tag at the N-terminal of rACT.sub.WT, two restriction sites Sac II and MluI, were incorporated 18 bp upstream and 18 bp downstream of P1 codon in RSL domain respectively. These sites were created by silent mutation using oligonucleotides 5-GTGATTTTGACCGCGGTGGCAGCAG-3 (SEQ ID NO:111) for Sac H and 5-GCACAATGGTACGCGTC TCCACTAATG-3 (SEQ ID NO:112) for Mlu I site and following the quickchange mutagenesis protocol supplied by Stratagene.

Construction of the Substrate Phage Display Library

[0158] Substrate phage libraries were generated using a modified pH0508b phagemid (Lowman et al. 1991 Selecting high-affinity binding proteins by monovalent phage display Biochemistry 12, 10832-8). The construction consists of a His.sub.6 tag at either end of a Gly-Gly-Gly-Ser-repeat-rich region that precedes the carboxyl-terminal domain (codons 249-406) of the M13 gene III. The random pentamers were generated by PCR extension of the template oligonucleotides with appropriate restriction sites positioned on both side of the degenerate codons:

5TGAGCTAGTCTAGATAGGTGGCGGTNNSNNSNNSNNSNNSGGGTCGACGTCGGTCA TAGCAGTCGCTGCA-3 (SEQ ID NO:113) (where N is any nucleotide and S is either G or C) using 5 biotinylated primers corresponding to the flanking regions:

5TGAGCTAGTCTAGATAGGTG-3 (SEQ ID NO:83) and 5-TGCAGCGACTGCTATGA-3 (SEQ ID NO:84).

[0159] PCR templates are digested and purified as described previously (Smith G. P, Scott J. K. 1993 Libraries of peptides and proteins displayed on filamentous phage Methods Enzymol. 217, 228-57), inserted into XbaI/SalI digested pH0508b vector, and electroporated into XL1-Blue (F.sup.). The extent of the library was estimated from the transformation efficiency determined by plating a small portion of the transformed cells onto Luria-Bertani plates containing ampicillin and tetracycline (100 and 15 g.Math.mL.sup.1, respectively). The rest of the transformed cells were used to prepare a phage library by incubating overnight by adding an M13K07 helper phage at a concentration giving a multiplicity of infection of 100 plaque forming units (p.f.u.) per mL. Phages were collected from the supernatant and purified by poly(ethylene glycol) precipitation. Of these, 200 clones were selected arbitrarily for sequencing to verify the randomization of the library.

Phage-Displayed Pentapeptide Library Screening

[0160] This new pentapeptide library was subjected to eight rounds of screening with hK2. One hundred microliters of Ni.sup.2+-nitrilotriacetic acid coupled to sepharose beads (Ni.sup.2+-nitrilotriacetic acid resin) was washed with 10 mL NaCl/P.sub.i containing 1 mg.Math.mL.sup.1 BSA. Phage particles (10.sup.11) were added to the equilibrated Ni.sup.2+-nitrilotriacetic acid resin and allowed to bind with gentle agitation for 3 h at 4 C. The resin was subsequently washed (NaCl/P.sub.i/BSA 1 mg.Math.mL.sup.1, 5 mM imidazole, 0.1% TWEEN 20 (polysorbate 20 or polyoxyethylene sorbitol ester) to remove unbound phages and then equilibrated in NaCl/Pi. The substrate phage was exposed to 27 nM (final concentration) of hK2 for 45 min at 37 C. A control selection without protease was also performed. The cleaved phages released into the supernatant were amplified using XL1-Blue Escherichia coli and then used for subsequent rounds of selection. After eight rounds of panning, about 15 individual clones were picked from the fifth, sixth and eighth round of selection and plasmid DNA were isolated and sequenced in the region encoding for the substrate.

Construction and Expression of Recombinant Wild Type ACT and its Variants.

[0161] Six variants, which correspond to a change in the reactive site loop in positions between P3 and P3 (see Table III below), were generated by PCR extension of the template oligonucleotides:

TABLE-US-00003 rACT.sub.8.20, (SEQIDNO:61) 5-TACCGCGGTCAAAATCACCCTCCGTTCTCGAGCAGTGGA GACGCGTGA-3; rACT.sub.6.3, ((SEQIDNO:62) 5-TACCGCGGTCAAAATCACCAGGAGGTCTATCGATGT GGAGACGCGTGA-3; rACT.sub.8.3, (SEQIDNO:63) 5-TACCGCGGTCAAAATCAGGGGGAGATCTGAGTTAGTG GAGACGCGTGA-3; rACT.sub.6.7, ((SEQIDNO:64) 5-TACCGCGGTCAAAATCAAGCTTAGAACAACATTAG TGGAGACCGCTGA-3; rACT.sub.6.1, (SEQIDNO:65) 5-TACCGCGGTCAAAATCATGACAAGATCTAACTTAGT GGAGACGCGTGA-3; rACT.sub.5.18, (SEQIDNO:66) 5-TACCGCGGTCAAAATCACCGAGCGTGTCTCGCCCGTG GAGACGCGTGA-3
(where underlined sequences encode new cleavage sites in the reactive site loop), using primers corresponding to the flanking regions: 5-TACCGCGGTCAAAATC-3 (SEQ ID NO:67) and 5-TCACGCGTGTCCAC-3 (SEQ ID NO:68). PCR products were digested with Sac II and Mlu I restriction enzymes and then subcloned into digested rACT.sub.WT construct. Recombinant serpins were produced in TG1 E. coli strain. Cells were grown at 37 C. in 2TY media (16 g tryptone, 10 g yeast extract, 5 g NaCl per L) containing 100 g/ml ampicillin to A.sub.600=0.5. Isopropylthio--galactoside (IPTG) was then added to a final concentration of 0.5 mM allowing the expression of recombinant serpins for 16 h at 16 C. The cells from 100 ml of culture were harvested by centrifugation, resuspended in cold PBS and then passed through a french press to recover the total soluble cytoplasmic proteins. Cell debris were removed by centrifugation and Ni.sup.2+-nitilotriacetic affinity agarose beads were added to supernatant for 90 min at 4 C. to bind recombinant serpins. The resin was subsequently washed with 50 mM Tris pH 8.0, 500 mM NaCl, 25 mM Imidazole and the bound proteins were eluted for 10 min with 50 mM Tris pH 8.0, 500 mM NaCl and 150 mM Imidazole. Once purification was completed, rACT were dialysed against 50 mM Tris pH 8.0, 500 mM NaCl, 0.05% Triton X-100 for 16 h at 4 C. The protein concentration was determined for each purification by Bradford assay and normalized by densitometry of Coomassie Blue-stained SDS-PAGE gels (Laemmli U K. 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680-5).

TABLE-US-00004 TABLEIII AlignmentofRSL(ReactiveSerpinLoop)ofrecombinantserpin1-antichymotrypsin (ACT)anditsvariants. Selected.sup.a Substrate Serpin Peptide P6 P5 P4 P3 P2 P1 P1 P2 P3 P4 P5 P6 rACT.sub.WT V K I T L L* S A L V E T rACT.sub.8.20 LRSRA V K I T L R* S R A V E T SEQIDNO:157 rACT.sub.6.2 RRSID V K I T R R* S I D V E T SEQIDNO:158 rACT.sub.8.3 RGRSE V K I R G R* S E L V E T SEQIDNO:159 rACT.sub.6.7 KLRTT V K I K L R* T T L V E T SEQIDNO:160 rACT.sub.6.1 MTRSN V K I M T R* S N A V E T SEQIDNO:161 ACT.sub.5.18 ERVSP V K I T E R* V S P V E T SEQIDNO:162 .sup.aSubstrate peptides selected by kallikrein hK2 using a phage-displayed random pentapeptide library. Plain type residues are common to rACT.sub.WT, bold and underlined residues correspond to substrate peptides relocated in RSL of ACT variants. The scissile bond by hK2 in substrate peptides is designated by and putative cleavage site in serpins is marked by asterisks between the P1-P1 residues.

Inhibition Assays and Stoichiometry of Inhibition (SI)

[0162] The stoichiometry of inhibition (SI) values were determined for the inhibition of rACT.sub.WT and its variants with hK2 and different other enzymes. An initial test was made with a molar excess of rACT (100 fold) over hK2, PSA, hK1, chymotrypsin (Chtr), plasma kallikrein (PK), urokinase (uPA) and human neutrophile elastase (HNE) enzymes. The reaction was carried out for 30 min at 25 C. (90 min at 37 C. for PSA) in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA) and residual enzyme activity was measured by adding fluorescent substrates (Z-Phe-Arg-AMC for hK1, hK2 and PK, Suc-Ala-Ala-Pro-Phe-AMC for Chtr, Z-Gly-Gly-Arg-AMC for uPA, MeOSuc-Ala-Ala-Pro-Val-AMC for HNE, and CFP-TFRSA-YFP (TFRSA SEQ ID NO:137) for PSA). Activity of enzyme in presence of inhibitors was compared to uninhibited reaction. For reactions where an inhibition was observed, SI was determined by incubating different concentrations of recombinant serpins. Using linear regression analysis of fractional activity (velocity of inhibited enzyme reaction/velocity of uninhibited enzyme reaction) versus the molar ratio of the inhibitor to enzyme ([I.sub.o]/[E.sub.o]), the stoichiometry of inhibition, corresponding to the abscissa intercept, was obtained.

Kinetics

[0163] The association rate constants for interactions of hK2, chymotrypsin, PK and HNE with different rACTs were determined under pseudo-first order conditions using the progress curve 80% (Morrison J F, Walsh C T. 1988 The behavior and significance of slow-binding enzyme inhibitors Adv. Enzymol. Relat. Areas Mol. Biol 61, 201-301). Under these conditions, a fixed amount of enzyme (2 nM) was mixed with different concentrations of inhibitor (0-800 nM) and an excess of substrate (10 M). Each reaction was made in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA) at 25 C. for 45 min and the rate of product formation was measured using a FL.sub.x800 fluorescence 96-well microplate reader (Biotek, USA). In this model, inhibition is considered to be irreversible over the course of reaction and the progress of enzyme activity is expressed by product formation (P), beginning at a rate (v.sub.z) and is inhibited over time (t) at a first-order rate (k.sub.obs), rate constant that is dependent only on inhibitor concentration.


P=(v.sub.z/k.sub.obs)[1e.sup.(k.sup.obst.sup.)]eq 1

For each inhibitor, a k.sub.obs was calculated, for four different concentrations of inhibitors, by non linear regression of the data using equation 1. By plotting the k.sub.obs versus inhibitor concentration [I], a second-order rate constant, k, equal to the slope of the curve (k=k.sub.obs/[I]), was determined. Due to the competition between inhibitor and the substrate, equation 2 below is used to correct the second order rate constant k by taking in account the substrate concentration [S] and the K.sub.m of the enzyme for its substrate, giving the k.sub.a.


k.sub.a=(1+[S]/K.sub.m)keq 2

The K.sub.m of hK2 for Z-FR-AMC, chymotrypsin for Suc-AAPF-AMC (AAPF (SEQ ID NO:135), PK for Z-FR-AMC and HNE for MeOSuc-AAPV-AMC (AAPV SEQ ID NO:136) were 67 M, 145 M, 170 M and 130 M respectively.

Western Blot Analysis of Complex Formation and Inhibitor Degradation.

[0164] Kallikrein hK2 was incubated 3 hours at 37 C. with different recombinant ACTs at a [I].sub.o:[E].sub.o ratio of 100:1 in 50 mM Tris, 200 mM NaCl, 0.05% Triton X-100. Protein samples were heated at 95 C. for 5 min, separated by SDS-PAGE (12% acrylamid 19:1 T:C ratio) and then electroblotted onto Hybond-ECL (Amersham Pharmacia) nitrocellulose. The free-hK2 and hK2-ACT complexes were detected using a mouse anti-hK2 monoclonal antibody and an alkaline phosphatase-conjugated goat anti-mouse secondary antibody. Western blot was visualized using the ECL detection kit (Amersham Pharmacia Biotech). hK2 was also incubated with ACT.sub.8.3 or ACT.sub.6.7 30 min at 25 C. (kinetic conditions) at a ratio of 10:1 in 50 mM Tris, 200 mM NaCl, 0.05% Triton X-100. Proteins were detected by western blot, using an anti-His.sub.6 monoclonal antibody followed by detection with the secondary antibody and protocol described above.

Production of Soluble Recombinant Wild Type and Variant ACTs Wild type serpin 1-antichymotrypsin was used to develop specific inhibitors of the kallikrein hK2. Residues P3-P3 located in RSL structure of rACT.sub.WT were replaced by substrate pentapeptides, previously selected by phage display technology as described above. Six variants of rACT shown in table IV, have been designed and constructed. The scissile bond in substrate peptides was aligned according to Leu-358-Ser-359 into RSL of the serpin. rACT.sub.WT and its variants were expressed in E. coli TG1 as fusion proteins containing an His tag in N-terminal position. Each of them was produced at low temperature allowing protein accumulation mainly in active soluble form. Purified under native conditions, the level of production varied between 1.0 to 2.5 mg/L. The purity of purified serpins, such as for example Variant 6.1 and wild type ACT, as estimated by SDS-PAGE analysis is more than 98%.
rACT Variants are Mainly Specific to Kallikrein hK2

[0165] A panel of enzymes including human neutrophil elastase, chymotrypsin-like (Chtr, PSA or hK3) and trypsin-like (hK2, hK1, PK, uPA) proteinases have been screened to determine inhibitory specificity of rACT variants (Table IV).

TABLE-US-00005 TABLE IV Inhibitory profile of rACT.sub.WT and its variants. ACT.sub.8.20 ACT.sub.6.2 ACT.sub.8.3 ACT.sub.6.7 ACT.sub.6.1 ACT.sub.5.18 (LRSRA).sup.a (RRSID).sup.a (RGRSE).sup.a (KLRTT).sup.a (MTRSN).sup.a (ERVSP).sup.a ACT.sub.WT SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID (LLSA).sup.a NO: 157 NO: 158 NO: 159 NO: 160 NO: 161 NO: 162 SEQ ID MD 820 MD 62 MD 83 MD 67 MD 61 MD518 NO: 163 Protease INHIBITION %.sup.B hK2 95 100 100 100 100 73 0 Chtr 66 0 0 0 0 0 100 PK 54 100 0 36 100 0 0 HNE 30 0 0 0 60 0 15 PSA 45 0 0 0 0 0 80 (hK3) hK1 0 0 0 0 0 0 0 Urokinase 0 0 0 0 0 0 0 .sup.aAmino acid sequence cleaved in RSL (Reactive Serpin Loop) of recombinant ACTs corresponding to selected substrate peptide by hK2. .sup.BProtease and serpins were incubated for 30 min at 25 C. (90 min at 37 for PSA) at a [I].sub.o/[E].sub.o ratio of 100:1. Percent inhibition correspond to 100 (1 (velocity in presence of inhibitor/velocity of uninhibited control)).

[0166] Incubating with an excess of inhibitors ([I].sub.o/[E].sub.o of 100:1) for 30 minutes, hK2 is completely inhibited by rACT.sub.6.2, rACT.sub.8.3, rACT.sub.6.7 and rACT.sub.6.1, whereas rACT.sub.8.20 and rACT.sub.5.18 inhibited 95% and 73% of enzyme activity, respectively. Under this condition, wild type rACT showed no inhibition activity toward hK2. Among these variants, two (rACT.sub.8.3 and rACT.sub.5.18) are specific to hK2, inhibiting no other tested enzyme. Two other variants, rACT.sub.6.7 and rACT.sub.6.2, inhibited as well PK at 36% and 100% respectively. As wild-type ACT, variant rACT.sub.8.20 inhibited the two chymotrypsin-like proteases Chtr and PSA but additionally also PK and HNE. None of the recombinant serpins showed inhibitory activity against the kallikrein hK1 and uPA.

Stoichiometries of Inhibitory of Variant ACTs for hK2 are Improved Drastically in Comparison to Wild Type ACT

[0167] The determination of the stoichiometry of inhibitory was accomplished under physiological conditions of pH and ionic strength for all enzymes to ensure the most valuable comparison.

[0168] Recombinant wild type ACT gave a SI value of 2 (table V) with chymotrypsin which is identical to the value obtained with commercial ACT under similar conditions (data not shown).

TABLE-US-00006 TABLE V Comparison of stoichiometry of inhibition values and second-order rate constants (k.sub.a) for the reaction of rACT.sub.WT and its variants with hK2 and others proteinases. ACT.sub.8.20 ACT.sub.6.2 ACT.sub.8.3 ACT.sub.6.7 ACT.sub.6.1 ACT.sub.5.18 (LRSRA).sup.c (RRSID) (RGRSE) (KLRTT) (MTRSN) (ERVSP) ACT.sub.WT MD820 MD62.sup.c MD83.sup.c MD67.sup.c MD61.sup.c MD518.sup.c (LLSA).sup.c SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO: 157 NO: 158 NO: 159 NO: 160 NO: 161 NO: 162 NO: 163 (k.sub.a).sup.b k.sub.a.sup.b k.sub.a.sup.b k.sub.a.sup.b k.sub.a.sup.b k.sub.a.sup.b k.sub.a.sup.b Protease SI M.sup.1s.sup.1 SI M.sup.1s.sup.1 SI M.sup.1s.sup.1 SI M.sup.1s.sup.1 SI M.sup.1s.sup.1 SI M.sup.1s.sup.1 SI M.sup.1s.sup.1 hK2 105 1779 25 6261 34 2439 9 8991 19 3442 139 595 Chtr 134 905 2 61295 PK 150 424 18 6217 277 201 16 8024 HNE 334 158 159 1192 .sub.aSI values reported were determined using linear regression analysis to extrapolate the I/E ratio. .sup.bSecond order rate constants for serpin-proteinase reactions were measured under pseudo-first- or second order conditions as described in Experimental Procedure. .sup.cAmino acid sequence of P3-P3 residues in RSL (Reactive Serpin Loop) of recombinant ACT corresponding to selected substrate peptide by hK2 , No detectable inhibitory activity.

[0169] In order to determine the SI values of all the recombinant variants, Applicants have incubated hK2 (5 nM) with different concentrations (6.25-500 nM) of rACT.sub.8.20, rACT.sub.6.2, rACT.sub.8.3, rACT.sub.6.7, rACT.sub.6.1, rACT.sub.5.18, rACT.sub.WT, at 25 C. for 30 min in reaction buffer. Residual activities (velocity) for hK2, were assayed by adding the fluorescent substrate (10 M) Z-FR-AMC. Fractional velocity corresponds to the ratio of the velocity of inhibited enzyme (v.sub.i) to the velocity of the uninhibited control (v.sub.o). The SI was determined using linear regression analysis to extrapolate the I/E ratio (i.e. the x intercept).

[0170] All newly constructed variants of ACT showed lower SI values with hK2 than wild type ACT. From these variants rACT.sub.6.7, rACT.sub.6.1 and rACT.sub.6.2 had the lowest stoichiometry of inhibition values for hK2 (9, 19 and 25 respectively). Whereas rACT.sub.6.2 and rACT.sub.6.1 had also the lowest SI values (18 and 16) for PK, the SI for rACT6.7 was much higher (277). The two recombinant ACTs specific for hK2, rACT.sub.8.3 and rACT.sub.5.18 had a higher SI ratio of 34 and 139, respectively. The SI value of rACT.sub.8.20 inhibitor was superior to 100 for all tested proteases including hK2.

Variant ACTs Form Stable Complexes with hK2 without Degradation of Inhibitors

[0171] hK2 was incubated 3 h at 37 C. with rACT.sub.8.20, rACT.sub.6.2, rACT.sub.8.3, rACT.sub.6.7, rACT.sub.6.1, rACT.sub.5.18 and wild type rACT, at a I:E ratio of 100:1. Western Blot analysis of the reaction products of rACTs with hK2 (rACT.sub.8.20), rACT.sub.6.2, rACT.sub.8.3, rACT.sub.6.7, rACT.sub.6.1, rACT.sub.5.18 and wild type rACT has been done under reducing conditions using a mouse anti-hK2 antibody to determine the fate of inhibitors after the interaction with the enzyme. When hK2 is incubated with ACT variants, free hK2 (E) disappeared completely to form a covalent complex (EI). This covalent complex demonstrated a high stability as it did not break down over a 16 h incubation period (data not shown). Wild type ACT inhibited more slowly hK2, which was mainly uncomplexed after 3 hours of incubation. Elevated SI values measured with hK2 were not due to non-complex forming degradation of ACT variant inhibitors.

[0172] Further on ACT.sub.8.3 or ACT.sub.6.7 were incubated with hK2 under kinetic conditions (30 min at 25 C.) at a I:E ratio of 10:1. The complex formation was analysed by western blot under reducing conditions using a mouse monoclonal anti-his tag. All inhibitor proteins were either complexed with hK2 or present as uncleaved form, indicating that the possible substrate pathway for the serpin-enzyme interaction is marginal.

Variant ACTs Showed Highest Association Constants with hK2

[0173] The rate of inhibitory reaction with variant ACTs was determined for each protease showing reactivity with these inhibitors. To that end, interaction of hK2 and recombinant serpins was measured under pseudo-first order conditions using progress curve method. hK2 (2 nM) and substrate Z-FR-AMC (10 M) were added to varying amounts (20n-800 nM) of inhibitors rACT.sub.8.20, rACT.sub.5.18 and inhibitors rACT.sub.6.2, rACT.sub.8.3, rACT.sub.6.7, rACT.sub.6.1 (data not shown). Representative progress curves were subjected to non linear regression analysis using eq 1 and the rate (k.sub.obs) was plotted against the serpin concentrations. After determination of kobs, association constants (ka) were calculated using K.sub.m of the proteases for their corresponding substrates (table VI). The ka value of wild type ACT with chymotrypsin was identical as to published data (Cooley et al. 2001 The serpin MNEI inhibits elastase-like and chymotrypsin-like serine proteases through efficient reactions at two active sites Biochemistry 40, 15762-70). The recombinant rACT.sub.6.7 showed a highest ka (8991 M.sup.1 s.sup.1) with hK2 whereas that obtained with PK was 45 fold inferior. In contrast, recombinant rACT.sub.6.2 gave equivalent ka with hK2 and PK demonstrating a lack of discrimination between the two proteases. ka values of hK2 specific recombinant inhibitors rACT.sub.8.3 and rACT.sub.5.18 were lower, 2439 and 595 M.sup.1 s.sup.1 respectively, whereas non specific ACT.sub.8.20 exhibited a ka of 1779 M.sup.1 s.sup.1, for hK2, superior compared to Chtr, PK and HNE. One of the recombinant serpins, rACT.sub.6.1, was reacting at higher velocity with PK than with hK2.

[0174] Residues P3-P3 located in RSL structure of rACT.sub.WT were replaced by substrate pentapeptide coding for the RSL of Protein C Inhibitor (PCI) (Table VI) as described in example 1.

TABLE-US-00007 TABLEVI AlignmentofRSL(ReactiveSerpinLoop)ofrecombinantserpinsACT,PCIandACT.sub.PCI- RSLsequences Serpin P6 P5 P4 P3 P2 P1 P1 P2 P3 P4 P5 P6 rACT.sub.WT Aminoacid V K I T L L S A L V E T sequence DNA GTC AAA ATC ACC CTC CTT TCT GCA TTA GTG GAG GTC sequence (codon) rPCI.sub.WT Aminoacid T I F T F R S A R L N S sequence rACT.sub.PCI Aminoacid V K I T F R S A L V E T (MDCI) sequence DNA GTC AAA ATC ACC TTT AGA TCT GCA TTA GTG GAG GTC (codon) Plain type residues are common to rACT.sub.WT, bold and underlined residues correspond to substrate peptides relocated in RSL of ACT variants. The scissile bond in substrate peptides is designated by and putative cleavage site in serpins is marked by asterisks between the P1-P1 residues.

[0175] Briefly, to produce the recombinant protein ACT.sub.PCI (MDCI), TG1 cells were transformed with the corresponding constructions followed by growth in appropriate culture media. Cells were then induced to an optimal density to express recombinant inhibitors for 16 h at 16 C.

[0176] Recombinant inhibitor ACT.sub.PCI was extracted from cytoplasm bacteria and separated by affinity chromatography using Ni-NTA column as described for the previous example.

Analysis of Recombinant ACT Expression by SDS-PAGE.

[0177] The purity of the different inhibitors developed in example 1 and 2 was tested by SDS-PAGE analysis under reducing conditions.

Evaluation of the Inhibitors.

[0178] These inhibitors were further analysed to assess their specificity and affinity to inhibit the human kallikreins hK2 and hK3 and plasma kallikrein, trypsin, urokinase, elastase, thrombin, hK14 and human kallikrein 8 (Table VII). These two enzymes possess different enzymatic specificities (hK2: trypsin-like, hK3: chymotrypsin-like) but are naturally inhibited by ACT. While ACT is considered to be the natural hK3 inhibitor in blood circulation, its inhibition of hK2 is weaker.

[0179] Analysis of the inhibitory reaction between rACTs and the human kallikreins were analysed by Western Blot (data not shown). For each variants of ACT, 1 g of inhibitor was incubated with 100 ng of either hK2 or hK3 during 1 hour at 37 C. under physiological conditions.

[0180] The amino acid changes within the reactive loop using substrate sequences selected for hK2 specificity transformed ACT into an inhibitor highly specific for hK2 (MD820, MD61, MD62) without inhibiting hK3. These results confirm those previously shown in Table IV. Only MDCI, based on the reactive loop of the inhibitor of the Protein C (PCI) is able to inhibit both kallikreins tested (hK2 and hK3).

[0181] MD61 and MD62 are inhibitors with very high affinity for hK2 inhibiting all hK2 protein in less than 3 minutes (under the same conditions) compared to wild type or commercial 1-antichymotrypsin, which requires more than 12 hours of incubation to inhibit the same amount of hK2 (data not shown).

TABLE-US-00008 TABLE VII Inhibitory profile of MD.sub.CI. PROTEASE INHIBITION %.sup.B SI k.sub.a M.sup.1 s.sup.1 Chymotrypsin 98 1 86216 Plasma Kallikrein 100 4.6 25900 Trypsin 100 1 1126025 Urokinase 0 Elastase 0 Thrombin 0 hK14 100 3.2 287000 Human Kallikrein 8 ~25 ~180

Example 2

[0182] Development of substrate active sites specific to human hK14.

[0183] The content of Application N+ PCT/IB2006/000574 (Universit de Lausanne) is incorporated herein by reference in its entirety.

Materials

[0184] The following materials were obtained from commercial sources: elastase, trypsin, chymotrypsin, and plasma kallikrein (Calbiochem), human laminin 10 & 11 (Chemicon), human collagen IV (Life Technologies), T4 DNA ligase (Invitrogen), T4 polynucleotide kinase (Qbiogene), Ni.sup.2+-nitrilotriacetic acid agarose beads (Qiagen), restrictions enzymes (Roche, Amersham Pharmacia, Promega), anti-His antibody (Sigma). Oligonucleotide synthesis was carried out by Invitrogen and DNA sequencing by Synergene Biotech GmbH. Human kallikrein 2 and prostate specific antigen were purified from human seminal plasma as previously described (Frenette et al., 1997; Frenette et al., 1998). Matrilin-4 is a gift from R. Wagener (Cologne, Germany).

Cloning of KLK14 into P. pastoris Expression Vector pPICZA

[0185] First-strand cDNA synthesis was performed by reverse transcriptase using the SUPERSCRIPT (reverse transcriptase) preamplification system (Gibco BRL, Gaithersburg, Md.) with 2 g of total human cerebellum RNA (Clontech, Palo Alto, Calif.) as a template. The final reaction volume was 20 L. To confirm the efficiency of RT-PCR, 1 L of cDNA was subsequently amplified by PCR with primers specific for actin, a housekeeping gene (ActinS: 5 ACAATGAGCTGCGTGTGGCT (SEQ ID NO:114), ActinAS: 5 TCTCCTTAATGTCACGCACGA (SEQ ID NO:115)). Actin PCR products with an expected length of 372 base pairs (bp) were visualized on a 2% agarose gel stained with ethidium bromide. PCR amplification of KLK14 cDNA encoding the 227 amino acids of the mature hK14 protein (corresponding to amino acids 25-251 of Genbank accession no. AAK48524) was carried out in a 50 L reaction mixture containing 1 pt of cerebellum cDNA as a template, 100 ng primers (FPL6: 5 AGG ATG AGG AAT TCA TAA TTG GTG GCC AT (SEQ ID NO:69) and RPL6: 5 CCC ACC GTC TAG ACC ATC ATT TGT CCC GC (SEQ ID NO:70)), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl.sub.2, 200 M deoxynucleoside triphosphates (dNTPs) and 0.75 L (2.6 U) of Expand Long Template PCR polymerase mix (Roche Diagnostics, Mannheim, Germany), using an Eppendorf master cycler. The PCR conditions were 94 C. for 2 min, followed by 94 C. for 10 s, 52 C. for 30 s, 68 C. for 1 min for 40 cycles, and a final extension at 68 C. for 7 min. Following PCR, amplified KLK14 was visualized with ethidium bromide on 2% agarose gels, extracted, digested with EcoRI/XbaI and ligated into expression vector pPICZA of the EASYSELECT Pichia pastoris expression system (Invitrogen, Carlsbad, Calif.) at corresponding restriction enzyme sites using standard techniques (Sambrook et al., 1989). The KLK14 sequence within the construct was confirmed with an automated DNA sequencer using vector-specific primers in both directions.

Protein Production

[0186] PmeI-linearized pPICZA-KLK14, as well as empty pPICZA (negative control), were transformed into chemically competent P. pastoris yeast strain X-33 after which they integrated into the yeast genome by homologous recombination. Transformed X-33 cells were then plated on YPDS (1% yeast extract, 2% peptone, 2% dextrose, 1 M sorbitol, 2% agar) plates containing Zeocin, a selective reagent. A stable yeast transformant was selected as per the manufacturer's recommendations, inoculated in buffered minimal glycerol-complex (BMGY) medium [1% yeast extract, 2% peptone, 100 mM potassium phosphate (pH 6.0), 1.34% yeast nitrogen base, 40 mg/litre biotin, and 1% glycerol] overnight at 30 C. on a plate agitator at 250 rpm, diluted to OD.sub.600=1.0 in BMMY (same as BMGY except that 1% glycerol is replaced with 0.5% methanol) and incubated under the same conditions as above for 6 days with a daily supplement of 1% methanol. The supernatant was collected by centrifugation at 4000g for 20 min.

Protein Purification

[0187] Recombinant hK14 was purified from yeast culture supernatant by cation exchange using a 5 mL HiTrap carboxymethyl (CM) Sepharose Fast Flow column on the AKTAFPLC chromatography system (Amersham Biosciences, Piscataway, N.J.). First, the supernatant was filtered with a 0.22 m disposable filter and concentrated 50-fold by ultrafiltration with an AMICON (protein concentrating and desalting, regenerated cellulose, ultrafiltration centrifugal filter) YM10 membrane (Millipore Corporation, Bedford, Mass.). The filtered, concentrated supernatant was then introduced into the injector of the AKTAFPLC system and loaded onto the CM sepharose column, previously equilibrated with 5 mL of 10 mM MES buffer (pH 5.3) at a flow rate of 0.8 ml/min. The column was washed with the aforementioned equilibration buffer and the adsorbed hK14 was eluted with a 150 mL continuous linear KCl gradient from 0 to 1 M in 10 mM MES (pH 5.3) at a flow rate of 3 ml/min. Elution fractions of 5 ml were collected and analyzed. Fractions containing hK14 were pooled and further concentrated 10 times using Biomax-10 Ultrafree-15 Centrifugal Filter Device (Millipore Corporation, Bedford, Mass.). The protein concentration of the purified hK14 was determined by the bicinchoninic acid method (Smith et al., 1985), which uses bovine serum albumin as calibrator (Pierce Chemical Co., Rockford, Ill.). The purity of the recombinant hK14 protein was analyzed by SDS-PAGE (Laemmli, 1970) followed by Coomassie blue staining and/or Western blot analysis using a previously produced polyclonal rabbit antibody raised against hK14 (Borgono et al., 2003) and its identity was confirmed by tandem mass spectrometry, as described in detail for recombinant hK10 (Luo et al., 2001).

Phage-Displayed Pentapeptide Library Screening.

[0188] A monovalent type phagemid supplied by Dr Lowman (Genentech company, San Fransisco, Calif.) was previously modified in order to generate a substrate phage library containing six His residues N terminal to the random pentapeptide fused to the g3p (Cloutier et al, 2002). The six His residues allow the phage fixation to the Ni-NTA column.

[0189] Preparation of the duplex that is inserted into the phagemid was performed by PCR reaction of a degenerated oligonucleotide, in which the 5 random amino acids are coded by NSS (N=A, T, G, C and S=G, C). The resulting library was composed of 1.810.sup.8 transformants, which is largely enough to get all random sequences represented.

[0190] This phage display substrate library was subjected to six rounds of screening with hK14. Briefly, substrate phages (10.sup.11) were incubated with sixty microliters of Ni.sup.2+-nitrilotriacetic acid resin in PBS 1 containing BSA at 1 mg/mL, washed four times (PBS 1, BSA 1 mg/mL, 5 mM imidazole, 0.1% TWEEN 20 (polysorbate 20 or polyoxyethylene sorbitol ester)) to remove unbound phages and then exposed to 65 nM (final concentration) of hK14 for 45 minutes at 37 C. in 50 mM Tris, 100 mM NaCl, 0.05% Triton, pH 7.5. The released phages were subsequently amplified using XL1-Blue Escherichia coli and then used after purification for subsequent rounds of selection. 32 individual clones from the last round of selection were sequenced for determination of their corresponding amino acid sequences.

Expression of CFP-YFP Fluorescent Substrate

[0191] Recombinant fluorescent substrates, using cyan fluorescent protein as donor and yellow fluorescent protein as acceptor, were constructed as described recently (Felber et al., 2004). CFP-XXXXX-YFP-6His recombinant proteins were constructed with varying pentapeptides (in bold) between CFP and YFP proteins using synthetic genes possessing the appropriate restriction sites (BssHII; SalI). The constructs contain the following amino acid sequences between CFP and YFP proteins: Gly-Ala-Leu-Gly-Gly-XXXXX-Gly-Ser-Thr (GALGGXXXXXGST (SEQ ID NO:116)). To produce recombinant proteins, TG1 cells were transformed with the corresponding constructs and purified by affinity chromatography using Ni.sup.2+-NTA agarose beads. The purity and quantity of the purified CFP-YFP recombinant substrates were evaluated by SDS gel electrophoresis according to Laemmli followed by Coomassie Blue staining and Western blot analysis using a specific anti-His primary antibody (1/3000 dilution), a mouse anti-Fab secondary antibody (1/50000 dilution) and the ECL system (Amersham) for detection. All clones were sequenced prior to evaluation.

Direct Determination of the Kcat/Km and Specificity Studies Using CFP-YFP Fluorescent Substrates

[0192] Substrate specificity of CFP-substrate-YFP proteins was tested towards different proteases and Kcat/Km values calculated as previously described (Felber et al., 2004). Briefly, fluorescence of CFP-X.sub.5-YFP proteins was measured in black 96-well plates using a microplate fluorescence reader (Bio-Tek Instruments, Inc.) with excitation at 440 nm (15) and emissions at 485 nm (10) and 528 nm (10). Each recombinant substrate, at a concentration of 150 nM, was incubated with hK14, chymotrypsin, trypsin, PSA, hK2, plasma kallikrein or elastase at a final concentration of 8 nM, 0.1 nM, 0.3 nM, 2 M, 10 nM, 10 nM and 0.5 nM respectively. The reaction was performed for 60 min at 37 C. in reaction buffer (50 mM Tris pH 7.5, 100 mM NaCl, 0.05% Triton-X100). The enzyme concentration for initial-rate determinations was chosen at a level intended to hydrolyze specifically the substrate linker and not a GGGGG (SEQ ID NO:117) substrate, which was used as negative control. The appearance of fluorescence, corresponding to product formation, was measured spectrometrically with excitation at 440 nm (15) and emission at 485 nm (10). The slope was converted into units of nmol of product generated per sec, based on a calibration curve obtained from the complete hydrolysis of each peptide, evaluated on SDS-PAGE. The kinetic parameter k.sub.cat/K.sub.m was determined under pseudo-first order conditions using a substrate concentration far below the estimated Km (Felber et al., 2004).

[0193] The cleavage products were separated by SDS-polyacrylamide gel electrophoresis, transferred to an Immobilon polyvinylidene difluoride membrane (Bio-Rad), and subjected to automated Edman degradation with an Applied Biosystems (model ABI493A) sequenator to determine the cleavage site.

Selection of Phage Substrate for hK14

[0194] The substrate phage library was panned against hK14 to select substrates cleaved by its hydrolytic activity. Cleaved phages were amplified in E. coli TG1 cells and then subjected to five more rounds of enzyme digestion and screening. The amount of released phages increased with each round, indicating the presence of a higher number of hK14-susceptible phages after each round of selection. The amino acid sequences of 32 phage peptides from the last round of selection were determined by sequencing. The sequences corresponding to the substrate regions are listed in Table 1. From all selected and cleaved peptides, 69% possess a basic residue in P1 position, as expected for a putative trypsin-like activity of hK14, whereas 31% of peptides have a tyrosine residue specific for a chymotrypsin-like enzyme in P1.

Kinetic Characterization of Substrate Hydrolysis by hK14

[0195] To verify that the sequences from the phage display analysis were indeed substrates for hK14, and to identify the cleavage site, all selected peptides were constructed in fluorescent substrate form. Applicants substrate system is based on the transfer of energy from CFP to YFP which are linked by the substrate. Cleavage of the linker by a protease separates the two fluorophores and results in a loss of the energy transfer. Thus, hydrolysis of the substrate can be evaluated by the measurement of increasing fluorescence intensity of the donor at 485 nm, corresponding to the wavelength of CFP emission (Mitra et al., 1996; Felber et al., 2004).

[0196] All substrates were hydrolyzed by hK14 with variable level of efficacy and Kcat/Km values ranged from 2 000 to 481 000 M.sup.1 s.sup.1. The specificity of cleavage was demonstrated with CFP-GGGGG-YFP (SEQ ID NO:117) which is not hydrolyzed by hK14 (not shown).

[0197] Results clearly indicate that the preferred P1 amino acid for hK14 susceptibility is Arg (Table 1) since the best hK14 substrates with Kcat/Km greater than 200,000 M.sup.1 s.sup.1 possess an Arg in P1 position. Interestingly, from the four peptides cleaved most efficiently by hK14, two contained a Gln at the P2 position. In contrast, a broad variety of amino acids were found in P1 position, demonstrating no significant preference at this position. However, two substrates possess an aspartic acid in P1 position and are cleaved relatively efficiently.

[0198] On the other hand, all substrates with a Lys at the P1 position were cleaved at low rate with a Kcat/Km equal to or below 34 000 M.sup.1 s.sup.1. Similarly, the cleavage rate for substrates with a P1 tyrosine was very low except for one substrate, peptide G9, which had a Kcat/Km of 134 000 M.sup.1 s.sup.1. With the exception of P1 position, where glycine residue is found in about 50% of P1 Lysine or Tyrosine substrates, no amino acid was recovered more frequently at the other positions. Nevertheless, it has to be stated that the majority of glycine residues found in position P1 were originating from the phage linker region flanking the selected pentapeptide substrates, where Lys or Tyr residues are found in position 5 of the selected peptide.

Specificity of Preferred Selected Substrates

[0199] Since many of the selected substrates contained motifs potentially susceptible to cleavage by other proteases, Applicants measured the degree to which hK2, plasma kallikrein, PSA, chymotrypsin, trypsin and elastase could cleave these hK14 substrates (Table VIII). Each substrate was tested at enzyme concentration leading to specific cleavage in the substrate linker and not hydrolyzing the GGGGG (SEQ ID NO:117) control substrate.

[0200] Not surprisingly, most of trypsin-like substrates are cleaved by trypsin with a variable efficacy which was not strictly in correlation with hK14 preferences. For instance, the two pentapeptides VGSLR (SEQ ID NO:118) and RQTND (SEQ ID NO:119) were the best substrates for hK14 but were not very efficiently cleaved by trypsin in comparison to other peptides like LSGGR (SEQ ID NO:124) exhibiting a Kcat/Km of almost 5,000,0000 M-1.Math.s-1. In contrast, peptides possessing a Gln in P2 position were excellent substrates for hK14 as well as for trypsin. Only two hK14 substrates with low trypsin-like hK14 activity, RVTST (SEQ ID NO:128) and VVMKD (SEQ ID NO:129), but four out of five substrates with chymotrypsin like hK14 activity were not cleaved by trypsin.

[0201] All chymotrypsin-like substrates were cleaved by chymotrypsin more efficiently than with hK14, except for the substrate TVDYA (SEQ ID NO:130) which gave almost the same kcat/Km with hK14, chymotrypsin and elastase. Elastase also proteolyzed the two selected peptides TSYLN (SEQ ID NO:134) and YQSLN (SEQ ID NO:133), which is also cleaved weakly by PSA. Preferred substrates displayed a high selectivity for hK14 in comparison to other human kallikreins such as hK1, hK2, PSA and PK. Only hK2 proteolyzed most of the trypsin-like substrates with Kcat/Km values always at least 5 fold lower than for hK14. For example, NQRSS (SEQ ID NO:120) peptide is 27 and 78 fold more selective for hK14 than for hK2 and PK, respectively and F3 peptide demonstrates high hK14 specificity and no cleavage with another kallikrein could be detected.

TABLE-US-00009 TABLEVIII SpecificityofphageselectedhK14substratestowarddifferenthumanproteases. Chymo- Plasma Peptide Sequence hK14 Trypsin Trypsin Elastase kallikrein hK1 hK2 PSA Trypsin-likesubstrate Kcat/Km(M-1.s-1) G1 VGSLR 481000 270000 145000 21000 SEQID NO:118 C11 RQTND 415000 260000 251000 23000 SEQID NO:119 E5 NQRSS 388000 2070000 5000 14000 SEQID NO:120 E8 LQRAI 367000 2270000 209000 5000 25000 SEQID NO:121 F11 QRLRD 307000 1420000 168000 L.C. 32000 SEQID NO:122 F3 PDRHM 243000 319000 192000 SEQID NO:123 E2 LSGGR 207000 4'676000 83000 14000 SEQID NO:124 E7 LSRDN 127000 246000 155000 16000 SEQID NO:125 D9 RGKTN 80000 2111000 94000 21000 SEQID NO:126 E9 NNKLR 74000 384000 77000 12000 SEQID NO:127 E12 RVTST 26000 100000 200000 SEQID NO:128 E10 VVMKD 15000 65000 SEQID NO:129 Chymotrypsin-likesubstrate kcat/Km(M-1.s-1) G9 TVDYA 134000 145000 181000 SEQID NO:130 E1 AYGYK 24000 129000 618000 SEQID NO:131 F6 VGLYD 18000 409000 SEQID NO:132 F10 YQSLN 12000 134000 49000 L.C. SEQID NO:133 D7 TSYLN 9000 266000 90000 SEQID NO:134 L.C.: low cleavage, kcat/Km not determined; no detectable cleavage

Example 2

Materials

[0202] The following materials were obtained from commercial sources: elastase, trypsin, chymotrypsin, thrombin and plasma kallikrein (Calbiochem), T4 DNA ligase (Invitrogen), T4 polynucleotide kinase (Qbiogene), Ni.sup.2+-nitrilotriacetic acid agarose beads (Qiagen), restrictions enzymes (Roche, Amersham Pharmacia, Promega), anti-His antibody and an alkaline phosphatase-conjugated goat anti-mouse secondary antibody (Sigma). Fluorescent substrates Z-Phe-Arg-AMC, Suc-Ala-Ala-Pro-Phe-AMC (AAPF (SEQ ID NO:135), Z-Gly-Gly-Arg-AMC and MeOSuc-Ala-Ala-Pro-Val-AMC (AAPV SEQ ID NO:136) were purchased from Calbiochem, Boc-Val-Pro-Arg-AMC from Bachem, Abz-Thr-Phe-Arg-Ser-Ala-Dap(Dnp)-NH2 (TFRSA SEQ ID NO:137) from Neosystem. Oligonucleotide synthesis was carried out by Invitrogen and DNA sequencing by Synergene Biotech GmbH. Human kallikrein 2, 5, 13 and 14 were produced in a yeast system (Yousef et al., 03c; Kapadia et al., 03; Borgono et al., 03). Human kallikrein 6 was produced in a 293 human embryonic kidney cell system and human kallikrein 8 with a baculovirus vector and HighFive insect cells (Little et al., 97; Kishi et al., 03). HK6 and hK8 were activated with Lys-C(Shimizu et al., 98).

Construction of Expression Vectors for Recombinant Wild-Type AAT, ACT and their Variants.

[0203] Human AAT cDNA (Invitrogen, UK) was amplified by PCR using the oligonucleotides 5-TATGGATCCGATGATCCCCAGGGAGA-3 (SEQ ID NO:71) and 5-CGCGAAGCTTTTATTTTTGGGTGGGA-3 (SEQ ID NO:72). The BamHI-HindIII fragment of the amplified AAT gene was cloned into the vector pQE9 (Qiagen, Germany) resulting in plasmid pAAT, which contains an open reading frame of the mature AAT with an N-terminal His.sub.6-tag. Silent mutations producing KasI and Bsu36I restriction sites were introduced in pAAT 24 bp upstream and 11 bp downstream of the P1 codon of the RSL domain, respectively. The restriction sites were created using the oligonucleotides 5-ACTGAAGCTGCTGGCGCCGAGCTCTTAGAGGCCATA-3 (SEQ ID NO:73) for the KasI and 5-GTCTATCCCCCCTGAGGTCAAGTTC-3 (SEQ ID NO:74) for the Bsu36I site following the QuikChange mutagenesis protocol supplied by Stratagene. Construction of the plasmid expressing wild-type ACT was described previously (Cloutier et al., 2004).

[0204] rAAT and rACT variants were produced by replacement of the RSL region with corresponding DNA fragments amplified from appropriate template oligonucleotides:

TABLE-US-00010 rAAT.sub.E8, (SEQIDNO:75) 5-CCATGTTTCTAGAGGCTCTGCAGCGTGCTATCCCGCCTGAGGTCAAG TT-3; rAAT.sub.G9, (SEQIDNO:76) 5-CCATGTTTCTAGAGACCGTTGACTACGCTATCCCGCCTGAGGTCAAG TT-3, rACT.sub.E8, (SEQIDNO:77) 5-TACCGCGGTCAAAATCCTGCAGCGTGCTATCCTGGTGGAGACGCGTG A-3 and rACT.sub.G9, (SEQIDNO:78) 5-TACCGCGGTCAAAACCGTTGACTACGCTGCTCTGGTGGAGACGCGTG A-3.

[0205] Templates were amplified using primers corresponding to their respective flanking regions, 5-GCTGGCGCCATGTTTCTAGAG-3 (SEQ ID NO:79; AAT variants1) and 5-TTGTTGAACTTGACCTCAGG-3 (SEQ ID NO:80; AAT variants 2) for AAT variants and 5-GTACCGCGGTCAAA-3(SEQ ID NO:81; ACT variants 1) and 5-TCACGCGTGTCCAC-3(SEQ ID NO:82; ACT variants 2) for ACT variants. Resulting PCR fragments were cloned as KasI/Bsu36I fragments into pAAT and as MluI/SacII fragments into rACT.sub.WT constructs and confirmed by DNA sequencing. Changes in the reactive site loop between positions P4 and P2 are shown in Table IX.

Expression and Purification of Recombinant Serpins

[0206] Recombinant serpins were produced in Escherichia coli strain TG1. Cells were grown at 37 C. in 2 TY media (16 g tryptone, 10 g yeast extract, 5 g NaCl per L) containing 100 g/ml ampicillin to O.D..sub.600=0.5-0.7. Isopropyl thio--D-galactoside (IPTG) was added to a final concentration of 0.5 mM for production of rACT proteins and 0.1 mM for rAAT proteins and recombinant serpins were expressed for 16 h at 18 C. Cells were harvested by centrifugation and resuspended in 0.1 volume of cold PBS 2. After 45 min of incubation with lysozyme (0.5 mg/ml) on ice, total soluble cytoplasmic proteins were extracted by four cycles of freeze/thaw and total DNA was degraded with DNase I. Cell debris was removed by centrifugation (25 min., 17500 g) and Ni.sup.2+-nitrilotriacetic affinity agarose beads were added to the supernatant for 90 min at 4 C. to bind recombinant serpins. The resin was washed three times with 50 mM Tris, pH 7.5, 150 mM NaCl, 20 mM imidazole and bound proteins were eluted with 50 mM Tris, pH 7.5, 150 mM NaCl, 150 mM imidazole. Eluted proteins were dialyzed against 50 mM Tris, pH 7.5, 150 mM NaCl, 0.01% Triton X-100 for 16 h at 4 C. and protein purity was assessed by Coomassie Blue-stained SDS-PAGE. Protein concentrations were determined by the bicinchoninic acid method (Smith et al., 1985), using bovine serum albumin as standard (Pierce Chemical Co., Rockford, Ill.). AAT.sub.E8, ACT.sub.E8 and AAT.sub.G9, ACT.sub.G9 were titrated with trypsin and chymotrypsin, respectively.

Stoichiometry of Inhibition (SI)

[0207] SI values of rAAT, rACT, and their variants were determined with hK14 incubating the protease with varying concentrations of inhibitor. After an incubation of 4 hours at 37 C. in reaction buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA), the residual activity was detected by the addition of fluorescent substrate (Boc-Val-Pro-Arg-AMC). Fluorescence was measured with excitation at 340 nm (15) and emission at 485 nm (10) in black 96 well plates using a microplate fluorescence reader FL.sub.x800 (Bio-Tek Instruments, Inc.). The SI value corresponds to the abscissa intercept of the linear regression analysis of fractional velocity (velocity of inhibited enzyme reaction (vi)/velocity of uninhibited enzyme reaction (v.sub.0)) vs. the molar ratio of the inhibitor to enzyme ([I.sub.0]/[E.sub.0]).

Kinetic Analysis

[0208] The association rate constants for interactions of hK14, with different inhibitors were determined under pseudo-first order conditions using the progress curve method (Morrison and Walsh, 1988). Under these conditions, a fixed amount of enzyme (2 nM) was mixed with different concentrations of inhibitor (0-80 nM) and an excess of substrate (20 M). Reactions were performed in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA) at 37 C. for 45 min and the rate of product formation was measured using a FL.sub.x800 fluorescence 96-well microplate reader (Biotek, USA). Inhibition is considered to be irreversible over the course of reaction and the progression of enzyme activity is expressed as product formation (P), beginning at a rate (v.sub.z) and is inhibited over time (t) at a first-order rate (k.sub.obs), where the rate constant is only dependent on the inhibitor concentration.


P=(v.sub.z/k.sub.obs)[1e.sup.(k.sup.obst.sup.)]eq 1

[0209] For each inhibitor, a k.sub.obs was calculated for four different concentrations of inhibitor, by non linear regression of the data using equation 1. By plotting the k.sub.obs versus inhibitor concentration [I], a second-order rate constant, k, equal to the slope of the curve (k=k.sub.obs/[I]), was determined. Due to the competition between the inhibitor and the substrate, equation 2 below is used to correct the second order rate constant k by taking into account the substrate concentration [S] and the K.sub.m of the enzyme for its substrate, giving the k.sub.a.


k.sub.a=(1+[S]/K.sub.m)keq 2

The K.sub.m of hK14 for MeOSuc-VPR-AMC was 8 M. However, it will be understood that, depending on the purity grade and specific activity of the hK14 protease, the K.sub.m may vary.

SDS-PAGE Analysis of Enzyme-Inhibitor Complexes

[0210] A constant amount of the different inhibitors (ranging from 1 to 2 ug) was incubated for 4 h in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100) with different amounts of hK14 corresponding to 0.5, 1 and 2 times the SI value. Samples were heated at 90 C. for 10 minutes, resolved on a 10% SDS gel under reducing conditions and visualized by Coomassie Blue staining.

Inhibitory Specificity of Recombinant rAAT and rACT Variants (Table IX)

[0211] 2 nM of trypsin, chymotrypsin, plasma kallikrein, human neutrophil elastase and thrombin and 10 nM of hK2, hK3, hK5, hK6, hK8, hK13 and hK14 were incubated for 30 minutes at 37 C. with 100 nM and 500 nM of recombinant inhibitors, respectively. Residual activities were detected by the addition of fluorescent substrates (Z-Phe-Arg-AMC for trypsin and plasma kallikrein, Suc-Ala-Ala-Pro-Phe-AMC for chymotrypsin, Z-Gly-Gly-Arg-AMC for thrombin and MeOSuc-Ala-Ala-Pro-Val-AMC for human neutrophil elastase and Abz-Thr-Phe-Arg-Ser-Ala-Dap(Dnp)-NH2 for human kallikreins).

Stability of the Complex

[0212] HK14 (2 nM) was incubated with different amounts of inhibitors, corresponding to 0, 1 and 2 times the SI. After incubations for 4, 8 and 24 h at 37 C. in reaction buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA), the residual activity was detected by addition of 20 M of the fluorescent substrates Boc-Val-Pro-Arg-AMC. The slope (velocity) of each inhibitory reaction was divided by the slope of the corresponding reaction without inhibitor.

Design and Production of Soluble Recombinant Serpins

[0213] To develop specific inhibitors for hK14, Applicants substituted five residues surrounding the scissile bond of rAATwt and rACTwt by two substrate pentapeptides, previously selected with hK14 using phage-display technology (Felber et al., 05). Profiling of hK14 enzymatic activity demonstrated that hK14 has a dual trypsin and chymotrypsin-like activity. Applicants therefore decided to develop inhibitors with two substrate peptides, E8 and G9, specific for trypsin and chymotrypsin-like activity, respectively. The scissile bond of these substrates was aligned according to the P1-P1 of the rAATwt and rACTwt. The RSL regions of the serpin variants are shown in Table IX.

TABLE-US-00011 TABLEIX Selected.sup.a Substrate Serpin Peptide P6 P5 P4 P3 P2 P1 P1 P2 P3 P4 P5 AAT.sub.WT L E A I P M* S I P P E AAT.sub.E8 LQRAI L E A L Q R* A I P P E SEQIDNO:121 AAT.sub.G9 TVDYA L E T V D Y* A I P P E SEQIDNO:130 ACT.sub.WT V K I T L L* S A L V E ACT.sub.E8 LQRAI V K I L Q R* A I L V E SEQIDNO:121 ACT.sub.G9 TVDYA V K T V D Y* A A L V E SEQIDNO:130 Comparison of amino acid sequence of the scissile bond region of the reactive serpin loop (RSL)of wild type AAT, ACT and their variants. .sup.aSubstrate peptides selected by kallikrein hK14 using a phage-displayed random pentapeptide library (Felber et al., 2004). Plain type residues are common to wild type serpin, bold residues correspond to substrate peptides relocated in RSL of AAT and ACT variants. The scissile bond cleaved by hK14 in substrate peptides is designated by and putative cleavage sites in serpins are marked by asterisks between the P1-P1 residues.

[0214] The recombinant serpins were produced as soluble, active form and were purified under native conditions from cytoplasmic proteins in a one-step procedure over a nickel affinity column. Analysis on SDS-PAGE under reducing conditions revealed a single band for each inhibitor, rAAT and rACT variants, migrating at apparent sizes of 45 to 50 kDa, corresponding with their molecular weight, except for the protein AAT.sub.E8, which is migrating slightly faster (data not shown). All inhibitors were estimated to be more than 95% pure by densitometric analysis, with a range of production yield of 1 to 5 mg/L.

Stoichiometry of Inhibition, Association Constants and Complex Stability

[0215] Determination of stoichiometry of inhibition (SI) was performed under physiological conditions of pH and ionic strength. The SI indicates the number of inhibitor molecule required to inhibit one molecule of hK14. Applicants observed that titration curves were linear, even for SI values >>1, indicating that the reaction is completely finished. The calculated SI values of the serpin variants range from 1 to 1.5, except for rAAT.sub.E8 which resulted in a SI of 7.4 (Table X).

[0216] Whereas wild type ACT did not react with hK14 under the tested conditions, AAT.sub.WT was found to be a good inhibitor for hK14 with a SI of 1. Substitution of ACT RSL region with hK14 substrate peptides not only allowed generating reactivity toward the enzyme but creating inhibitors with high affinity. On the other hand, using AAT.sub.WT as scaffold, modification of the RSL was less favorable since all inhibitors are less efficient than wild type version (Table X).

TABLE-US-00012 TABLEX Selected.sup.a Inhibitor SubstratePeptide SI k.sub.aM.sup.-1s.sup.-1 AAT.sub.WT IPM*SI 1.0 263000 SEQIDNO:140 AAT.sub.E8 LQRAI 7.4 n.a. SEQIDNO:121 AAT.sub.G9 TVDYA 1.2 217000 SEQIDNO:130 ACT.sub.WT TLL*SA SEQIDNO:138 ACT.sub.E8 LQRAI 1.2 575000 SEQIDNO:121 ACT.sub.G9 TVDYA 1.5 74000 SEQIDNO:130 Stoichiometry Inhibition (SI) and second-order rate constants (k.sub.a) values for the reaction of rAATwt, rACTwt and their variants with hK14. .sup.aSubstrate peptide selected by phage display technology with hK14 (Felber et al., 2005) and used to modify the rAATwt and rACTwt. , No detectable inhibitory activity.

[0217] Calculated SI values were consistent with the ratio between cleaved and complexed forms of the serpins after reaction with hK14 as demonstrated by SDS-PAGE analysis (data not shown). Each variant was incubated with different concentrations of hK14 corresponding to a ratio of inhibitor to protease below, equal and above the SI value. The analysis of SDS-PAGE showed the formation of covalent complexes (C) for each serpin variant hK14 pair, with apparent molecular masses consistent with expected values. When hK14 concentration was 0.5 time the SI value, degraded forms of the complex was observed which is certainly generated by the uncomplexed and free hK14.

[0218] Besides the formation of an inhibitor complex, reaction with hK14 also produced a fraction of hydrolyzed inhibitor, with a molecular size consistent with the serpin being cleaved at or near the reactive site of the RSL. The amount of this fraction was largely lowered when the SI value is close to 1 (AAT-G9, ACT-E8 and ACT-G9). In contrast, the only variant with a SI values >>1 (rAAT.sub.E8) exhibited a substrate behavior with hK14, resulting mainly in accumulation of the cleaved form of the inhibitor rather than formation of the irreversible complex. As expected, the presence of intact inhibitor was observed when the ratio [I].sub.o/[E].sub.o was above the SI with a weak band of complex.

[0219] Surprisingly, most of complexes were found to be SDS stable (data not shown) even if a relatively slow breakdown of the complex was observed with AAT.sub.G9 resulting in the reappearance of hK14 activity after 8 hours of incubation.

[0220] Kinetic analysis of the inhibition of human hK14 by recombinant serpins were performed under pseudo-first-order conditions using an excess of inhibitor at various molar ratios of hK14. The time-dependent inactivation of the enzyme through reaction with serpin was monitored continuously, following the decrease in the rate of substrate turnover. Progress curves for reactions with different serpin concentrations were fitted to equation 1 to calculate values describing the rate constant (kobs). The association rate constants (k.sub.a) were determined from the slope of kobs values versus the concentration of the hK14 inhibitors. Independently of the inhibitor scaffold (AAT or ACT), the recombinant serpins modified with the substrate E8 showed superior k.sub.a values than the equivalent G9 inhibitor.

[0221] Serpins modified with the chymotrypsin-like substrate, rAAT.sub.G9 and rACT.sub.G9, demonstrated only a moderate affinity for hK14, with association constants of respectively 217,000 and 74,000 M.sup.1 s.sup.1 while rACT.sub.E8 possessed association constants of 575,000 M.sup.1 s.sup.1.

Inhibitory Specificity of Recombinant rAAT and rACT Variants

[0222] In order to define the inhibitory specificity of hK14 inhibitors, Applicants investigated the reaction of purified variants with a broad panel of proteinases. First at all, proteinases with broad specificities were examined, including trypsin, chymotrypsin, plasma kallikrein, human neutrophil elastase and thrombin. Additionally, Applicants assessed the specificity of hK14 inhibitors towards enzymes belonging to the same protease family, i.e. hK2, hK3, hK5, hK6, hK8 and hK13 (Table XI). Following 30 minutes of incubation of hK14 with an excess of inhibitors ([I].sub.o/[E].sub.o of 50:1), no residual activity was detected with all modified serpins and rAATwt.

[0223] Under these conditions, only rACTwt showed weak inhibitory activity against hK14, with only 17% of inhibition. Serpins modified with the E8 substrate showed a moderate specificity since several other enzymes were inhibited by these inhibitors. A very high specificity was observed with AAT.sub.G9 and ACT.sub.G9 and none of the tested enzymes was inhibited, except for chymotrypsin and to a lower extent for hK5.

TABLE-US-00013 TABLE XI Protease AATwt AAT.sub.E8 AAT.sub.G9 ACTwt ACT.sub.E8 ACT.sub.G9 hK14 100 100 100 17 100 100 Trypsin 100 100 0 0 100 0 Chtr 100 19 100 100 14 100 PK 17 100 0 46 36 0 HNE 100 0 0 16 0 0 Thrombin 4 0 0 18 0 0 hK2 0 19 0 0 100 0 hK3 0 0 0 100 0 0 hK4 na na na Na 100 0 hK5 28 100 30 7 100 0 hK6 33 100 0 24 72 0 hK8 0 36 0 0 34 0 hK13 0 30 0 0 0 0 Inhibitory specificity of hK14 inhibitors. Percentage inhibition conrresponding to 100 [1 (velocity in presence of inhibitor/velocity of uninhibited control)]. Reaction of 30 min. incubation with an excess of inhibitors ([I].sub.o/[E].sub.o of 50:1).

Example 3

[0224] Production and Purification of Active hK14

[0225] Human Kallikrein 14 was produced and purified as previously described.

[0226] Selection of substrate peptides for hk14 using phage display technology

[0227] The substrate phage library was panned against hK14 to select substrates hydrolyzed by its hydrolytic activity. Cleaved phages were amplified in E. coli TG1 cells and then subjected to five more rounds of enzyme digestion and screening. The amount of released phages increased with each round, thus verifying a higher number of hK14-susceptible phages after each round of selection. The amino acid sequences of 32 phage peptides from the last round of selection were determined by sequencing and the obtained sequences corresponding to the substrate regions were listed in Table 8. From all selected and cleaved peptides, 69% possess at least one basic residue in P1 position as expected with the putative trypsin-like activity of hK14 whereas 31% of peptides have a tyrosine residue specific to chymotrypsin-like enzyme in P1.

Kinetic Characterization of Substrate Hydrolysis by hK14

[0228] To verify that the sequences from the phage display analysis were indeed substrates for hK14 and to identify the cleavage site, all selected peptides were constructed in fluorescent substrate form. All substrates were hydrolyzed by hK14 with variable level of efficacy and kcat/Km ranged from 2,000 to 481,000 M.sup.1 s.sup.1. The specificity of cleavage was demonstrated by CFP-GGGGG-YFP (SEQ ID NO:117) which is not hydrolyzed by hK14.

[0229] Results clearly indicate that the preferred P1 amino acid for hK14 susceptibility is Arg (Table XIII) since all of the best hK14 substrates with kcat/Km superior to 200 000 M.sup.1 s.sup.1 possess an Arg in P1 position. Interestingly, from the four peptides cleaved most efficiently by hK14, two contained Glu at the P2 position. In contrast, a broad variety of amino acids occurred in P1 position demonstrating no significant preference at this position. However, two substrates possess an aspartic acid in P1 position and are cleaved relatively efficiently.

[0230] On the other hand, all substrates with a Lys at the P1 position were cleaved at very low rate with a Kcat/Km below 34 000 M.sup.1 s.sup.1. Similarly, the cleavage rate for the substrate with a P1 Tyrosine was very low excepted one substrate, peptide G9, which has a Kcat/Km of 134 000 M.sup.1 s.sup.1. With the exception of P1 position, where glycine residue is recovered in almost 50% of P1 Lysine or Tyrosine substrates, none amino acid in particular was recovered more frequently at the other positions.

[0231] Since many of the selected substrates contained some motifs susceptible to be cleaved by other proteases, Applicants measured the degree to which hK2, plasma kallikrein, PSA, chymotrypsin, trypsin and elastase could cleave these hK14 substrates (Table XII). Each substrate was tested at enzyme concentration giving a specific cleavage in the substrate linker.

[0232] Not surprisingly, most of trypsin-like substrates are cleaved by trypsin with a variable efficacy which was not strictly in correlation with hK14 preferences. For instance, the two pentapeptides VGSLR (SEQ ID NO:118) and RQTND (SEQ ID NO:119) were best substrates for hK14 but were not very efficiently cleaved by trypsin in comparison to other peptides like LSGGR (SEQ ID NO:124) peptide giving a Kcat/Km of almost 5,000,0000 M.sup.1.Math.s.sup.1 with trypsin. In contrast, peptides possessing a Gln in P2 position were best substrates as well as for hK14 than for trypsin. Only two hK14 substrates, RVTST (SEQ ID NO:128) and VVMKD (SEQ ID NO:129), in exception to chymotrypsin-like substrates were not cleaved by trypsin.

[0233] Chymotrypsin-like substrates were cleaved by chymotrypsin more efficiently than with hK14 excepted TVDYA (SEQ ID NO:130) substrate which gave almost the same Kcat/Km with hK14, chymotrypsin and elastase. This last enzyme also proteolyzed the two selected peptides YQSLN (SEQ ID NO:133), which is also cleaved weakly by PSA, and TSYLN (SEQ ID NO:134). Selected substrates displayed a high selectivity for hK14 in comparison to other human kallikreins such as hK1, hK2, PSA and PK. Only hK2 proteolyzed most of the trypsin-like substrates with Kcat/Km values always at least 5 fold less than for hK14. For example, NQRSS (SEQ ID NO:120) peptide is 27 and 78 fold more selective for hK14 than for hK2 and PK, respectively.

TABLE-US-00014 TABLEXII Specificityofpreferredselectedsubstrates Comparisonofspecificityconstant(kcat/Km) valuesofCFP-X5-YFPsubstratesbasedon selectedsubstratesforhK14.(P1positionsof scissilebondsareinbold). Clone Sequence k.sub.cat/K.sub.m(M.sup.-1.s.sup.-1) G1 VGSLR 481000 SEQIDNO:118 C11 RQTND 415000 SEQIDNO:119 E5 NQRSS 388000 SEQIDNO:120 E8 LQRAI 367000 SEQIDNO:121 F11 QRLRD 307000 SEQIDNO:122 F3 PDRHM 243000 SEQIDNO:123 E2 LSGGR 207000 SEQIDNO:124 G9 TVDYA 134000 SEQIDNO:130 E7 LSRDN 127000 SEQIDNO:125 D9 RGKTN 80000 SEQIDNO:126 E9 NNKLR 74000 SEQIDNO:127 E6 MQVKH 34000 SEQIDNO:142 E4 TTDLR 27000 SEQIDNO:143 E12 RVTST 26000 SEQIDNO:128 E1 AYGYK 24000 SEQIDNO:131 G3 STKGI 20000 SEQIDNO:144 F5 KLKET 19000 SEQIDNO:145 F6 VGLYD 18000 SEQIDNO:132 E10 VVMKD 15000 SEQIDNO:129 D11 RVDTG 15000 SEQIDNO:146 F7 GHRIN 12000 SEQIDNO:147 F10 YQSLN 12000 SEQIDNO:133 C5 SDKVY 9000 SEQIDNO:148 G11 HETLK 9000 SEQIDNO:149 D7 TSYLN 9000 SEQIDNO:134 F4 MQATK 8000 SEQIDNO:150 G7 EAPAK 8000 SEQIDNO:151 F12 PVHLY 7000 SEQIDNO:152 F1 QPNGY 6000 SEQIDNO:153 G5 AYGLA 6000 SEQIDNO:154 C9 YQNSS 6000 SEQIDNO:155 E11 SAVRP 5000 SEQIDNO:156

All

[0234]

TABLE-US-00015 TABLEXIII SpecificityofphageselectedhK14substratestowarddifferenthumanproteases. Chymo- Plasma Peptide Sequence hK14 Trypsin Trypsin Elastase kallikrein hK1 hK2 PSA Trypsin-likesubstrate k.sub.cat/K.sub.m(M.sup.-1.s.sup.-1) G1 VGSLR 481000 270000 145000 21000 SEQID NO:118 C11 RQTND 415000 260000 251000 23000 SEQID NO:119 E5 NQRSS 388000 2070000 5000 14000 SEQID NO:120 E8 LQRAI 367000 2270000 209000 5000 25000 SEQID NO:121 F11 QRLRD 307000 1420000 168000 L.C. 32000 SEQID NO:122 F3 PDRHM 243000 319000 192000 SEQID NO:123 E2 LSGGR 207000 4'676000 83000 14000 SEQID NO:124 E7 LSRDN 127000 246000 155000 16000 SEQID NO:125 D9 RGKTN 80000 2111000 94000 21000 SEQID NO:126 E9 NNKLR 74000 384000 77000 12000 SEQID NO:127 E12 RVTST 26000 100000 200000 SEQID NO:128 E10 VVMKD 15000 65000 SEQID NO:129 Chymotrypsin-likesubstrate k.sub.cat/K.sub.m(M.sup.-1.s.sup.-1) G9 TVDYA 134000 145000 181000 SEQID NO:130 E1 AYGYK 24000 129000 618000 SEQID NO:131 F6 VGLYD 18000 409000 SEQID NO:132 F10 YQSLN 12000 134000 49000 L.C. SEQID NO:133 D7 TSYLN 9000 266000 90000 SEQID NO:134 L.C.: low cleavage, kcat/Km not determined; no detectable cleavage

[0235] This study identified two classes of pentapeptide substrates for hK14: trypsin-like and chymotrypsin-like substrates. However, Applicants showed that hK14 has trypsin-rather than chymotrypsin-like cleavage specificity despite the selection of several aromatic residue-containing substrates. The substrates with the highest Kcat/Km have an arginine in P1 position indicating a preference for this amino acid (Table XIV). Lysine, on the other hand, seems to be less suitable than tyrosine in P1 position. If the two amino acids were present in the same peptide, hK14 cleaved after the tyrosine residue. In addition, one of the chymotrypsin-like substrates, TVDYA (SEQ ID NO:130), gave a significantly higher kinetic value, 134,000 M.sup.1.Math.s.sup.1, than all the lysine-P1 substrates, with Kcat/km values not higher than 34,000 M.sup.1.Math.s.sup.1. No selectivity of hK14 was observed for the P1 position, where different types of amino acids such as small and uncharged, hydrophobic, positively charged or negatively charged residues have been recovered in the best substrates Analysis of other surrounding positions demonstrated that hK14 can be accommodated by a large variety of amino acids. This observation does not mean that hK14 has a large spectrum of activities like trypsin or chymotrypsin but demonstrates an ability to cleave different sequences depending to the context.

[0236] The chymotrypsin-like activity of hK14, even if it is inferior to its trypsin-like activity, is interesting. To Applicants knowledge, except for the Phe-Phe link cleaved by hK1 in kallistatin and some derived peptides, this is the first human kallikrein described with a dual activity. The conformation of the specificity pocket in hK14 should therefore accommodate both aromatic and basic amino acid side chains at the substrate P1 position to explain the dual chymotrypsin and trypsin-like activity of hK14.

Development of hK14 Specific Inhibitors

[0237] Modifications of the RSL of 1-antichymotrypsin (ACT) and cd-antitrypsin (AT or AAT) have been performed to change the specificity of this inhibitor. Selected substrates (G1, C11, E5, E8, F3, F11, G9) were then transplanted into the reactive site loop of serpins to generate new variants, able to inhibit the human kallikrein hK14. More than one inhibitor variants have been constructed using sequences from peptides G1 and C11.

TABLE-US-00016 TABLEXIV AlignmentofRSL(reactiveserpinloop)regionofrecombinantserpin1- antichymotrypsin(ACT)anditsvariants. Selected.sup.aSubstrate Serpin Peptide P6 P5 P4 P3 P2 P1 P1 P2 P3 P4 P5 ACT.sub.WT V K I T L L* S A L V V ACT.sub.G1 vGSLR V K G S L R* S A L V V SEQIDNO:118 ACT.sub.G1g vGSLRG V K G S L R* G A L V V SEQIDNO:141 ACT.sub.G1v VGSLR V V G S L R* S A L V E SEQIDNO:118 ACT.sub.C11 RQTNd V K I T L R* Q T N V V SEQIDNO:119 ACT.sub.C11g gRQTNd V K I T G R* Q T N V V SEQIDNO:139 ACT.sub.C11D gRQTND V K I T L R* Q T N D V SEQIDNO:139 ACT.sub.E5 NQRSS V K I N Q R* S S L V V SEQIDNO:120 ACT.sub.E8 LQRAI V K I L Q R* A I L V V SEQIDNO:121 ACT.sub.F11 QRLRD V K Q R L R* D A L V V SEQIDNO:122 ACT.sub.F3 PDRHM V K I P D R* H M L V V SEQIDNO:123 ACT.sub.G9 TVDYA V K T V D Y* A A L V V SEQIDNO:130 .sup.aSubstrate peptides selected by kallikrein hK14 using a phage-displayed random pentapeptide library. Plain type residues are common to rACT.sub.WT, underlined residues correspond to substrate peptides relocated in RSL of ACT variants. The scissile bond by hK14 in substrate peptides is designated by bold and putative cleavage site in serpins is marked by asterisks between the P1-P1 residues.

TABLE-US-00017 TABLEXV AlignmentofRSL(reactiveserpinloop)regionofrecombinantserpinalpha- 1-antitrypsin(AAT)anditsvariants. Selected.sup.aSubstrate Serpin Peptide P6 P5 P4 P3 P2 P1 P1 P2 P3 P4 P5 AAT.sub.WT L E A I P M* S I P P E AAT.sub.G1 vGSLR L E G S L R* S I P P E SEQIDNO:118 AAT.sub.G1g vGSLRG L E G S L R* G I P P E SEQIDNO:141 AAT.sub.G1v VGSLR L V G S L R* S I P P E SEQIDNO:118 AAT.sub.C11 RQTND L E A I P R* Q T N P E SEQIDNO:119 AAT.sub.C11g gRQTND L E A I G R* Q T N P E SEQIDNO:139 AAT.sub.E5 NQRSS L E A N Q R* S S P P E SEQIDNO:120 AAT.sub.E8 LQRAI L E A L Q R* A I P P E SEQIDNO:121 AAT.sub.F11 QRLRD L E Q R L R* D I P P E SEQIDNO:122 AAT.sub.F3 PDRHM L E A P D R* H M P P E SEQIDNO:123 AAT.sub.G9 TVDYA L E T V D Y* A I P P E SEQIDNO:130 .sup.aSubstrate peptides selected by kallikrein hK14 using a phage-displayed random pentapeptide library. Plain type residues are common to rAAT.sub.WT, underlined residues correspond to substrate peptides relocated in RSL of AT variants. The scissile bond by hK14 in substrate peptides is designated by bold and putative cleavage site in serpins is marked by asterisks between the P1-P1 residues.

[0238] The determination of the stoichiometry of inhibitory (SI) and the rate of inhibitory reaction (ka) were performed under physiological conditions of pH and ionic strength to ensure a more relevant comparison. Almost all the newly constructed variants of ACT showed lower SI values with hK14 than wild type ACT. From these variants rACT.sub.C11, rACT.sub.C11D, rACT.sub.G9 and rACT.sub.E8 had the lowest stoichiometry of inhibition values for hK14 (4.8, 2.8, 1.5 and 1.2 respectively) and the highest association constants (65000, 74000, 75000 and 575000 M.sup.1 s.sup.1 respectively). Contrary to ACT, the serpin AATwt is a good inhibitor for hK14 with an association constant of 263 000 M.sup.1 s.sup.1. All the AAT variants had a lower association constant than AATwt, but several of them still react at high velocity with hK14, as AAT.sub.G1, AAT.sub.G9, AAT.sub.E8, AAT.sub.G1g and AAT.sub.C11 exhibiting a ka of 168 000, 217 000, 242 000, 257 000 and 63 000 M.sup.1 s.sup.1 respectively. Only two AT variants did not inhibit hK14.

TABLE-US-00018 TABLEXVI ComparisonofStoichiometryInhibitionvaluesandsecond-order rateconstants(k.sub.a)forthereactionofACTvariantswithhK14. Selected.sup.a Clone SubstratePeptide SI k.sub.aM.sup.-1s.sup.-1 ACT.sub.WT ACT.sub.G1 vGSLR 13.3 3200* SEQIDNO:118 ACT.sub.G1g vGSLRG SEQIDNO:141 ACT.sub.G1v VGSLR 11.7 22000* SEQIDNO:118 ACT.sub.C11 RQTNd 4.8 65000* SEQIDNO:119 ACT.sub.C11g gRQTNd 13.8 7600* SEQIDNO:139 ACT.sub.C11D gRQTND 2.8 74000* SEQIDNO:139 ACT.sub.E5 NQRSS SEQIDNO:120 ACT.sub.E8 LQRAI 1.2 575000 SEQIDNO:121 ACT.sub.F11 QRLRD SEQIDNO:122 ACT.sub.F3 PDRHM SEQIDNO:123 ACT.sub.G9 TVDYA 1.5 74000 SEQIDNO:130 *Calculation based on reaction conditions in which [I.sub.0]/[E.sub.0] < 5*SI

TABLE-US-00019 TABLEXVII ComparisonofStoichiometryInhibitionvaluesandsecond-orderrate constants(k.sub.a)forthereactionofATvariantswithhK14. Selected.sup.a Clone SubstratePeptide SI k.sub.aM.sup.-1s.sup.-1 AAT.sub.WT 1.0 263000 AAT.sub.G1 vGSLR 3.6 16800* SEQIDNO:118 AAT.sub.G1g vGSLRG 2.3 257000* SEQIDNO:141 AAT.sub.G1v VGSLR - - SEQIDNO:118 AAT.sub.C11 RQTNd 2.8 63000* SEQIDNO:119 AAT.sub.C11g gRQTNd 9 42000* SEQIDNO:139 AAT.sub.E5 NQRSS 10 28000* SEQIDNO:120 AAT.sub.E8 LQRAI 7.4 242000* SEQIDNO:121 AAT.sub.F11 QRLRD SEQIDNO:122 AAT.sub.F3 PDRHM 11.7 13000* SEQIDNO:123 AAT.sub.G9 TVDYA 1.2 217000 SEQIDNO:130 *Calculation based on reaction conditions in which [I.sub.0]/[E.sub.0] < 5*SI

[0239] A panel of enzymes including trypsin, human neutrophil elastase, chymotrypsin, plasma kallikrein (PK), urokinase (uPA), and thrombin were screened to determine inhibitory specificity of ACT and AAT variants with a SI for hK14 lower than 10 (Table XVIII). When incubated for 30 min with an excess of inhibitor ([I]o/[E]o) of 50:1), hK14 is completely inhibited (100%). Under this condition, wild type ACT showed only 17% inhibition activity toward hK14 contrary to AATwt (100% of inhibition). Among the ACT variants, two (rACT.sub.C11 and rACT.sub.C11D) show specificity to hK14, inhibiting no other tested enzymes apart from trypsin and chymotrypsin. For AAT variants, these new inhibitors clearly exhibited a higher specificity toward hK14 than AATwt. AAT.sub.G9 demonstrated to be highly specific to hK14, showing no reactivity with any trypsin-like proteases.

TABLE-US-00020 TABLE XVIII Inhibitory profile of ACT.sub.WT, AAT.sub.WT and its variants. ACT.sub.C11 ACT.sub.C11D ACT.sub.E8 ACT.sub.WT AAT.sub.G1 AAT.sub.G1g AAT.sub.C11 AAT.sub.E8 AAT.sub.G9 AAT.sub.WT Protease % Inhibition HK14 100 100 100 17 100 100 100 100 100 100 Trypsin 100 100 100 0 100 100 100 100 0 100 Chtr 84 83 14 100 27 17 18 19 100 100 PK 0 0 36 46 100 100 8 100 0 17 HNE 0 0 0 26 0 0 0 0 0 100 Urokinase 0 0 0 0 17 0 0 0 0 0 Trombin 0 0 0 18 51 0 100 0 0 4 .sup.aSerpins and proteases were incubated for 30 min at 37 C. at a [I].sub.o/[E].sub.o ratio of 50:1. Percent inhibition correspond to 100 (1 (velocity in presence of inhibitor/velocity of uninhibited control).

[0240] Additional hK14 inhibiting ACT variants were screened against a larger panel of tissue kallikreins related to hK14. Partial inhibition was observed against different subsets of tested kallikreins.

TABLE-US-00021 TABLE XIX ACT.sub.G1 ACT.sub.G1g ACT.sub.C11g ACT.sub.E5 ACT.sub.F11 Protease % Inhibition.sup.a hK2 15 0 25 0 25 hK4 0 0 0 75 45 hK5 50 10 5 10 15 hK6 20 0 0 0 0 hK8 0 0 0 10 0 .sup.aProtease and serpins were incubated for 30 min at 37 C. (90 min at 37 for PSA) at a [I].sub.o/[E].sub.o ratio of 50:1. Percent inhibition correspond to 100 (1 (velocity in presence of inhibitor/velocity of uninhibited control)).

[0241] The permutation of RSL cleavage site for hK14 phage display selected substrates has changed wild type serpins (ACT and AAT) into highly sensitive inhibitors for hK14, especially AAT.sub.G9 showing a unique reactivity. To Applicants knowledge, this is the first report describing the development of a specific inhibitor for hK14. The fact that some recombinant inhibitors also inhibited other enzymes than hK14 is not surprising because of the homology of substrate between trypsin-like proteases. Moreover, the velocity of reaction should be determined for recombinant inhibitors toward other enzymes.

TABLE-US-00022 TABLE XX Acanthosis Nigricans, Bacterial Mouth Infections, Confluent and Reticulated Acne Conglobata, Balanitis Circumscripta Papillomatosis, Acne Fulminans, Plasmacellularis, Congenital Hypertrichosis Acne Keloidalis Nuchae, Balanitis Xerotica Obliterans, Lanuginosa, Acne Vulgaris, Balanoposthitis, Congenital Nevi, Acneiform Eruptions, Basal Cell Carcinoma, Congenital Onychodystrophy of Acquired Digital Fibrokeratoma, Basic Excisional Surgery, the Index Fingers, Acquired Progressive Becker Melanosis, Congenital Patterned Lymphangioma Bedbug Bites, Leukodermas, Acrochordon, Behcet Disease, Connective Tissue Nevus, Acrodermatitis Chronica Berloque Dermatitis, Contact Dermatitis, (Allergic), Atrophicans, Birt-Hogg-Dube Syndrome, Contact Dermatitis, (Irritant), Acrodermatitis Enteropathica, Black Heel (Calcaneal Contact Stomatitis, Acrodynia, Petechiae), Corns, Acrokeratoelastoidosis, Black Widow Spider Bite, Cosmeceuticals, Acrokeratosis Neoplastica, Bloom Syndrome (Congenital Cosmetics, Acrokeratosis Verruciformis of Telangiectatic Erythema), Cowden Disease (Multiple Hopf, Blue Nevi, Hamartoma Syndrome), Acromegaly, Blue Rubber Bleb Nevus Cowpox Infection, Human, Acropustulosis of Infancy, Syndrome, CREST Syndrome, Actinic Keratosis, Botanical Dermatology, Cronkhite-Canada Syndrome, Actinic Prurigo, Botulinum Toxin, Crouzon Syndrome, Actinic Purpura, Boutonneuse Fever, Cryotherapy, Actinomycosis, Bowen Disease, Cutaneous CD30 + (Ki-1) Acute Febrile Neutrophilic Bowenoid Papulosis, Anaplastic Large-Cell Lymphoma, Dermatosis, Branchial Cleft Cyst, Cutaneous Cholesterol Emboli, Acute Hemorrhagic Edema of Bromhidrosis, Cutaneous Columnar Cysts, Infancy, Brown Recluse Spider Bite, Cutaneous Cryptococcus, Addison Disease, Bruton Agammaglobulinemia, Cutaneous Ectopic Brain, Adiposis Dolorosa, Bullous Disease of Diabetes, Cutaneous Horn, Advancement Flaps, Bullous Disease of Dialysis, Cutaneous Kikuchi Disease, Ainhum, Bullous Pemphigoid, Cutaneous Larva Migrans, Albinism, Burns, Chemical, Cutaneous Laser Resurfacing: Albright Syndrome, Burns, Electrical, Carbon Dioxide, Alezzandrini Syndrome, Buruli Ulcer, Cutaneous Laser Resurfacing: Alopecia Areata, Calcinosis Cutis, Erbium: YAG, Alopecia Mucinosa, Calciphylaxis, Cutaneous Manifestations Amyloidosis, Lichen, Cancers of the Oral Mucosa, Following Exposures to Marine Amyloidosis, Macular, Candidiasis, Chronic Life, Amyloidosis, Nodular Localized Mucocutaneous, Cutaneous Manifestations of Cutaneous, Candidiasis, Cutaneous, Cholesterol Embolism, Amyloidosis, Primary Systemic, Candidiasis, Mucosal, Cutaneous Manifestations of Anagen Effluvium, Capillary Malformation, Hepatitis C, Anatomy in Cutaneous Surgery, Carney Syndrome, Cutaneous Manifestations of HIV Androgenetic Alopecia, Carotenemia, Disease, Anetoderma, Catscratch Disease, Cutaneous Manifestations of Angina Bullosa Hemorrhagica, Cellulitis, Smoking, Angioedema, Acquired, Chancroid, Cutaneous Melanoacanthoma, Angioedema, Hereditary, Chediak-Higashi Syndrome, Cutaneous T-Cell Lymphoma, Angioendotheliomatosis, Cheek Reconstruction, Cutaneous Tuberculosis, Angioimmunoblastic Cheilitis Glandularis, Cutis Laxa (Elastolysis), Lymphadenopathy With Cheilitis Granulomatosa Cutis Marmorata Telangiectatica Dysproteinemia, (Miescher-Melkersson-Rosenthal Congenita, Angiokeratoma Circumscriptum, Syndrome), Cutis Verticis Gyrata, Angiokeratoma Corporis Chemical Peels, Cylindroma, Diffusum (Fabry Syndrome), Chemotherapy-Induced Oral Dabska Tumor Angiokeratoma of the Scrotum, Mucositis, de Lange Syndrome, Angiolymphoid Hyperplasia with Cherry Hemangioma, Degos Disease, Eosinophilia, Chickenpox, Delusions of Parasitosis, Angioma Serpiginosum, CHILD Syndrome, Dengue, Animal Bites, Childhood HIV Disease, Denture Stomatitis, Aphthous Stomatitis, Chondrodermatitis Nodularis Dermabrasion, Aplasia Cutis Congenita, Helicis, Dermal Fillers, Apocrine Hidrocystoma, Chromhidrosis, Dermatitis Artefacta, Arcanobacterium Haemolyticum, Chromoblastomycosis Dermatitis Herpetiformis, Argyria, Chronic Granulomatous Disease Dermatofibroma, Arsenical Keratosis, Churg-Strauss Syndrome, Dermatofibrosarcoma Aspergillosis, (Allerqic Granulomatosis), Protuberans, Asteatotic Eczema, Cicatricial Pemphigoid, Dermatofibrosis Lenticularis Asymmetric Periflexural Clavus, (Buschke-Ollendorf Syndrome), Exanthem of Childhood, Closure of Complicated Wounds, Dermatologic Aspects of Ataxia-Telangiectasia, Clubbing of the Nails, Bioterrorism Agents, Atopic Dermatitis, Cobb Syndrome, Dermatologic Aspects of Atrophia Maculosa Varioliformis Coccidioidomycosis, Bioterrorism Agents, Anthrax, Cutis, Cockayne Syndrome, Dermatologic Manifestations of Atrophoderma of Pasini and Cold Panniculitis, Cardiac Disease, Pierini, Colloid Milium, Dermatologic Manifestations of Atypical Fibroxanthoma, Common Variable Gastrointestinal Disease, Atypical Mole (Dysplastic Nevus), Immunodeficiency, Dermatologic Manifestations of Atypical Mycobacterial Diseases, Complement Receptor Hematologic Disease, Avitaminosis A, Deficiency, Dermatologic Manifestations of Axillary Granular Parakeratosis, Complications of Dermatologic Neurologic Disease, Bacillary Angiomatosis, Laser Surgery, Dermatologic Manifestations of Digital Mucous Cyst, Florid Cutaneous Papillomatosis Pulmonary Disease, Digital Photography, Focal Dermal Hypoplasia Dermatologic Manifestations of Dilated Pore of Winer, Syndrome, Renal Disease, Disseminate and Recurrent Fogo Selvagem, Dermatology Internet Sites, Infundibular Folliculitis, Follicular Infundibulum Tumor, Dermatomyositis, Down Syndrome, Folliculitis, Dermatopathia Pigmentosa Drug Eruptions, Folliculoma, Reticularis, Drug-Induced Bullous Disorders, Forehead and Temple Dermatosis Papulosa Nigra, Drug-Induced Gingival Reconstruction, Dermoid Cyst, Hyperplasia, Fox-Fordyce Disease, Dermoscopy, Drug-Induced Photosensitivity, Friction Blisters, Desmoid Tumor, DiGeorge Drug-Induced Pigmentation, Frostbite, Syndrome, Drug-Induced Pseudolymphoma Gardner Syndrome Intertrigo Syndrome, Generalized Essential Jellyfish Stings Dupuytren Contracture, Telangiectasia Jessner Lymphocytic Infiltration Dyshidrotic Eczema, Geographic Tongue of the Skin Dyskeratosis Congenita, Gianotti-Crosti Syndrome Job Syndrome Dysmorphophobia, (Papular Acrodermatitis of Juvenile Xanthogranuloma Ear Reconstruction, Childhood) (Nevoxanthoendothelioma) Eccrine Carcinoma, Giant Condylomata Acuminata of Kaposi Sarcoma Eccrine Spiradenoma, Buschke and Lowenstein Kaposi Varicelliform Eruption Ecthyma, Glomus Tumor Kawasaki Disease Ecthyma Gangrenosum, Glucagonoma Syndrome Keloid and Hypertrophic Scar Ectodermal Dysplasia, Glycogen Storage Diseases Keratoacanthoma Ehlers-Danlos Syndrome, Types I-VII Keratosis Follicularis (Darier Elastofibroma, Gonococcemia Disease) Elastosis Perforans Graft Versus Host Disease Keratosis Palmaris et Plantaris Serpiginosum, Graham-Little-Piccardi-Lasseur Keratosis Pilaris Elejalde Syndrome, Syndrome Kimura Disease Endemic Syphilis, Gram-Negative Folliculitis Kindler Syndrome Enteroviral Infections, Gram-Negative Toe Web Klippel-Trenaunay-Weber Eosinophilia-Myalgia Syndrome, Infection Syndrome Eosinophilic Fasciitis, Granuloma Annulare Knuckle Pads Eosinophilic Pustular Folliculitis, Granuloma Faciale Kyrie Disease Eosinophilic Ulcer, Granuloma Gluteale Infantum Langerhans Cell Histiocytosis Ephelides (Freckles), Granuloma Inguinale Laser Revision of Scars Epidermal Inclusion Cyst, (Donovanosis) Laser Treatment of Acquired and Epidermal Nevus Syndrome, Granulosis Rubra Nasi Congenital Vascular Lesions Epidermodysplasia Verruciformis, Griscelli Syndrome Laser Treatment of Benign Epidermolysis Bullosa, Haberland Syndrome Pigmented Lesions Epidermolysis Bullosa Acquisita, Hair Transplantation Laser Treatment of Leg Veins Epidermolytic Hyperkeratosis Hair Transplantation: Follicular Laser-Assisted Hair Removal (Bullous Congenital Unit Transplant Method Laugier-Hunziker Syndrome Ichthyosiform Erythroderma), Hairy Tongue Lawrence-Seip Syndrome Epulis Fissuratum, Halo Nevus Leiomyoma Eruptive Vellus Hair Cysts, Halogenoderma Leishmaniasis Erysipelas, Hand-Foot-and-Mouth Disease Lentigo Erysipeloid, Handheld Computers in LEOPARD Syndrome Erythema Ab Igne, Dermatology Leprosy Erythema Annulare Centrifugum, Hartnup Disease Leukemia Cutis Erythema Dyschromicum Hemochromatosis Leukoplakia, Oral Perstans, Henoch-Schnlein Purpura Lice Erythema Elevatum Diutinum, (Anaphylactoid Purpura) Lichen Myxedematosus Erythema Gyratum Repens, Hermansky-Pudlak Syndrome Lichen Nitidus Erythema Induratum (Nodular Herpes Simplex Lichen Planus Vasculitis), Herpes Zoster Lichen Sclerosus et Atrophicus Erythema Infectiosum (Fifth Hidradenitis Suppurativa Lichen Simplex Chronicus Disease), Hirsutism Lichen Spinulosus Erythema Multiforme, Homocystinuria Lichen Striatus Erythema Nodosum, Human Bites Linear IgA Dermatosis Erythema Toxicum Neonatorum Human Herpesvirus 6 Lip Reconstruction Erythrasma, Hutchinson-Gilford Progeria Lipodystrophy, HIV Erythroderma (Generalized Hydroa Vacciniforme Lipodystrophy, Localized Exfoliative Dermatitis), Hypereosinophilic Syndrome Lipodystrophy, Progressive Erythrokeratodermia Variabilis, Hyperhidrosis Lipoid Proteinosis Erythroplasia of Queyrat (Bowen Hyperkeratosis Lenticularis Lipomas Disease of the Glans Penis), Perstans (Flegel Disease) Liposarcoma Erythropoietic Porphyria, Hyperkeratosis of the Nipple and Livedoid Vasculopathy Erythropoietic Protoporphyria, Areola Lobomycosis Essentials of Tissue Movement, Hypersensitivity Vasculitis Local Anesthesia and Regional Eumycetoma (Fungal Mycetoma), (Leukocytoclastic Vasculitis) Nerve Block Anesthesia Extracorporeal Photopheresis, Hypnosis: Applications in Loose Anagen Syndrome Extramammary Paget Disease, Dermatology and Dermatologic Lupus Erythematosus, Acute Familial Benign Pemphigus Surgery Lupus Erythematosus, Bullous (Hailey-Hailey Disease), Hypomelanosis of Ito Lupus Erythematosus, Discoid Favre-Racouchot Syndrome Ichthyosis Fetalis Lupus Erythematosus, Drug- (Nodular Elastosis with Cysts Ichthyosis Vulgaris, Hereditary Induced and Comedones), and Acquired Lupus Erythematosus, Subacute Favus, Ichthyosis, Lamellar Cutaneous Fibrodysplasia Ossificans, Ichthyosis, X-Linked Lupus Miliaris Disseminatus Fibrous Papule of the Face, Id Reaction (Autoeczematization) Faciei Filariasis, Idiopathic Guttate Lyme Disease Fire Ant Bites, Hypomelanosis Lymphangiectasia Fissured Tongue, Impetigo Lymphangioma Materials for Wound Closure Incontinentia Pigmenti Lymphocytoma Cutis Measles, Rubeola Infantile Digital Fibromatosis Lymphogranuloma Venereum Melanotic Neuroectodermal Infantile Hemangioma Lymphomatoid Papulosis Tumor of Infancy Insect Bites Maffucci Syndrome Melasma Insect Repellents Majocchi Granuloma Meningococcemia Interactive Teledermatology Malakoplakia Menkes Kinky Hair Disease Oral Examination Malignant Melanoma Merkel Cell Carcinoma Oral Fibromas and Fibromatoses Mastocytosis Metastatic Carcinoma of the Skin Oral Florid Papillomatosis Postinflammatory Metastatic Neoplasms to the Oral Frictional Hyperkeratosis Hyperpigmentation Oral Cavity Oral Granular Cell Tumors Preauricular Sinuses Microcystic Adnexal Carcinoma Oral Hemangiomas Premalignant Fibroepithelial Milia Oral Lichen Planus Tumor (Pinkus Tumor) Miliaria Oral Lymphangiomas Preoperative Evaluation and Milker's Nodules Oral Malignant Melanoma Management Mixed Connective Tissue Oral Manifestations of Pretibial Myxedema Disease Autoimmune Blistering Diseases Proliferating Pilar Tumor Mohs Micrographic Surgery Oral Manifestations of Drug Protein-Energy Malnutrition Moisturizers Reactions Proteus Syndrome Molluscum Contagiosum Oral Manifestations of Systemic Protothecosis, Cutaneous Mondor Disease Diseases Prurigo Nodularis Mongolian Spot Oral Melanoacanthoma Pruritic Urticarial Papules and Monilethrix Oral Neurofibroma Plaques of Pregnancy Monkeypox Oral Nevi Pruritus and Systemic Disease Morphea Oral Pyogenic Granuloma Pseudo-Kaposi Sarcoma Mucocele and Ranula Oral Submucous Fibrosis (Acroangiodermatitis) Mucopolysaccharidoses Types I- Orf Pseudoatrophoderma Colli VII Osler-Weber-Rendu Syndrome Pseudocyst of the Auricle Mucous Cyst Osteoma Cutis Pseudofolliculitis of the Beard Muehrcke Lines of the Outpatient Surgical Suite Pseudolymphoma, Cutaneous Fingernails Pachydermoperiostosis Pseudomonas Folliculitis Muir-Torre Syndrome Pachyonychia Congenita Pseudopelade, Brocq Multicentric Reticulohistiocytosis Paget Disease, Mammary Pseudoporphyria Multinucleate Cell Papular Urticaria Pseudoxanthoma Elasticum Angiohistiocytoma Papulonecrotic Tuberculids Psoriasis, Guttate Multiple Endocrine Neoplasia Paraneoplastic Diseases Psoriasis, Nails Type 1 Parapsoriasis Psoriasis, Plaque Mycetoma Paronychia Psoriasis, Pustular Mycobacterium Avium- Pearly Penile Papules Psoriatic Arthritis Intracellulare Infection Pedicle/lnterpolation Flaps Pulp Polyp Mycobacterium Marinum Pellagra Punch Biopsy and Scalpel Infection of the Skin Pemphigoid Gestationis Biopsy Naegeli-Franceschetti- Pemphigus Erythematosus Pyoderma Gangrenosum Jadassohn Syndrome Pemphigus Foliaceus Pyoderma Vegetans Nail Cosmetics Pemphigus Herpetiformis Pyogenic Granuloma (Lobular Nail Surgery Pemphigus Vulgaris Capillary Hemangioma) Nail-Patella Syndrome Pemphigus, Drug-Induced Reactive Arthritis Nasal Reconstruction Pemphigus, IgA Reactive Perforating Nasopalatine Duct Cyst Pemphigus, Paraneoplastic Collagenosis Necrobiosis Lipoidica Penile Squamous Cell Refsum Disease Necrolytic Acral Erythema Carcinoma Relapsing Polychondritis Necrotizing Fasciitis Perforating Folliculitis Reticulate Pigmented Anomaly Necrotizing Sialometaplasia Perifolliculitis Capitis Abscedens Rhinoscleroma Neonatal Lupus Erythematosus Et Suffodiens Riehl Melanosis Nephrogenic Fibrosing Perioral Dermatitis Rocky Mountain Spotted Fever Dermopathy Peripheral Giant Cell Granuloma Rosacea Neurilemoma Pernio Roseola Infantum Neurofibromatosis Peyronie Disease Rotation Flaps Neurotic Excoriations Phenylketonuria Rothmund-Thomson Syndrome Neutrophilic Eccrine Hidradenitis Photodynamic Therapy for the Rubella Nevi of Ota and Ito Dermatologist Rubinstein-Taybi Syndrome Nevi, Melanocytic Phytophotodermatitis Rud Syndrome Nevoid Basal Cell Carcinoma Piebaldism Sarcoidosis Syndrome Piedra Scabies Nevus Anemicus Piezogenic Pedal Papules Scalp Reconstruction Nevus Araneus (Spider Nevus) Pigmented Purpuric Dermatitis Scar Revision Nevus Comedonicus Pilar Cyst Scarlet Fever Nevus Sebaceus Pilomatrixoma Schnitzler Syndrome Nicotine Stomatitis Pitted Keratolysis Scleredema Niemann-Pick Disease Pityriasis Alba Sclerema Neonatorum Nijmegen Breakage Syndrome Pityriasis Lichenoides Scrub Typhus Nocardiosis Pityriasis Rosea Scurvy Nonablative Resurfacing Pityriasis Rotunda Seabather's Eruption Noncandidal Fungal Infections of Pityriasis Rubra Pilaris Sebaceous Adenoma the Mouth Pityrosporum Folliculitis Sebaceous Carcinoma Nonlaser Hair Removal Plantar Fibromatosis Sebaceous Hyperplasia Techniques POEMS Syndrome Seborrheic Dermatitis Nummular Dermatitis Poikiloderma of Civatte Seborrheic Keratosis Ochronosis Polymorphous Light Eruption Severe Combined Onchocerciasis (River Porokeratosis Immunodeficiency Blindness) Poroma Sign of Leser-Trelat Onycholysis Porphyria Cutanea Tarda Sjogren Syndrome Onychomycosis Urticaria, Cholinergic Sjogren-Larsson Syndrome Oral Brush Biopsy With Urticaria, Chronic Skin and Hair Cleansers Computer-Assisted Analysis Urticaria, Contact Syndrome Skin Grafting Oral Cutaneous Fistulas Urticaria, Dermographism Skin Lightening and Smokeless Tobacco Lesions Urticaria, Pressure Depigmenting Agents Smoker's Melanosis Urticaria, Solar Smallpox South American Blastomycosis Urticarial Vasculitis Transposition Flaps Speckled Lentiginous Nevus Varicose Vein Treatment with Traumatic Ulcers Spitz Nevus Endovenous Laser Therapy Trichilemmoma Sporotrichosis Varicose Veins and Spider Veins Trichoepithelioma Squamous Cell Carcinoma Varicose Veins Treated with Trichofolliculoma Staphylococcal Scalded Skin Ambulatory Phlebectomy Trichomycosis Axillaris Syndrome Varicose Veins Treated with Trichomycosis Pubis Stasis Dermatitis Radiofrequency Ablation Trichorrhexis Invaginata Steatocystoma Multiplex Therapy (Netherton Syndrome or Stevens-Johnson Syndrome and Variegate Porphyria Bamboo Hair) Toxic Epidermal Necrolysis Venous Insufficiency Trichorrhexis Nodosa Stewart-Treves Syndrome Venous Lakes Trichostasis Spinulosa Store-and-Forward Verruciform Xanthoma Trichotillomania Teledermatology Verrucous Carcinoma Tuberous Sclerosis Striae Distensae Vesicular Palmoplantar Eczema Tufted Angioma Strongyloidiasis Vibrio Vulnificus Infection Tufted Hair Folliculitis Stucco Keratosis Viral Hemorrhagic Fevers Tumescent Liposuction Subacute Nodular Migratory Viral Infections of the Mouth Tungiasis Panniculitis (Vilanova Disease) Vitiligo Ulerythema Subcorneal Pustular Dermatosis Vogt-Koyanagi-Harada Unilateral Nevoid Telangiectasia Subcutaneous Fat Necrosis of Syndrome Urticaria, Acute the Newborn Vohwinkel Syndrome Transient Neonatal Pustular Sunscreens and Photoprotection Waardenburg Syndrome Melanosis Supernumerary Digit Warts, Genital Tinea Corporis Supernumerary Nipple Warts, Nongenital Surgical Complications Warty Dyskeratoma Surgical Dressings Wegener Granulomatosis Suturing Techniques Wells Syndrome (Eosinophilic Syphilis Cellulitis) Syringoma Werner Syndrome Systemic Sclerosis Winchester Syndrome Targetoid Hemosiderotic Wiskott-Aldrich Syndrome Hemangioma Xanthomas Tattoo Lasers Xeroderma Pigmentosum Tattoo Reactions Yaws Teledermatology Tinea Cruris Telogen Effluvium Tinea Faciei Temporal (Giant Cell) Arteritis Tinea Nigra The Role of Antibiotics in Tinea Pedis Cutaneous Surgery Tinea Versicolor The Role of Sentinel Node Tooth Discoloration Biopsy in Skin Cancer Toxic Shock Syndrome Thermal Burns Traction Alopecia Thrombophlebitis Transient Acantholytic Tinea Barbae Dermatosis Tinea Capitis

Example 4

[0242] A potential therapeutic effect of MDPK67b (rACT.sub.6.7) on skin diseases has been tested on a Netherton syndrome mouse model as a topical application.

Trial Design

[0243] The molecule has been formulated at 2 mg/ml in NATROSOL (hydroxyethylcellulose (HEC)) 2% (w/v). The formulation has been chosen following in vitro diffusion criteria retaining MDPK67b inhibition property over trypsin (surrogate in vitro substrate). MDPK67b 2 mg/ml, prepared as a solution, is formulated in 2% NATROSOL (hydroxyethylcellulose (HEC)) (w/v), PBS1 pH7.4 at 4 C. under slow agitation to prevent molecule shearing. The preparation is carefully homogenized under stirring at 4 C. to ensure proper inhibitor repartition within the hydrogel. NATROSOL (hydroxyethylcellulose (HEC)) has to be added as a powder to MDPK67b solution to avoid clumps and to allow a homogenous formulation without shearing.

[0244] To maintain sterility the solutions are autoclaved or filtered through a 0.22 u filter. [0245] MDPK67b 2 mg/ml/Hydroxyethylcellulose formulation contains 4 mg MDPK67b, 2 ml PBS1 pH7.4 and 0.04 g NATROSOL (hydroxyethylcellulose (HEC)). The formulation is then stored at 4 C. or lyophilized overnight and stored at 20 C. Protease inhibition properties of MDPK67b are tested in vitro upon formulation before in vivo use.

[0246] MDPK67b potential therapeutic effect has been assessed on a group of 12 transgenic KLK5 mice with different lesion grade severity, starting from a low severity grade (grade 1) to a more severe grade (grade 4) (FIG. 30). Group 1 has been treated once per day with 0.3 ml of vehicle, 2% NATROSOL (hydroxyethylcellulose (HEC)) and group 2 once per day with 0.3 ml of MDPK67b formulated at 2 mg/ml in 2% NATROSOL (hydroxyethylcellulose (HEC)) over 28 days. This time period corresponds to two epiderma renewals in the mouse model. Mice have been monitored for changes in lesion grade and lesion size phenotypes. Lesion size has been measured every 3 days and lesion grade was monitored daily

Results (FIG. 31)

[0247] Comparison of the development of skin lesions on KLK5 transgenic mice of MDPK67b treated versus non-treated mice showed a decrease of lesion sizes within the MDPK67b group (group 2) compared to vehicle group (group 1). Whereas lesion sizes increased in a majority of the vehicle control group, the majority of the MDPK67b treated group showed a decrease in lesion size. A clear size increase was observed in 3 test animals of group1 and 1 within group 2. A slight lesion size increase was observed 1 animal of group 2. No change was reported in 1 animal of group 1. A decrease in lesion size was observed in 1 test animals of group1 and 3 within group 2. The protective effect seems larger in mice with low grade symptoms.

TABLE-US-00023 TABLE XXI Group 1 Group 2 Lesion size evolution (control) (MDPK67b) evolution 3 1 slight evolution 0 1 stable 1 0 decrease 1 3

[0248] Lesion grade development was also positively affected by topical application of MDPK67b. One MDPK67b treated test animal showed a complete reversion of the phenotype. A partial reversion was seen on a second MDPK67b treated animal. The protective effect seems larger in mice with low grade symptoms.

REFERENCE LIST

[0249] Barrett. In: Proteinase Inhibitors. Ed. Barrett, A. J. et al, Elsevier, Amsterdam, pages 3-22 (1986) [0250] Blasi. In: Human Genes and Diseases. Ed. Blasi, F., John Wiley & Sons, Ltd., pages 377-414 (1986) [0251] Borgono et al. Cancer Res. 63, 9032-9041 (2003) [0252] Borgono et al. J. Biol. Chem 282(6):3640-52 (2007) [0253] Brattsand and Egelrud. J. Biol. Chem. 274, 30033-40 (1999) [0254] Brattsand et al. J Invest Dermatol. 124, 198-203 (2005) [0255] Carrell et al. Trends Biochem Sci. 10:20-24 (1985) [0256] Carrell et al. Cold Spring Harbor Symp Quant Biol. 52:527-35 (1987) [0257] Caubet et al. J. Invest Dermatol. 122, 1235-1244 (2004) [0258] Chavanas et al. Nat. Genet. 25, 141-142 (2000) [0259] Cloutier et al. Eur J Biochem 271, 607-613 (2004) [0260] Cloutier et al. Eur J Biochem. 269, 2747-2754 (2002) [0261] Cooley et al. Biochemistry 40, 15762-70 (2001) [0262] Deraison et al. Mol Biol Cell. 18(9):3607-19 (2007). [0263] Descargues et al. J Invest Dermatol. 126(7):1622-32 (2006) [0264] Descargues et al. Nat Genet. 37(1):56-65 (2005) [0265] Egelrud et al. Br. J. Dermatol. 153, 1200-1203(2005) [0266] Ekholm and Egelrud. Arch Dermatol Res. 291, 195-200. (1999) [0267] Felber et al. Biol Chem. 386(3):291-8 (2005) [0268] Felber et al. Biotechniques 36, 878-885 (2004) [0269] Felber et al. FEBS J. 273(11):2505-14 (2006) [0270] Frenette et al. Biochim Biophys Acta 1334, 109-115 (1997) [0271] Frenette et al. J Urol 159, 1375-8 (1998) [0272] Gerard et al. Mol Biol Med. 2:449-457 (1986) [0273] Hachem et al. J. Invest Dermatol. 126, 1609-1621 (2006) [0274] Hansson et al. J. Biol. Chem. 269, 19420-19426 (1994) [0275] Hansson et al. J. Invest Dermatol. 118, 444-449. (2002) [0276] Huang et al. Oncol Res. 14, 387-397. (2004). [0277] Hunt and Dayhoff. Biochem Biophys Res Commun. 95(2):864-71 (1980) [0278] Kapadia. Clin Chem 49, 77-86 (2003) [0279] Ketcham et al. In: Atlas of Protein Sequence and Structure. Ed. Dayhoff, pages 131-143 (1978) [0280] Kishi et al. Clin Chem 49, 87-96 (2003) [0281] Kishibe et al. J. Biol. Chem. 282(8):5834-41 (2007) [0282] Komatsu et al. Br. J. Dermatol. 153, 274-281 (2005) [0283] Komatsu et al. J. Invest Dermatol. 118, 436-443. (2002) [0284] Komatsu et al. J. Invest Dermatol. 125, 1182-1189. (2005) [0285] Komatsu et al. J. Invest Dermatol. 126, 2338-2342. (2006) [0286] Kraut et al. Z Physiol Chem 192: 1-21 (1930) [0287] Laemmli Nature 227, 680-5 (1970) [0288] Laskowski et al. Annu Rev Biochem. 49:593-626 (1980) [0289] Laskowski et al. Cold Spring Harbor Symp Quant Biol. 545-553 (1987) [0290] Levin et al. Proc Natl Acad Sci USA. 80:6804-6808 (1983) [0291] Little et al. J Biol Chem 272, 25135-25142 (1997) [0292] Lowman et al. Biochemistry 12, 10832-8 (1991) [0293] Luo et al. Clin. Chem. 47, 237-246 (2001) [0294] Mahajan et al. Chem Biol 6, 401-9 [0295] Mitra et al. Gene 173, 13-17 (1996) [0296] Mize et al. Mol Cancer Res. 6(6):1043-51. 2008 [0297] Morrison and Walsh. Adv Enzymol Relat Areas Mol Biol 61, 201-301 (1988) [0298] Nin et al. J Dermatol Sci. 2008 (2008). [0299] Oikonomopoulou et al. J. Biol. Chem. 281, 32095-32112. (2006). [0300] Paine et al. J. Invest. Dermatol. 116, 587-595. (2001). [0301] Papamokos et al. J Mol Biol. 158(3):515-37 (1982) [0302] Potempa et al. J Biol Chem. 269(23):15957-60 (1994) [0303] Read, R. J. et al, In: Proteinase Inhibitors. Ed. Barrett, Elsevier, Amsterdam, pages 301-336 (1986) [0304] Remold-O'Donnell. FEBS Lett. 315(2):105-8 (1993) [0305] Shimizu et al. J Biol Chem 273, 11189-11196 (1998) [0306] Smith and Scott. Methods Enzymol. 217, 228-57 (1993) [0307] Sommer et al. Biochemistry. 26(20):6407-10 (1987) [0308] Sondell et al. J. Invest Dermatol. 104, 819-823. (1995) [0309] Sprecher et al. J. Invest Dermatol. 117, 179-187(2001) [0310] Sprengers et al. Blood. 69(2):381-7 (1987) [0311] Stefansson et al. Biol. Chem. 387, 761-768 (2006) [0312] Stefansson et al. J Invest Dermatol. 128(1):18-25 (2008) [0313] Stump et al. J Biol Chem. 261(27):12759-66 (1986) [0314] Suzuki et al. J Biol Chem. 262(2):611-6 (1987) [0315] Travis et al. Annu Rev Biochem. 52:655-709 (1983) [0316] Vandell et al. J Neurochem. 107(3):855-70 (2008) [0317] Voegeli et al. Int. J. Cosm. Sci. 29, 191-200. (2007). [0318] Werle. Biochem Z. 269:415-34. [0319] Yamasaki et al. LFASEB J. 20, 2068-2080. (2006) [0320] Yousef et al. Cancer Res 63, 3958-3965 (2003)