DESIGNER alpha 6-FUCOSIDASE MUTANTS ENABLE DIRECT CORE FUCOSYLATION OF INTACT N-GLYCOPEPTIDES AND N-GLYCOPROTEINS
20190185898 ยท 2019-06-20
Assignee
Inventors
Cpc classification
C12N9/2402
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides for novel fucosidase mutants that server as fuco-ligases for core fucosylation of a range of biological glycopeptides and glycoproteins including intact therapeutic antibodies. Several mutants with mutation at the general acid/base residue E274 of the Lactobacillus casei 1,6-fucosidase, including E274A, E274S, and E274G, were able to efficiently fucosylate a wide variety of complex N-glycopeptides and intact glycoproteins. The site specific mutants enable the transfer of fucose to a core GlcNAc-Asn residue and useful for drug delivery and vaccine development.
Claims
1. A catalytic method for fucosylating a N-glycopeptide or N-glycoprotein, the method comprising: providing a GlcNAc containing peptide, protein, or other glycans as an GlcNAc acceptor (acceptor substrate); providing an activated glycosyl donor for access to a sugar fucose; and providing an 1,6-fucosidase mutant enzyme for enzymatically transfucosylating the GlcNAc acceptor with the sugar fucose, wherein the 1,6-fucosidase mutant enzyme is a Lactobacillus casei -fucosidase mutant, thereby synthesizing a fucosylated glycopeptide or glycoprotein.
2. The catalytic method according to claim 1, wherein the activated glycosyl donor is selected from the group consisting of -fucosyl fluoride FucF, -fucosyl chloride, -fucosyl azide, 4-nitrophenyl -fucoside, 3-nitrophenyl -fucoside, 3,4-dinitrophenyl -fucoside, and 4-methylumbelliferyl -fucoside.
3. The catalytic method according to claim 1, wherein 1,6-fucosidase mutant enzyme is selected from the group comprising E274A, E274S, E274G, E274T, E274C, E274I, E274L, E274M, E274F, E274W, E274Y and E274V or mutants having at least 90% homology thereof with fucosylating activity and derived from Lactobacillus casei fucosidase (AlfC).
4. The catalytic method according to claim 1, wherein 1,6-fucosidase mutant enzyme is selected from a group comprising E274A (SEQ ID NO: 1), E274S (SEQ ID NO: 2) and E274G (SEQ ID NO:3) derived from Lactobacillus casei -fucosidase (SEQ ID NO: 4).
5. The catalytic method according to claim 4, further comprising CPD and HIS (SEQ ID NO: 31) or CPD (SEQ ID NO. 30).
6. A chemoenzymatic method for the preparation of homogeneous fucosylated glycopeptides or glycoproteins, comprising: providing an nonfucosylated glycopeptide or glycoprotein acceptor; and reacting the nonfucosylated glycopeptide or glycoprotein acceptor with a donor substrate including an activated fucose containing moiety, in the presence of a Lactobacillus casei 1-6-fucosidase E274 mutant protein or fragment thereof that includes the catalytic domain and exhibits increased transfucosylation and reduced hydrolytic activity relative to the wild type 1-6-fucosidase E274 enzyme to transfer the activated fucose containing moiety to the nonfucosylated glycopeptide or glycoprotein acceptor and yielding the homogeneous fucosylated glycopeptides or glycoproteins.
7. The chemoenzymatic method according to claim 6, the homogeneous glycopeptides and glycoproteins include glycans attached to peptides or proteins selected from high mannose type, sialylated and asialo-complex type, hybrid type and their analogs.
8. The chemoenzymatic method according to claim 6, wherein the nonfucosylated glycopeptides or glycoproteins acceptors may include one or more Asn(asparagine)-linked GlcNAc moieties or more N-glycan sites, thus allowing introduction of one or multiple core fucoses.
9. The chemoenzymatic method according to claim 6, wherein the glycoproteins or glycoproteins are selected from a group of antibodies comprising 17b, 48d, A32, C11, 2G12, F240, IgG1b12, 19e, X5, TNX-355, cetuximab, rituximab, muromonab-CD3, abciximab, daclizumab, basiliximab, palivizumab, infliximab, trastuzumab, gemtuzumab ozogamicin, alemtuzumab, ibritumomab tiuxetan, adalimumab, omalizumab, tositumomab, 1131 tositumomab, efalizumab, bevacizumab, panitumumab, pertuzumab, natalizumab, etanercept, IGN101, volociximab, Anti-CD80 mAb, Anti-CD23 mAb, CAT-3888, CDP-791, eraptuzumab, MDX-010, MDX-060, MDX-070, matuzumab, CP-675,206, CAL, SGN-30, zanolimumab, adecatumumab, oregovomab, nimotuzumab, ABT-874, denosumab, AM 108, AMG 714, fontolizumab, daclizumab, golimumab, CNTO 1275, ocrelizumab, HuMax-CD20, belimumab, epratuzumab, MLN1202, visilizumab, tocilizumab, ocrerlizumab, certolizumab pegol, eculizumab, pexelizumab, abciximab, ranibizimumab, mepolizumab and MYO-029.
10. The chemoenzymatic method according to claim 6, wherein the activated fucose containing moiety is selected from the group consisting of -fucosyl fluoride FucF, -fucosyl chloride, -fucosyl azide, 4-nitrophenyl -fucoside, 3-nitrophenyl -fucoside, 3,4-dinitrophenyl -fucoside, and 4-methylumbelliferyl -fucoside.
11. The chemoenzymatic method according to claim 6, wherein the Lactobacillus casei 1-6-fucosidase E274 mutant protein or fragment thereof is selected from the group comprising E274A, E274S, E274G, E274T, E274C, E274I, E274L, E274M, E274F, E274W, E274Y and E274V or mutants having at least 90% homology thereof with fucosylating activity and derived from Lactobacillus casei fucosidase (AlfC).
12. The chemoenzymatic method according to claim 6, wherein of a Lactobacillus casei 1-6-fucosidase E274 mutant protein or fragment thereof is selected from a group comprising E274A (SEQ ID NO: 1), E274S (SEQ ID NO: 2) and E274G (SEQ ID NO:3) derived from Lactobacillus casei -fucosidase (SEQ ID NO: 4).
13. The chemoenzymatic method according to claim 12, further comprising CPD and HIS (SEQ ID NO: 31) or CPD (SEQ ID NO. 30).
14. An Enzymatic fucosylated glycopeptide synthesized by the methods of claim 13 and used as biomarkers for cancer and/or other diseases in the testing of drugs to determine efficiency.
15. A method of treatment using a remodeled antibody having a desired fucosylation state prepared according to claim 6 in an amount sufficient to modulate biological activity in a treated subject.
16. A kit comprising a least one Lactobacillus casei -fucosidase mutant selected from the group consisting of E274A (SEQ ID NO: 1), E274S (SEQ ID NO: 2) and E274G (SEQ ID NO: 3).
17. (canceled)
18. A mutated 1-6-fucosidase enzyme selected from the group consisting of E274A (SEQ ID NO: 1), E274S (SEQ ID NO: 2) and E274G (SEQ ID NO: 3).
19. (canceled)
Description
BRIEF DESCRIPTION OF THE FIGURES
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
DETAILED DESCRIPTION OF THE INVENTION
[0054] The present invention described herein is for novel fucosidase mutants that serve as fuco-ligases for core fucosylation of a range of biologically important glycopeptides and glycoproteins including intact therapeutic antibodies. Previously, there was no general method that can perform direct core-fucosylation of mature complex glycoproteins. The natural 1,6-fucosyltransferases can only glycosylate limited intermediate N-glycan during biosynthesis and cannot add fucose to mature complex glycoproteins. The present invention solves a long-standing problem for direct enzymatic core-fucosylation of synthetic glycopeptides and recombinant glycoproteins. This invention also includes a series of fucosidase mutants including E274A, E274S and E274G, derived from Lactobacillus casei -(1,6)-fucosidase (AlfC). These site-specific mutants enable the transfer of fucose from simple synthetic substrate -fucosyl fluoride to the core GlcNAc-Asn residue in complex glycopeptides and glycoproteins including antibodies. Since core-fucosylation of glycoproteins is important for cancer progression and metastasis, and is critical for antibody effector functions, the present invention has wide applications for drug discovery and vaccine development.
[0055] The present invention provides for generating generate glycosidase mutants capable of using simple glycosyl donors for direct core-fucosylation of intact N-glycopeptides and N-glycoproteins, which could not be achieved by the catalysis of the biosynthetic -1,6-fucosyltransferase (FUT8) because of its strict substrate specificity. To create such enabling mutants, two general glycosidase engineering strategies have been attempted. One is the glycosynthase concept through site-directed mutagenesis at the critical nucleophilic residue of a retaining glycosidase to generate a mutant that is devoid of hydrolysis activity but can take an activated glycosyl donor (usually a glycosyl fluoride) with an opposite anomeric configuration for transglycosylation.sup.36-38. Glycosynthases derived from several GH family glycosidases have been successfully created using this strategy.sup.39-43. The other is the glycoligase approach, first developed by Withers and co-workers, in which the general acid/base residue of a retaining glycosidase is mutated to eliminate the hydrolysis activity, and the enzymatic transglycosylation is enabled by using an activated glycosyl donor with the same anomeric configuration.sup.44-47. For -glycosynthases derived from the corresponding retaining -glycosidases, the readily synthesized and relatively stable -glycosyl fluorides have become the common glycosyl donors.sup.39,40 However, the evaluation of the transglycosylation activity of potential -fucosynthases usually requires the -fucosyl fluoride, which is quite unstable in aqueous solution and will be hydrolyzed spontaneously with a half-life of ca. 20 min.sup.48. Previously several 1,2- and 1,3-1,4-fucosynthases have been generated from the Bifidobacterium bifidum -L-fucosidases and examined for enzymatic transfucosylation of glycoconjuagtes, but the dependence on the use of the highly unstable -glycosyl fluoride renders these mutants less attractive for synthetic purpose.sup.48-51. As an alternative approach, Moracci and co-workers have shown that the stable -fucosyl azide could serve as a glycosyl donor for the -fucosynthases derived from the hyperthermophilic archaeon Sulfolobus solfataricus -L-fucosidase.sup.52. This -glycosyl azide was also successfully applied as a substrate for an -galactosynthase.sup.53,54.
[0056] Despite these successes, no 1,6-fucosynthase or any -fucoligase has been reported so far. To explore this possibility, the present invention was started by choosing the 1,6-fucosidase from Lactobacillus casei (AlfC) as the model enzyme, which was shown to hydrolyze specifically 1,6-fucosidic linkage.sup.55 and was recently reported to have transglycosylation activity, capable of making Fuc1,6GlcNAc disaccharide, using p-nitrophenyl -fucoside as the donor substrate and GlcNAc as the acceptor.sup.56,57. Nevertheless, the wild type enzyme also hydrolyzes the disaccharide product rapidly leading to low synthetic efficiency. Moreover, it has been unclear if this enzyme could act on more complex substrates for transglycosylation other than a simple GlcNAc substrate. Thus, the present design is to generate potential glycosynthase and glycoligase mutants from the Lactobacillus casei 1,6-fucosidase, and to test their ability to core-fucosylate various acceptor substrates (
[0057] Alignment of Amino Acid Sequence with GH29 -Fucosidases.
[0058] GH29 retaining -L-fucosidases catalyze the removal of non-reducing terminal L-fucose residues in the 1,2, 1,3, 1,4, or 1,6-glycosidic linkages in oligosaccharides and glycoconjugates. In order to determine the key catalytic residues of AlfC -fucosidase, several -fucosidases belonging to the GH29 family were chosen in alignment of amino acid sequences, due to their distinct substrate specificities and positions of the two catalytic residues clarified in previous reports.sup.58-61. The results were shown in
[0059] Generation of Potential -Fucosidase-Based Glycosynthases and Glycoligases.
[0060] Following the glycosynthase concept proposed by Withers and co-workers.sup.36, site-directed mutagenesis was performed at the identified nucleophile in the AlfC 1,6-fucosidase, D200, to generate selected mutants, including D200G, D200S, D200A, and D200S. Similarly, selected mutants at the putative general acid/base residue, E274, were generated to provide potential glycoligases, including E274A, E274S, E274G, and E274D (Table 1 provides the primer pairs for such mutant SEQ ID NO: 14 to 29). These mutants were expressed as a fusion protein with a C-terminal Vibrio cholera MARTX toxin cysteine protease domain (CPD) carrying a 10His tag (SEQ ID NO: 31), as previous experiments have demonstrated that the CPD tag (SEQ ID NO: 30) can enhance the solubility and stability of recombinant proteins.sup.63-66. All these mutants were efficiently expressed in E. coli with a relatively high yield (more than 40 mg/L) and were readily purified by Nickel-NTA affinity chromatography.sup.63. The hydrolysis activity of these mutants was tested together with wild type AlfC using p-nitro -fucoside (pNPFuc) as the substrate. As expected, all these mutants, except E274D, showed only trace residual hydrolysis activity due to the mutations at the critical residues, while (
[0061] Assessment of the Mutants as Potential Glycosynthases or Glycoligases.
[0062] Initially, the D200 mutants were examined as potential glycosynthases using two types of activated fucosyl donors with opposite anomeric configuration as substrates. For nucleophile mutant such as D200G, a fucosyl fluoride with reversed anomeric configuration, -fucosyl fluoride or -fucosyl azide, should be applied to mimic the enzyme-substrate intermediate.sup.52,53,67. However, -glycosyl fluorides are quite unstable and are subjected to spontaneous hydrolysis in aq. solutions.sup.42. Indeed, most successful glycosynthases have been derived so far from retaining -glycosidases that take the -glycosyl fluoride as donor substrate. To overcome this problem, 2-deoxy-2-fluoro--fucosyl fluoride (2) was synthesized as a more stable substrate (
[0063] Next, the potential glyco-ligase activity was tested of the general acid/base residue mutants using the -fucosyl fluoride (3) as the donor substrate (
[0064] The structure of 5 was confirmed by ESI-MS (calculated, M=703.3 Da; found, 704.5 [M+H].sup.+) and .sup.1H-.sup.1H COS Y NMR (
[0065] Interestingly, it was observed that in the absence of the GlcNAc acceptor, the AlfC mutants (E274A, E274G, and E274S) only hydrolyzed -fucosyl fluoride slowly but the wild type AlfC could quickly hydrolyze the donor substrate. Taken together, these results indicated that the AlfC mutants represented a class of unique O-fucoligase for core-fucosylation, which could use synthetic -fucosyl fluoride as the simple donor substrate instead of the expensive GDP-fucose as the substrate in the case of -fucosyltransferase. To examine whether the fused CPD domain in the enzyme played a role in catalyzing fucosylation, the CPD tag was removed in the AlfC E274A mutant by using inositol hexaphosphate (
[0066] Kinetic studies were also performed on the mutants and the results were summarized in Table 2 and
[0067] Direct Core-Fucosylation of Various GlcNAc-Peptides.
[0068] The discovery that the E274A and related mutants were able to efficiently catalyze the trans-fucosylation on the GlcNAc-Asn derivative prompted us to test if the mutants could also fucosylate GlcNAc moiety in the context of polypeptides. Three distinct GlcNAc-containing peptides were chosen for the test: the hexapeptide (6) derived from the sialylglycopeptide (SGP) isolated from egg yolks, a 19-mer GlcNAc-peptide (8) that consisting of the CD52 antigen and a sortase A signal peptide sequence, and a potent HIV inhibitor GlcNAc-C34 (10) derived from the HIV-1 gp41 envelope glycoprotein.sup.70.
[0069] It was found that the E274A could transfer a fucose moiety to all the three GlcNAc-peptides to form the corresponding fucosylated peptides (7, 9, and 11), respectively (
[0070] Direct Core Fucosylation of Intact N-Glycopeptides.
[0071] Next, the feasibility was tested of E274A-catalyzed directed core-fucosylation of intact N-glycopeptides carrying a full-size N-glycan. Several complex N-glycopeptides (12, 14, 16, and 18) carrying a sialylated biantennary complex type N-glycan were used as potential acceptor substrates, including a large cyclic HIV-1 V3 glycopeptide (18). Surprisingly, the E274 mutant could efficiently add a core fucose to the intact N-glycopeptides to give the corresponding core-fucosylated N-glycopeptides (13, 15, 17, and 19), respectively in excellent yields (
[0072] To verify that the fucose was specifically added to the innermost GlcNAc moiety in the glycopeptide, the isolated glycopeptide product (15) was treated with two specific hydrolytic enzymes PNGase F and Endo-F3 that hydrolyze N-glycopeptides and N-glycoproteins. PNGase F completely removes the N-glycans from N-glycopeptides by hydrolyzing the amide linkage between asparagine and the N-glycans, while Endo-F3 specifically cleaves at the 1,4-glycosidic bond between the two GlcNAc moieties in N-glycopeptides/proteins. ESI-MS analysis indicated that treatment of 15 with PNGase F efficiently converted 15 into a single peptide species that was corresponding to the free polypeptide without any sugar attached (Calcd for the plain polypeptide, M=1848.75 Da; found, M=1848.83 Da) (
[0073] Direct Core Fucosylation of Intact Glycoproteins.
[0074] The success in direct core-fucosylation intact glycopeptides by the glycoligase mutants encouraged us to also test the direct core-fucosylation of intact N-glycoproteins. Thus, bovine ribonuclease B (RNase B, 20) was chosen, a natural glycoprotein with heterogeneous high-mannose type N-glycan, as a model system to investigate whether this engineered enzyme was capable of fucosylating the natural glycoprotein. RNase B is a good model for the study of protein glyco-remodeling, as it has only a single N-glycosylation site, N34, located around the cleft of the spheroidal protein. The N-glycans on natural RNase B are a mixture of high mannose type from five to nine mannose residues. Firstly, it was examined whether the E274A mutant could perform direct core-fucosylation on the glycoform mixtures and, if yes, whether the mutant showed any selectivity on the N-glycans of different size. Thus, RNase B (20) was incubated with 3 and the E274A mutant at 37 C. (a lower temperature to prevent protein denaturation). The reaction was monitored with LC-MS. To calculate the reaction yields, glycans were cleaved from the protein with PNGase F and then detected and quantitated with HPLC after Fmoc-labelling (See experimental section).sup.71. It was found that RNase B (20) could serve as an acceptor substrate of AlfC E274A for core-fucosylation (
[0075] Since the direct core-fucosylation of RNase B was less efficient, an alternative approach was tested that consists of deglycosylation, glycoligase-catalyzed core-fucosylation, and Endo-F3 catalyzed transglycosylation to constitute a core-fucosylated complex type RNase glycoform (Ribonuclease C) (
[0076] Direct Enzymatic Core-Fucosylation of Intact Monoclonal Therapeutic Antibody.
[0077] The potent transfucosylation activity of AlfC -fucoligase towards glycopeptides and glycoproteins prompted further exploring of its application for glycoengineering of therapeutic monoclonal antibodies. Core fucosylation of the Fc domain N-glycans plays a pivotal role in modulating the functions of antibodies and their therapeutic efficacy.sup.8,74. It was previously developed by the current inventors a chemoenzymatic Fc glycan remodeling method that consists of deglycosylation and glycosynthase-catalyzed glycan transfer to produce homogeneous Fc glycoforms.sup.65,66,75. If the fucoligase mutant could act on intact antibody, then it would further expand the repertoire of the toolbox for antibody Fc glycan engineering. To test this possibility, rituximab (26) was selected as a model system. First, rituximab was deglycosylated with Endo-S followed by defucosylation with the wild type AlfC -fucosidase to give the GlcNAc-rituximab (27) (
[0078] Finally, the direct fucosylation of the intact rituximab (28) was tested carrying the full size complex type Fc N-glycans. Interestingly, it was found that the AlfC E274 mutant could also smoothly transfer the fucose moiety to the intact rituximab, albert at a slow rate in comparison with the GlcNAc-rituximab substrate. Nevertheless, an increased amount of the enzyme could lead to complete transformation of the intact rituximab (28) to the core-fucosylated glycoform (30) within a few hours at 37 C. (
[0079] To confirm that the fucose was specifically attached at the core position and that there was no non-enzymatic attachment of the fucose to any residues in the protein portions, ESI-MS analysis was performed of the intact antibody product, coupled with specific enzymatic transformations (
[0080] Lectin Binding Studies with Core-Fucosylated RNase B and Rituximab.
[0081] The interactions of glycoproteins and core fucose-specific lectins play important roles in biological recognition processes. To demonstrate the specific recognition, the binding analysis of the interactions between the Aleuria aurantia lectin (AAL) and a few core-fucosylated glycoproteins synthesized via the AlfC fucoligase catalyzed reactions was performed. AAL is a commonly used lectin, which has high affinity for 1,6-fucosylated glycoproteins, including core fucosylated antibody and haptoglobin.sup.76,77. First the binding of 21 carrying core fucosylated high-mannose glycans and the natural glycoprotein (20) with AAL was tested. The AAL showed specific binding to 21, while it didn't show any binding to the non-fucosylated glycoprotein (20) (
[0082] The present invention establishes a highly efficient chemoenzymatic method for direct core-fucosylation of intact N-glycopeptides, N-glycoproteins, and therapeutic antibodies. This method was enabled by the discovery of an array of AlfC -fucosidase mutants that act as novel glycoligases for transglycosylation using -fucosyl fluoride as the simple donor substrates. The AlfC -fucosidase mutants represent the first examples of glycoligases capable of specifically attaching an 1,6-fucose moiety to intact N-glycans of glycoproteins. The discovery of the -fucoligases opens a new avenue to quickly constructing library of core-fucosylated N-glycopeptides and N-glycoproteins directly from the corresponding non-fucosylated counterparts, which have been hitherto difficult to obtain for glycomic studies.
[0083] Materials and Methods
[0084] All chemicals, reagents and solvents were purchased from Sigma-Aldrich and TCI, and unless specially noted, applied in the reaction without further purification. Monoclonal antibody rituximab was purchased from Premium Health Services Inc. (Columbia, Md.). Silica gel (200-425 mesh) for flash chromatography was purchased from Sigma-Aldrich. Analytical reverse-phase chromatography was performed on a Waters 626 HPLC instrument equipped with an)(Bridge BEH130 C18 column (3.5 m, 4.6250 mm) for reversed phase or YMC-Pack NH.sub.2 column (5 m, 4.6250 mm) for normal phase. The XBridge column was eluted with a linear gradient of acetonitrile (0-30%, v/v) with water containing TFA (0.1%) over 35 min at a flowrate of 0.5 mL/min under UV 214 nm. The YMC-Pack NH.sub.2 column was eluted with a linear gradient of ammonium formate (100 mM, pH4.5, 10-60%, v/v) with acetonitrile containing TFA (0.1%) over 80 min at a flowrate of 0.5 mL/min under UV 266 nm. Preparative HPLC was performed on a Waters 600 HPLC instrument equipped with a SymmetryPrep C18 column (7 m, 19300 mm). High-Performance Anion-Exchange Chromatography with Pulsed Amperometric Detection (HPAEC-PAD) was performed on a Dionex ICS-5000 chromatography system (Fischer Scientific) equipped with an electrochemical detector (ED.sub.50) and an anion exchange column (CarboPac PA10 4250 mm). The PA10 column was eluted with a constant buffer composed of 80% 100 mM NaOH and 20% water at a flowrate 1.0 mL/min. Liquid Chromatography Electrospray Mass spectrometry (LC-ESI-MS) was used to analyze transfer products including core fucosylated glycopeptides and glycoproteins. The LC-ESI-MS was performed on an Exactive Plus Orbitrap Mass Spectrometer (Thermo Scientific) equipped with a C18 column (proZap Expedite MS C18, 2.110 mm, 1.5 m, P. J. Cobert Associates, Inc.) for glycopeptides, C8 column (Poroshell 300SB-C8, 1.075 mm, 5 m, Agilent) for glycoproteins and C-4 column (XBridge BEH300 C4, 2.150 mm, 3.5 m, Waters) for antibody analysis. .sup.1H, .sup.13C and .sup.1H-.sup.1H COS Y spectra were recorded on a 400 or 600 MHz spectrometer (Bruker, Tokyo, Japan) with D20 or DMSO-d.sub.6 as the solvent. Amino acid sequence alignment for different fucosidases was performed using MAFFT, a multiple sequence alignment tool. Plasmid pCPD vector (CPD-Lasso) was created by engineering the CPD protein as a C-terminal tag into pET31(b) (Novagen) vector. PfuUltra II fusion HS DNA polymerase was purchased from Agilent. Restriction enzymes and Escherichia coli competent cells including 5-alpha and BL21 (DE3), used for DNA manipulation and protein production, were purchased from New England BioLabs Inc. Enzyme Kinetics was performed by GraFit (Erithacus Software, UK).
[0085] Construction, Expression and Purification of AlfC Fucosidase.
[0086] The DNA sequence encoded AlfC 1,6-fucosidase from Lactobacillus casei was synthesized (GenScript) and inserted into CPD-Lasso plasmid at NdeI and BamHI sites. The plasmid was transformed to BL21 (DE3) E. coli competent cell and AlfC -fucosidases were overexpressed as CPD and 10His tagged proteins in Luria-Bertani (1 L) broth with carbenicillin (0.1 mg/ml) at 37 C. for 4 h until the OD.sub.600 up to 0.5. After induced by isopropyl -
[0087] Site-Directed Mutagenesis of AlfC -Fucosidase.
[0088] The site-directed mutagenesis of AlfC 1,6-fucosidase was performed using Stratagene protocol. Two complementary primers (0.02 nmol) were employed in the polymerase chain reaction (PCR). After 14 cycles for PCR reaction, the reaction was mixed with DpnI (2,000 U/ml) and CutSmart buffer (1), and incubated at 37 C. for 1 h. Then the plasmids in reaction mixture were transformed to NEB 5-alpha high efficiency competent cell for miniprep. After gene sequencing, the plasmid was transformed to BL21 (DE3) E. coli competent cell, following the same procedure of expression and purification described above. The purified AlfC mutants were characterized by SDS-PAGE. To remove the cysteine protease domain (CPD) tag, inositol hexaphosphate (10 mM) was mixed with AlfC mutants (1 mg) in PBS buffer (0.1 M, pH 7.0) at 4 C. overnight. The enzyme without CPD tag was then purified by Ni-NTA spin kit (QIAGEN). Purified AlfC mutants (44 kDa) were characterized by SDS-PAGE, compared with its counterpart with CPD tag.
[0089] Enzymatic Kinetics of Hydrolysis and Transfucosylation of AlfC and its Mutants.
[0090] Kinetic studies on the hydrolysis were carried out at 42 C. in sodium phosphate (0.1 M, pH 7.0). The amount of the released free fucose was detected by using Dionex chromatography. The concentration of the substrate 4-nitrophenyl -fucoside (pNPFuc) was varied from 0.2 to 2.0 mM. K.sub.M and k.sub.cat values were determined by fitting the initial velocity curves to the Michaelis-Menten equation by nonlinear regression in GraFit (Erithacus Software).
[0091] The kinetic studies on transglycosylation were carried out at 42 C. in sodium phosphate (0.1 M, pH 7.5). The transglycosylation product was detected and quantitated by HPLC analysis. The concentration of the donor substrates (1-3) was varied from 0.2 to 2.0 mM, while that of the acceptor (4) was fixed (2 mM). K.sub.M and k.sub.cat values (strictly, apparent K.sub.M and k.sub.cat, as they were determined at a fixed, nonsaturating, co-substrate concentration) were determined by fitting the initial velocity curves to the Michaelis-Menten equation by nonlinear regression in GraFit.
[0092] Fucosylation of 4.
[0093] To a mixture of 3 (0.249 mg, 1.5 mol) and acceptor 4 (0.557 mg, 1 mol) in a buffer (PBS, 100 mM, pH 7.5, 500 L) containing 20% DMSO was added the E274A mutant (0.05 mg, 0.1 mg/mL), and the solution was incubated at 42 C. The reaction was monitored by LC-MS analysis on a C-18 column. After the reaction completed (30 min), the reaction mixture was quenched by 0.1% TFA, and then centrifuged and filtered through 0.45 m syringe filter. The filtrate was concentrated and the residue was purified by reverse-phase (C18) HPLC to obtain the product (5) (0.63 mg, 99%) as a white powder after lyophilizaion. .sup.1H NMR (DMSO-d.sub.6+1% D.sub.2O, 400 MHz): =7.88 (d, J=7.6 Hz, 2H, Ph-H), 7.71 (d, J=7.6 Hz, 2H, Ph-H), 7.41 (dd, J=7.6, 7.2 Hz, 2H, Ph-H), 7.32 (dd, J=7.2, 7.6 Hz, 2H, Ph-H), 4.80 (d, J.sub.1,2=6.4 Hz, 1H, H-1), 4.62 (d, J.sub.1,2=3.2 Hz, 1H, H-1), 4.22 (m, 4H, Asn-H-2, Fmoc-H-2, Fmoc-H-1), 3.85 (m 1H, H-6), 3.77 (d, J=10 Hz, 1H, H-6), 3.50 (m, 3H, H-2, H-3, H-2), 3.46 (m, 1H, H-4), 3.33 (m, 3H, H-3, H-4, H-5), 3.09 (m, 1H, H-5), 2.54 (m, 2H, Asn-H-1), 1.78 (s, 3H, COCH.sub.3), 1.06 (d, J=6.8 Hz, 3H, CH.sub.3). .sup.13C NMR (DMSO-d.sub.6+1% D.sub.2O, 100 MHz): =174.52 (CO), 172.64 (CO), 171.37 (CO), 158.20 (CO), 145.59 (Ph-C, 2C), 145.26 (Ph-C, 2C), 131.44 (Ph-C, 2C), 129.36 (Ph-C, 2C), 126.48 (Ph-C, 2C), 121.91 (Ph-C, 2C), 102.10 (C-1), 88.62 (C-1), 77.03, 75.28, 72.77, 71.31, 70.85, 69.93, 68.48, 67.73, 67.02, 55.63, 51.85, 47.09, 36.52, 23.03 (COCH.sub.3), 17.85 (C-6). ESI-MS: calc. for 5, M=703.3 Da; found (m/z), 704.5 [M+H].sup.+, 726.6 [M+Na].sup.+. Analytical RP-HPLC, t.sub.R=28.5 min.
[0094] Fucosylation of GlcNAc-Peptides. The Fucosylation of 6 as a Representative Procedure.
[0095] A mixture of 3 (0.249 mg, 1.5 mol) and acceptor 6 (0.863 mg, 1 mol) in a buffer (PBS, 100 mM, pH 7.5, 500 L) containing the glycoligase mutant E274A (0.1 mg, 0.2 mg/mL) was incubated at 42 C. The reaction was monitored by LC-MS analysis. After the reaction was complete, the reaction mixture was quenched by 0.1% TFA, and then centrifuged and filtered through 0.45 m syringe filter. The filtrate was dried, and the product was purified by RP-HPLC to give the fucosylated product (7) (1.00 mg, 99%). ESI-MS: Calcd. for 7, M=1008.6 Da; found (m/z), 505.43 [M+2H].sup.2+, 1009.68 [M+H].sup.+. Analytical RP-HPLC, t.sub.R=6.5 min. the fucosylation of 8 and 10 followed the same procedure to give the fucosylated products 9 and 11 in almost quantitative yield.
[0096] Fucosylated Glycopeptide 9.
[0097] ESI-MS: Calcd. for 9, M=2197.0 Da; found (m/z), 550.79 [M+4H].sup.4+, 733.63 [M+3H].sup.3+, 1099.43 [M+2H].sup.2+. Analytical RP-HPLC, t.sub.R=22.4 min.
[0098] Fucosylated Glycopeptide 9.
[0099] ESI-MS: calcd. for 11, M=4647.3 Da; found (m/z), 929.36 [M+5H].sup.5+, 1161.67 [M+4H].sup.4+, 1547.66 [M+3H].sup.3+. Analytical RP-HPLC, t.sub.R=26.7 min.
[0100] Direct Core Fucosylation of Intact Glycopeptides. Fucosylation of 12 as a Representative Procedure.
[0101] To a mixture of 3 (0.249 mg, 1.5 mol) and the acceptor (12) (2.86 mg, 1 mol) in a buffer (PBS, 100 mM, pH7.5, 500 L) was added mutant E274A (0.14 mg, 0.28 mg/mL). The solution was incubated at 42 C. The reaction was monitored by HPLC and LC-MS analysis. HPLC indicated the completion of the reaction after 45 min. Then the reaction was quenched with 0.1% TFA, and the mixture was centrifuged and filtered through 0.45 m syringe filter. The filtrate was dried and the product was purified by RP-HPLC to give the fucosylated product (13) (2.81 mg, 93.4%). ESI-MS: calcd. for 13, M=3010.2 Da; found (m/z), 1004.73 [M+3H].sup.3+, 1506.68 [M+2H].sup.2+. Analytical RP-HPLC, t.sub.R=4.2 min. The fucosylation of 14, 16, and 18 was performed in a similar manner and the reaction took 1-5 h to completion as monitored by HPLC analysis. The products were purified by RP-HPLC.
[0102] Fucosylated Glycopeptide 15 (92%).
[0103] ESI-MS: calcd. for 15, M=4198.2 Da; found (m/z), 840.60 [M+5H].sup.5+, 1050.48 [M+4H].sup.4+, 1400.72 [M+3H].sup.3+. Analytical RP-HPLC, t.sub.R=16.0 min.
[0104] Fucosylated Glycopeptide 17 (91%).
[0105] ESI-MS: calcd. for 17, M=6641.7 Da; found (m/z), 1107.29 [M+6H].sup.6+, 1329.27 [M+5H].sup.5+, 1661.48 [M+4H].sup.4+. Analytical RP-HPLC, t.sub.R=19.6 min.
[0106] Fucosylated Glycopeptide 19 (90%).
[0107] ESI-MS: calcd. for 19, M=6479.3 Da; found (m/z), 926.76 [M+7H].sup.7+, 1080.81 [M+6H].sup.6+, 1296.40 [M+5H].sup.5+, 1620.62 [M+4H].sup.4+. Analytical RP-HPLC, t.sub.R=22.5 min.
[0108] Core Fucosylation of Ribonuclease B (20).
[0109] To a mixture of the -fucosyl fluoride (3) (0.224 mg, 1.34 mol) and the RNase B (20) (1.0 mg, 0.067 mol) win the buffer (PBS, 100 mM, pH 7.5, 100 L) was added mutant E274A (0.2 mg, 2 mg/mL). The solution was incubated at 37 C. The reaction was monitored by LC-MS analysis. After 5 h, the reaction was quenched by adding 0.1% TFA and the mixture was filtrated through a 0.45 m syringe filter. The filtrate was subjected to RP-HPLC purification. The fractions containing the fucosylated (21) and afucosylated RNase B (20) were pooled and lyophilized. The residue was then dialyzed against sodium phosphate (100 mM, pH 7.4) at 4 C. Concentration of the RNase B mixture was determined by NanoDrop quantitation. ESI-MS: calcd. for 21, M=15042 Da (M5F), 15205 Da (M6F), 15368 Da (M7F), 15528 Da (M8F) and 15692 Da (M9F) Da; found (deconvolution data) (m/z): 15044 (M5F), 15207 (M6F), 15369 (M7F), 15530 (M8F) and 15693 (M9F). Analytical RP-HPLC, t.sub.R=18.4 min.
[0110] To quantitate the M5-M9 glycan forms of RNase B, normal phase HPLC equipped with NH.sub.2 column was used to separate and quantitate the fucosylated and afucosylated N-glycans after PNGase F releasing and labeling with Fmoc tag, as described below. The RNase B mixture (100 g) was first denatured by treatment with 1 mL of guanidine hydrochloride (8 M) containing 1,4-dithiothreitol (180 mM). The mixture was incubated at 37 C. for 1 h. Then iodoacetamide (0.7 M) was added and the mixture was incubated at 37 C. for 1 h. The denatured RNase B mixture was dialyzed against sodium phosphate (100 mM, pH 8.5) at ambient temperature. To release and tag the N-glycans, the mixture was treated with PNGase F (10 U) (37 C. for 2 h). After that, 200 L of Fmoc-Cl in acetone (50 mg/mL) was added and the mixture was incubated at 37 C. for 1 h. After centrifugation, the reaction mixture was washed with chloroform (3200 L) and the aqueous layer was passed through a Sep-Pak C-18 cartridge to remove deglycosylated proteins. The purified Fmoc-labeling N-glycans was eluted and analyzed by normal HPLC. The ratios of each N-glycan form were calculated based on the peak integration. (MSF: 72%, M6F: 54%, M7F: 51%, M8F: 55% and M9F: 43%). NP-HPLC, t.sub.R=39.8, 49.1, 56.9, 63.8 and 70.3 min, respectively.
[0111] Fucosylation of GlcNAc-Rituximab (27).
[0112] To a mixture of the -fucosyl fluoride (3) (96 g, 0.56 mol) and the GlcNAc-rituximab (27) (2.0 mg, 0.014 mol) in a buffer (PBS, 100 mM, pH 7.5, 100 L) was added mutant E274A (200 g, 2.0 mg/mL). The solution was incubated at 37 C. for 7 h, when LC-MS indicated complete conversion of 27 to the fully fucosylated product (29). The mixture was then loaded on a protein A affinity column (HiTrap Protein A HP, GE Healthcare). After washing, the desired product was eluted with citrate buffer (50 mM, pH 3.5) and promptly dialyzed against sodium phosphate (100 mM, pH 7.4) at 4 C. The solution was concentrated and the amount of fucosylated rituximab (29) was quantitated by NanoDrop analysis (1.80 mg, 90%). To verify the complete fucosylation at the Fc domain, the fucosylated rituximab (29) was treated with the IdeS protease (0.2 mg/mL) to release the monomeric Fc domain, which was then subjected to LC ESI-MS analysis. The ESI-MS revealed a single Fc species confirming the complete fucosylation of the Fc domain. ESI-MS: calcd. for the IdeS released Fc domain of 29, M=24108 Da; found (m/z), 965.53 [M+25H].sup.25+, 1005.36 [M+24H].sup.24+, 1049.23 [M+23H].sup.23+, 1096.91 [M+22H].sup.22+, 1149.06 [M+21H].sup.21+, 1206.02 [M+20H].sup.20+, 1269.72 [M+19H].sup.19+, 1340.18 [M+18H].sup.18+, and 1419.02 [M+17H] .sup.17+; Deconvolution of the ESI-MS, M=24110 Da.
[0113] Fucosylation of Intact Rituximab (28) and ESI-MS Analysis of the Fucosylated Intact Antibody (30).
[0114] To a mixture of the -fucosyl fluoride (3) (46.3 g, 0.27 mol) and the intact rituximab (28) (1.0 mg, 0.0067 mol) in a buffer (PBS, 100 mM, pH 7.5, 100 L) was added mutant E274A (200 g, 2.0 mg/mL). The fucosylation of 28 was performed in a similar manner with that of 27 and the reaction took 8 h to completion as monitored by LC-MS analysis. The products were purified by protein A affinity column and was quantitated by NanoDrop analysis (0.87 mg, 87%). The ESI-MS revealed a single species confirming the complete fucosylation in the intact rituximab (30). ESI-MS: calcd. for 30, M=148888 Da; found (m/z), 2708.01 [M+55H].sup.55+, 2758.17 [M+54H].sup.54+, 2810.16 [M+53H].sup.53+, 2864.21 [M+52H].sup.52+, 2920.29 [M+51H].sup.51+, 2978.64 [M+50H].sup.50+, 3039.40 [M+49H].sup.49+, 3102.70 [M+48H].sup.48+, 3168.70 [M+47H].sup.47+; Deconvolution of the ESI-MS, M=148886 Da.
[0115] Lectin Binding Studies of the Core-Fucosylated RNase B and Rituximab.
[0116] The glycoprotein (20, 21, 28 or 30) (10 g/ml) in a phosphate buffer (pH 7.5) was coated onto a 96-well plate (UltraCruz) at 4 C. for overnight. After wash twice, 2% bovine serum albumin in PBS containing Tween 20 (PBST buffer) was added to block the plate for 2 h. Subsequently, after washed twice again, a serial dilution of AAL-biotin ranging from 0.1 M to 1000 M in PBST buffer was added and the plate was incubated for 1 h. After washing, peroxidase streptavidin (2 g/mL) (Jackson ImmunoResearch Inc.) was added and incubated for 1 h. Finally, 100 L of substrate, 3, 3, 5, 5-tetramethylbenzidine was added for signal development. The reaction was stopped by the adding 100 L of 20% sulfuric acid (v/v). The absorbance at 450 nm was measured using SpectraMax M5 microplate reader (Molecular Devices). For the binding of the N-glycans, the Fmoc-labeled N-glycans released from 20, 21, 28 and 30 (1 g/ml) were coated on the plate and the ELISA analysis was performed in the same manner as that of the glycoproteins.
REFERENCES
[0117] The contents of the following references cited herein are incorporated by reference herein for all purposes. [0118] (1) Dwek, R. A. Chem. Rev. 1996, 96, 683. [0119] (2) Helenius, A.; Aebi, M. Science 2001, 291, 2364. [0120] (3) Petrescu, A. J.; Wormald, M. R.; Dwek, R. A. Curr. Opin. Struct. Biol. 2006, 16, 600. [0121] (4) Varki, A. Glycobiology 1993, 3, 97. [0122] (5) Haltiwanger, R. S.; Lowe, J. B. Annu. Rev. Biochem. 2004, 73, 491. [0123] (6) Dube, D. H.; Bertozzi, C. R. Nat. Rev. Drug Discov. 2005, 4, 477. [0124] (7) Nimmerjahn, F.; Ravetch, J. V. Nat. Rev. Immunol. 2008, 8, 34. [0125] (8) Jefferis, R. Nat. Rev. Drug Discov. 2009, 8, 226. [0126] (9) Hart, G. W.; Copeland, R. J. Cell 2010, 143, 672. [0127] (10) Taniguchi, N.; Kizuka, Y. Adv. Cancer Res. 2015, 126, 11. [0128] (11) Pinho, S. S.; Reis, C. A. Nat. Rev. Cancer 2015, 15, 540. [0129] (12) Chen, C. Y.; Jan, Y H.; Juan, Y H.; Yang, C. J.; Huang, M. S.; Yu, C. J.; Yang, P. C.; Hsiao, M.; Hsu, T. L.; Wong, C. H. Proc. Natl. Acad. Sci. USA 2013, 110, 630. [0130] (13) Sato, Y; Nakata, K.; Kato, Y; Shima, M.; Ishii, N.; Koji, T.; Taketa, K.; Endo, Y.; Nagataki, S. N. Engl. J. Med. 1993, 328, 1802. [0131] (14) Wang, X.; Inoue, S.; Gu, J.; Miyoshi, E.; Noda, K.; Li, W.; Mizuno-Horikawa, Y.; Nakano, M.; Asahi, M.; Takahashi, M.; Uozumi, N.; Ihara, S.; Lee, S. H.; Ikeda, Y.; Yamaguchi, Y.; Aze, Y; Tomiyama, Y.; Fujii, J.; Suzuki, K.; Kondo, A.; Shapiro, S. D.; Lopez-Otin, C.; Kuwaki, T.; Okabe, M.; Honke, K.; Taniguchi, N. Proc. Natl. Acad. Sci. USA 2005, 102, 15791. [0132] (15) Mimura, Y; Katoh, T.; Saldova, R.; O'Flaherty, R.; Izumi, T.; Mimura-Kimura, Y.; Utsunomiya, T.; Mizukami, Y.; Yamamoto, K.; Matsumoto, T.; Rudd, P. M. Protein Cell 2017. [0133] (16) Lee, S. H.; Takahashi, M.; Honke, K.; Miyoshi, E.; Osumi, D.; Sakiyama, H.; Ekuni, A.; Wang, X.; Inoue, S.; Gu, J.; Kadomatsu, K.; Taniguchi, N. J. Biochem. 2006, 139, 391. [0134] (17) Wang, X.; Gu, J.; Ihara, H.; Miyoshi, E.; Honke, K.; Taniguchi, N. J. Biol. Chem. 2006, 281, 2572. [0135] (18) Pinho, S. S.; Seruca, R.; Gartner, F.; Yamaguchi, Y.; Gu, J.; Taniguchi, N.; Reis, C. A. Cell. Mol. Life Sci. 2011, 68, 1011. [0136] (19) Lin, H.; Wang, D.; Wu, T.; Dong, C.; Shen, N.; Sun, Y.; Xie, H.; Wang, N.; Shan, L. Am. J. Physiol. Renal. Physiol. 2011, 300, F1017. [0137] (20) Venkatachalam, M. A.; Weinberg, J. M. Kidney Int. 2013, 84, 11. [0138] (21) Li, W.; Yu, R.; Ma, B.; Yang, Y.; Jiao, X.; Liu, Y; Cao, H.; Dong, W.; Liu, L.; Ma, K.; Fukuda, T.; Liu, Q.; Ma, T.; Wang, Z.; Gu, J.; Zhang, J.; Taniguchi, N. J. Immunol. 2015, 194, 2596. [0139] (22) Andre, S.; Kozar, T.; Kojima, S.; Unverzagt, C.; Gabius, H. J. Biol. Chem. 2009, 390, 557. [0140] (23) Andre, S.; Kozar, T.; Schuberth, R.; Unverzagt, C.; Kojima, S.; Gabius, H. J. Biochemistry 2007, 46, 6984. [0141] (24) Schmaltz, R. M.; Hanson, S. R.; Wong, C. H. Chem. Rev. 2011, 111, 4259. [0142] (25) Rillahan, C. D.; Paulson, J. C. Annu. Rev. Biochem. 2011, 80, 797. [0143] (26) Kiessling, L. L.; Splain, R. A. Annu. Rev. Biochem. 2010, 79, 619. [0144] (27) Voynow, J. A.; Kaiser, R. S.; Scanlin, T. F.; Glick, M. C. J. Biol. Chem. 1991, 266, 21572. [0145] (28) Yang, Q.; Wang, L. X. J. Biol. Chem. 2016, 291, 11064. [0146] (29) Li, L.; Liu, Y.; Ma, C.; Qu, J.; Calderon, A. D.; Wu, B.; Wei, N.; Wang, X.; Guo, Y; Xiao, Z.; Song, J.; Sugiarto, G.; Li, Y.; Yu, H.; Chen, X.; Wang, P. G. Chem. Sci. 2015, 6, 5652. [0147] (30) Brzezicka, K.; Echeverria, B.; Serna, S.; van Diepen, A.; Hokke, C. H.; Reichardt, N. C. ACS Chem. Biol. 2015, 10, 1290. [0148] (31) Calderon, A. D.; Liu, Y.; Li, X.; Wang, X.; Chen, X.; Li, L.; Wang, P. G. Org. Biomol. Chem. 2016, 14, 4027. [0149] (32) Tseng, T. H.; Lin, T. W.; Chen, C. Y.; Chen, C. H.; Lin, J. L.; Hsu, T. L.; Wong, C. H. J. Am. Chem. Soc. 2017, 139, 9431. [0150] (33) Yang, Q.; Zhang, R.; Cai, H.; Wang, L. X. J. Biol. Chem. 2017, Jul. 20. pii: jbc.M117.804070. doi: 10.1074/jbc.M117.804070. [Epub ahead of print]. [0151] (34) Nagorny, P.; Fasching, B.; Li, X.; Chen, G.; Aussedat, B.; Danishefsky, S. J. J. Am. Chem. Soc. 2009, 131, 5792. [0152] (35) Sun, B.; Srinivasan, B.; Huang, X. Chem. Eur. J. 2008, 14, 7072. [0153] (36) MacKenzie, L. F.; Wang, Q.; Warren, R. A. J.; Withers, S. G. J. Am. Chem. Soc. 1998, 120, 5583. [0154] (37) Moracci, M.; Trincone, A.; Perugino, G.; Ciaramella, M.; Rossi, M. Biochemistry 1998, 37, 17262. [0155] (38) Malet, C.; Planas, A. FEBS Lett. 1998, 440, 208. [0156] (39) Perugino, G.; Trincone, A.; Rossi, M.; Moracci, M. Trends Biotechnol. 2004, 22, 31. [0157] (40) Hancock, S. M.; Vaughan, M. D.; Withers, S. G. Curr. Opin. Chem. Biol. 2006, 10, 509. [0158] (41) Shaikh, F. A.; Withers, S. G. Biochem. Cell Biol. 2008, 86, 169. [0159] (42) Cobucci-Ponzano, B.; Moracci, M. Nat. Prod. Rep. 2012, 29, 697. [0160] (43) Wang, L. X.; Amin, M. N. Chem. Biol. 2014, 21, 51. [0161] (44) Jahn, M.; Marles, J.; Warren, R. A.; Withers, S. G. Angew. Chem. Int. Ed. 2003, 42, 352. [0162] (45) Kim, Y. W.; Zhang, R.; Chen, H.; Withers, S. G. Chem. Commun. (Camb) 2010, 46, 8725. [0163] (46) Li, C.; Ahn, H. J.; Kim, J. H.; Kim, Y W. Carbohydr. Polym. 2014, 99, 39. [0164] (47) Danby, P. M.; Withers, S. G. ACS Chem. Biol. 2016, 11, 1784. [0165] (48) Sakurama, H.; Fushinobu, S.; Hidaka, M.; Yoshida, E.; Honda, Y.; Ashida, H.; Kitaoka, M.; Kumagai, H.; Yamamoto, K.; Katayama, T. J. Biol. Chem. 2012, 287, 16709. [0166] (49) Wada, J.; Honda, Y.; Nagae, M.; Kato, R.; Wakatsuki, S.; Katayama, T.; Taniguchi, H.; Kumagai, H.; Kitaoka, M.; Yamamoto, K. FEBS Lett. 2008, 582, 3739. [0167] (50) Sugiyama, Y.; Gotoh, A.; Katoh, T.; Honda, Y; Yoshida, E.; Kurihara, S.; Ashida, H.; Kumagai, H.; Yamamoto, K.; Kitaoka, M.; Katayama, T. Glycobiology 2016, 26, 1235. [0168] (51) Sugiyama, Y; Katoh, T.; Honda, Y; Gotoh, A.; Ashida, H.; Kurihara, S.; Yamamoto, K.; Katayama, T. Biosci. Biotechnol. Biochem. 2017, 81, 283. [0169] (52) Cobucci-Ponzano, B.; Conte, F.; Bedini, E.; Corsaro, M. M.; Parrilli, M.; Sulzenbacher, G.; Lipski, A.; Dal Piaz, F.; Lepore, L.; Rossi, M.; Moracci, M. Chem. Biol. 2009, 16, 1097. [0170] (53) Cobucci-Ponzano, B.; Zorzetti, C.; Strazzulli, A.; Bedini, E.; Corsaro, M. M.; Sulzenbacher, G.; Rossi, M.; Moracci, M. Biocatalysis and Biotransformation 2012, 30, 288. [0171] (54) Cobucci-Ponzano, B.; Zorzetti, C.; Strazzulli, A.; Carillo, S.; Bedini, E.; Corsaro, M. M.; Comfort, D. A.; Kelly, R. M.; Rossi, M.; Moracci, M. Glycobiology 2011, 21, 448. [0172] (55) Rodriguez-Diaz, J.; Monedero, V.; Yebra, M. J. Appl. Environ. Microbiol. 2011, 77, 703. [0173] (56) Rodriguez-Diaz, J.; Carbajo, R. J.; Pineda-Lucena, A.; Monedero, V.; Yebra, M. J. Appl. Environ. Microbiol. 2013, 79, 3847. [0174] (57) Becerra, J. E.; Coll-Marques, J. M.; Rodriguez-Diaz, J.; Monedero, V; Yebra, M. J. Appl. Microbiol. Biotechnol. 2015, 99, 7165. [0175] (58) Ashida, H.; Miyake, A.; Kiyohara, M.; Wada, J.; Yoshida, E.; Kumagai, H.; Katayama, T.; Yamamoto, K. Glycobiology 2009, 19, 1010. [0176] (59) Sakurama, H.; Tsutsumi, E.; Ashida, H.; Katayama, T.; Yamamoto, K.; Kumagai, H. Biosci. Biotechnol. Biochem. 2012, 76, 1022. [0177] (60) Sulzenbacher, G.; Bignon, C.; Nishimura, T.; Tarling, C. A.; Withers, S. G.; Henrissat, B.; Bourne, Y J. Biol. Chem. 2004, 279, 13119. [0178] (61) Liu, S. W.; Chen, C. S.; Chang, S. S.; Mong, K. K.; Lin, C. H.; Chang, C. W.; Tang, C. Y; Li, Y K. Biochemistry 2009, 48, 110. [0179] (62) Shaikh, F. A.; Lammerts van Bueren, A.; Davies, G. J.; Withers, S. G. Biochemistry 2013, 52, 5857. [0180] (63) Shen, A.; Lupardus, P. J.; Morell, M.; Ponder, E. L.; Sadaghiani, A. M.; Garcia, K. C.; Bogyo, M. PloS One 2009, 4, e8119. [0181] (64) Lomino, J. V; Tripathy, A.; Redinbo, M. R. J. Bacteriol. 2011, 193, 2089. [0182] (65) Li, T.; Tong, X.; Yang, Q.; Giddens, J. P.; Wang, L. X. J. Biol. Chem. 2016, 291, 16508. [0183] (66) Giddens, J. P.; Lomino, J. V; Amin, M. N.; Wang, L. X. J. Biol. Chem. 2016, 291, 9356. [0184] (67) Wang, L. X. Chem. Biol. 2009, 16, 1026. [0185] (68) Williams, S. J.; Withers, S. G. Carbohydr. Res. 2000, 327, 27. [0186] (69) Huang, W.; Li, J.; Wang, L. X. Chem Bio Chem 2011, 12, 932. [0187] (70) Wang, L. X.; Song, H.; Liu, S.; Lu, H.; Jiang, S.; Ni, J.; Li, H. Chem Bio Chem 2005, 6, 1068. [0188] (71) Kamoda, S.; Nakano, M.; Ishikawa, R.; Suzuki, S.; Kakehi, K. J. Proteome Res. 2005, 4, 146. [0189] (72) Amin, M. N.; Huang, W.; Mizanur, R. M.; Wang, L. X. J. Am. Chem. Soc. 2011, 133, 14404. [0190] (73) Huang, W.; Yang, Q.; Umekawa, M.; Yamamoto, K.; Wang, L. X. Chem Bio Chem 2010, 11, 1350. [0191] (74) Li, T.; DiLillo, D. J.; Bournazos, S.; Giddens, J. P.; Ravetch, J. V.; Wang, L. X. Proc. Natl. Acad. Sci. USA 2017, 114, 3485. [0192] (75) Huang, W.; Giddens, J.; Fan, S. Q.; Toonstra, C.; Wang, L. X. J. Am. Chem. Soc. 2012, 134, 12308. [0193] (76) Nakano, M.; Nakagawa, T.; Ito, T.; Kitada, T.; Hijioka, T.; Kasahara, A.; Tajiri, M.; Wada, Y.; Taniguchi, N.; Miyoshi, E. Int. J. Cancer 2008, 122, 2301. [0194] (77) Lai, J. I.; Licht, A. F.; Dugast, A. S.; Suscovich, T.; Choi, I.; Bailey-Kellogg, C.; Alter, G.; Ackerman, M. E. J. Virol. 2014, 88, 2799.
TABLE-US-00001 TABLE1 ComplementaryprimerpairofeachAlfCmutant.Theunderlineindicates themutationforeachmutant AlfC mutants Primerpair D200A Fw:CGCGACCGCCTGGTTCGCCGTGCCGATGACGCTGT(SEQIDNO:14) Rv:ACAGCGTCATCGGCACGGCGAACCAGGCGGTCGCG(SEQIDNO:15) D200S Fw:CGCGACCGCCTGGTTCTCCGTGCCGATGACGCTGT(SEQIDNO:16) Rv:ACAGCGTCATCGGCACGGAGAACCAGGCGGTCGCG(SEQIDNO:17) D200G Fw:CGCGACCGCCTGGTTCGGCGTGCCGATGACGCTGT(SEQIDNO:18) Rv:ACAGCGTCATCGGCACGCCGAACCAGGCGGTCGCG(SEQIDNO:19) D200T Fw:CGCGACCGCCTGGTTCACCGTGCCGATGACGCTGT(SEQIDNO:20) Rv:ACAGCGTCATCGGCACGGTGAACCAGGCGGTCGCG(SEQIDNO:21) E274A Fw:CACCGCTGGGTCTGTACGCAACCGCGGGCACGATTAA(SEQIDNO:22) Rv:TTAATCGTGCCCGCGGTTGCGTACAGACCCAGCGGTG(SEQIDNO:23) E274S Fw:CACCGCTGGGTCTGTACTCAACCGCGGGCACGATTAA(SEQIDNO:24) Rv:TTAATCGTGCCCGCGGTTGAGTACAGACCCAGCGGTG(SEQIDNO:25) E274G Fw:CACCGCTGGGTCTGTACGGAACCGCGGGCACGATTAA(SEQIDNO:26) Rv:TTAATCGTGCCCGCGGTTCCGTACAGACCCAGCGGTG(SEQIDNO:27) E274D Fw:CCGCTGGGTCTGTACGATACCGCGGGCACG(SEQIDNO:28) Rv:CGTGCCCGCGGTATCGTACAGACCCAGCGG(SEQIDNO:29)
TABLE-US-00002 TABLE 2 Transglycosylation kinetics of AlfC -fucosidase mutants. .sup.a) k.sub.cat K.sub.M k.sub.cat/K.sub.M Enzyme (min.sup.1) (mM) (min.sup.1mM.sup.1) E274G (a/b).sup.b 1.38 0.15 10.sup.2 0.25 0.03 5.52 0.41 10.sup.2 E274A (a/b).sup.b 2.73 0.18 10.sup.2 0.17 0.02 16.1 0.89 10.sup.2 E274S (a/b).sup.b 2.42 0.14 10.sup.2 0.26 0.03 9.31 0.56 10.sup.2 .sup.a Conditions: Donor sugar (0.2 to 2.0 mM), acceptor (2.0 mM), sodium phosphate (0.1M, pH 7.5), 42 C.