USE OF SUMF2 GENE AS A GENE THERAPY TARGET FOR PREVENTING AND/OR TREATING ALLERGIC ASTHMA ATTACK AND REDUCING AIRWAY HYPERRESPONSIVENESS
20220401582 · 2022-12-22
Inventors
- Meng JIANG (Harbin, CN)
- Xiaofeng JIANG (Harbin, CN)
- Huijun GAO (Harbin, CN)
- Bin LI (Harbin, CN)
- Wenxuan SUN (Harbin, CN)
- Ye ZHENG (Harbin, CN)
- Mingsi TONG (Harbin, CN)
Cpc classification
A61K48/0008
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
A61K48/0075
HUMAN NECESSITIES
A61K48/005
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
Abstract
Provided is the use of as SUMF2 gene therapy target for preventing and/or treating an allergic asthma attack and reducing airway hyperresponsiveness. It is verified that the abnormal metabolic pathway of SUMF1/GAG causes epithelial cells to produce a similar immune memory and the epithelial cells can promote T.sub.H2 response when exposed to allergens again. In the present disclosure, SUMF2 gene in airway epithelial cells from a mouse is overexpressed using the adeno-associated virus vector 20 days before the induction of asthma. Compared with a control group, the present disclosure can significantly improve the lung airway inflammation in an asthmatic mouse. Therefore, the overexpression of SUMF2 can be used as a gene therapy target to prevent allergic asthma and reduce airway hyperresponsiveness. Therefore, the use of an adeno-associated virus to overexpress SUMF2 for the prevention of allergic asthma has broad use values and market prospects.
Claims
1. A method for preventing and/or treating an allergic asthma attack and reducing airway hyperresponsiveness, wherein the method comprises a step of targeting SUMF2 gene of a patient.
2. The method according to claim 1, wherein SUMF2 gene has the nucleotide sequence shown in SEQ ID NO: 1.
3. The method according to claim 1, wherein SUMF2 gene is used jointly with a gene vector for gene therapy for preventing and/or treating an allergic asthma attack and reducing airway hyperresponsiveness.
4. The method according to claim 3, wherein the gene vector comprises an adeno-associated virus packaging system.
5. The method according to claim 4, wherein the adeno-associated virus packaging system comprises a shuttle plasmid for inserting exogenous genes, a pAAV6-RC plasmid for encoding Rep and Cap proteins, and a pHelper plasmid for expressing adenovirus proteins.
6. A drug for preventing and/or treating an allergic asthma attack and reducing airway hyperresponsiveness, wherein the drug comprises a component targeting SUMF2 gene in airway epithelial cells.
7. The drug according to claim 6, further comprising a gene vector for SUMF2 gene.
8. The drug according to claim 7, wherein the gene vector comprises an adeno-associated virus packaging system.
9. The drug according to claim 8, wherein the adeno-associated virus packaging system comprises a shuttle plasmid for inserting exogenous genes, a pAAV6-RC plasmid for encoding Rep and Cap proteins, and a pHelper plasmid for expressing adenovirus proteins.
10. The method according to claim 3, wherein SUMF2 gene has the nucleotide sequence shown in SEQ ID NO: 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0026] The present disclosure provides the use of SUMF2 gene as a gene therapy target for preventing and/or treating an allergic asthma attack and reducing airway hyperresponsiveness.
[0027] In the present disclosure, SUMF2 gene preferably has a nucleotide sequence shown in SEQ ID NO: 1.
[0028] In the present disclosure, SUMF2 treatment nearly blocks all events related to the T.sub.H2 response by overexpressing SUMF2 in the lung airway epithelial cells in the allergic asthma mouse model. Meanwhile, SUMF2 treatment can inhibit the expression of lysosomes and MHC II pathway associated genes, while reducing the punctate staining of MHC II and leading lysosomal accumulation. The sulfatase in lysosomes is inhibited by AAV6-mSUMF2, which may be the reason of lysosome accumulation. Therefore, the present disclosure further provides the use of SUMF2 gene as the gene therapy target for preventing and/or treating the allergic asthma attack and reducing airway hyperresponsiveness.
[0029] In the present disclosure, SUMF2 gene is preferably used jointly with a gene vector to prevent and/or treat the allergic asthma attack and reducing airway hyperresponsiveness. Preferably, the gene vector includes an adeno-associated virus packaging system. Preferably, the adeno-associated virus packaging system includes a shuttle plasmid for inserting exogenous genes, a pAAV6-RC plasmid for encoding proteins Rep and Cap, and a pHelper plasmid for expressing adenovirus proteins. In the examples of the present disclosure, the pAAV6-RC plasmid (pHBAAV-Cap6) encoding proteins Rep and Cap and the pHelper plasmid expressing adenovirus proteins are purchased from Hanbio Company.
[0030] In the present disclosure, when SUMF2 gene is used jointly with a gene vector to prepare the therapeutic adeno-associated virus, it is preferred that SUMF2 gene is inserted into a shuttle plasmid to form a recombinant shuttle plasmid. In the present disclosure, there is no specific limitation to the method for constructing the recombinant shuttle plasmid, and the construction method well known in the art may be employed.
[0031] In the present disclosure, the AAV6-SUMF2 has the property of targeting lung airway epithelial cells. Introducing SUMF2 gene into the animal body along with the adeno-associated virus enables SUMF2 to overexpress in airway epithelial cells, which significantly decreases the infiltration of immune cells as well as reversing the GAG sulfation on the cell surface, thereby inhibiting the T.sub.H2 allergic reaction.
[0032] The present disclosure provides a gene therapy for preventing and/or treating an allergic asthma attack and reducing airway hyperresponsiveness, including SUMF2 gene in airway epithelial cells. Preferably, the gene therapy further includes a gene vector of SUMF2 gene. Preferably, the gene vector includes an adeno-associated virus packaging system. Preferably, the adeno-associated virus packaging system includes a shuttle plasmid for inserting exogenous genes, a pAAV6-RC plasmid for encoding Rep and Cap proteins, and a pHelper plasmid for expressing adenovirus proteins. In the present disclosure, there is no particular limitation to a dosage form of the drug for the gene therapy, and dosage forms of the drug well known in the art may be adopted. Experiments in the present disclosure prove that specific overexpression of SUMF2 gene in lung airway epithelial cells can effectively increase the threshold of AECs to trigger an allergic reaction, thereby preventing asthma attack and reducing airway hyperresponsiveness.
[0033] The use of SUMF2 gene therapy for preventing and/or treating an allergic asthma attack and reducing airway hyperresponsiveness provided by the present disclosure will be described in detail below with reference to examples, but it should not be understood as limiting the protection scope of the present disclosure.
Example 1
[0034] In this example, a screening method was provided for identifying SUMF1/2 as a therapy target in allergic asthma patient. An asthma time series model was established using bioinformatics analysis, and the analysis process is shown in
[0035] The RNA-seq and microarray data on nasal mucosa and airway epithelium of the asthmatic patients were subjected to fuzzification processing. Fisrtly, the dimensionality of the raw data was reduced using a Gene Set Variation Analysis (GSVA) method to transform the data on the expression profile from expression values of a single gene to an enrichment degree of different signal pathways, giving a cell pathway enrichment matrix. Secondly, weighted gene co-expression network analysis (WCGNA) was conducted on 5 sets of RNA-seq and microarray data from different samples, and diagrams of gene expression regulation network were generated using the genes as nodes and Pearson correlation of expression values between the genes as weights. A Consensus Network diagram was generated by selecting the common parts of the five sets of gene expression regulation network diagrams, in which Consensus Network represented a conservative inter-gene regulation relationship that existed both in different data sets and in different diseased sites in the entire airway mucosa. In the Consensus Network diagram, each node represented a set of gene modules having a mutually regulated relationship, and the connection lines between the nodes represented the correlation between the nodes. When the genes constituting the nodes were used as a characteristic vector, a characteristic value of the characteristic vector could be obtained by a least square method among the different data sets and the different samples, and a correlation analysis was conducted against the characteristic values and the GSVA results to give a biological event represented by the node. Once again, manifold dimensionality reduction was conducted on the gene sets represented by the nodes, using a PHATE algorithm. Due to the nature that PHATE reorders the samples, ordering of samples after dimensionality reduction by the algorithm was a pseudo-time series that can represent the biological process. According to the distribution of different gene sets in the samples, which is shown in
[0036] The results are shown in
[0037] Pearson correlation analysis was conducted on 14 conservative gene modules, and the signal pathways having the strongest Pearson correlation to 1-14 modules were selected from the cell pathway enrichment matrix following GSVA dimensionality reduction as functional labels for the conservative modules. As shown in
[0038] The results for the manifold analysis are shown in
[0039] As shown in
Example 2
[0040] Construction Method and Index Detection for Allergic Asthma Animal Model
[0041] SPF-grade, 4-week-old C57BL/6N female mice were treated with normal feed, free water drinking, and grew normally in a well-ventilated environment with a temperature of 20-25° C. and a humidity of 40-60%. The breeding and use of laboratory animals followed the “Reduction, Replacement and Refinement (3R)” principle and the laboratory animals were given humanitarian care.
[0042] The mice were randomly divided into an acute asthma group, an acute aggravated asthma group, a chronic asthma group, a chronic asthma plus a 2-week rest group, a chronic asthma plus a 3-week rest group, a chronic asthma plus a 4-week rest and relapse group, and an acute lung injury group, as well as control groups for each group. The mice were euthanized after the experiment. The model was judged to be successfully established according to the pathological characteristics of the lungs, such as smooth muscle hyperplasia, pulmonary fibrosis, and the number of infiltration of eosinophils, neutrophils, lymphocytes, and monocytes. The acute asthma group was marked by a large number of eosinophil infiltrations, and the acute aggravation stage was accompanied by neutrophils, monocytes and a large number of lymphocytes. The chronic asthma had a relatively small neutrophil infiltration, mainly including lymphocytes and monocytes. And there further is airway smooth muscle hyperplasia and airway remodeling. After termination of OVA stimulation, the inflammatory cell infiltration reduced gradually and finally disappeared, nevertheless the remodeled airway did not return to normal.
[0043] On day 0 of the experiment, mice were intraperitoneally injected with 0.2 ml of OVA+aluminum gel (40 μg of OVA, and 2 mg of aluminum potassium sulfate dissolved in 0.2 ml of PBS), and mice in control group were intraperitoneally injected with PBS of equal volume. The intraperitoneal injection was repeated on day 14 of the experiment, and the mice were subjected to nebulized inhalation of OVA to stimulate asthma using a nebulized inhalation device in combination with an anesthesia induction box on day 21 of the experiment. The acute asthma group was subjected to nebulized inhalation of 5% OVA/PBS 1 time/day for 3 days. The acute aggravated asthma group was subjected to nebulized inhalation of 5% OVA/PBS 1 time/day for 9 days. The chronic asthma group was subjected to: nebulized inhalation of 1% OVA/PBS 3 times/week for 3 weeks on the basis of acute aggravated asthma model. The chronic asthma with a 2-week or 3-week rest group was subjected to termination of nebulized inhalation for 2 or 3 weeks after successful modeling of chronic asthma. The chronic asthma with a 4-week rest and relapse group was subjected to an additional episode of nebulized inhalation of 1% OVA after resting for 4 weeks after successful modeling of chronic asthma. The acute lung injury group was subjected to one episode of nebulized inhalation of 50 μl of LPS solution (2 ng/μl) in airway after anesthetization with pentobarbital. Each control group was subjected to nebulized inhalation of PBS of equal volume. In
[0044] The mouse asthma model was induced using OVA stimulation. After the modeling became successful, the mouse was euthanized at different time points. The lung tissue of the mouse was taken out, and RNA samples, protein samples and pathological samples were reserved. The inflammatory cell infiltration and SUMF1/2 expression in airway epithelial cells and the microenvironment thereof were detected using RNA sequencing in combination with an immunohistochemical staining technique, to verify the results of bioinformatics analysis. Specifically, the asthma models in each group were analyzed using a sulfation site heparan sulfate (H-S) 10E4 on the sulfatase SGSH as an indicator of the degree of sulfatase activation, and using an immunohistochemical staining technique. The results are shown in
[0045] It can be seen that as the expression ratio of SUMF1/2 the increased, a continuous decrease in the H-S 10E4 staining on the basement membrane side of epithelial cells was observed. However, the LPS stimulation had no effect on the expression of SUMF1/2 or H-S 10E4. These results indicated that repeated stimulation of allergens would lead to an irreversible increase in the expression ratio of SUMF1/2 and to desulfation of GAG on the cell membrane surface. This may result in a stronger immune response of the epithelial cells the next time when the epithelial cells were exposed to an allergen, thus forming an immune memory. In addition, reduction in SUMF1/2 expression was a unique biological event for T.sub.H2 inflammation.
[0046] Since LPS pre-treatment may greatly reduce the immune response induced by OVA, the lungs of mice were lavaged with LPS, and subjected to routine acute asthma modeling. After 3 days of OVA stimulation, the mice were euthanized and the expression levels of SUMF1/2 and H-S 10E4 were determined by immunohistochemical staining technology. As shown in
Example 3
[0047] Packaging, Collection, Purification, and Titer Determination of Adeno-Associated Virus
[0048] Adeno-associated virus subtypes (AAV5, AAV6, and AAV9) that were reported in the literature and were capable of binding to mouse lung cells were selected for pre-experiment. The mouse was lavaged in the airway with the AAV5-GFP, AAV6-GFP, and AAV9-GFP viruses provided by Hanbio Company, and euthanized after 21 days. And the expression of GFP in mouse lung cells was detected by immunohistochemical staining technology. As shown in
[0049] In this example, AAV6 subtype that can well target mouse lung airway epithelial cells to overexpress SUMF2 was selected. The AAV6 genome included two inverted terminal repeats (ITR) and two open reading frames (ORF), namely Cap and Rep, and Rep could be translated into a variety of proteins necessary to the life cycle of AAV. In the AAV packaging system, Rep and Cap were replaced with the target gene SUMF2-3flag/3flag (the mouse SUMF2 cDNA had a sequence shown in SEQ ID NO: 2), and co-transfected with the plasmid expressing the Rep and Cap genes to produce the AAV virus containing target genes.
[0050] The AAV packaging system included 3 types of plasmids, which were a shuttle plasmid AAV6-SUMF2-3flag/3flag for inserting exogenous genes, a pAAV6-RC plasmid for encoding Rep and Cap proteins, and a pHelper plasmid for expressing adenovirus proteins on which AAV depended (the map of the AAV packaging system was shown in
[0051] Six hours after the transfection of AAV-293 cell, the system was transferred to a DMEM medium containing 10% fetal bovine serum. All the cells were collected after 72 hours, frozen and thawed three times using liquid nitrogen. The supernatant was to be collected and purified using a Biomiga purification column. The AAV virus sample to be tested was digested routinely with DNase I and proteinase K, titer of the virus was determined by real-time fluorescent quantitative PCR (using a plasmid with a known copy number as a standard), dispensed and stored at −80° C. The specific method was as follows:
[0052] A. Determination of titer of a virus
[0053] 1. Preparation of AAV6 sample
[0054] AAV6 virus sample was treated using DNase I and proteinase K to prepare a PCR template.
[0055] (1) DNase I reaction system
[0056] DNase I, 10 μL
[0057] DNase I Buffer, 6 μL
[0058] AAV sample, 3 μL
[0059] dd H.sub.2O, 41 μL
[0060] (2) the sample was treated in a 37° C. water bath for 40 min, and inactivated in a 100° C. metal bath for 5 min; and
[0061] (3) three μL of proteinase K was added, the sample was allowed to be treated in a water bath at 55° C. for 40 min and inactivated in a metal bath at 100° C. for 5 min for further use.
[0062] 2. Preparation of a standard
[0063] A plasmid having a known copy number was used as a standard and was gradiently diluted to final concentrations of 10.sup.8, 10.sup.7, 10.sup.6, and 10.sup.5 copies/ml.
[0064] 3. PCR reaction system
[0065] 2×SYBR Green mix 10 μl,
[0066] Primer (F or R) 1 μL
[0067] Standard plasmid/virus template 1 μL
[0068] ddH.sub.2O 8 μL
[0069] Total 20 μl,
TABLE-US-00001 Forward primer: (SEQ ID NO: 3) acgctatgtggatacgctgc; Reverse primer: (SEQ ID NO: 4) cgggccacaactcctcataa.
[0070] 4. qPCR reaction program
[0071] UDG activation, 50° C. for 2 min
[0072] Polymerase activation, 95° C. for 2 min
[0073] Denaturation, 95° C. for 15
[0074] Annealing/extension, 60° C. for 1 min (40 cycles);
[0075] 65-95° C. melt curve.
[0076] Results
[0077] The results for virus determination of standards of different concentrations are shown in Table 1.
TABLE-US-00002 TABLE 1 Virus gradient results at different concentrations Concentration 10.sup.8 10.sup.7 10.sup.6 10.sup.5 Mean 9.72 13.03 15.34 19.10 CT1 9.78 12.94 15.65 19.31 CT2 9.53 13.01 15.15 19.09 CT3 9.86 13.14 15.22 18.92
The standard curve is shown in
[0078] B. Test results for AAV virus samples
TABLE-US-00003 TABLE 2 Test results for control virus and virus containing SUMF gene AAV6-3flag AAV6-SUMF2-3flag Mean 8.25 8.76 CT1 8.24 8.81 CT2 8.15 8.75 CT3 8.37 8.73
[0079] The mean Ct values of the AAV samples were put into the formula, a copy number X of the added AAV template was calculated and converted into the titer. A conversion formula is shown in the following Formula I:
AAV virus titer=10.sup.x×40000 (dilution multiple) vg/mL Formula I
[0080] Upon calculation, the titer of AAV6-SUMF2-3flag was about 1×10.sup.12.8 vg/mL, and the titer of AAV6-3flag was about 1×10.sup.12.9 vg/mL.
Example 4
[0081] Construction of Mouse Model of Gene Therapy Targeting SUMF2
[0082] Mice were infected with AAV6-SUMF2 at different time points to simulate the drug use after first exposure to allergens and airway hyperresponsiveness.
[0083] 1. Thirty two (32) 4-week-old female C57BL/6 mice were randomly divided into SUMF2 overexpression group and a control group. Mice were subjected to OVA sensitization on day 0 and day 14 of the experiment. A purified adeno-associated virus and a control virus (packaged by AAV6-3flag plasmid) were injected into the airways of SUMF2 overexpression group and the control group (containing approximately 0.5×10.sup.11 viral particle genome copies) through an airway nebulizer on day 1. The mice were subjected to nebulized inhalation of a PBS liquid with 5% OVA for three days on day 21, subjected to pulmonary CT and sacrificed with CO.sub.2 on day 24, and lung tissues were harvested for pathological analysis.
[0084] 2. An acute exacerbated allergic asthma model was constructed using 32 4-week-old female C57BL/6 mice (using the method same as in Example 2), and nebulized inhalation was stopped for a period of time to allow the mice enter a stable period of asthma. The adeno-associated virus and the control virus were injected into the airways of the experiment group and the control group. The mice received nebulized inhalation of a PBS liquid with 5% OVA for three days from day 21, and the mice were subjected to pulmonary CT and sacrificed with CO.sub.2 on day 24; and lung tissues were taken out for pathological analysis.
[0085] Results
[0086] The adeno-associated virus (AAV) having specific affinity to epithelial cells was used as a gene therapy vector to infect the respiratory epithelial cells of mice through nebulized inhalation, thereby forcibly increasing the expression level of SUMF2 (
[0087] In order to explore the specific mechanism of SUMF1/2 regulating the T.sub.H2 response, RNA-seq was conducted on the lung tissues of AAV6-mSUMF2 gene-treated mice and control mice at different time points, and gene expression enrichment analysis was performed using differential genes between groups. The results are shown in
[0088] Described above are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, and such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.