METHODS AND KITS FOR CLASSIFYING CANNABINOID PRODUCTION IN CANNABIS PLANTS

20190185946 ยท 2019-06-20

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure provides methods and kits for characterizing Cannabis plants. Methods and kits of the present disclosure include detection/amplification of one or more enzymes involved in the production of cannabinoids, such as, for example, tetrahydrocannabinolic acid (THCA) synthase and/or cannabidiolic acid (CBDA) synthase.

    Claims

    1. A method comprising the steps of: (1) detecting the presence of a tetrahydrocannabinolic acid (THCA) synthase gene sequence comprising a THCA synthase gene sequence promoter in a sample that comprises nucleic acid from a Cannabis plant; (2) detecting the presence of a mutated THCA synthase gene sequence in a sample that comprises nucleic acid from the Cannabis plant, wherein the mutated THCA synthase gene sequence includes at least one mutation that alters the activity of a THCA synthase encoded by the mutated THCA synthase gene sequence relative to a THCA synthase encoded by a wild-type THCA synthase gene sequence; (3) detecting the presence of a wild-type cannabidiolic acid (CBDA.sup.WT) synthase gene sequence in a sample that comprises nucleic acid from the Cannabis plant; (4) detecting the presence of a mutated cannabidiolic acid (CBDA.sup.mut) synthase gene sequence in a sample that comprises nucleic acid from the Cannabis plant, wherein the mutated CBDA synthase gene sequence comprises a deletion mutation; or (5) any combination thereof.

    2. The method of claim 1, wherein one or more of the detecting steps comprise isothermic nucleic acid amplification.

    3. The method of claim 2, wherein the detecting the presence of a THCA synthase gene sequence comprises isothermic nucleic acid amplification of a THCA synthase gene sequence that is at least 2000 nucleotides long.

    4. The method of claim 3, wherein the THCA synthase gene sequence is between 2100-2200 nucleotides long.

    5. The method of claim 1, wherein one or more of the detecting steps comprises performing a Loop-Mediated Isothermal Amplification (LAMP) assay.

    6. The method of claim 5, wherein the LAMP assay includes a colorimetric assay.

    7. The method of claim 1, wherein the Cannabis plant is a C. sativa plant.

    8. The method of claim 1, wherein the Cannabis plant is a C. indica plant.

    9. The method of claim 1, wherein the Cannabis plant is a C. ruderalis plant.

    10. The method of claim 1, wherein the step of detecting the presence of a THCA synthase gene sequence includes contacting a sample that comprises nucleic acid from the Cannabis plant with at least two THCA synthase primers under conditions sufficient for amplification of a THCA synthase gene sequence.

    11. The method of claim 1, wherein the step of detecting the presence of a mutated THCA synthase gene sequence includes contacting a sample that comprises nucleic acid from the C. sativa plant with at least two THCA synthase primers under conditions sufficient for amplification of a mutated THCA synthase gene sequence.

    12. The method of claim 1, wherein the step of detecting the presence of a wild-type cannabidiolic acid (CBDA.sup.WT) synthase gene sequence includes contacting a sample that comprises nucleic acid from the Cannabis plant with at least two CBDA synthase primers under conditions sufficient for amplification of a wild-type CBDA (CBDA.sup.WT) synthase gene sequence.

    13. The method of claim 1, wherein the step of detecting the presence of a mutated cannabidiolic acid (CBDA.sup.mut) synthase gene sequence includes contacting a sample that comprises nucleic acid from the Cannabis plant with at least two CBDA synthase primers under conditions sufficient for amplification of a CBDA.sup.mut synthase gene sequence.

    14. The method of claim 13, wherein (i) the step of detecting the presence of a THCA synthase gene sequence includes contacting a sample that comprises nucleic acid from the Cannabis plant with at least five THCA synthase primers under conditions sufficient for LAMP of a THCA synthase gene sequence; (ii) the step of detecting the presence of a mutated THCA synthase gene sequence includes contacting a sample that comprises nucleic acid from the Cannabis plant with at least five THCA synthase primers under conditions sufficient for LAMP of a mutated THCA synthase gene sequence; (iii) the step of detecting the presence of a wild-type cannabidiolic acid (CBDA.sup.WT) synthase gene sequence includes contacting a sample that comprises nucleic acid from the Cannabis plant with at least five CBDA synthase primers under conditions sufficient for LAMP of a wild-type CBDA (CBDA.sup.WT) synthase gene sequence; and/or (iv) the step of detecting the presence of a mutated cannabidiolic acid (CBDA.sup.mut) synthase gene sequence includes contacting a sample that comprises nucleic acid from the Cannabis plant with at least five CBDA synthase primers under conditions sufficient for LAMP of a CBDA.sup.mut synthase gene sequence.

    15. The method of claim 1, wherein the method further includes a step of analyzing results from one or more detecting steps, thereby characterizing the Cannabis plant as a Type Ia, Type Ib, Type IIa, Type IIb, Type IIc, Type IIIa, Type IIIb, Type IV or Type V plant.

    16. A method comprising the steps of: (1) contacting a sample that comprises nucleic acid from a Cannabis plant with at least two tetrahydrocannabinolic acid (THCA) synthase primers under conditions sufficient for amplification of a THCA synthase gene sequence, wherein the at least two THCA synthase primers include a forward THCA synthase primer and a reverse THCA synthase primer, wherein the forward THCA synthase primer is complementary to a sequence that is 200-1000 nucleotides upstream of a THCA synthase open reading frame in a Cannabis genome and the reverse THCA synthase primer is complementary to a sequence that is 50-1000 nucleotides downstream of the THCA synthase open reading frame; (2) contacting a sample that comprises nucleic acid from the Cannabis plant with at least two cannabidiolic acid (CBDA) synthase primers under conditions sufficient for amplification of a mutant CBDA synthase (CBDA.sup.Bd) gene sequence, wherein at least one CBDA.sup.Bd synthase primer is complementary to a sequence that bridges a 4 nucleotide deletion found in the CBDA.sup.Bd open reading frame; (3) contacting a sample that comprises nucleic acid from the Cannabis plant with at least two cannabidiolic acid (CBDA) synthase primers under conditions sufficient for amplification of a wild-type CBDA (CBDA.sup.WT) synthase gene sequence, wherein at least one CBDA.sup.WT synthase primer is complementary to a sequence that includes the 4 nucleotides deleted in the CBDA.sup.Bd synthase open reading frame; or (4) any combination thereof.

    17. The method of claim 16, wherein the THCA synthase gene sequence is at least 2,000 nucleotides long.

    18. The method of claim 17, wherein the THCA synthase gene sequence is 2100-2200 nucleotides long.

    19. The method of claim 16, wherein one or more steps of contacting is under conditions sufficient for is isothermic nucleic acid amplification.

    20. The method of claim 19, wherein the isothermic nucleic acid amplification includes a Loop-Mediated Isothermal Amplification (LAMP) assay.

    21. The method of claim 20, wherein the LAMP assay includes a colorimetric assay.

    22. The method of claim 16, wherein the Cannabis plant is a C. sativa plant.

    23. The method of claim 16, wherein the Cannabis plant is a C. indica plant.

    24. The method of claim 16, wherein the Cannabis plant is a C. ruderalis plant.

    25. The method of claim 16, wherein: (i) a sample that comprises nucleic acid from the Cannabis plant is contacted with at least five THCA synthase primers under conditions sufficient for LAMP of a THCA synthase gene sequence; (ii) a sample that comprises nucleic acid from the Cannabis plant is contacted with at least five THCA synthase primers under conditions sufficient for LAMP of a mutated THCA synthase gene sequence; (iii) a sample that comprises nucleic acid from the Cannabis plant is contacted with at least five CBDA synthase primers under conditions sufficient for LAMP of a wild-type CBDA (CBDA.sup.WT) synthase gene sequence; and/or (iv) a sample that comprises nucleic acid from the Cannabis plant is contacted with at least five CBDA synthase primers under conditions sufficient for LAMP of a CBDA.sup.mut synthase gene sequence.

    26. A kit comprising: at least two tetrahydrocannabinolic acid (THCA) synthase primers including a forward THCA synthase primer and a reverse THCA synthase primer, wherein the forward THCA synthase primer is complementary to a sequence that is 200-1000 nucleotides upstream of a THCA synthase open reading frame in a Cannabis genome and the reverse THCA synthase primer is complementary to a sequence that is 50-1000 nucleotides downstream of the THCA synthase open reading frame.

    27. The kit of claim 26, wherein the Cannabis plant is a C. sativa plant.

    28.-34. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWING

    [0042] The Figures described below, that together make up the Drawing, are for illustration purposes only, not for limitation.

    [0043] FIG. 1: Panels (A) and (B) provide schematic representations of portion of the cannabinoid synthesis pathway.

    [0044] FIG. 2: depicts a subtype classification system for Cannabis plants.

    [0045] FIG. 3: depicts an alignment of various primers sequences with the sequence of a Cannabis THCA synthase gene sequence. Exemplary mutations in a THCA synthase gene sequence are provided along THCAS-FIBER dotted underneath the ORF/CDS sequence.

    [0046] FIG. 4: depicts a position-specific weight matrix for alignment of CBDA synthase alleles in a Cannabis plant.

    [0047] FIG. 5: depicts isothermic (e.g., LAMP) amplification of a THCA synthase gene sequence. Panel (A) depicts an isothermic (e.g., LAMP) amplification at 65 C. of THCA synthase gene sequence with Kitamura primers (K primers) (Kitamura et al., (2017) Journal of natural medicines, 71(1):86-95 and Kitamura et al., (2016) Biological & pharmaceutical bulletin, 39(7):1144-9, both of which are incorporated herein by reference) and Long Range primers (LR primers) on the Cannabis strain Grandaddy Purple (GDP). Additionally, an isothermic amplification with K primers of various strains of Cannabis: Otto, two hemp samples, Grape Stomper (RSP10516), and Erk Train X Deadhead OG (RSP10517) were also determined. Panel (B) depicts an isothermic (LAMP) amplification with LR primers at various temperatures for multiple strains of Cannabis.

    [0048] FIG. 6: depicts an isothermic (LAMP) amplification of THCA gene sequence at 65 C. with Long Range primers on various Cannabis strains.

    [0049] FIG. 7: depicts isothermic (LAMP) amplification of (Panel (A)) a CBDA synthase gene sequence and (Panel (B)) isothermic (LAMP) amplification of THCA gene sequence on various hemp varietals of Cannabis. Panel (C) includes a map of the samples run in both Panels (A) and (B).

    [0050] FIG. 8: depicts isothermic (LAMP) amplification assays for CBDA.sup.wt (Panel (A)) and CBDA.sup.del (Panel (B)) sequences on various hemp varietals of Cannabis.

    [0051] FIG. 9: depicts exemplary primer sequences useful in the context of the present disclosure.

    [0052] FIG. 10: depicts a table of exemplary THCA synthase gene sequence.

    CERTAIN DEFINITIONS

    [0053] Associated With: The term associated with is used herein to describe an observed correlation between two items or events. For example, a mutation in THCA synthase may be considered to be associated with a particular cannabinoid synthesis profile and/or cannabinoid composition.

    [0054] Cannabis: As used herein, Cannabis refers to any plant in the genus Cannabis. In some embodiments, Cannabis refers to a part of, a specific compound from, and/or any product from a Cannabis plant (e.g., C. sativa, C. indica, C. ruderalis). For example, a Cannabis enzyme refers to an enzyme from a Cannabis plant. Similarly, a Cannabis genome refers to a genome from a Cannabis plant. Cannabis includes both marijuana and hemp, two forms of Cannabis that are distinguished on the basis of the relative abundances of different cannabinoids. Cannabis includes any variety of Cannabis species, cultivar of Cannabis species, or hybrid between any Cannabis species.

    [0055] Chemotype: As used herein, the term chemotype refers to chemically distinct entity (e.g., plant) with a particular profile of metabolites. In some embodiments, a chemotype is a particular type of Cannabis plant with a particular profile of one or more cannabinoids. In some embodiments, plants having different chemotypes may have same or different morphological characteristics. In some embodiments, a chemotype is characterized by a highly abundant chemical produced by that entity (e.g., plant). In some certain embodiments, a chemotype may refer to a Cannabis plant with an abundance of one or more cannabinoids (e.g., THC or CBD). In some embodiments, abundance of one or more cannabinoids may be a relative amount (e.g., a ratio of cannabinoids, such as a THC:CBD ratio).

    [0056] Coding sequence: As used herein, the term coding sequence refers to a sequence of a nucleic acid or its complement, or a part thereof, that (i) can be transcribed to an mRNA sequence that can be translated to produce a polypeptide or a fragment thereof, or (ii) an mRNA sequence that can be translated to produce a polypeptide or a fragment thereof. Coding sequences include exons in genomic DNA or immature primary RNA transcripts, which are joined together by the cell's biochemical machinery to provide a mature mRNA.

    [0057] Gene and Gene sequence: The term gene, as used herein, refers to a part of the genome that codes for a product (e.g., an RNA product and/or a polypeptide product). A gene sequence is a sequence that includes at least a portion of a gene (e.g., all or part of a gene) and/or regulatory elements associated with a gene. In some embodiments, a gene includes coding sequence; in some embodiments, a gene includes non-coding sequence. In some particular embodiments, a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequences. In some embodiments, a gene may include one or more regulatory elements (e.g., a promoter) that, for example, may control or impact one or more aspects of gene expression (e.g., cell-type-specific expression, inducible expression, etc.).

    [0058] Mutation: As used herein, the term mutation refers to a change introduced into a parental sequence, including, but not limited to, substitutions, insertions, deletions (including truncations). The consequences of a mutation include, but are not limited to, the creation of a new character, property, function, phenotype or trait not found in the protein encoded by the parental sequence, or the increase or reduction/elimination of an existing character, property, function, phenotype or trait not found in the protein encoded by the parental sequence.

    [0059] Nucleic Acid: As used herein, the terms nucleic acid, nucleic acid molecule, oligonucleotide, and polynucleotide are each used herein to refer to a polymer of at least three nucleotides. In some embodiments, a nucleic acid comprises deoxyribonucleic acid (DNA). In some embodiments comprises ribonucleic acid (RNA). In some embodiments, a nucleic acid is single stranded. In some embodiments, a nucleic acid is double stranded. In some embodiments, a nucleic acid comprises both single and double stranded portions. Unless otherwise stated, the terms encompass nucleic acid-like structures with synthetic backbones, as well as amplification products. In some embodiments, nucleic acids of the present disclosure are linear nucleic acids.

    [0060] Plant part: As used herein, the term plant part refers to any part of a plant including but not limited to the embryo, shoot, root, stem, seed, stipule, leaf, petal, flower bud, flower, ovule, bract, trichome, branch, petiole, internode, bark, pubescence, tiller, rhizome, frond, blade, ovule, pollen, stamen, and the like. The two main parts of plants grown in some sort of media, such as soil or vermiculite, are often referred to as the above-ground part, also often referred to as the shoots, and the below-ground part, also often referred to as the roots. Plant part may also include certain extracts such as kief or hash which includes cannabis trichomes or glands.

    [0061] Primer: The terms primer, as used herein, typically refers to oligonucleotides that hybridize in a sequence specific manner to a complementary nucleic acid molecule (e.g., a nucleic acid molecule comprising a target sequence). In some embodiments, a primer will comprise a region of nucleotide sequence that hybridizes to at least 8, e.g., at least 10, at least 15, at least 20, at least 25, or 20 to 60 nucleotides of a target nucleic acid (i.e., will hybridize to a sequence of the target nucleic acid). In general, a primer sequence is identified as being either complementary (i.e., complementary to the coding or sense strand (+)), or reverse complementary (i.e., complementary to the anti-sense strand ()). In some embodiments, the term primer may refer to an oligonucleotide that acts as a point of initiation of a template-directed synthesis using methods such as PCR (polymerase chain reaction) under appropriate conditions (e.g., in the presence of four different nucleotide triphosphates and a polymerization agent, such as DNA polymerase in an appropriate buffer solution containing any necessary reagents and at suitable temperature(s)). Such a template directed synthesis is also called primer extension. For example, a primer pair may be designed to amplify a region of DNA using PCR. Such a pair will include a forward primer and a reverse primer that hybridize to complementary strands of a DNA molecule and that delimit a region to be synthesized and/or amplified.

    [0062] Reference: As will be understood from context, a reference sequence, sample, population, agent or individual is one that is sufficiently similar to a particular sequence, sample, population, agent or individual of interest to permit a relevant comparison (i.e., to be comparable). In some embodiments, information about a reference sample is obtained simultaneously with information about a particular sample. In some embodiments, information about a reference sample is historical. In some embodiments, information about a reference sample is stored for example in a computer-readable medium. In some embodiments, comparison of a particular sample of interest with a reference sample establishes identity with, similarity to, or difference of a particular sample of interest relative to a reference.

    [0063] Regulatory Sequence: The term regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals).

    [0064] Wild type: As used herein, the term wild-type refers to a typical or common form existing in nature; in some embodiments it is the most common form.

    DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

    [0065] The disclosure provides useful methods for characterizing certain genetic sequences of Cannabis plants. The present disclosure encompasses a recognition that amplification of a region of THCA synthase gene sequence that includes a THCA synthase gene sequence promoter and/or termination region can robustly predict the presence of a functional THCA synthase gene sequence. The present disclosure also provides a method that reliably and accurately detects a CBDA synthase gene sequence in a Cannabis plant. Methods of the present disclosure may include characterization (e.g., detection, amplification) of CDBA gene sequences, including wildtype (CDBA.sup.wt) and deletion (CDBA.sup.del) sequences.

    Cannabis Plants and Cannabinoids

    [0066] Two sub-species of Cannabis plants are C. indica and C. sativa, which are commonly distinguished based on morphology of a Cannabis plant. Generally, C. sativa plants are taller, loosely branched and have long, narrow leaves, while C. indica plants are shorter, more densely branched and have wider leaves. However, there is some doubt about the accuracy of these generalizations. Originally, classification of C. indica was made in 1785 by a French biologist named Jean-Baptiste Lamarck who observed that certain marijuana plants from India were intoxicating and could be made into hashish. In contrast, traditional hemp crops in Europe had little or no mind-altering effect. Lamark came up with the name C. indica to distinguish Indian cannabis from European hemp, which was known at the time as C. sativa. Therefore, additionally or alternatively, Cannabis plants can be characterized by production of one or more chemical metabolites (e.g., cannabinoids). In some embodiments, a Cannabis plant is characterized as having a specified level (e.g., high/low) of one or more cannabinoids, flavonoids and/or terpenes.

    [0067] Cannabinoids are terpenophenolic secondary metabolites, produced by Cannabis plants in the sessile and stalked trichomes. Trichomes are generally abundant on the inflorescences of a Cannabis plant, present in lower number on leaves, petioles and stems, and generally absent on roots and seeds. As a consequence, roots and seeds generally do not contain cannabinoids. In some embodiments, a Cannabis plant for use in a method of the present disclosure may include any plant part, such as, for example, a bloom, leaf, petiole, stem, root and/or seed.

    [0068] As an annual, cannabis plants follow a solar cycle consisting of two basic stages often referred to as vegetative, and bloom (flowering). Cannabinoid synthesis occurs predominantly in bloom (flowering) phase. In some embodiments, a Cannabis plant for use in a method of the present disclosure is in a vegetative state. In some embodiments, a Cannabis plant for use in a method of the present disclosure is in a flowering state.

    [0069] Cannabinoids such as, for example, delta-9-tetrahydrocannabinol (9-THC or THC), cannabidiol (CBD), cannabinol (CBN), cannabigerol (CBG), and cannabichromene (CBC) have been identified from Cannabis plants. In some embodiments, a cannabinoid is an aryl-substituted monoterpene. Generally, cannabinoids are lipid soluble and neutral. Cannabinoids can be divided into at least ten classes: cannabigerol, cannabichromene, cannabidiol, delta-9-tetrahydrocannabinol, delta-8-tetrahydrocannabinol, cannabicyclol, cannabielsoin, cannabinol and cannabinodiol, cannabitriol and miscellaneous cannabinoids.

    [0070] In some embodiments, C. indica plants are characterized as having high THC:CBD ratios and C. sativa plants are characterized as having high CBD:THC ratios. However, many strains produce varying amounts of cannabinoids, which may be due to hybridization, or cross breeding. Accordingly, in some embodiments, a C. sativa plant may be rich in THC and a C. indica plant may have low THC.

    [0071] Cannabis plants for use in accordance with the methods of the present disclosure may be, for example, a C. sativa plant and/or a C. indica plant. In some embodiments, a Cannabis plant may be characterized as and/or determined to be rich in one or more cannabinoids such as a cannabigerol, cannabichromene, cannabidiol, delta-9-tetrahydrocannabinol, delta-8-tetrahydrocannabinol, cannabicyclol, cannabielsoin, cannabinol and cannabinodiol, and/or cannabitriol. In some embodiments, a Cannabis plant is determined to be or characterized as rich in THC. In some embodiments, a Cannabis plant is determined to be or characterized as rich in CBD.

    [0072] In some embodiments, a Cannabis plant may be characterized as and/or determined to be expressing a low amount of one or more cannabinoids such as a cannabigerol, cannabichromene, cannabidiol, delta-9-tetrahydrocannabinol, delta-8-tetrahydrocannabinol, cannabicyclol, cannabielsoin, cannabinol and cannabinodiol, and/or cannabitriol. In some embodiments, a Cannabis plant is determined to be or characterized as low in THC. In some embodiments, a Cannabis plant is determined to be or characterized as low in CBD.

    [0073] The present disclosure also encompasses the recognition that levels of two or more cannabinoids may be related. FIG. 1 depict portions of the cannabinoid synthesis pathway. As shown in FIG. 1, Panels A and B, cannabigerolic acid is a precursor of both THCA and CBDA. THCA and CBDA each undergo non-enzymatic conversion to THC and CBD, respectively. Since both THC and CBD are synthesized from the same precursor, increased synthesis of one of these compounds may reduce synthesis of the other (e.g., by depletion of precursor). In some embodiments, the rate/amount of THC synthesis is inversely proportional to the rate/amount of CBD synthesis. Moreover, as synthesis of both THC and CBD use cannabigerolic acid, increased synthesis of either or both of these cannabinoids may reduce the amount of cannabigerolic acid. In some embodiments, the rate/amount of THC synthesis is inversely proportional to the rate/amount of cannabigerolic acid. In some embodiments, the rate/amount of CBD synthesis is inversely proportional to the rate/amount of cannabigerolic acid.

    [0074] Earlier studies proposed a model that the genes coding for functional THCA- and CBDA-synthase (referred to as Bt and Bd, respectively) are allelic and codominant. (de Meijer et al. (2003) Genetics, 163(1):335-46, PMID: 12586720, which is incorporated herein by reference). Variations in CBDA/THCA ratios could be directly related to a differential efficiency in transforming cannabigerolic acid by THCA- and CBDA-synthases. Id.

    [0075] In some embodiments, a Cannabis plant genome includes a THCA synthase gene sequence. In some embodiments, a Cannabis plant genome includes a wild-type THCA synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a wild-type THCA synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a wild-type THCA synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a variant THCA synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a variant THCA synthase gene sequence. In some embodiments, a Cannabis plant genome includes a THCA synthase gene sequence that is or comprises a sequence that is 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, or a portion thereof.

    TABLE-US-00002 ExemplaryC.sativaTHCAsynthasegenesequence SEQIDNO:1 ATGGGAACCATAATAAACTATAAAAGTCATTATGTGTACTTGCTACCATA GGCACCTATATCCCACAAACTAGCTACCATAGCCAATTTCTTTTTTGTTT CCAATATCCAATTTTTATTGATGCCAAACTATTCAATGTACAATGTACAT TTATTTTCAATAAGGGCTTCACCTAACAAAGGTGCCTAATTTTAGTTGAT TTATTTTTTATCACATGTGACTATTTAATGACTATCAAATTATAAAATAT TTAAGTCAATTTATTTGCCCCAACTCCAATATATAATATTATAAATAGGA TAGTTCTCAATTCCTAATAATTCAAAAAATCATTAGGACTGAAGAAAAAT GAATTGCTCAGCATTTTCCTTTTGGTTTGTTTGCAAAATAATATTTTTCT TTCTCTCATTCCATATCCAAATTTCAATAGCTAATCCTCGAGAAAACTTC CTTAAATGCTTCTCAAAACATATTCCCAACAATGTAGCAAATCCAAAACT CGTATACACTCAACACGACCAATTGTATATGTCTATCCTGAATTCGACAA TACAAAATCTTAGATTCATCTCTGATACAACCCCAAAACCACTCGTTATT GTCACTCCTTCAAATAACTCCCATATCCAAGCAACTATTTTATGCTCTAA GAAAGTTGGCTTGCAGATTCGAACTCGAAGCGGTGGCCATGATGCTGAGG GTATGTCCTACATATCTCAAGTCCCATTTGTTGTAGTAGACTTGAGAAAC ATGCATTCGATCAAAATAGATGTTCATAGCCAAACTGCGTGGGTTGAAGC CGGAGCTACCCTTGGAGAAGTTTATTATTGGATCAATGAGAAGAATGAGA ATCTTAGTTTTCCTGGTGGGTATTGCCCTACTGTTGGCGTAGGTGGACAC TTTAGTGGAGGAGGCTATGGAGCATTGATGCGAAATTATGGCCTTGCGGC TGATAATATTATTGATGCACACTTAGTCAATGTTGATGGAAAAGTTCTAG ATCGAAAATCCATGGGAGAAGATCTGTTTTGGGCTATACGTGGTGGTGGA GGAGAAAACTTTGGAATCATTGCAGCATGGAAAATCAAACTGGTTGATGT CCCATCAAAGTCTACTATATTCAGTGTTAAAAAGAACATGGAGATACATG GGCTTGTCAAGTTATTTAACAAATGGCAAAATATTGCTTACAAGTATGAC AAAGATTTAGTACTCATGACTCACTTCATAACAAAGAATATTACAGATAA TCATGGGAAGAATAAGACTACAGTACATGGTTACTTCTCTTCAATTTTTC ATGGTGGAGTGGATAGTCTAGTCGACTTGATGAACAAGAGCTTTCCTGAG TTGGGTATTAAAAAAACTGATTGCAAAGAATTTAGCTGGATTGATACAAC CATCTTCTACAGTGGTGTTGTAAATTTTAACACTGCTAATTTTAAAAAGG AAATTTTGCTTGATAGATCAGCTGGGAAGAAGACGGCTTTCTCAATTAAG TTAGACTATGTTAAGAAACCAATTCCAGAAACTGCAATGGTCAAAATTTT GGAAAAATTATATGAAGAAGATGTAGGAGCTGGGGTGTTGTACCCTTACG GTGGTATAATGGAGGAGATTTCAGAATCAGCAATTCCATTCCCTCATCGA GCTGGAATAATGTATGAACTTTGGTACACTGCTTCCTGGGAGAAGCAAGA AGATAATGAAAAGCATATAAACTGGGTTCGAAGTGTTTATAATTTTACGA CTCCTTATGTGTCCCAAAATCCAAGATTGGCGTATCTCAATTATAGGGAC CTTGATTTAGGAAAAACTAATCATGCGAGTCCTAATAATTACACACAAGC ACGTATTTGGGGTGAAAAGTATTTTGGTAAAAATTTTAACAGGTTAGTTA AGGTGAAAACTAAAGTTGATCCCAATAATTTTTTTAGAAACGAACAAAGT ATCCCACCTCTTCCACCGCATCATCATTAATTATCTTTAAATAGATATAT TTCCCTTATCAATTAGTTAATCATTATACCATACATACATTTATTGTATA TAGTTTATCTACTCATATTATGTATGCTCCCAAGTATGAAAATCTACATT AGAACTGTGTAGACAATCATA

    [0076] In some embodiments, a Cannabis plant genome includes a CBDA synthase gene sequence. In some embodiments, a Cannabis plant genome includes a wild-type CBDA synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a wild-type CBDA synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a wild-type CBDA synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a variant CBDA synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a variant CBDA synthase gene sequence. In some embodiments, a variant CBDA synthase gene sequence comprises a deletion. In some embodiments, a variant CBDA synthase gene sequence comprises a deletion of a sequence comprising CGTA (SEQ ID NO:3). In some embodiments, a Cannabis plant genome includes a CBDA synthase gene sequence that is or comprises a sequence that is 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2, or a portion thereof.

    TABLE-US-00003 ExemplaryC.sativaCBDAsynthasegenesequence SEQIDNO:2 GATATATATCTCACACGGATGCACCTAACAATGATGCCTAATTTTTGTGA ATTTTTTTTACCACATGACTTAATGATATCAAATTATGAAATATTTAGTT AATTTATTTGCCCCTGCTCCAATATATAAAGCTATAAATAGGATAGTTCT TAATCCATAGTAATTCAAAATTCATTAGAACTAAAGAAAAATGAAGTGCT CAACATTCTCCTTTTGGTTTGTTTGCAAGATAATATTTTTCTTTTTCTCA TTCAATATCCAAACTTCCATTGCTAATCCTCGAGAAAACTTCCTTAAATG CTTCTCGCAATATATTCCCAATAATGCAACAAATCTAAAACTCGTATACA CTCAAAACAACCCATTGTATATGTCTGTCCTAAATTCGACAATACACAAT CTTAGATTCACCTCTGACACAACCCCAAAACCACTTGTTATCGTCACTCC TTCACATGTCTCTCATATCCAAGGCACTATTCTATGCTCCAAGAAAGTTG GCTTGCAGATTCGAACTCGAAGTGGTGGTCATGATTCTGAGGGCATGTCC TACATATCTCAAGTCCCATTTGTTATAGTAGACTTGAGAAACATGCGTTC AATCAAAATAGATGTTCATAGCCAAACTGCATGGGTTGAAGCCGGAGCTA CCCTTGGAGAAGTTTATTATTGGGTTAATGAGAAAAATGAGAATCTTAGT TTGGCGGCTGGGTATTGCCCTACTGTTTGCGCAGGTGGACACTTTGGTGG AGGAGGCTATGGACCATTGATGAGAAACTATGGCCTCGCGGCTGATAATA TCATTGATGCACACTTAGTCAACGTTCATGGAAAAGTGCTAGATCGAAAA TCTATGGGGGAAGATCTCTTTTGGGCTTTACGTGGTGGTGGAGCAGAAAG CTTCGGAATCATTGTAGCATGGAAAATTAGACTGGTTGCTGTCCCAAAGT CTACTATGTTTAGTGTTAAAAAGATCATGGAGATACATGAGCTTGTCAAG TTAGTTAACAAATGGCAAAATATTGCTTACAAGTATGACAAAGATTTATT ACTCATGACTCACTTCATAACTAGGAACATTACAGATAATCAAGGGAAGA ATAAGACAGCAATACACACTTACTTCTCTTCAGTTTTCCTTGGTGGAGTG GATAGTCTAGTCGACTTGATGAACAAGAGTTTTCCTGAGTTGGGTATTAA AAAAACGGATTGCAGACAATTGAGCTGGATTGATACTATCATCTTCTATA GTGGTGTTGTAAATTACGACACTGATAATTTTAACAAGGAAATTTTGCTT GATAGATCCGCTGGGCAGAACGGTGCTTTCAAGATTAAGTTAGACTACGT TAAGAAACCAATTCCAGAATCTGTATTTGTCCAAATTTTGGAAAAATTAT ATGAAGAAGATATAGGAGCTGGGATGTATGCGTTGTACCCTTACGGTGGT ATAATGGATGAGATTTCAGAATCAGCAATTCCATTCCCTCATCGAGCTGG AATCTTGTATGAGTTATGGTACATATGTAGTTGGGAGAAGCAAGAAGATA ACGAAAAGCATCTAAACTGGATTAGAAATATTTATAACTTCATGACTCCT TATGTGTCCAAAAATCCAAGATTGGCATATCTCAATTATAGAGACCTTGA TATAGGAATAAATGATCCCAAGAATCCAAATAATTACACACAAGCACGTA TTTGGGGTGAGAAGTATTTTGGTAAAAATTTTGACAGGCTAGTAAAAGTG AAAACCCTGGTTGATCCCAATAACTTTTTTAGAAACGAACAAAGCATCCC ACCTCTTCCACGGCATCGTCATTAATGATCTTAAATAGATCTTTTTCTCT TATTAATTAGTCCTTATAATATACATATATTGATTATATATATAAAAATA GTTTGTCCGGGTGTACTGTGTATGCGATATATATCTCACAC

    [0077] In some embodiments, a Cannabis plant genome includes an olivetol synthase gene sequence. In some embodiments, a Cannabis plant genome includes a wild-type olivetol synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a wild-type olivetol synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a wild-type olivetol synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a variant olivetol synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a variant olivetol synthase gene sequence. In some embodiments, a Cannabis plant genome includes an olivetol synthase gene sequence that is or comprises a sequence that is 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 4, or a portion thereof.

    TABLE-US-00004 ExemplaryC.sativaolivetolsynthasegene sequence SEQIDNO:4 ATGAATCATCTTCGTGCTGAGGGTCCGGCCTCCGTTCTCGCCATTGGCAC CGCCAATCCGGAGAACATTTTATTACAAGATGAGTTTCCTGACTACTATT TTCGCGTCACCAAAAGTGAACACATGACTCAACTCAAAGAAAAGTTTCGA AAAATATGTGACAAAAGTATGATAAGGAAACGTAACTGTTTCTTAAATGA AGAACACCTAAAGCAAAACCCAAGATTGGTGGAGCACGAGATGCAAACTC TGGATGCACGTCAAGACATGTTGGTAGTTGAGGTTCCAAAACTTGGGAAG GATGCTTGTGCAAAGGCCATCAAAGAATGGGGTCAACCCAAGTCTAAAAT CACTCATTTAATCTTCACTAGCGCATCAACCACTGACATGCCCGGTGCAG ACTACCATTGCGCTAAGCTTCTCGGACTGAGTCCCTCAGTGAAGCGTGTG ATGATGTATCAACTAGGCTGTTATGGTGGTGGAACCGTTCTACGCATTGC CAAGGACATAGCAGAGAATAACAAAGGCGCACGAGTTCTCGCCGTGTGTT GTGACATAATGGCTTGCTTGTTTCGTGGGCCTTCAGAGTCTGACCTCGAA TTACTAGTGGGACAAGCTATCTTTGGTGATGGGGCTGCTGCGGTGATTGT TGGAGCTGAACCCGATGAGTCAGTTGGGGAAAGGCCGATATTTGAGTTGG TGTCAACTGGGCAAACAATCTTACCAAACTCGGAAGGAACTATTGGGGGA CATATAAGGGAAGCAGGACTGATATTTGATTTACATAAGGATGTGCCTAT GTTGATCTCTAATAATATTGAGAAATGTTTGATTGAGGCATTTACTCCTA TTGGGATTAGTGATTGGAACTCCATATTTTGGATTACACACCCAGGTGGG AAAGCTATTTTGGACAAAGTGGAGGAGAAGTTGCATCTAAAGAGTGATAA GTTTGTGGATTCACGTCATGTGCTGAGTGAGCATGGGAATATGTCTAGCT CAACTGTCTTGTTTGTTATGGATGAGTTGAGGAAGAGGTCGTTGGAGGAA GGGAAGTCTACCACTGGAGATGGATTTGAGTGGGGTGTTCTTTTTGGGTT TGGACCAGGTTTGACTGTCGAAAGAGTGGTCGTGCGTAGTGTTCCCATCA AATATTAA

    [0078] In some embodiments, a Cannabis plant genome includes a divarinic acid synthase gene sequence. In some embodiments, a Cannabis plant genome includes a wild-type divarinic acid synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a wild-type divarinic acid synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a wild-type divarinic acid synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a variant divarinic acid synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a variant divarinic acid synthase gene sequence.

    [0079] In some embodiments, a Cannabis plant genome includes a limonene synthase gene sequence. In some embodiments, a Cannabis plant genome includes a wild-type limonene synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a wild-type limonene synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a wild-type limonene synthase gene sequence. In some embodiments, a Cannabis plant genome is homozygous for a variant limonene synthase gene sequence. In some embodiments, a Cannabis plant genome is heterozygous for a variant limonene synthase gene sequence. In some embodiments, a Cannabis plant genome includes a limonene synthase gene sequence that is or comprises a sequence that is 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 5, or a portion thereof.

    TABLE-US-00005 ExemplaryC.sativalimonenesynthasegene sequence SEQIDNO:5 ATGCAGTGCATAGCTTTTCACCAATTTGCTTCATCATCATCCCTCCCTAT TTGGAGTAGTATTGATAATCGTTTTACACCAAAAACTTCTATTACTTCTA TTTCAAAACCAAAACCAAAACTAAAATCAAAATCAAACTTGAAATCGAGA TCGAGATCAAGTACTTGCTACTCCATACAATGTACTGTGGTCGATAACCC TAGTTCTACGATTACTAATAATAGTGATCGAAGATCAGCCAACTATGGAC CTCCCATTTGGTCTTTTGATTTTGTTCAATCTCTTCCAATCCAATATAAG GGTGAATCTTATACAAGTCGATTAAATAAGTTGGAGAAAGATGTGAAAAG GATGCTAATTGGAGTGGAAAACTCTTTAGCCCAACTTGAACTAATTGATA CAATACAAAGACTTGGAATATCTTATCGTTTTGAAAATGAAATCATTTCT ATTTTGAAAGAAAAATTCACCAATAATAATGACAACCCTAATCCTAATTA TGATTTATATGCTACTGCTCTCCAATTTAGGCTTCTACGCCAATATGGAT TTGAAGTACCTCAAGAAATTTTCAATAATTTTAAAAATCACAAGACAGGA GAGTTCAAGGCAAATATAAGTAATGATATTATGGGAGCATTGGGCTTATA TGAAGCTTCATTCCATGGGAAAAAGGGTGAAAGTATTTTGGAAGAAGCAA GAATTTTCACAACAAAATGTCTCAAAAAATACAAATTAATGTCAAGTAGT AATAATAATAATATGACATTAATATCATTATTAGTGAATCATGCTTTGGA GATGCCACTTCAATGGAGAATCACAAGATCAGAAGCTAAATGGTTTATTG AAGAAATATATGAAAGAAAACAAGACATGAATCCAACTTTACTTGAGTTT GCCAAATTGGATTTCAATATGCTGCAATCAACATATCAAGAGGAGCTCAA AGTACTCTCTAGGTGGTGGAAGGATTCTAAACTTGGAGAGAAATTGCCTT TCGTTAGAGATAGATTGGTGGAGTGTTTCTTATGGCAAGTTGGAGTAAGA TTTGAGCCACAATTCAGTTACTTTAGAATAATGGATACAAAACTCTATGT TCTATTAACAATAATTGATGATATGCATGACATTTATGGAACATTGGAGG AACTACAACTTTTCACTAATGCTCTTCAAAGATGGGATTTGAAAGAATTA GATAAATTACCAGATTATATGAAGACAGCTTTCTACTTTACATACAATTT CACAAATGAATTGGCATTTGATGTATTACAAGAACATGGTTTTGTTCACA TTGAATACTTCAAGAAACTGATGGTAGAGTTGTGTAAACATCATTTGCAA GAGGCAAAATGGTTTTATAGTGGATACAAACCAACATTGCAAGAATATGT TGAGAATGGATGGTTGTCTGTGGGAGGACAAGTTATTCTTATGCATGCAT ATTTCGCTTTTACAAATCCTGTTACCAAAGAGGCATTGGAATGTCTAAAA GACGGTCATCCTAACATAGTTCGCCATGCATCGATAATATTACGACTTGC AGATGATCTAGGAACATTGTCGGATGAACTGAAAAGAGGCGATGTTCCTA AATCAATTCAATGTTATATGCACGATACTGGTGCTTCTGAAGATGAAGCT CGTGAGCACATAAAATATTTAATAAGTGAATCATGGAAGGAGATGAATAA TGAAGATGGAAATATTAACTCTTTTTTCTCAAATGAATTTGTTCAAGTTT GCCAAAATCTTGGTAGAGCGTCACAATTCATATACCAGTATGGCGATGGA CATGCTTCTCAGAATAATCTATCGAAAGAGCGCGTTTTAGGGTTGATTAT TACTCCTATCCCCATGTAA

    [0080] Classification of Cannabis

    [0081] Provided herein is a recognition that certain genotypes are associated with altered cannabinoid synthesis or an altered cannabinoid profile. Genetic information can positively benefit consumers, growers, and regulators of Cannabis. There are at least several hundred compounds found in Cannabis and currently only a fraction of these compounds are analyzed. As used herein, chemotype of a Cannabis plant refers to an abundance and/or deficiency of one or more compounds found in a Cannabis plant (e.g., cannabinoids, flavonoids and/or terpenes). In some embodiments, a chemotype is an abundance of one or more cannabinoids, flavonoids and/or terpenes. In some embodiments, a chemotype is a relative amount of two or more cannabinoids, flavonoids and/or terpenes.

    [0082] Chemotype determination has been limited as quantitative analytical techniques and standards do not currently exist for all Cannabis compounds. As a result, previously described chemotypes fail to capture the chemical and potential medicinal complexity in a Cannabis plant. The present disclosure encompasses a recognition that genetic analysis, for example, of one, two, three, four, five or more synthetic enzymes, can serve as a proxy for unmeasured chemical complexity.

    [0083] The present disclosure encompasses the recognition that genetic analysis can be used to assess the potential of a Cannabis plant to produce certain compounds, such as cannabinoids, flavonoids and/or terpenes. While a Cannabis plant can be raised under conditions that result in varied expression and/or concentrations of certain compounds, the relative ratios of key chemotypic gene sequences, such as, for example, THCA synthase and CBDA synthase, are usually genetically determined. For example, there are currently no known agricultural methods to make a CBD-dominant Cannabis strain become a THC-dominant Cannabis strain via environmental conditions. These critical chemotypes are governed by genetic alterations in their respective enzymatic synthases (e.g., CDBA synthase and THCA synthase).

    [0084] In some embodiments, methods of the present disclosure include genetic analysis of one, two, three, four, five or more enzymes involved in the production of cannabinoids, flavonoids and/or terpenes. In some embodiments, methods of the present disclosure include amplification of a genomic region that encodes an enzyme involved in the production of a cannabinoid, flavonoid and/or terpene. In some embodiments, methods of the present disclosure include amplification of a plurality of genomic regions that encode enzymes involved in the production of a cannabinoid, flavonoid and/or terpene. In some embodiments, methods include amplification of a portion of a gene sequence that encodes an enzyme involved in the production of a cannabinoid, flavonoid and/or terpene.

    [0085] Genetic prediction of cannabinoid production has been an active area of study. See, for example, Weiblen et al., (2015), The New Phytologist, PMID: 26189495; Marks et al., (2009) Journal of Experimental Botany, 60(13):3715-26, PMID: 19581347; Onofri et al., (2015) Phytochemistry, 116:57-68, PMID: 25865737; de Meijer et al. (2003) Genetics, 163(1):335-46, PMID: 12586720; and Kojoma et al. (2006), Forensic Sci. Int, 159(2-3):132-40, PMID: 16143478, each of which is incorporated herein by reference. However, there are significant caveats and shortcomings with prior methods of genetic prediction of cannabinoid production. For example, while alleles of Bt (functional THCA synthase) and Bd (functional CBDA synthase) have been proposed as a model for generating Type I, II, III, and IV plants, the exact DNA sequences that govern these alleles remain unknown. As described in the examples herein, single molecule sequencing was performed to identify mutations in gene sequences in cannabinoid synthesis pathway enzyme(s) (e.g., THCA synthase and CBDA synthase). This sequencing revealed a more refined structure of inheritance and numerous additional subtypes that can be identified by genotyping to predict chemical inheritance. See, FIG. 2.

    [0086] Kitamura describes amplification of a small region of THCA synthase to resolve hemp from drug-type (i.e., THC expressing) strains. Kitamura et al., (2017) Journal of natural medicines, 71(1):86-95, PMID: 27535292 and Kitamura et al., (2016) Biological & pharmaceutical bulletin, 39(7):1144-9, PMID: 27118244, each of which is incorporated herein by reference. However, the present disclosure recognizes that these studies only tested 3 cultivars and also failed to consider CBDA status. The present disclosure encompasses a recognition that an understanding CBDA status is critical for determining allelic balance of CBDA and THCA synthases, which may be important for Cannabis breeding efforts.

    [0087] Cannabis genomes are about 10 fold more variable than human genomes. Moreover, a given Cannabis strain is often capable of crossing with highly divergent Cannabis strains (e.g., Cannabis strains of a different chemotype, genotype, etc.). As a result, even sibling strains cannot be not be assumed to have the same chemotype. The present disclosure provides methods and kits suitable for genetic characterization of individual Cannabis plants.

    [0088] In some embodiments, a method includes detection of one or a plurality of sequences that include a gene sequence or portion thereof in a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a gene sequence encodes an enzyme involved in the synthesis of one or more cannabinoids.

    [0089] In some embodiments, a method of the present disclosure includes detecting the presence of a tetrahydrocannabinolic acid (THCA) synthase gene sequence or a portion thereof. The present disclosure encompasses the recognition that THCA synthase is under selective breeding pressure and has approximately a 4 fold higher polymorphism rate than a Cannabis genome in general. Moreover, a THCA synthase gene sequence can include a SNP approximately every 25 nucleotides, which complicates design of primers that anneal within the open reading frame of THCA synthase. In some embodiments, a THCA synthase gene sequence encodes a wildtype THCA synthase enzyme (i.e., functional). In some embodiments, a THCA synthase gene sequence includes a THCA synthase gene sequence promoter sequence. In some embodiments, a THCA synthase gene sequence includes a THCA synthase gene sequence 5 UTR sequence.

    [0090] In some embodiments, a method of the present disclosure includes amplifying a THCA synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, amplification of a THCA synthase gene sequence includes contacting nucleic acid from a Cannabis plant with a forward THCA synthase primer that is complementary to a sequence that is 200-1000 nucleotides upstream of a THCA open reading frame. In some embodiments, a forward THCA synthase primer is complementary to a sequence that is 200 to 800 nucleotides, 200 to 600 nucleotides, 200 to 400 nucleotides upstream of a THCA open reading frame. In some certain embodiments, a forward THCA synthase primer is complementary to a sequence that is at least 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a portion of SEQ ID NO: 6. In some certain embodiments, a forward THCA synthase primer is at 20 to 60 nucleotides long.

    TABLE-US-00006 ExemplaryC.sativasequenceupstreamofTHCA synthaseopenreadingframe SEQIDNO:6 CATAGCGACTATCGTGATGGGAACCATAATAAACTATAAAAGTCATTAT GTGTACTTGCTACCATAGGCACCTATATCCCACAAACTAGCTACCATAG CCAATTTCTTTTTTGTTTCCAATATCCAATTTTTATTGATGCCAAACTA TTCAATGTACAATGTACATTTATTTTCAATAAGGGCTTCACCTAACAAA GGTGCCTAATTTTAGTTGATTTATTTTTTATCACATGTGACTATTTAAT GACTATCAAATTATAAAATATTTAAGTCAATTTATTTGCCCCAACTCCA ATATATAATATTATAAATAGGATAGTTCTCAATTCCTAATAATTCAAAA AATCATTA

    [0091] In some embodiments, amplification of a THCA synthase gene sequence includes contacting nucleic acid from a Cannabis plant with a reverse THCA synthase primer that is complementary to a sequence that is 200-1000 nucleotides downstream of a THCA open reading frame. In some embodiments, a reverse THCA synthase primer is complementary to a sequence that is 200 to 800 nucleotides, 200 to 600 nucleotides, 200 to 400 nucleotides downstream of a THCA open reading frame. In some certain embodiments, a reverse THCA synthase primer is complementary to a sequence that is at least 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a portion of SEQ ID NO: 7. In some certain embodiments, a reverse THCA synthase primer is about 20 to 60 nucleotides long.

    TABLE-US-00007 ExemplaryC.sativasequencedownstreamofTHCA synthaseopenreadingframe SEQIDNO:7 TTATCAATTAGTTAATCATTATACCATACATACATTTATTGTATATAGTT TATCTACTCATATTATGTATGCTCCCAAGTATGAAAATCTACATTAGAAC TGTGTAGACAATCATACATAGCGACTATCGTG

    [0092] In some embodiments, amplification of a THCA synthase gene sequence includes contacting nucleic acid from a Cannabis plant with two or more primers that are at least 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 8-12.

    [0093] In some embodiments, a method of the present disclosure includes detecting the presence of a variant THCA synthase gene sequence in a sample that comprises nucleic acid from the Cannabis plant. In some embodiments, a method of the present disclosure includes amplifying a variant THCA synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant.

    [0094] In some embodiments, a method of the present disclosure includes detecting the presence of a mutated THCA synthase gene sequence in a sample that comprises nucleic acid from the Cannabis plant. In some embodiments, a mutated THCA synthase gene sequence includes at least one mutation that alters the activity of a THCA synthase encoded by the mutated THCA synthase gene sequence relative to a THCA synthase encoded by a wild-type THCA synthase gene sequence.

    [0095] In some embodiments, a method of the present disclosure includes detecting the presence of a polymorphism within a THCA synthase gene sequence in a sample that comprises nucleic acid from the Cannabis plant. In some embodiments, a polymorphism within a THCA synthase gene sequence is or comprises one or more variants as described in FIG. 3 and/or FIG. 10. FIG. 10 prevents a chart describing certain Single Nucleotide Polymorphism (SNP) variants of THCA synthase in different Cannabis plant strains (indicated by accession code). SNPs that result in an amino acid change are indicated in bold, and the type of change is with the corresponding position in the amino acid sequence is indicated in the bottom row. In the last column is provided the proportion of THC(V)A product of the total cannabinoid fraction that is accumulated in each Cannabis plant variant. In some embodiments, a THCA synthase gene sequence is or comprises a I63L variant, a V125L variant, a E236Q variant, a A250D variant, a E265G variant, and/or a G410Evariant. In some certain embodiments, a THCA synthase gene sequence is or comprises a A411V variant.

    [0096] In some embodiments, a method of the present disclosure includes detecting the presence of a wild-type cannabidiolic acid (CBDA.sup.WT) synthase gene sequence in a sample that comprises nucleic acid from the Cannabis plant. In some embodiments, a method of the present disclosure includes amplifying a CBDA.sup.WT synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant.

    [0097] In some embodiments, a method of the present disclosure includes detecting the presence of a mutated cannabidiolic acid (CBDA.sup.mut) synthase gene sequence in a sample that comprises nucleic acid from the Cannabis plant, wherein the mutated CBDA synthase gene sequence comprises a deletion mutation. In some embodiments, a CBDA.sup.del sequence includes or comprises a deletion of CGTA (SEQ ID NO:3). In some embodiments, a method of the present disclosure includes amplifying a CBDA.sup.mut synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes amplifying a CBDA.sup.del synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant.

    [0098] In some embodiments, a method of the present disclosure includes detecting a combination of two or more genomic sequences selected from: a THCA synthase gene sequence, a variant or mutant THCA synthase gene sequence, a CBDA.sup.WT synthase, and CBDA.sup.mut synthase gene sequence. In some embodiments, a method of the present disclosure includes amplifying two or more genomic sequences selected from: a THCA synthase gene sequence, a variant or mutant THCA synthase gene sequence, a CBDA.sup.WT synthase, and CBDA.sup.mut synthase gene sequence, from a sample that comprises nucleic acid from a Cannabis plant.

    [0099] In some embodiments, a method of the present disclosure includes detecting the presence of an olivetol synthase gene sequence in a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes amplifying an olivetol synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes detecting the presence of a variant olivetol synthase gene sequence in a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes amplifying a variant olivetol synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant.

    [0100] In some embodiments, a method of the present disclosure includes detecting the presence of a divarinic acid synthase gene sequence in a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes amplifying a divarinic acid synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes detecting the presence of a variant divarinic acid synthase gene sequence in a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes amplifying a variant divarinic acid synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant.

    [0101] In some embodiments, a method of the present disclosure includes detecting the presence of a limonene synthase gene sequence in a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes amplifying a limonene synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes detecting the presence of a variant limonene synthase gene sequence in a sample that comprises nucleic acid from a Cannabis plant. In some embodiments, a method of the present disclosure includes amplifying a variant limonene synthase gene sequence or portion thereof from a sample that comprises nucleic acid from a Cannabis plant.

    [0102] In some embodiments, a method of the present disclosure includes detecting a combination of two, three, four, five, six, seven, eight, or more genomic sequences selected from: a THCA synthase gene sequence, a variant or mutant THCA synthase gene sequence, a CBDA.sup.WT synthase, and CBDA.sup.mut synthase gene sequence. In some embodiments, a method of the present disclosure includes amplifying two or more genomic sequences selected from: a THCA synthase gene sequence, a variant or mutant THCA synthase gene sequence, a CBDA.sup.WT synthase, a CBDA.sup.mut synthase gene sequence, a olivetol synthase gene sequence, a variant olivetol synthase gene sequence, a divarinic acid synthase gene sequence, a variant divarinic acid synthase gene sequence, a limonene synthase gene sequence, and a variant limonene synthase gene sequence from a sample that comprises nucleic acid from the Cannabis plant.

    Methods for Genotyping Cannabis

    [0103] In vitro nucleic acid amplification technique can be used for genotyping Cannabis plants. In vitro nucleic acid amplification techniques can be grouped according to the temperature requirements of the procedure. For example, polymerase chain reaction (PCR) is the most popular method as a technique of amplifying nucleic acid in vitro. PCR has high sensitivity based on the effect of exponential amplification. Further, since a PCR amplification product can be recovered as DNA, this method is applied widely for genetic engineering techniques such as gene sequence cloning and structural determination. In PCR, however, temperature cycling or a special temperature controller is necessary for practice; the exponential progress of the amplification reaction causes a problem in quantification. Other PCR-based amplification techniques include, for example, transcription-based amplification (D. Y. Kwoh, et at. 1989. Proc. Natl. Acad Sci. USA 86, 1173-1177, which is incorporated herein by reference), ligase chain reaction (LCR; D. Y. Wu, et al. 1989. Genomics 4, 560-569; K. Barringer, et al. 1990. Gene 89, 117-122; F. Barany. 1991. Proc. Natl. Acad. Sci. USA 88, 189-193, each of which are incorporated herein by reference), and restriction amplification (U.S. Pat. No. 5,102,784, which is incorporated herein by reference).

    [0104] More recently, a number of isothermal nucleic acid amplification techniques have been developed. That is, these techniques do not rely on thermocycling to drive nucleic acid amplification. Isothermal amplification techniques typically utilize DNA polymerases with strand-displacement activity, thus eliminating the high temperature melt cycle that is required for PCR. This allows isothermal techniques to be faster and more energy efficient than PCR, and also allows for more simple and thus lower cost instrumentation since rapid temperature cycling is not required. For example, methods such as Strand Displacement Amplification (SDA; Walker, et at., (1992) Proc. Natl. Acad. Sci. USA 89: 392-396; Walker, et al., (1992) Nuc. Acids. Res. 20:1691-1696; U.S. Pat. No. 5,648,211 and EP 0 497 272, each of which is incorporated herein by reference); self-sustained sequence replication (3SR; J. C. Guatelli, et al., (1990) Proc. Natl. Acad. Sci. USA, 87: 1874-1878, which is incorporated herein by reference); and Q replicase system (Lizardi, et al., (1988) BioTechnology, 6: 1197-1202, which is incorporated herein by reference) are isothermal reactions. See also, Nucleic Acid Isothermal Amplification TechnologiesA Review. Nucleosides, Nucleotides and Nucleic Acids (2008) v27(3):224-243, which is incorporated herein by reference.

    [0105] In some embodiments, an in vitro nucleic acid amplification assay for use in the methods of the present disclosure is an isothermal amplification method. Isothermal amplification methods include, for example, transcription mediated amplification (TMA) or self-sustained sequence replication (3SR), nucleic acid sequence-based amplification (NASBA), signal mediated amplification of RNA technology (SMART), strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification of DNA (LAMP), isothermal multiple displacement amplification (IMDA), helicase-dependent amplification (HDA), single primer isothermal amplification (SPIA), and circular helicase-dependent amplification (cHDA))

    [0106] LAMP Assay

    [0107] It is envisioned that LAMP amplification assays as described herein will provides a rapid and scalable means to resolve chemotypes of Cannabis plants. In some embodiments, an in vitro nucleic acid amplification assay for use in the methods of the present disclosure is Loop-Mediated Isothermal Amplification (LAMP). Typically, LAMP reactions use a strand-displacing DNA polymerase with four to six primers, which can result in exponential amplification of a target sequence.

    [0108] In LAMP, a target sequence is amplified at a constant temperature. In some embodiments, a LAMP reaction temperature is between 37 C. and 75 C. In some embodiments, a LAMP reaction temperature is between 50 C. and 70 C. In some embodiments, a LAMP reaction temperature is between 55 C. and 65 C. In some embodiments, a LAMP reaction temperature is between 60 C. and 65 C. In some embodiments, a LAMP reaction uses two or three primer sets, and a polymerase with high strand displacement activity in addition to a replication activity. (See Nagamine et al., (2002) Mol. Cell. Probes 16 (3): 223-9; and U.S. Pat. No. 6,410,278, each of which is incorporated herein by reference).

    [0109] LAMP was originally invented and formulated as an isothermal amplification with a requirement for four primers: two loop-generating primers (FIP and BIP comprising F1, F2 and B1, B2 priming sites, correspondingly) and two Displacement primers (F3 and B3). In order to increase the speed of LAMP-based assays additional Loop primers were added in conjunction with the other primers used in LAMP, which resulted in significantly faster assays.

    [0110] In some embodiments, LAMP amplification of a THCA synthase gene sequence includes contacting nucleic acid from a Cannabis plant with four or more primers that are at least 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 8-12.

    [0111] In some embodiments, LAMP amplification of a CBDA synthase gene sequence includes contacting nucleic acid from a Cannabis plant with four, five, or six, or more primers that are at least 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 13-18 and 27.

    [0112] In some embodiments, LAMP amplification of a CBDA.sup.mut (CBDA.sup.del) synthase gene sequence includes contacting nucleic acid from a Cannabis plant with four, five, or six, or more primers that are at least 70%, 75%, 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 13, 15-19, and 27.

    [0113] In some embodiments, a LAMP amplification assay as described herein is a colorimetric LAMP assay.

    [0114] Due to the specific nature of the action of these primers, the amount of DNA produced in LAMP is considerably higher than PCR based amplification. The reaction can be followed in real-time either by measuring the turbidity or by fluorescence using intercalating dyes. Dye molecules intercalate or directly label the DNA, and in turn can be correlated to the number of copies initially present. Hence, LAMP can also be quantitative. Thus, LAMP provides major advantages due to its simplicity, ruggedness, and low cost, and has the potential to be used as a simple screening assay in the field or at the point of care by clinicians.

    [0115] Primer design for LAMP assays generally involves selection of eight separate regions of a target nucleic acid sequence (the FIP and BIP primers encompass two primer binding sites each), with BIP/FIP and Loop primers having significant restrictions on their positioning respective to each other. Loop primers are positioned between B2 and B1 sites and F2 and F1 sites, respectively, and must be orientated in a particular direction. Further, significant care must be taken in primer design to avoid primer-dimers between the six primers (which can be especially difficult as the FIP and BIP primers are generally greater than 40 nucleotides long). As a consequence, LAMP primer design is extremely challenging, especially when targeting highly polymorphic markers and sequences containing complex secondary structure. At least in part because primer design for LAMP is subject to numerous constraints, software is generally used to assist with LAMP primer design.

    [0116] LAMP has been observed to be less sensitive than PCR to inhibitors in complex samples such as blood, likely due to use of a different DNA polymerase (typically Bst DNA polymerase rather than Taq polymerase as in PCR). LAMP is useful primarily as a diagnostic or detection technique, but is generally not useful for some molecular biology applications enabled by PCR, such as, for example, cloning.

    [0117] Also, multiplexing approaches for LAMP are relatively undeveloped. The larger number of primers per target in LAMP increases the likelihood of primer-primer interactions for multiplexed target sets. The product of LAMP is a series of concatemers of the target region, giving rise to a characteristic ladder or banding pattern on a gel, rather than a single band as with PCR. Although this is not a problem when detecting single targets with LAMP, traditional (endpoint) multiplex PCR applications wherein identity of a target is confirmed by size of a band on a gel are not feasible with LAMP. Multiplexing in LAMP has been achieved by choosing a target region with a restriction site, and digesting prior to running on a gel, such that each product gives rise to a distinct size of fragment, although this approach adds complexity to the experimental design and protocol. The use of a strand-displacing DNA polymerase in LAMP also precludes the use of hydrolysis probes, e.g. TaqMan probes, which rely upon the 5-3 exonuclease activity of Taq polymerase.

    [0118] In some embodiments, a modified LAMP technique called LAMP-STEM is used in a method of the present disclosure. LAMP-STEM system utilizes Stem primers, which are directed to the stem portion of the LAMP amplicon (or dumbbell). Stem primers can be used as an alternative to LAMP Loop primers. When used in addition to loop-generating and displacement primers, Stem primers offer similar benefits in speed and sensitivity to the Loop primers. (See Gandelman et al., Loop-Mediated Amplification Accelerated by Stem Primers. Int. J. Mol. Sci. 2011, v12:9108-9124, and US 2012/0157326, each of which is incorporated herein by reference). This beneficial effect of Stem primers is surprising as they do not bind to the single-stranded DNA loops, which define the very nature of the LAMP technology. Stem primers can be employed in either orientation, do not require either the B2/B1 or F2/F1 sites to be a specific distance apart, can be multiplexed, and allow the F1 and B1 sites to be positioned further from each other than in LAMP.

    [0119] Stem primers significantly accelerate LAMP comprised of loop-generating and displacement primers only. They can be used on their own or synergistically with other Stem primers or even Loop primers. Addition of Stem primers into LAMP has a positive effect on both speed and sensitivity. In some cases they improve reproducibility at low copy number. The action of Stem primers can be rationalized via the proposed mechanism of LAMP. They anneal to transiently single-stranded regions of the amplicon and recopy the entire binding sites for the BIP/FIP primers. An additional unique feature is the extra strong intra-molecular self-priming when Stem primers delimit amplicon.

    [0120] In general, positioning of Stem primers is less constrained than that of Loop primers. A rather challenging primer design involving selection of at least eight binding sites is thus simplified. Furthermore, Stem primers impose fewer limitations on the primer design in terms of stem length, orientation and distances between B1-B2 and F1-F2 sites. In contradiction to the postulated LAMP mechanism that relies on the involvement of displacement primers Stem primers can occasionally allow displacement primers not to be used at all, though it is not clear why this is so. This has a major implication for primer design, as it allows the ability to omit one displacement primer or even both, if necessary.

    [0121] qPCR

    [0122] In some embodiments, an in vitro nucleic acid amplification assay for use in the methods of the present disclosure is qPCR. Real-time quantitative polymerase chain reaction (qPCR) determines, the fractional cycle number (C.sub.t) at which the well's rising fluorescence (proportional to product formation) crosses a set threshold that is several standard deviations above the baseline fluorescence (Higuchi, et al., (1993) Kinetic PGR analysis: real-time monitoring of DNA amplification reactions, Biotechnology (NY), 11: 1026-1030, which is incorporated by reference in its entirety). The C.sub.t versus log (amount of input target DNA) plot is linear, allowing relative quantitation of unknowns by comparison to a standard curve derived from amplifying, in the same plate, serial dilutions of a reference DNA sample.

    [0123] In some embodiments, a qPCR assay is normalized, for example, a signal from a target sequence can be normalized to a signal from a reference sequence. In some embodiments, a target sequence and reference sequence are measured in separate (monoplex) reactions. In some embodiments, a reaction includes a dye that fluoresces upon intercalation into any double-stranded DNA, e.g., ethidium bromide or SYBR Green I, etc. In some embodiments, a target sequence and reference sequence are measured in the same reaction vessel via a multicolor multiplex qPCR. In some embodiments, a multiplex qPCR uses separate fluorescent dyes with distinct excitation/emission spectra for each of the DNA sequences being quantified (Wittwer, et al., (2001) Real-time multiplex PCR assays. Methods, 25, 430-442, which is incorporated by reference in its entirety).

    Kits

    [0124] In some embodiments, the present disclosure provides kits comprising materials useful for amplification and detection and/or sequencing of Cannabis plant nucleic acid (e.g., DNA). In some embodiments, Cannabis plant nucleic acid sample includes detection of all or part of a THCA synthase gene sequence and/or a CBDA synthase gene sequence as described herein. In some embodiments, a kit in accordance of the present disclosure is portable.

    [0125] Suitable amplification reaction reagents that can be included in an inventive kit include, for example, one or more of: buffers; enzymes having polymerase activity; enzyme cofactors such as magnesium or manganese; salts; nicotinamide adenide dinuclease (NAD); and deoxynucleoside triphosphates (dNTPs) such as, for example, deoxyadenosine triphospate; deoxyguanosine triphosphate, deoxycytidine triphosphate and deoxythymidine triphosphate, biotinylated dNTPs, suitable for carrying out the amplification reactions.

    [0126] In some embodiments, a kit comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more primer sequences for in vitro nucleic acid amplification. Primer sequences may be suitable for in vitro nucleic acid amplification with any of the methods described herein (e.g., QT-PCR, LAMP, etc.). In some embodiments, a kit of the present disclosure includes reagents suitable to perform a colorimetric LAMP assay for amplification of one or more Cannabis gene sequences as described herein.

    [0127] Depending on the procedure, a kit may further include one or more of: wash buffers and/or reagents, hybridization buffers and/or reagents, labeling buffers and/or reagents, and detection means. The buffers and/or reagents included in a kit are preferably optimized for the particular amplification/detection technique for which a kit is intended. Protocols for using these buffers and reagents for performing different steps of the procedure may also be included in a kit.

    [0128] In some embodiments, a kit may further include one or more reagents for preparation of nucleic acid from a plant sample. For example, a kit may further include one or more of a lysis buffer, a DNA preparation solution (e.g., a solution for extraction and/or purification of DNA). Kits may also contain reagents for the isolation of nucleic acids from biological specimen prior to amplification. Protocols for using these reagents for performing different steps of the procedure may also be included in a kit.

    [0129] Furthermore, kits may be provided with an internal control as a check on the amplification procedure and to prevent occurrence of false negative test results due to failures in the amplification procedure. An optimal control sequence is selected in such a way that it will not compete with the target nucleic acid sequence in the amplification reaction (as described above).

    [0130] In some embodiments, a kit may further include reagents for an amplification assay to characterize the gender of a Cannabis plant.

    [0131] Reagents may be supplied in a solid (e.g., lyophilized) or liquid form. Kits of the present disclosure may optionally comprise different containers (e.g., vial, ampoule, test tube, flask or bottle) for each individual buffer and/or reagent. In some embodiments, each component will generally be suitable as aliquoted in its respective container or provided in a concentrated form. Other containers suitable for conducting certain steps of inventive amplification/detection assay(s) may also be provided. Individual containers of a kit are preferably maintained in close confinement for commercial sale.

    [0132] A kit may also comprise instructions for using the amplification reaction reagents, primer sets, primer/probe sets according to the present disclosure. Instructions for using a kit according to one or more methods of the present disclosure may comprise instructions for processing the biological sample, extracting nucleic acid molecules, and/or performing one or more amplification reactions; and/or instructions for interpreting results. In some embodiments, a kit may comprise instruction for determining, assessing and/or classifying a Cannabis plant used in the described methods as a Type Ia, Type Ib, Type IIa, Type IIb, Type IIc, Type IIIa, Type IIIb, Type IV or Type V plant.

    [0133] Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.

    EXEMPLIFICATION

    Example 1: Genotyping Cannabis Plants

    [0134] Bt and Bd alleles have been proposed as a model for generating Type I, II, III, and IV plants. While this classification system can be predictive, the exact DNA sequences that govern them remain unknown. Single molecule sequencing was performed to identify mutations in gene sequences in cannabinoid synthesis pathway(s) (e.g., THCA synthase and CBDA synthase). This sequencing revealed a more refined structure of the inheritance and revealed numerous additional subtypes that can be identified by genotyping to predict chemical inheritance. See, FIG. 2. As illustrated in FIG. 2, a Cannabis plant may be characterized as a Type Ia, Type Ib, Type IIa, Type IIb, Type IIc, Type IIIa, Type IIIb, Type IV or Type V plant.

    Example 2: Assay for Genotyping THCA Synthase

    [0135] This example describes development of superior isothermal nucleic acid amplification assays for detection of THCA synthase. Specifically, a colorimetric LAMP assay for detection of THCA synthase is described. It is envisioned that such a colorimetric LAMP assay may be portable, so that can it be performed at a point of grow to resolve Cannabis chemotypes in a rapid and scalable manner.

    [0136] Challenges with genotyping a THCA synthase include, for example, (1) that there are many pseudogene sequence copies of THCA synthase and (2) that THCA synthase gene sequences are highly polymorphic. For at least this reason, designing primers can be difficult and testing such primers on a few samples does not provide adequate population diversity to guarantee assay performance in the broader markets. The present disclosure addresses these deficiencies with a novel Long Range (2130 bp) LAMP assay that includes a primer that anneals to a promoter region of THCA synthase and internal primers that are less prone to effects resulting from polymorphisms.

    [0137] Weiblen, Stagginus and Onofri suggested primers for THCA synthase detection but failed to test enough samples to find fatal polymorphisms in their detection approach (Weiblen et al., (2015), The New Phytologist, PMID: 26189495; Staginnus et al., (2014) Journal of Forensic Sciences, 59(4):919-26, PMID: 24579739; and Onofri et al., (2015), supra, each of which is incorporated by reference in its entirety). While Kitamura et al. described a portable LAMP assay for THCA synthase, the assay was performed using only two THCA+ cultivars and one fiber type. Consequently, Kitamura et al. did not consider the full complexity of cannabis genotypes in circulation. Moreover, the primers used in Kitamura's assay annealed to different regions in a THCA synthase gene sequence. As a result, and shown herein, the present disclosure recognizes that the Kitamura primers were insufficient for detecting/amplifying a THCA synthase gene sequence in numerous common Cannabis cultivars. In fact, sequence analysis of the Kitamura primers revealed that the 5 end of the Kitamura BIP primer sits on a common I63E and I63F polymorphisms described by Onofri et al., (2015), supra, which is incorporated by reference in its entirety. As this 5 end becomes the 3 end in the second strain synthesis of a LAMP reaction, presence of this polymorphism could impair or stall the LAMP reaction. A similar problem existed with other Kitamura primers, which traversed the P333R variant and the Glu265Gln variants described by Onofri, et al., (2015), supra, incorporated by reference in its entirety.

    [0138] Amplification issues resulting from polymorphisms in an underlying gene sequence is a common problem with genetic studies of THCA synthase gene sequences. THCA synthase gene sequences are under selective breeding pressure and has a 4-fold higher polymorphism rate than the rest of the genome. There is a SNP approximately every 25 nucleotides in THCA synthase gene sequences, making primer design internal to a THCA synthase gene sequence complicated. To address this, primers (e.g., F3 and B3 primers for LAMP) were designed that were external to a THCA synthase gene sequence, where there is more sequence conservation. This results in a THCA synthase gene sequence amplicon of greater than 2000 nucleotides. There was no expectation that such a reaction would work, as there were no reports of Long Range LAMP assays in the literature and the common design tools found at Primer Explorer did not allow primer design of targets this large.

    [0139] Materials and Methods

    [0140] LAMP assay [0141] 10 ul 2LAMP mix (NEB Catalog # M1800S) [0142] 2 ul of primer cocktail [0143] 6 ul ddH2O (pH 6.5) [0144] 2 ul DNA (4 mm leaf biopsy boil in 100 ul ddH2O, 5% Chelex) [0145] Exemplary THCA synthase Long Range LAMP primers are provided in FIG. 9 and Table 2:

    TABLE-US-00008 TABLE2 THC_BIP CACACAAGCACGTATTTGGGCTTTAGTTTTCACCTTAACTAACCT SEQIDNO:8 THCFTP GACTCGCATGATTAGTTTTTCCTATCCTTATGTGTCCCAAAATCC SEQIDNO:9 THC_Loop1 TCCCTATAATTGAGATACGCCAAT SEQIDNO:10 THC-F3 ATGGGAACCATAATAAACTATAAAAGTCATT SEQIDNO:11 THC_B3 TATGATTGTCTACACAGTTCTAATGTAGATTTTC SEQlDNO:12

    [0146] To compare efficacy of Kitamura primers (K primers) to exemplary Long Range primers (LR primers), LAMP assays were performed with these primers on various strains of Cannabis plants. Results are shown in FIG. 5, panel (A). In FIG. 5, panel (A), the text on the left side of the image indicates the strain of Cannabis plant for each row of samples that was tested by LAMP amplification. The top row included samples from Granddaddy Purple (GDP), the second row from the top included samples from Otto, the third row from the top included samples from a first hemp strain, the fourth row from the top included samples from a second hemp strain, the fifth row from the top included samples from Grape Stomper (RSP10516), and the bottom row included samples from Erk Train X Deadhead OG (RSP10517). A sample obtained from each strain was placed in the first and third columns. For each strain, a LAMP assay using the K primers was performed in the first column, and a LAMP assay using the LR primers was performed in the third column.

    [0147] As shown in FIG. 5, panel (A), the two hemp strains displayed a negative result for THCA synthase using either the K primers or the LR primers. As a hemp strain would be expected to be THCA7THCA.sup., this result showed that LAMP amplification using either the K primers or the LR primers was not giving a false positive result. The Otto strain, which expresses THCA synthase, displayed a positive result using the K primers, which showed that LAMP amplification using the K primers detected the presence of a THCA synthase gene. However, the GDP strain of Cannabis plant, which also expresses THCA synthase, had a negative result when LAMP amplification was performed with K primers, while giving a positive result when LAMP amplification was performed with LR primers. This results showed that LR primers are able to successfully detect a THCA gene sequence by LAMP amplification, and do so in strains for which K primers are unable to detect a THCA gene sequence by LAMP amplification.

    [0148] To determine how a Long Range LAMP assay of THCA synthase would perform at various temperatures, LAMP assays with LR primers were performed on various samples over a range of temperatures (temperatures indicated on right side of FIG. 5, panel (B)). As indicated in FIG. 5, panel (B), the first two columns of samples were obtained from THCA synthase negative hemp strains. The third column included samples from a THCA synthase positive Cannabis strain. The fourth column included samples from a Granddaddy purple strain. The eighth column included a negative control, and the ninth column included a positive control. Amplification of the THCA synthase gene sequence was successful for the THCA synthase positive Cannabis strain, the Granddaddy Purple strain, and the positive control at each of the temperatures tested. These data showed that LAMP assays using LR primers were able to properly detect THCA synthase positive strains across a broad temperature profile.

    [0149] The exemplary Long Range LAMP assay of THCA synthase was repeated on various different Cannabis strains that are known to be THCA synthase positive. See, Figure. 6. FIG. 6, depicts LAMP amplifications with LR primers on 28 different known THCA synthase positive strains of Cannabis at 65 C., for 50 minutes. Wells H6-H9 were control samples. As can be seen, all 28 THCA synthase positive samples had successful amplification with the exemplary LR primers.

    [0150] Accordingly, this example demonstrates that LAMP assays using long range primers (such as the exemplified LR primers) of THCA synthase gene sequences was robust and reliable. This example also demonstrates the shortcomings of LAMP amplification using the Kitamura primers for accurately detecting THCA synthase gene sequences in Cannabis strains.

    Example 3: Combined THCA Synthase/CBDA Synthase Assay

    [0151] This example describes characterization of the CBDA synthase Bd allele as a four nucleotide deletion within the coding sequence of this gene. This example also describes development of amplification assays for detection of wild-type (CBDA.sup.wt) and mutant (CBDA.sup.Bd) CBDA synthase gene sequences.

    [0152] Kitamura simply assessed presence of a single gene sequence (THCA synthase) and its deleted pseudogene sequence copies in certain hemp fiber varietals. Thus, the LAMP assay described in Kitamura (at best) only differentiated Type I or II Cannabis from other types (Type II-V), but failed to refine certain chemotype categories. To more rigorously stratify the numerous classes of cannabinoid production other gene sequence(s) that compete for the same cannabinoid precursor (e.g., cannabigerolic acid or CBGA) should be considered. Since both THCA synthase and CBDA synthase compete for cannabigerolic acid, the mutational spectrum of both of these gene sequences with respect to one another was examined.

    [0153] To characterize CBDA synthase, single molecule sequencing of CBDA synthase in dozens of Cannabis cultivars was performed. This sequencing revealed a 4 nucleotide frame shifting deletion that governs the Bd allele. The Bd allele was then surveyed in more than 50 hemp and CBD lines to confirm the Bd allele and its phenotype. A consensus sequence for the region of the CBDA synthase gene sequence that includes this deletion is shown in FIG. 4.

    [0154] Assays that targeted a 4 nucleotide deletion in the CBDA synthase gene sequence (4bpDel) (See, FIG. 4, residues 330-333) were designed. Various different hemp lines that were known to be THCA synthase negative were tested by both an exemplary CBDA synthase assay and an exemplary LAMP assay using LR primers for a THCA synthase gene sequence. FIG. 7 shows LAMP assays for amplification of wild-type CBDA synthase gene sequence (panel (A)) and THCA synthase gene sequence (panel (B)) on 38 different hemp strains (i.e., THCA synthase negative strains). A plate map describing the hemp strain in each well is provided at the bottom (panel (C). As shown in FIG. 7, panel (A), all samples but one (sample M2 in well A1) resulted in amplification of a wild-type CBDA synthase gene sequence. Further, as shown in FIG. 7, panel (B), LAMP assay using LR primers for a THCA synthase gene sequence consistently showed no amplification on hemp samples. These results showed that the chemotype of Cannabis strains were accurately detected by performance of a CBDA synthase assay and an LAMP amplification using LR primers for a THCA synthase gene sequence.

    [0155] For the one hemp sample (A1) that failed to amplify in the exemplary CBDA synthase gene sequence assay, when this sample was repeated using a different DNA purification method, amplification of CBDA synthase gene sequence was observed. Thus, it was concluded that the result for this particular sample was a false negative that resulted from other experimental conditions.

    [0156] With two assays, discernment of THCA synthase positive plants from CBDA synthase positive plants was achieved. The copy number of THCA synthase or CBDA synthase in the genome of Cannabis plants could not be detected, however. Copy number can be useful information for breeders looking to breed plants that produce high levels of THC or CBD. In order to assess copy number, a deletion in the CBDA synthase gene sequence was targeted.

    [0157] Exemplary CBDA.sup.wt synthase primers (which hybridize to a wild-type CBDA synthase gene sequence) are provided in FIG. 9 and Table 3:

    TABLE-US-00009 TABLE3 CBD_BIP CAATCTTAGATTCACCTCTGACACAAGACATGTGAAGGAGTGAC SEQIDNO:13 CBD_FlP TGTATTGTCGAATTTAGGACAGACAATGCAACAAATCTAAAACTCGTA SEQIDNO:14 CBD_Loop1 CAATGGGTTGTTTTGAGTGT SEQIDNO:15 CBD_Loop2 ACCCCAAAACCACTTGT SEQIDNO:16 CBD_F3 CTTCTCGCAATATATTCCCAAT SEQIDNO:17 CBD_F3_v2 ATGCTTCTCGCAATATATTCCCA SEQIDNO:27 CBD_B3 GCATAGAATAGTGCCTTGGAT SEQIDNO:18

    [0158] Exemplary CBDA.sup.del synthase primers (which hybridize to a mutant CBDA synthase gene sequence including a 4 nucleotide deletion) are provided in FIG. 9 and Table 4:

    TABLE-US-00010 TABLE4 CBD_BIP CAATCTTAGATTCACCTCTGACACAAGACATGTGAAGGAGTGAC SEQIDNO:13 CBD-NEG_FIP TGTATTGTCGAATTTAGGACAGACAATGCAACAAATCTAAAACTTACA SEQIDNO:19 CBD_Loop1 CAATGGGTTGTTTTGAGTGT SEQIDNO:15 CBD_Loop2 ACCCCAAAACCACTTGT SEQIDNO:16 CBD_F3 CTTCTCGCAATATATTCCCAAT SEQIDNO:17 CBD_F3_v2 ATGCTTCTCGCAATATATTCCCA SEQIDNO:27 CBD_B3 GCATAGAATAGTGCCTTGGAT SEQIDNO:18

    [0159] The present disclosure encompasses a recognition that detection of both wild-type and mutant CBDA gene sequences will enable genetic differentiation of strains, for example, to differentiate a CBDA.sup./CBDA.sup.+ genotype from a CBDA.sup.+/CBDA.sup.+ genotype.

    [0160] FIG. 8 depicts results obtained from exemplary LAMP assays for amplification of CBDA.sup.wt and CBDA.sup.del (e.g., CBDA.sup.Bd) gene sequences. FIG. 8, panel (A), depicts results obtained from LAMP assays with CBDA.sup.wt primers on various hemp samples. Most of the samples resulted in amplification of a CBDA.sup.wt gene sequence. FIG. 8, panel (B), depicts results from LAMP assays with CBDA.sup.del primers on various hemp samples. As can be seen, most of these samples did not amplify a CBDA.sup.del gene sequence.

    [0161] The present disclosure encompasses a recognition that detection of both wild-type and mutant THCA gene sequences will enable genetic differentiation of strains. In order to assess THCA synthase copy number, one or more sequence variants can be targeted. For example, primers can be used that target the Cannabis THCA synthase A411V variant.

    [0162] Thus, combined THCA synthase/CBDA synthase assays provided herein can differentiate additional types of Cannabis plants. In some embodiments, methods in the context of the present disclosure can differentiate Type I, Type II, Type III, Type IV, and Type V plants. As described herein, the present disclosure further provides new sub-classification of plants we term Type Ia, Type Ib, Type IIa, Type IIb, Type IIc, Type IIIa, Type IIIb, Type IV and Type V Cannabis plants, see, e.g., FIG. 2 and Table 1 (above).

    EQUIVALENTS

    [0163] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of an invention described herein. The scope of an invention described is not intended to be limited to the above Description, but rather is as set forth in the following claims: