EXPRESSION FROM TRANSPOSON-BASED VECTORS AND USES
20190185863 ยท 2019-06-20
Assignee
Inventors
Cpc classification
C12N2015/8518
CHEMISTRY; METALLURGY
C12N2710/22031
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2830/001
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Recombinant expression vectors are disclosed that include a control sequence for recombinant expression of proteins of interest; the control sequence combines a mCMV enhancer sequence with a rat EF-1alpha intron sequence. Some of the vectors are useful for tetracycline-inducible expression. Some of the vectors contain a 5 PiggyBac ITR and a 3 PiggyBac ITR to promote genomic integration into a host cell chromosome. A method of selecting a stable production cell line for manufacturing a protein of interest is also disclosed. Also disclosed are mammalian host cells comprising the inventive recombinant expression vectors and a method of producing a protein of interest, in vitro, involving the mammalian host cell.
Claims
1. A recombinant expression vector, comprising: (a) a 5 PiggyBac ITR comprising the nucleotide sequence of SEQ ID NO:45; (b) a first expression cassette, comprising: (i) a control sequence comprising: (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence; (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence; (ii) an open reading frame encoding a protein of interest operably linked to the control sequence; and (iii) a polyadenylation site operably linked 3 to the open reading frame; (c) a second expression cassette, comprising: (i) a weak constitutive promoter, operably linked to an open reading frame encoding a selectable marker; and (ii) a polyadenylation site operably linked 3 to the open reading frame; and (d) a 3 PiggyBac ITR comprising the nucleotide sequence of SEQ ID NO:47.
2. The vector of claim 1, further comprising: (e) a third expression cassette comprising: (i) a control sequence comprising a promoter; (ii) an open reading frame encoding a protein of interest operably linked to the control sequence; and (iii) a second polyadenylation site operably linked 3 to the open reading frame.
3. The vector of claim 2, wherein the control sequence (i) of the third expression cassette comprises: (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence; (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence.
4. The vector of claim 1, wherein the weak constitutive promoter is a deleted SV40 promoter.
5. The vector of claim 4, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:53.
6. The vector of claim 4, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:46.
7. The vector of claim 1, wherein the selectable marker is glutamine synthetase, puromycin resistance, neomycin resistance, zeomycin resistance, or dihydrofolate reductase.
8. The vector of claim 1, wherein the selectable marker is glutamine synthetase.
9. The vector of claim 1, wherein the selectable marker is encoded by the nucleotide sequence of SEQ ID NO:49, or a degenerate DNA sequence.
10. A recombinant expression vector, comprising: (a) a first expression cassette, comprising: (i) a control sequence comprising: (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence; (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence; (ii) an open reading frame encoding a first immunoglobulin subunit operably linked to the control sequence; and (iii) a first polyadenylation site operably linked 3 to the open reading frame; (b) a second expression cassette 3 to the first expression cassette, comprising: (i) a control sequence comprising a promoter; (ii) an open reading frame encoding a second immunoglobulin subunit operably linked to the promoter; and (iii) a second polyadenylation site operably linked 3 to the open reading frame; and (c) a transcription termination sequence 3 to the first expression cassette and 5 to the second expression cassette.
11. The vector of claim 10, wherein the control sequence (i) of the second expression cassette comprises: (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence; (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence.
12. The vector of claim 10, further comprising: (d) a third expression cassette comprising: (i) a weak constitutive promoter, operably linked to an open reading frame encoding a selectable marker; and (ii) a polyadenylation site operably linked 3 to the open reading frame.
13. The vector of claim 12, wherein the weak constitutive promoter is a deleted SV40 promoter.
14. The vector of claim 13, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:53.
15. The vector of claim 13, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:46.
16. The vector of claim 12, wherein the selectable marker is glutamine synthetase, puromycin resistance, neomycin resistance, zeomycin resistance, or dihydrofolate reductase.
17. The vector of claim 12, wherein the selectable marker is glutamine synthetase.
18. The vector of claim 12, wherein the selectable marker is encoded by the nucleotide sequence of SEQ ID NO:49, or a degenerate DNA sequence.
19. A mammalian host cell, comprising the recombinant expression vector of claim 1 or claim 10.
20. The mammalian host cell of claim 19, wherein the mammalian host cell is a CHO cell.
21. The mammalian host cell of claim 19, wherein the CHO cell is a CHO-K1 cell, a DXB11 cell, or a DG44 cell.
22. A method of producing a protein of interest, in vitro, comprising culturing the mammalian host cell of claim 19 in an aqueous medium under physiological conditions permitting expression of the protein of interest; and recovering the protein of interest from the medium.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
DETAILED DESCRIPTION OF EMBODIMENTS
[0094] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
Definitions
[0095] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Thus, as used in this specification and the appended claims, the singular forms a, an and the include plural referents unless the context clearly indicates otherwise. For example, reference to a protein includes a plurality of proteins; reference to a cell includes populations of a plurality of cells.
[0096] In some embodiments, the present invention relates to a recombinant PiggyBac transposon-based vector for stable expression of one or more proteins of interest in mammalian host cells. The PiggyBac (PB) transposon is a mobile genetic element that efficiently transposes between vectors and host cell chromosomes via a cut and paste transposition mechanism. During transposition, the PB transposase recognizes transposon-specific inverted terminal repeat sequences (ITRs) located on both the 5 and 3 ends of the transposon-based vector and moves the vector contents between the 5 and 3 ITRs from the original vector sites and integrates them into TTAA chromosomal sites. For purposes of the invention the 5 PiggyBac ITR comprises the nucleotide sequence of SEQ ID NO:45:
TABLE-US-00001 SEQIDNO:45 CCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATT GCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATC TCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGT GTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGAT TATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTT ATTTCATGTTCTACTTACGTGATAACTTATTATATATATATTTTCTTGTT ATAGATATC//.
For purposes of the invention 3 PiggyBac ITR comprises the nucleotide sequence of SEQ ID NO:47:
TABLE-US-00002 SEQIDNO:47 GATAAAAGTTTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTT TAATAAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTATTAGTA TGTAAGTGTAAATATAATAAAACTTAATATCTATTCAAATTAATAAATAA ACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACACATGATT ATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGG//.
[0097] The present invention relates to a hybrid promoter for regulating recombinant expression of one or more proteins of interest. The inventive promoter includes a mCMV enhancer sequence operably linked to a rat EF-1alpha intron sequence. The term mCMV, used interchangeably with muCMV, refers to murine cytomegalovirus, which is a herpesvirus of the subfamily betaherpesviridae. The mCMV is a double-stranded enveloped DNA virus with host specificity for mice. Similarly, the term hCMV, or interchangeably huCMV, refers to human cytomegalovirus.
[0098] The mCMV enhancer sequence, with respect to the present invention, includes: [0099] (i) a mCMV enhancer element (mCMV-E); and, at the 3 end of the mCMV enhancer sequence, [0100] (ii) a CMV promoter sequence (CMV-P; i.e., a nucleotide sequence segment beginning at, and including, the TATA box through the start site of transcription); the CMV promoter sequence can be derived from mCMV, hCMV, simian CMV, rat CMV, or any other variety of CMV, or it can be an optimized version of a CMV-P, which is functional to enable transcription in mammalian cells, such as CHO cells.
[0101] The term recombinant indicates that the material (e.g., a nucleic acid or a polypeptide) has been artificially or synthetically (i.e., non-naturally) altered by human intervention. The alteration can be performed on the material within, or removed from, its natural environment or state. For example, a recombinant nucleic acid is one that is made by recombining nucleic acids, e.g., during cloning, DNA shuffling or other well known molecular biological procedures. Examples of such molecular biological procedures are found in Maniatis et al., Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982). A recombinant DNA molecule, is comprised of segments of DNA joined together by means of such molecular biological techniques. The term recombinant protein or recombinant polypeptide as used herein refers to a protein molecule which is expressed using a recombinant DNA molecule. A recombinant host cell is a cell that contains and/or expresses a recombinant nucleic acid.
[0102] The term naturally occurring as used throughout the specification in connection with biological materials such as polypeptides, nucleic acids, host cells, and the like, refers to materials which are found in nature.
[0103] The term control sequence or control signal refers to a polynucleotide sequence that can, in a particular host cell, affect the expression and processing of coding sequences to which it is ligated. The nature of such control sequences may depend upon the host organism. In particular embodiments, control sequences for prokaryotes may include a promoter, a ribosomal binding site, and a transcription termination sequence. Control sequences for eukaryotes, including mammalian cells, can include promoters comprising one or a plurality of recognition sites for transcription factors, transcription enhancer sequences or elements, intron sequences, polyadenylation sites, and transcription termination sequences. Control sequences can include leader sequences and/or fusion partner sequences. Promoters and enhancers consist of short arrays of DNA that interact specifically with cellular proteins involved in transcription (Maniatis, et al., Science 236:1237 (1987)). Promoter and enhancer elements have been isolated from a variety of eukaryotic sources including genes in yeast, insect and mammalian cells and viruses (analogous control elements, i.e., promoters, are also found in prokaryotes). The selection of a particular promoter and enhancer depends on what cell type is to be used to express the protein of interest. Some eukaryotic promoters and enhancers have a broad host range while others are functional in a limited subset of cell types (for review see Voss, et al., Trends Biochem. Sci., 11:287 (1986) and Maniatis, et al., Science 236:1237 (1987)).
[0104] A promoter is a region of DNA including a site at which RNA polymerase binds to initiate transcription of messenger RNA by one or more downstream structural genes. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA (towards the 5 region of the sense strand). Promoters are typically about 100-1000 bp in length. A common feature of promoter regions in eukaryotes is the TATA box, it is found about 25 bases upstream from the transcription start site and has the ideal sequence of TATAAAT. The closeness of the actual sequence to this ideal sequence effects the ability of the RNA polymerase complex to bind to the DNA and hence initiate the transcription process.
[0105] In some embodiments, the inventive recombinant expression vector includes an expression cassette comprising a weak constitutive promoter, operably linked to an open reading frame encoding a selectable marker. A constitutive promoter is: (1) a promoter sequence that initiates mRNA synthesis independent of the influence of regulation, or (2) a promoter sequence that initiates mRNA synthesis independent, or substantially independent, of the influence of regulation, under physiological conditions normally associated with cell culture for the expression of a protein of interest in an industrial protein manufacturing setting. The specific nucleic acid (i.e., nucleotide) sequence of the promoter determines the strength of the promoter (a strong promoter leads to a relatively high rate of transcription initiation). Commonly used constitutive promoters for mammalian cell systems include simian virus 40 early promoter (SV40), cytomegalovirus immediate-early promoter (CMV), human Ubiquitin C promoter (UBC), human elongation factor 1a promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and chicken -Actin promoter coupled with CMV early enhancer (CAGG). A weak constitutive promoter is a constitutive promoter that will not initiate transcription as efficiently as a strong promoter, for example, a modified version of one of the foregoing list of constitutive promoters. Thus, an example of a weak constitutive promoter is a deleted SV40 promoter. (See, e.g., Hartman et al., Vectors and host cells comprising a modified SV40 promoter for protein expression, U.S. Ser. No. 10/053,720; and Hartman et al., DAC HYP compositions and methods, U.S. Pat. No. 9,260,528B2). Another useful example of a weak constitutive promoter for purposes of the present invention is the PGK promoter described in Qin J Y et al. (Qin, J Y, Zhang L, Clift K L, Hulur I, Xiang A P, Ren B-Z, et al. (2010), Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter. PLoS ONE 5(5): e10611. doi.org/10.1371/journal.pone.0010611; see, also, e.g., Li, J. & Zhang, Y., Relationship between promoter sequence and its strength in gene expression, Eur. Phys. J. E 37: 86 (2014)). One particularly useful example of a weak constitutive promoter for purposes of the present invention is a deleted SV40 promoter comprising the nucleotide sequence of SEQ ID NO:46:
TABLE-US-00003 SEQIDNO:46 TCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGA CTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCT ATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAA AGCT//.
The deleted SV40 promoter comprising the nucleotide sequence of SEQ ID NO:46 is used, e.g., in vector pJVec_5 (see,
TABLE-US-00004 SEQIDNO:53 GTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCA GAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGG CTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCT//.
The weak constitutive promoter is operably linked to an open reading frame encoding a selectable marker, which selectable marker confers upon cells transfected with an expression vector, as described herein, a trait or characteristic that be used to identify transfected cells from non-transfected cells. Useful selectable markers and there coding sequences are well known in the art. They can confer traits such as, but not limited to, resistance to a toxin, heavy metal, antibiotic, or other agent, prototrophy in an auxotrophic host, the ability to grow in a medium free of an essential nutrient, the ability to synthesize an essential metabolite. Selectable markers commonly used in transfecting mammalian cells, such as CHO cells, include, but are not limited to, glutamine synthetase (GS), puromycin resistance (PurR), neomycin resistance (NeoR), zeomycin resistance (ZeoR), or dihydrofolate reductase (DHFR). A useful example of a glutamine synthetase coding sequence has the nucleotide sequence of SEQ ID NO:49, or a degenerate DNA sequence:
TABLE-US-00005 SEQIDNO:49 ATGGCCACCTCAGCAAGTTCCCACTTGAACAAAAACATCAAGCAAATGTA CTTGTGCCTGCCCCAGGGTGAGAAAGTCCAAGCCATGTATATCTGGGTTG ATGGTACTGGAGAAGGACTGCGCTGCAAAACCCGCACCCTGGACTGTGAG CCCAAGTGTGTAGAAGAGTTACCTGAGTGGAATTTTGATGGCTCTAGTAC CTTTCAGTCTGAGGGCTCCAACAGTGACATGTATCTCAGCCCTGTTGCCA TGTTTCGGGACCCCTTCCGCAGAGATCCCAACAAGCTGGTGTTCTGTGAA GTTTTCAAGTACAACCGGAAGCCTGCAGAGACCAATTTAAGGCACTCGTG TAAACGGATAATGGACATGGTGAGCAACCAGCACCCCTGGTTTGGAATGG AACAGGAGTATACTCTGATGGGAACAGATGGGCACCCTTTTGGTTGGCCT TCCAATGGCTTTCCTGGGCCCCAAGGTCCGTATTACTGTGGTGTGGGCGC AGACAAAGCCTATGGCAGGGATATCGTGGAGGCTCACTACCGCGCCTGCT TGTATGCTGGGGTCAAGATTACAGGAACAAATGCTGAGGTCATGCCTGCC CAGTGGGAATTTCAAATAGGACCCTGTGAAGGAATCCGCATGGGAGATCA TCTCTGGGTGGCCCGTTTCATCTTGCATCGAGTATGTGAAGACTTTGGGG TAATAGCAACCTTTGACCCCAAGCCCATTCCTGGGAACTGGAATGGTGCA GGCTGCCATACCAACTTTAGCACCAAGGCCATGCGGGAGGAGAATGGTCT GAAGCACATCGAGGAGGCCATCGAGAAACTAAGCAAGCGGCACCGGTACC ACATTCGAGCCTACGATCCCAAGGGGGGCCTGGACAATGCCCGTCGTCTG ACTGGGTTCCACGAAACGTCCAACATCAACGACTTTTCTGCTGGTGTCGC CAATCGCAGTGCCAGCATCCGCATTCCCCGGACTGTCGGCCAGGAGAAGA AAGGTTACTTTGAAGACCGCCGCCCCTCTGCCAATTGTGACCCCTTTGCA GTGACAGAAGCCATCGTCCGCACATGCCTTCTCAATGAGACTGGCGACGA GCCCTTCCAATACAAAAACTAA//.
[0106] In general, an enhancer is a short (50-1500 bp) region of DNA that can be bound with one or more activator proteins (transcription factors) to activate transcription of a gene.
[0107] A mCMV enhancer sequence useful in the inventive hybrid promoter comprises a nucleotide sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO:2, which contains a CMV promoter (CMV-P) sequence at its 3 end (bold underlined sequence in SEQ ID NO:2) beginning at nucleotide position 588 (including a TATA-box and transcriptional start site, i.e., TATAAGAGG CGCGA C CAGCG TCGG TACCG//SEQ ID NO:28; bold underlined in SEQ ID NO:2 below; SEQ ID NO:28 also comprises SEQ ID NO:26):
TABLE-US-00006 SEQIDNO:2 GTCAACAGGAAAGTTCCATTGGAGCCAAGTACATTGAGTC AATAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGT CAATGGGAGGTAAGCCAATGGGTTTTTCCCATTACTGGCA CGTATACTGAGTCATTAGGGACTTTCCAATGGGTTTTGCC CAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAGTC CCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCA TTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGT CAATGGGTTTTTCCCATTATTGGCACGTACATAAGGTCAA TAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAATTAA AACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTAT TGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCA TAGCTGATTAATGGGAAAGTACCGTTCTCGAGCCAATACA CGTCAATGGGAAGTGAAAGGGCAGCCAAAACGTAACACCG CCCCGGTTTTCCCCTGGAAATTCCATATTGGCACGCATTC TATTGGCTGAGCTGCGTTCTACGTGGGTAT AAGAGGCGCGACCAGCGTCGGTACCG//.
[0108] Another exemplary mCMV enhancer sequence useful in the inventive hybrid promoter comprises a nucleotide sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO:33, which contains a CMV promoter sequence at its 3 end (bold underlined sequence in SEQ ID NO:33) beginning at position 588, which includes a TATA-box and transcriptional start site, i.e., TATATAAGCAGAGCTCGTTTAGTGAACCGTCAGTTCGTCTCTAGACGCCAACCG//SEQ ID NO:35; bold underlined sequence in SEQ ID NO:33 below; SEQ ID NO:35 also comprises SEQ ID NO:24):
TABLE-US-00007 SEQIDNO:33 GTCAACAGGAAAGTTCCATTGGAGCCAAGTACATTGAGTCAATAGGGA CTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATGGGAGGTAAGCCAA TGGGTTTTTCCCATTACTGGCACGTATACTGAGTCATTAGGGACTTTCCA ATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAG TCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTT TGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCCATT ATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGC CAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCT ATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGAT TAATGGGAAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAA GGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCCTGGAAATTCCATAT TGGCACGCATTCTATTGGCTGAGCTGCGTTCTACGTGGGTATATAAGCAG AGCTCGTTTAGTGAACCGTCAGTTCGTCTCTAGACGCCAACCG//.
[0109] In some useful embodiments, in which tetracycline-inducible expression is desired, the inventive hybrid promoter comprises one or more TetO sequences operably linked 3 to the mCMV enhancer sequence, inserted within the CMV promoter (CMV-P) sequence at the 3 end of the mCMV enhancer sequence. A TetO sequence means a nucleotide sequence, which maintains the ability to bind tetracycline repressor protein (TetR). The TetO sequence is placed so that, in the presence of TetR protein, there is binding of TetR to the TetO sequence, thereby disrupting transcription to a detectable extent, compared to a control not having TetO in the promoter driving transcription of a gene of interest, or to a control not having TetR. Examples of the TetO sequence include a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:29 (TCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGA//SEQ ID NO:29) or having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:34 (CTCCCTATCAGTGATCAGTTCCTCCCTATCAGTGATAGAGA//SEQ ID NO:34). In some useful embodiments, there can be additional nucleotide residues 5 or 3 to the TetO sequence(s), or there can be intervening nucleotide linker sequences, as long as the ability to bind TetR protein is not eliminated.
[0110] Repression, or repressed, within the context of the invention, refers to the interference of transcription of a gene of interest (encoding a protein of interest), occurring when TetR protein binds to a TetO binding site in the promoter that drives expression of the gene of interest, resulting in decreased expression of the protein of interest by the cell(s) (which are cell(s) that express TetR). Expression of a gene of interest or of a protein of interest is said to be derepressed, when, in the presence of tetracycline in the medium, expression of the protein of interest is at least 1.5-fold over the basal levels of expression by the cell(s) in the absence of tetracycline in the medium.
[0111] Tetracycline means tetracycline or an analog of tetracycline, such as doxycycline, anhydrotetracycline, minocycline, oxytetracycline, methacycline, chlortetracycline, or COL-3 (Chemically modified tetracycline-3).
[0112] The recombinant expression vectors of the present invention can optionally contain one or more insulator elements, if desired. Insulator elements, or interchangeably, insulator sequences, are DNA sequences that protect transcription units from outside regulatory influence. When placed between a transcription unit and an enhancer sequence, these elements can block the action of the enhancer sequence on the transcription unit. In constructs where insulator sequences flank a transcription unit, they can confer position independent expression when transfected in cells. Many insulator elements have been identified and characterized including the chicken HS4, mouse H19, and Xenopus ARS. (See, e.g., Kanduri, C. et al., The 5 flank of mouse H19 in an unusual chromatin conformation unidirectionally blocks enhancer-promoter communication, Current Biology 10(8):449-457 (2000); Recillas-Targa, F. et al., Position-effect protection and enhancer blocking by the chicken beta-globin insulator are separable activities. Proc. Nat. Acad. Sci. USA 99(10):6883-6888 (2002); Valenzuela, L., & Kamakaka, R. T., Chromatin Insulators, Annu. Rev. Genet. 40:107-38 (2006); Watanabe, S. et al., Functional analysis of the sea urchin-derived arylsulfatase (Ars)-element in mammalian cells. Genes to Cells, 11(9), 1009-1021 (2006)).
[0113] A rat EF-1alpha intron sequence useful in the inventive hybrid promoter comprises a nucleotide sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO:4:
TABLE-US-00008 SEQIDNO:4 GTGAGTGGCGGGTGTGGCTTCCGCGGGCCCCGGAGCTGGAGCCCTGCTC TGAGCGGGCCGGGCTGATATGCGAGTGTCGTCCGCAGGGTTTAGCTGTGA GCATTCCCACTTCGAGTGGCGGGCGGTGCGGGGGTGAGAGTGCGAGGCCT AGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGAGGCCTAGCGTGG TGTCCGCCGCCGCGTGCCACTCCGGCCGCACTATGCGTTTTTTGTCCTTG CTGCCCTCGATTGCCTTCCAGCAGCATGGGCTAACAAAGGGAGGGTGTGG GGCTCACTCTTAAGGAGCCCATGAAGCTTACGTTGGATAGGAATGGAAGG GCAGGAGGGGCGACTGGGGCCCGCCCGCCTTCGGAGCACATGTCCGACGC CACCTGGATGGGGCGAGGCCTGTGGCTTTCCGAAGCAATCGGGCGTGAGT TTAGCCTACCTGGGCCATGTGGCCCTAGCACTGGGCACGGTCTGGCCTGG CGGTGCCGCGTTCCCTTGCCTCCCAACAAGGGTGAGGCCGTCCCGCCCGG CACCAGTTGCTTGCGCGGAAAGATGGCCGCTCCCGGGGCCCTGTTGCAAG GAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGGGCGGGTGAGTCA CCCACACAAAGGAAGAGGGCCTTGCCCCTCGCCGGCCGCTGCTTCCTGTG ACCCCGTGGTCTATCGGCCGCATAGTCACCTCGGGCTTCTCTTGAGCACC GCTCGTCGCGGCGGGGGGAGGGGATCTAATGGCGTTGGAGTTTGTTCACA TTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTGGAAGTCATTCTT GGAATTTGCCCCTTTGAGTTTGGAGCGAGGCTAATTCTCAAGCCTCTTAG CGGTTCAAAGGTATTTTCTAAACCCGTTTCCAG//.
[0114] The inventive hybrid promoter also includes an intervening first leader sequence, operably linked 3 to the mCMV enhancer and 5 to the EF-1alpha intron sequence in an operable orientation. The intervening first leader sequence is about 10 to 200 nucleotide residues in lengthmore preferably about 10 to 60 nucleotide residues in length or even more preferably about 20-50 nucleotide residues in lengthand lacks any secondary structure with stability greater than 20 kcal and lacks any ATG translational start sites. An example of a useful first leader sequence is an untranslated (5UTR) leader sequence derived from adenovirus tripartite leader (TPL), i.e., the nucleotide sequence of SEQ ID NO:3:
TABLE-US-00009 SEQIDNO:3 TACCTCTTCCGCATCGCTGTCTGCGAGGGCCAGCTGTTGGG//.
[0115] The inventive hybrid promoter also includes a second leader sequence operably linked 3 to the EF-1alpha intron sequence in an operable orientation. The second leader sequence is about 5 to 200 nucleotide residues in lengthmore preferably about 10 to 200 nucleotide residues in length or even more preferably about 10-150 nucleotide residues in lengthand lacks any secondary structure with stability greater than 20 kcal and lacks any ATG translational start sites. An example of a useful second leader sequence is another untranslated (5UTR) leader sequence region derived from adenovirus tripartite leader (TPL), i.e., the nucleotide sequence of SEQ ID NO:5:
TABLE-US-00010 SEQIDNO:5 CTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTACTCTTGGATCG GAAACCCGTCGGCCTCCGAACGGTACTCCGCCACCGAGGGACCTGAGCGA GTCCGCATCGACCGGATCGGAAAACCTC//.
[0116] For other examples of useful leader sequences and design principles, see, e.g., Mignone, F. et al., Untranslated regions of mRNAs. Genome Biology, 3(3):reviews0004.1-0004.10 (2002)), incorporated herein by reference in its entirety. Any suitable leader sequences, with the above mentioned characteristics, can be used in practicing the present invention.
[0117] One useful embodiment of the inventive hybrid promoter is a promoter that comprises a nucleotide sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO:1, following, which contains mCMV GenBank: L06816.1, nucleotides 4067-4682, Rat EF-1alpha intron Genbank: AC158987.3, nucleotides 22137-21728; and an intervening first leader sequence underlined in lower case letters (SEQ ID NO:3); and a second leader sequence underlined in italic lower case letters (SEQ ID NO:5):
TABLE-US-00011 SEQIDNO:1 GTCAACAGGAAAGTTCCATTGGAGCCAAGTACATTGAGTCAATAGGGA CTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATGGGAGGTAAGCCAA TGGGTTTTTCCCATTACTGGCACGTATACTGAGTCATTAGGGACTTTCCA ATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAG TCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTT TGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCCATT ATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGC CAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCT ATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGAT TAATGGGAAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAA GGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCCTGGAAATTCCATAT TGGCACGCATTCTATTGGCTGAGCTGCGTTCTACGTGGGTATAAGAGGCG CGACCAGCGTCGGTACCGtacctcttccgcatcgctgtctgcgagggcca gctgttgggGTGAGTGGCGGGTGTGGCTTCCGCGGGCCCCGGAGCTGGAG CCCTGCTCTGAGCGGGCCGGGCTGATATGCGAGTGTCGTCCGCAGGGTTT AGCTGTGAGCATTCCCACTTCGAGTGGCGGGCGGTGCGGGGGTGAGAGTG CGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGAGGCC TAGCGTGGTGTCCGCCGCCGCGTGCCACTCCGGCCGCACTATGCGTTTTT TGTCCTTGCTGCCCTCGATTGCCTTCCAGCAGCATGGGCTAACAAAGGGA GGGTGTGGGGCTCACTCTTAAGGAGCCCATGAAGCTTACGTTGGATAGGA ATGGAAGGGCAGGAGGGGCGACTGGGGCCCGCCCGCCTTCGGAGCACATG TCCGACGCCACCTGGATGGGGCGAGGCCTGTGGCTTTCCGAAGCAATCGG GCGTGAGTTTAGCCTACCTGGGCCATGTGGCCCTAGCACTGGGCACGGTC TGGCCTGGCGGTGCCGCGTTCCCTTGCCTCCCAACAAGGGTGAGGCCGTC CCGCCCGGCACCAGTTGCTTGCGCGGAAAGATGGCCGCTCCCGGGGCCCT GTTGCAAGGAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGGGCGG GTGAGTCACCCACACAAAGGAAGAGGGCCTTGCCCCTCGCCGGCCGCTGC TTCCTGTGACCCCGTGGTCTATCGGCCGCATAGTCACCTCGGGCTTCTCT TGAGCACCGCTCGTCGCGGCGGGGGGAGGGGATCTAATGGCGTTGGAGTT TGTTCACATTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTGGAAG TCATTCTTGGAATTTGCCCCTTTGAGTTTGGAGCGAGGCTAATTCTCAAG CCTCTTAGCGGTTCAAAGGTATTTTCTAAACCCGTTTCCAGctcgcggtt gaggacaaactcttcgcggtctttccagtactcttggatcggaaacccgt cggcctccgaacggtactccgccaccgagggacctgagcgagtccgcatc gaccggatcggaaaacctc//.
[0118] Examples of additional useful embodiments of the inventive hybrid promoter include (i) SEQ ID NO:30 (hybrid promoter sequence including TetO, as in pJV57), (ii) SEQ ID NO:31 (hybrid promoter including a mCMV enhancer element with optimized hCMV promoter sequence, as in pJV59), and (iii) SEQ ID NO:32 (hybrid promoter including mCMV enhancer element with optimized hCMV promoter sequence and optimized TetO sequence, as in pJV60):
TABLE-US-00012 SEQIDNO:30 GTCAACAGGAAAGTTCCATTGGAGCCAAGTACATTGAGTCAATAGGGA CTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATGGGAGGTAAGCCAA TGGGTTTTTCCCATTACTGGCACGTATACTGAGTCATTAGGGACTTTCCA ATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAG TCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTT TGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCCATT ATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGC CAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCT ATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGAT TAATGGGAAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAA GGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCCTGGAAATTCCATAT TGGCACGCATTCTATTGGCTGAGCTGCGTTCTACGTGGGTATATAAGCAG AGCTCTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGATCGTC GACGAGCTCAGCGTCGGTACCGTACCTCTTCCGCATCGCTGTCTGCGAGG GCCAGCTGTTGGGGTGAGTGGCGGGTGTGGCTTCCGCGGGCCCCGGAGCT GGAGCCCTGCTCTGAGCGGGCCGGGCTGATATGCGAGTGTCGTCCGCAGG GTTTAGCTGTGAGCATTCCCACTTCGAGTGGCGGGCGGTGCGGGGGTGAG AGTGCGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGA GGCCTAGCGTGGTGTCCGCCGCCGCGTGCCACTCCGGCCGCACTATGCGT TTTTTGTCCTTGCTGCCCTCGATTGCCTTCCAGCAGCATGGGCTAACAAA GGGAGGGTGTGGGGCTCACTCTTAAGGAGCCCATGAAGCTTACGTTGGAT AGGAATGGAAGGGCAGGAGGGGCGACTGGGGCCCGCCCGCCTTCGGAGCA CATGTCCGACGCCACCTGGATGGGGCGAGGCCTGTGGCTTTCCGAAGCAA TCGGGCGTGAGTTTAGCCTACCTGGGCCATGTGGCCCTAGCACTGGGCAC GGTCTGGCCTGGCGGTGCCGCGTTCCCTTGCCTCCCAACAAGGGTGAGGC CGTCCCGCCCGGCACCAGTTGCTTGCGCGGAAAGATGGCCGCTCCCGGGG CCCTGTTGCAAGGAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGG GCGGGTGAGTCACCCACACAAAGGAAGAGGGCCTTGCCCCTCGCCGGCCG CTGCTTCCTGTGACCCCGTGGTCTATCGGCCGCATAGTCACCTCGGGCTT CTCTTGAGCACCGCTCGTCGCGGCGGGGGGAGGGGATCTAATGGCGTTGG AGTTTGTTCACATTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTG GAAGTCATTCTTGGAATTTGCCCCTTTGAGTTTGGAGCGAGGCTAATTCT CAAGCCTCTTAGCGGTTCAAAGGTATTTTCTAAACCCGTTTCCAGCTCGC GGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTACTCTTGGATCGGAAAC CCGTCGGCCTCCGAACGGTACTCCGCCACCGAGGGACCTGAGCGAGTCCG CATCGACCGGATCGGAAAACCTC//; SEQIDNO:31 GTCAACAGGAAAGTTCCATTGGAGCCAAGTACATTGAGTCAATAGGGA CTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATGGGAGGTAAGCCAA TGGGTTTTTCCCATTACTGGCACGTATACTGAGTCATTAGGGACTTTCCA ATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAG TCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTT TGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCCATT ATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGC CAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCT ATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGAT TAATGGGAAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAA GGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCCTGGAAATTCCATAT TGGCACGCATTCTATTGGCTGAGCTGCGTTCTACGTGGGTATATAAGCAG AGCTCGTTTAGTGAACCGTCAGTTCGTCTCTAGACGCCAACCGCCTCTTC CGCATCGCTGTCTGCGAGGGCCAGCTGTTGGGGTGAGTGGCGGGTGTGGC TTCCGCGGGCCCCGGAGCTGGAGCCCTGCTCTGAGCGGGCCGGGCTGATA TGCGAGTGTCGTCCGCAGGGTTTAGCTGTGAGCATTCCCACTTCGAGTGG CGGGCGGTGCGGGGGTGAGAGTGCGAGGCCTAGCGGCAACCCCGTAGCCT CGCCTCGTGTCCGGCTTGAGGCCTAGCGTGGTGTCCGCCGCCGCGTGCCA CTCCGGCCGCACTATGCGTTTTTTGTCCTTGCTGCCCTCGATTGCCTTCC AGCAGCATGGGCTAACAAAGGGAGGGTGTGGGGCTCACTCTTAAGGAGCC CATGAAGCTTACGTTGGATAGGAATGGAAGGGCAGGAGGGGCGACTGGGG CCCGCCCGCCTTCGGAGCACATGTCCGACGCCACCTGGATGGGGCGAGGC CTGTGGCTTTCCGAAGCAATCGGGCGTGAGTTTAGCCTACCTGGGCCATG TGGCCCTAGCACTGGGCACGGTCTGGCCTGGCGGTGCCGCGTTCCCTTGC CTCCCAACAAGGGTGAGGCCGTCCCGCCCGGCACCAGTTGCTTGCGCGGA AAGATGGCCGCTCCCGGGGCCCTGTTGCAAGGAGCTCAAAATGGAGGACG CGGCAGCCCGGTGGAGCGGGCGGGTGAGTCACCCACACAAAGGAAGAGGG CCTTGCCCCTCGCCGGCCGCTGCTTCCTGTGACCCCGTGGTCTATCGGCC GCATAGTCACCTCGGGCTTCTCTTGAGCACCGCTCGTCGCGGCGGGGGGA GGGGATCTAATGGCGTTGGAGTTTGTTCACATTTGGTGGGTGGAGACTAG TCAGGCCAGCCTGGCGCTGGAAGTCATTCTTGGAATTTGCCCCTTTGAGT TTGGAGCGAGGCTAATTCTCAAGCCTCTTAGCGGTTCAAAGGTATTTTCT AAACCCGTTTCCAGCTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCA GTACTCTTGGATCGGAAACCCGTCGGCCTCCGAACGGTACTCCGCCACCG AGGGACCTGAGCGAGTCCGCATCGACCGGATCGGAAAACCTC//; and SEQIDNO:32 GTCAACAGGAAAGTTCCATTGGAGCCAAGTACATTGAGTCAATAGGGA CTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATGGGAGGTAAGCCAA TGGGTTTTTCCCATTACTGGCACGTATACTGAGTCATTAGGGACTTTCCA ATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAG TCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTT TGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCCATT ATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGC CAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCT ATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGAT TAATGGGAAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAA GGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCCTGGAAATTCCATAT TGGCACGCATTCTATTGGCTGAGCTGCGTTCTACGTGGGTATATAAGCAG AGCTCTCCCTATCAGTGATCAGTTCCTCCCTATCAGTGATAGAGATCGTC GACGAGCTCAGCGTCGGTACCGTACCTCTTCCGCATCGCTGTCTGCGAGG GCCAGCTGTTGGGGTGAGTGGCGGGTGTGGCTTCCGCGGGCCCCGGAGCT GGAGCCCTGCTCTGAGCGGGCCGGGCTGATATGCGAGTGTCGTCCGCAGG GTTTAGCTGTGAGCATTCCCACTTCGAGTGGCGGGCGGTGCGGGGGTGAG AGTGCGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGA GGCCTAGCGTGGTGTCCGCCGCCGCGTGCCACTCCGGCCGCACTATGCGT TTTTTGTCCTTGCTGCCCTCGATTGCCTTCCAGCAGCATGGGCTAACAAA GGGAGGGTGTGGGGCTCACTCTTAAGGAGCCCATGAAGCTTACGTTGGAT AGGAATGGAAGGGCAGGAGGGGCGACTGGGGCCCGCCCGCCTTCGGAGCA CATGTCCGACGCCACCTGGATGGGGCGAGGCCTGTGGCTTTCCGAAGCAA TCGGGCGTGAGTTTAGCCTACCTGGGCCATGTGGCCCTAGCACTGGGCAC GGTCTGGCCTGGCGGTGCCGCGTTCCCTTGCCTCCCAACAAGGGTGAGGC CGTCCCGCCCGGCACCAGTTGCTTGCGCGGAAAGATGGCCGCTCCCGGGG CCCTGTTGCAAGGAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGG GCGGGTGAGTCACCCACACAAAGGAAGAGGGCCTTGCCCCTCGCCGGCCG CTGCTTCCTGTGACCCCGTGGTCTATCGGCCGCATAGTCACCTCGGGCTT CTCTTGAGCACCGCTCGTCGCGGCGGGGGGAGGGGATCTAATGGCGTTGG AGTTTGTTCACATTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTG GAAGTCATTCTTGGAATTTGCCCCTTTGAGTTTGGAGCGAGGCTAATTCT CAAGCCTCTTAGCGGTTCAAAGGTATTTTCTAAACCCGTTTCCAGCTCGC GGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTACTCTTGGATCGGAAAC CCGTCGGCCTCCGAACGGTACTCCGCCACCGAGGGACCTGAGCGAGTCCG CATCGACCGGATCGGAAAACCTC//.
[0119] The terms in operable combination, in operable order and operably linked as used herein refer to the linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and/or the synthesis of a desired protein molecule is produced. The term also refers to the linkage of amino acid sequences in such a manner so that a functional protein is produced. For example, a control sequence in a vector that is operably linked to a protein coding sequence is ligated thereto so that expression of the protein coding sequence is achieved under conditions compatible with the transcriptional activity of the control sequences.
[0120] Polypeptide and protein are used interchangeably herein and include a molecular chain of two or more amino acids linked covalently through peptide bonds. The terms do not refer to a specific length of the product. Thus, peptides, and oligopeptides, are included within the definition of polypeptide. The terms include post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. In addition, protein fragments, analogs, mutated or variant proteins, fusion proteins and the like are included within the meaning of polypeptide. The terms also include molecules in which one or more amino acid analogs or non-canonical or unnatural amino acids are included as can be expressed recombinantly using known protein engineering techniques. In addition, fusion proteins can be derivatized as described herein by well-known organic chemistry techniques.
[0121] A variant of a polypeptide (e.g., an immunoglobulin, or an antibody) comprises an amino acid sequence wherein one or more amino acid residues are inserted into, deleted from and/or substituted into the amino acid sequence relative to another polypeptide sequence. Variants include fusion proteins.
[0122] The term fusion protein indicates that the protein includes polypeptide components derived from more than one parental protein or polypeptide. Typically, a fusion protein is expressed from a fusion gene in which a nucleotide sequence encoding a polypeptide sequence from one protein is appended in frame with, and optionally separated by a linker from, a nucleotide sequence encoding a polypeptide sequence from a different protein. The fusion gene can then be expressed by a recombinant host cell as a single protein.
[0123] A secreted protein refers to those proteins capable of being directed to the ER, secretory vesicles, or the extracellular space as a result of a secretory signal peptide sequence, as well as those proteins released into the extracellular space without necessarily containing a signal sequence. If the secreted protein is released into the extracellular space, the secreted protein can undergo extracellular processing to produce a mature protein. Release into the extracellular space can occur by many mechanisms, including exocytosis and proteolytic cleavage. In some other embodiments of the inventive method, the protein of interest can be synthesized by the host cell as a secreted protein, which can then be further purified from the extracellular space and/or medium.
[0124] As used herein soluble when in reference to a protein produced by recombinant DNA technology in a host cell is a protein that exists in aqueous solution; if the protein contains a twin-arginine signal amino acid sequence the soluble protein is exported to the periplasmic space in gram negative bacterial hosts, or is secreted into the culture medium by eukaryotic host cells capable of secretion, or by bacterial host possessing the appropriate genes (e.g., the kil gene). Thus, a soluble protein is a protein which is not found in an inclusion body inside the host cell. Alternatively, depending on the context, a soluble protein is a protein which is not found integrated in cellular membranes, or, in vitro, is dissolved, or is capable of being dissolved in an aqueous buffer under physiological conditions without forming significant amounts of insoluble aggregates (i.e., forms aggregates less than 10%, and typically less than about 5%, of total protein) when it is suspended without other proteins in an aqueous buffer of interest under physiological conditions, such buffer not containing a detergent or chaotropic agent, such as urea, guanidinium hydrochloride, or lithium perchlorate. In contrast, an insoluble protein is one which exists in denatured form inside cytoplasmic granules (called an inclusion body) in the host cell, or again depending on the context, an insoluble protein is one which is present in cell membranes, including but not limited to, cytoplasmic membranes, mitochondrial membranes, chloroplast membranes, endoplasmic reticulum membranes, etc., or in an in vitro aqueous buffer under physiological conditions forms significant amounts of insoluble aggregates (i.e., forms aggregates equal to or more than about 10% of total protein) when it is suspended without other proteins (at physiologically compatible temperature) in an aqueous buffer of interest under physiological conditions, such buffer not containing a detergent or chaotropic agent, such as urea, guanidinium hydrochloride, or lithium perchlorate.
[0125] The term polynucleotide or nucleic acid includes both single-stranded and double-stranded nucleotide polymers containing two or more nucleotide residues. The nucleotide residues comprising the polynucleotide can be ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. Said modifications include base modifications such as bromouridine and inosine derivatives, ribose modifications such as 2,3-dideoxyribose, and internucleotide linkage modifications such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate and phosphoroamidate.
[0126] The term oligonucleotide means a polynucleotide comprising 200 or fewer nucleotide residues. In some embodiments, oligonucleotides are 10 to 60 bases in length. In other embodiments, oligonucleotides are 12, 13, 14, 15, 16, 17, 18, 19, or 20 to 40 nucleotides in length. Oligonucleotides may be single stranded or double stranded, e.g., for use in the construction of a mutant gene. Oligonucleotides may be sense or antisense oligonucleotides. An oligonucleotide can include a label, including a radiolabel, a fluorescent label, a hapten or an antigenic label, for detection assays. Oligonucleotides may be used, for example, as PCR primers, cloning primers or hybridization probes.
[0127] A polynucleotide sequence or nucleotide sequence or nucleic acid sequence, as used interchangeably herein, is the primary sequence of nucleotide residues in a polynucleotide, including of an oligonucleotide, a DNA, and RNA, a nucleic acid, or a character string representing the primary sequence of nucleotide residues, depending on context. From any specified polynucleotide sequence, either the given nucleic acid or the complementary polynucleotide sequence can be determined. Included are DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand. Unless specified otherwise, the left-hand end of any single-stranded polynucleotide sequence discussed herein is the 5 end; the left-hand direction of double-stranded polynucleotide sequences is referred to as the 5 direction. The direction of 5 to 3 addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 5 to the 5 end of the RNA transcript are referred to as upstream sequences; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 3 to the 3 end of the RNA transcript are referred to as downstream sequences.
[0128] As used herein, an isolated nucleic acid molecule or isolated nucleic acid sequence is a nucleic acid molecule that is either (1) identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the nucleic acid or (2) cloned, amplified, tagged, or otherwise distinguished from background nucleic acids such that the sequence of the nucleic acid of interest can be determined. An isolated nucleic acid molecule is other than in the form or setting in which it is found in nature. However, an isolated nucleic acid molecule includes a nucleic acid molecule contained in cells that ordinarily express the immunoglobulin (e.g., antibody) where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.
[0129] As used herein, the terms nucleic acid molecule encoding, DNA sequence encoding, and DNA encoding refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of ribonucleotides along the mRNA chain, and also determines the order of amino acids along the polypeptide (protein) chain. The DNA sequence thus codes for the RNA sequence and for the amino acid sequence.
[0130] The term gene is used broadly to refer to any nucleic acid associated with a biological function. Genes typically include coding sequences and/or the regulatory sequences required for expression of such coding sequences. The term gene applies to a specific genomic or recombinant sequence, as well as to a cDNA or mRNA encoded by that sequence. Genes also include non-expressed nucleic acid segments that, for example, form recognition sequences for other proteins. Non-expressed regulatory sequences including transcriptional control elements to which regulatory proteins, such as transcription factors, bind, resulting in transcription of adjacent or nearby sequences.
[0131] Expression of a gene or expression of a nucleic acid means transcription of DNA into RNA (optionally including modification of the RNA, e.g., splicing), translation of RNA into a polypeptide (possibly including subsequent post-translational modification of the polypeptide), or both transcription and translation, as indicated by the context.
[0132] The present invention relates to an expression cassette that includes the inventive hybrid promoter. A eukaryotic expression cassette refers to the part of an expression vector that enables production of protein in a eukaryotic cell, such as a mammalian cell. It includes a promoter, operable in a eukaryotic cell, for mRNA transcription, one or more gene(s) encoding protein(s) of interest and a mRNA termination and processing signal. An expression cassette can usefully include among the coding sequences, a gene useful as a selective marker. In the expression cassette of the present invention, the hybrid promoter (or control sequence) is operably linked 5 to an open reading frame encoding an exogenous protein of interest; and a polyadenylation site is operably linked 3 to the open reading frame. The protein of interest encoded by the open reading frame can be a monomeric protein or fusion protein, or it can be a subunit of a larger multimeric protein. The protein of interest expressed from a second or third expression cassette can be different or the same as the protein of interest encoded by the open reading frame of the first expression cassette; for example, a first expression cassette can include the coding sequence for a light chain subunit of an immunoglobulin, and a second or third expression cassette in the expression vector can include the coding sequence for the immunoglobulin heavy chain subunit, or vice versa, with each of the subunits being the protein of interest with respect to the expression cassette in which its coding sequence is included. One embodiment of a useful polyadenylation site sequence is a SV40 late polyadenylation site SEQ ID NO:14:
TABLE-US-00013 SEQIDNO:14 CACACATCATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAAT GCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTAT TTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATT CATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCAA GTAAAACCTCTACAAATGTGGTA//.
[0133] Other suitable control sequences can also be included as long as the expression cassette remains operable. The open reading frame can optionally include a coding sequence for more than one protein of interest.
[0134] As used herein the term coding region or coding sequence when used in reference to a structural gene refers to the nucleotide sequences which encode the amino acids found in the nascent polypeptide as a result of translation of an mRNA molecule. The coding region is bounded, in eukaryotes, on the 5 side by the nucleotide triplet ATG which encodes the initiator methionine and on the 3 side by one of the three triplets which specify stop codons (i.e., TAA, TAG, TGA).
[0135] The present invention also encompasses a recombinant expression vector comprising the inventive expression cassette.
[0136] The term vector means any molecule or entity (e.g., nucleic acid, plasmid, bacteriophage or virus) used to transfer protein coding information into a host cell.
[0137] The term expression vector or expression construct as used herein refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid control sequences necessary for the expression of the operably linked coding sequence in a particular host cell. An expression vector can include, but is not limited to, sequences that affect or control transcription, translation, and, if introns are present, affect RNA splicing of a coding region operably linked thereto. Nucleic acid sequences necessary for expression in prokaryotes include a promoter, optionally an operator sequence, a ribosome binding site and possibly other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals. A secretory signal peptide sequence can also, optionally, be encoded by the expression vector, operably linked to the coding sequence of interest, so that the expressed polypeptide can be secreted by the recombinant host cell, for more facile isolation of the polypeptide of interest from the cell, if desired. Such techniques are well known in the art. (E.g., Goodey, Andrew R.; et al., Peptide and DNA sequences, U.S. Pat. No. 5,302,697; Weiner et al., Compositions and methods for protein secretion, U.S. Pat. Nos. 6,022,952 and 6,335,178; Uemura et al., Protein expression vector and utilization thereof, U.S. Pat. No. 7,029,909; Ruben et al., 27 human secreted proteins, US 2003/0104400 A1). For expression of multi-subunit proteins of interest, separate expression vectors in suitable numbers and proportions, each containing a coding sequence for each of the different monomers, can be used to transform a host cell. In other embodiments a single expression vector can be used to express the different subunits of the protein of interest.
[0138] The present invention also relates to a mammalian host cell comprising the inventive recombinant expression vector.
[0139] The term host cell means a cell that has been transformed, or is capable of being transformed, with a nucleic acid and thereby expresses a gene of interest. The term includes the progeny of the parent cell, whether or not the progeny is identical in morphology or in genetic make-up to the original parent cell, so long as the gene of interest is present. Any of a large number of available and well-known host cells may be used in the practice of this invention. The selection of a particular host is dependent upon a number of factors recognized by the art. These include, for example, compatibility with the chosen expression vector, toxicity of the peptides encoded by the DNA molecule, rate of transformation, ease of recovery of the peptides, expression characteristics, bio-safety and costs. A balance of these factors must be struck with the understanding that not all hosts may be equally effective for the expression of a particular DNA sequence. Within these general guidelines, useful microbial host cells in culture include bacteria (such as Escherichia coli sp.), yeast (such as Saccharomyces sp.) and other fungal cells, insect cells, plant cells, mammalian (including human) cells, e.g., CHO cells and HEK-293 cells. Modifications can be made at the DNA level, as well. The peptide-encoding DNA sequence may be changed to codons more compatible with the chosen host cell. For E. coli, optimized codons are known in the art. Codons can be substituted to eliminate restriction sites or to include silent restriction sites, which may aid in processing of the DNA in the selected host cell. Next, the transformed host is cultured and purified. Host cells may be cultured under conventional fermentation conditions so that the desired compounds are expressed. Such fermentation conditions are well known in the art.
[0140] Examples of useful mammalian host cell lines are Chinese hamster ovary cells, including CHO-K1 cells (e.g., ATCC CCL61), DXB-11, DG-44, and Chinese hamster ovary cells/-DHFR (CHO, Urlaub et al, Proc. Natl. Acad. Sci. USA 77: 4216 (1980)); monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, [Graham et al, J. Gen Virol. 36: 59 (1977)]; baby hamster kidney cells (BHK, ATCC CCL 10); mouse Sertoli cells (TM4, Mather, Biol. Reprod. 23: 243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human hepatoma cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al, Annals N.Y Acad. Sci. 383: 44-68 (1982)); MRC 5 cells or FS4 cells; or mammalian myeloma cells.
[0141] Cell, cell line, and cell culture are often used interchangeably and all such designations herein include cellular progeny. For example, a cell derived from a CHO cell is a cellular progeny of a Chinese Hamster Ovary cell, which may be removed from the original primary cell parent by any number of generations, and which can also include a transformant progeny cell. Transformants and transformed cells include the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same function or biological activity as screened for in the originally transformed cell are included.
[0142] Host cells are transformed or transfected with the above-described nucleic acids or vectors for production of polypeptides (including antigen binding proteins, such as antibodies) and are cultured in conventional nutrient medium modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. In addition, novel vectors and transfected cell lines with multiple copies of transcription units separated by a selective marker are particularly useful for the expression of polypeptides, such as antibodies.
[0143] The term transfection means the uptake of foreign or exogenous DNA by a cell, and a cell has been transfected when the exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are well known in the art and are disclosed herein. See, e.g., Graham et al., 1973, Virology 52:456; Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, supra; Davis et al., 1986, Basic Methods in Molecular Biology, Elsevier; Chu et al., 1981, Gene 13:197. Such techniques can be used to introduce one or more exogenous DNA moieties into suitable host cells.
[0144] The term transformation refers to a change in a cell's genetic characteristics, and a cell has been transformed when it has been modified to contain new DNA or RNA. For example, a cell is transformed where it is genetically modified from its native state by introducing new genetic material via transfection, transduction, or other techniques. Following transfection or transduction, the transforming DNA may recombine with that of the cell by physically integrating into a chromosome of the cell, or may be maintained transiently as an episomal element without being replicated, or may replicate independently as a plasmid. A cell is considered to have been stably transformed when the transforming DNA is replicated with the division of the cell.
[0145] The present invention also relates to a method of producing a protein of interest involving culturing the mammalian host cell, in aqueous medium under physiological conditions permitting expression of the protein of interest; and recovering the protein of interest from the medium.
[0146] The host cells used to produce the polypeptides useful in the invention may be cultured in a variety of media. Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ((DMEM), Sigma) are suitable for culturing the host cells. In addition, any of the media described in Ham et al., Meth. Enz. 58: 44 (1979), Barnes et al., Anal. Biochem. 102: 255 (1980), U.S. Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 4,560,655; or 5,122,469; WO90103430; WO 87/00195; or U.S. Pat. Re. No. 30,985 may be used as culture media for the host cells. Any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as Gentamycin drug), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source, such that the physiological conditions of the cell in, or on, the medium promote expression of the protein of interest by the host cell; any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art. The culture conditions, such as temperature (typically, but not necessarily, about 37 C.), pH (typically, but not necessarily, about pH 6.5-7.5), oxygenation, and the like, are those previously used with the host cell selected for expression of the protein of interest, and will be apparent to the ordinarily skilled artisan. The culture medium can include a suitable amount of serum such a fetal bovine serum (FBS), or preferably, the host cells can be adapted for culture in serum-free medium. In some embodiments, the aqueous medium is liquid, such that the host cells are cultured in a cell suspension within the liquid medium. The host cells can be usefully grown in batch culture or in continuous culture systems.
[0147] In other embodiments, the mammalian host cells can be cultured on solid or semisolid aqueous medium, for example, containing agar or agarose, to form a medium or substrate surface to which the cells adhere and form an adhesion layer.
[0148] Upon culturing the host cells, the recombinant polypeptide can be produced intracellularly, in the periplasmic space, or directly secreted into the medium. If the polypeptide, such as an antigen binding protein (e.g., an antibody), is produced intracellularly, as a first step, the particulate debris, either host cells or lysed fragments, is removed, for example, by centrifugation or ultrafiltration.
[0149] A protein of interest, such as an antibody or antibody fragment can be purified using, for example, hydroxylapatite chromatography, cation or anion exchange chromatography, or preferably affinity chromatography, using the antigen of interest or protein A or protein G as an affinity ligand. Protein A can be used to purify proteins that include polypeptides are based on human 1, 2, or 4 heavy chains (Lindmark et al., J. Immunol. Meth. 62: 1-13 (1983)). Protein G is recommended for all mouse isotypes and for human 3 (Guss et al, EMBO J. 5: 15671575 (1986)). The matrix to which the affinity ligand is attached is most often agarose, but other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. Where the protein comprises a CH 3 domain, the Bakerbond ABX resin (J. T. Baker, Phillipsburg, N.J.) is useful for purification. Other techniques for protein purification such as ethanol precipitation, Reverse Phase HPLC, chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation are also possible depending on the antibody to be recovered.
[0150] Under physiological conditions with respect to incubating buffers and immunoglobulins, or other binding assay reagents means incubation under conditions of temperature, pH, and ionic strength, that permit a biochemical reaction, such as a non-covalent binding reaction, to occur. Typically, the temperature is at room or ambient temperature up to about 37 C. and at pH 6.5-7.5.
[0151] Physiologically acceptable salt of a composition of matter, for example a salt of an immunoglobulin, such as an antibody, or other protein of interest, means any salt, or salts, that are known or later discovered to be pharmaceutically acceptable. Some non-limiting examples of pharmaceutically acceptable salts are: acetate; trifluoroacetate; hydrohalides, such as hydrochloride and hydrobromide; sulfate; citrate; maleate; tartrate; glycolate; gluconate; succinate; mesylate; besylate; salts of gallic acid esters (gallic acid is also known as 3, 4, 5 trihydroxybenzoic acid) such as PentaGalloylGlucose (PGG) and epigallocatechin gallate (EGCG), salts of cholesteryl sulfate, pamoate, tannate and oxalate salts.
[0152] A reaction mixture is an aqueous mixture containing all the reagents and factors necessary, which under physiological conditions of incubation, permit an in vitro biochemical reaction of interest to occur, such as a covalent or non-covalent binding reaction.
[0153] A domain or region (used interchangeably herein) of a polynucleotide is any portion of the entire polynucleotide, up to and including the complete polynucleotide, but typically comprising less than the complete polynucleotide. A domain can, but need not, fold independently (e.g., DNA hairpin folding) of the rest of the polynucleotide chain and/or be correlated with a particular biological, biochemical, or structural function or location, such as a coding region or a regulatory region.
[0154] A domain or region (used interchangeably herein) of a protein is any portion of the entire protein, up to and including the complete protein, but typically comprising less than the complete protein. A domain can, but need not, fold independently of the rest of the protein chain and/or be correlated with a particular biological, biochemical, or structural function or location (e.g., a ligand binding domain, or a cytosolic, transmembrane or extracellular domain).
[0155] The term antibody, or interchangeably Ab, is used in the broadest sense and includes fully assembled antibodies, monoclonal antibodies (including human, humanized or chimeric antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments that can bind antigen (e.g., Fab, Fab, F(ab).sub.2, Fv, single chain antibodies, diabodies), comprising complementarity determining regions (CDRs) of the foregoing as long as they exhibit the desired biological activity. Multimers or aggregates of intact molecules and/or fragments, including chemically derivatized antibodies, are contemplated. Antibodies of any isotype class or subclass, including IgG, IgM, IgD, IgA, and IgE, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2, or any allotype, are contemplated. Different isotypes have different effector functions; for example, IgG1 and IgG3 isotypes have antibody-dependent cellular cytotoxicity (ADCC) activity.
[0156] An isolated protein, e.g., an immunoglobulin, such as an antibody or antibody fragment, is one that has been identified and separated from one or more components of its natural environment or of a culture medium in which it has been secreted by a producing cell. In some embodiments, the isolated protein is substantially free from proteins or polypeptides or other contaminants that are found in its natural or culture medium environment that would interfere with its therapeutic, diagnostic, prophylactic, research or other use. Contaminant components of its natural environment or medium are materials that would interfere with diagnostic or therapeutic uses for the protein, e.g., an antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous (e.g., polynucleotides, lipids, carbohydrates) solutes. Typically, an isolated protein constitutes at least about 5%, at least about 10%, at least about 25%, or at least about 50% of a given sample. In some embodiments, the protein of interest, e.g., an antibody will be purified (1) to greater than 95% by weight of protein, and most preferably more than 99% by weight, or (2) to homogeneity by SDS-PAGE under reducing or nonreducing conditions, optionally using a stain, e.g., Coomassie blue or silver stain. Isolated naturally occurring antibody includes the antibody in situ within recombinant cells since at least one component of the protein's natural environment will not be present. Typically, however, the isolated protein of interest (e.g., an antibody) will be prepared by at least one purification step.
[0157] The term monoclonal antibody as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies that are antigen binding proteins are highly specific binders, being directed against an individual antigenic site or epitope, in contrast to polyclonal antibody preparations that typically include different antibodies directed against different epitopes. Nonlimiting examples of monoclonal antibodies include murine, rabbit, rat, chicken, chimeric, humanized, or human antibodies, fully assembled antibodies, multispecific antibodies (including bispecific antibodies), antibody fragments that can bind an antigen (including, Fab, Fab, F(ab).sub.2, Fv, single chain antibodies, diabodies), maxibodies, nanobodies, and recombinant peptides comprising CDRs of the foregoing as long as they exhibit the desired biological activity, or variants or derivatives thereof.
[0158] The modifier monoclonal indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler et al., Nature, 256:495 [1975], or may be made by recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567). The monoclonal antibodies may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352:624-628119911 and Marks et al., J. Mol. Biol., 222:581-597 (1991), for example.
[0159] A multispecific binding agent or antigen binding protein or antibody is one that targets more than one antigen or epitope.
[0160] A bispecific, dual-specific or bifunctional binding agent or antigen binding protein or antibody is a hybrid having two different antigen binding sites. Biantigen binding proteins, antigen binding proteins and antibodies are a species of multiantigen binding protein, antigen binding protein or multispecific antibody and may be produced by a variety of methods including, but not limited to, fusion of hybridomas or linking of Fab fragments. (See, e.g., Songsivilai and Lachmann, 1990, Clin. Exp. Immunol. 79:315-321; Kostelny et al., 1992, J. Immunol. 148:1547-1553; Spiess et al., Alternative molecular formats and therapeutic applications for bispecific antibodies, Mol. Immunol. 67:95-106 (2015)). The two binding sites of a bispecific antigen binding protein or antibody will bind to two different epitopes, which may reside on the same or different protein targets.
[0161] The term immunoglobulin encompasses full antibodies comprising two dimerized heavy chains (HC), each covalently linked to a light chain (LC); a single undimerized immunoglobulin heavy chain and covalently linked light chain (HC+LC), or a chimeric immunoglobulin (light chain+heavy chain)-Fc heterotrimer (a so-called hemibody). An immunoglobulin is a protein, but is not necessarily an antigen binding protein.
[0162] In an antibody, each tetramer is composed of two identical pairs of polypeptide chains, each pair having one light chain of about 220 amino acids (about 25 kDa) and one heavy chain of about 440 amino acids (about 50-70 kDa). The amino-terminal portion of each chain includes a variable (V) region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function. The variable region differs among different antibodies. The constant region is the same among different antibodies. Within the variable region of each heavy or light chain, there are three hypervariable subregions that help determine the antibody's specificity for antigen in the case of an antibody that is an antigen binding protein. However, within the scope of the present invention, an embodiment of the immunoglobulin, e.g., an antibody, need not be an antigen binding protein, or need not be known to specifically bind to an antigen. The variable domain residues between the hypervariable regions are called the framework residues and generally are somewhat homologous among different antibodies Immunoglobulins can be assigned to different classes depending on the amino acid sequence of the constant domain of their heavy chains. Human light chains are classified as kappa (.kappa.) and lambda (.lamda.) light chains. Within light and heavy chains, the variable and constant regions are joined by a J region of about 12 or more amino acids, with the heavy chain also including a D region of about 10 more amino acids. See generally, Fundamental Immunology, Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, N.Y. (1989)). Within the scope of the invention, an antibody also encompasses a recombinantly made antibody, and antibodies that are glycosylated or lacking glycosylation.
[0163] The term light chain or immunoglobulin light chain includes a full-length light chain and fragments thereof having sufficient variable region sequence to confer binding specificity. A full-length light chain includes a variable region domain, V.sub.L, and a constant region domain, C.sub.L. The variable region domain of the light chain is at the amino-terminus of the polypeptide. Light chains include kappa chains and lambda chains.
[0164] The term heavy chain or immunoglobulin heavy chain includes a full-length heavy chain and fragments thereof having sufficient variable region sequence to confer binding specificity. A full-length heavy chain includes a variable region domain, V.sub.H, and three constant region domains, C.sub.H1, C.sub.H2, and C.sub.H3. The V.sub.H domain is at the amino-terminus of the polypeptide, and the C.sub.H domains are at the carboxyl-terminus, with the C.sub.H3 being closest to the carboxy-terminus of the polypeptide. Heavy chains are classified as mu (), delta (), gamma (), alpha (), and epsilon (), and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. In separate embodiments of the invention, heavy chains may be of any isotype, including IgG (including IgG1, IgG2, IgG3 and IgG4 subtypes), IgA (including IgA1 and IgA2 subtypes), IgM and IgE. Several of these may be further divided into subclasses or isotypes, e.g. IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. Different IgG isotypes may have different effector functions (mediated by the Fc region), such as antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC). In ADCC, the Fc region of an antibody binds to Fc receptors (Fc.gamma.Rs) on the surface of immune effector cells such as natural killers and macrophages, leading to the phagocytosis or lysis of the targeted cells. In CDC, the antibodies kill the targeted cells by triggering the complement cascade at the cell surface.
[0165] An Fc region, or used interchangeably herein, Fc domain or immunoglobulin Fc domain, contains two heavy chain fragments, which in a full antibody comprise the C.sub.H1 and C.sub.H2 domains of the antibody. The two heavy chain fragments are held together by two or more disulfide bonds and by hydrophobic interactions of the C.sub.H3 domains.
[0166] The term salvage receptor binding epitope refers to an epitope of the Fc region of an IgG molecule (e.g., IgG.sub.1, IgG.sub.2, IgG.sub.3, or IgG.sub.4) that is responsible for increasing the in vivo serum half-life of the IgG molecule.
[0167] In many embodiments of the invention, the protein of interest is an antigen binding protein, such as but not limited to, an antibody, antibody subunit, or antibody fragment. For a detailed description of the structure and generation of antibodies, see Roth, D. B., and Craig, N. L., Cell, 94:411-414 (1998), herein incorporated by reference in its entirety. Briefly, the process for generating DNA encoding the heavy and light chain immunoglobulin sequences occurs primarily in developing B-cells. Prior to the rearranging and joining of various immunoglobulin gene segments, the V, D, J and constant (C) gene segments are found generally in relatively close proximity on a single chromosome. During B-cell-differentiation, one of each of the appropriate family members of the V, D, J (or only V and J in the case of light chain genes) gene segments are recombined to form functionally rearranged variable regions of the heavy and light immunoglobulin genes. This gene segment rearrangement process appears to be sequential. First, heavy chain D-to-J joints are made, followed by heavy chain V-to-DJ joints and light chain V-to-J joints. In addition to the rearrangement of V, D and J segments, further diversity is generated in the primary repertoire of immunoglobulin heavy and light chains by way of variable recombination at the locations where the V and J segments in the light chain are joined and where the D and J segments of the heavy chain are joined. Such variation in the light chain typically occurs within the last codon of the V gene segment and the first codon of the J segment. Similar imprecision in joining occurs on the heavy chain chromosome between the D and J.sub.H segments and may extend over as many as 10 nucleotides. Furthermore, several nucleotides may be inserted between the D and J.sub.H and between the V.sub.H and D gene segments which are not encoded by genomic DNA. The addition of these nucleotides is known as N-region diversity. The net effect of such rearrangements in the variable region gene segments and the variable recombination which may occur during such joining is the production of a primary antibody repertoire.
[0168] The term hypervariable region refers to the amino acid residues of an antibody which are responsible for antigen-binding. The hypervariable region comprises amino acid residues from a complementarity determining region or CDR [i.e., residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain as described by Kabat et al., Sequences of Proteins of Immunological Interest, th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)]. Even a single CDR may recognize and bind antigen, although with a lower affinity than the entire antigen binding site containing all of the CDRs.
[0169] An alternative definition of residues from a hypervariable loop is described by Chothia et al., J. Mol. Biol. 196: 901-917 (1987) as residues 26-32 (L1), 50-52 (L2) and 91-96 (L3) in the light chain variable domain and 26-32 (H1), 53-55 (H2) and 96-101 (H3) in the heavy chain variable domain.
[0170] Framework or FR residues are those variable region residues other than the hypervariable region residues.
[0171] Antibody fragments comprise a portion of an intact full length antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab, F(ab)2, and Fv fragments; diabodies; linear antibodies (Zapata et al., Protein Eng., 8(10):1057-1062 (1995)); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
[0172] Papain digestion of antibodies produces two identical antigen-binding fragments, called Fab fragments, each with a single antigen-binding site, and a residual Fc fragment which contains the constant region. The Fab fragment contains all of the variable domain, as well as the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. The Fc fragment displays carbohydrates and is responsible for many antibody effector functions (such as binding complement and cell receptors), that distinguish one class of antibody from another.
[0173] Pepsin treatment yields an F(ab).sub.2 fragment that has two Single-chain Fv or scFv antibody fragments comprising the V.sub.H and V.sub.L domains of antibody, wherein these domains are present in a single polypeptide chain. Fab fragments differ from Fab fragments by the inclusion of a few additional residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains that enables the Fv to form the desired structure for antigen binding. For a review of scFv see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 1 13, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994).
[0174] A Fab fragment is comprised of one light chain and the C.sub.H1 and variable regions of one heavy chain. The heavy chain of a Fab molecule cannot form a disulfide bond with another heavy chain molecule.
[0175] A Fab fragment contains one light chain and a portion of one heavy chain that contains the V.sub.H domain and the C.sub.H1 domain and also the region between the C.sub.H1 and C.sub.H2 domains, such that an interchain disulfide bond can be formed between the two heavy chains of two Fab fragments to form an F(ab).sub.2 molecule.
[0176] A F(ab).sub.2 fragment contains two light chains and two heavy chains containing a portion of the constant region between the C.sub.H1 and C.sub.H2 domains, such that an interchain disulfide bond is formed between the two heavy chains. A F(ab).sub.2 fragment thus is composed of two Fab fragments that are held together by a disulfide bond between the two heavy chains.
[0177] Fv is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the VH VL dimer. A single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
[0178] Single-chain antibodies are Fv molecules in which the heavy and light chain variable regions have been connected by a flexible linker to form a single polypeptide chain, which forms an antigen-binding region. Single chain antibodies are discussed in detail in International Patent Application Publication No. WO 88/01649 and U.S. Pat. Nos. 4,946,778 and 5,260,203, the disclosures of which are incorporated by reference in their entireties.
[0179] Single-chain Fv or scFv antibody fragments comprise the V.sub.H and V.sub.L domains of antibody, wherein these domains are present in a single polypeptide chain, and optionally comprising a polypeptide linker between the V.sub.H and V.sub.L domains that enables the Fv to form the desired structure for antigen binding (Bird et al., Science 242:423-426, 1988, and Huston et al., Proc. Nati. Acad. Sci. USA 85:5879-5883, 1988). An Fd fragment consists of the V.sub.H and C.sub.H1 domains.
[0180] The term diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (V.sub.H) connected to a light-chain variable domain (V.sub.L) in the same polypeptide chain (V.sub.H V.sub.L). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).
[0181] A domain antibody is an immunologically functional immunoglobulin fragment containing only the variable region of a heavy chain or the variable region of a light chain. In some instances, two or more V.sub.H regions are covalently joined with a peptide linker to create a bivalent domain antibody. The two V.sub.H regions of a bivalent domain antibody may target the same or different antigens.
[0182] The term antigen binding protein (ABP) includes antibodies or antibody fragments, as defined above, and recombinant peptides or other compounds that contain sequences derived from CDRs having the desired antigen-binding properties such that they specifically bind a target antigen of interest.
[0183] In general, an antigen binding protein, e.g., an antibody or antibody fragment, specifically binds to an antigen of interest when it has a significantly higher binding affinity for, and consequently is capable of distinguishing, that antigen, compared to its affinity for other unrelated proteins, under similar binding assay conditions. Typically, an antigen binding protein is said to specifically bind its target antigen when the dissociation constant (K.sub.D) is 10.sup.8 M or lower. The antigen binding protein specifically binds antigen with high affinity when the K.sub.D is 10.sup.9 M or lower, and with very high affinity when the K.sub.D is 10.sup.10 M or lower.
[0184] Antigen binding region or antigen binding site means a portion of a protein that specifically binds a specified antigen. For example, that portion of an antigen binding protein that contains the amino acid residues that interact with an antigen and confer on the antigen binding protein its specificity and affinity for the antigen is referred to as antigen binding region. An antigen binding region typically includes one or more complementary binding regions (CDRs). Certain antigen binding regions also include one or more framework regions (FRs). A CDR is an amino acid sequence that contributes to antigen binding specificity and affinity. Framework regions can aid in maintaining the proper conformation of the CDRs to promote binding between the antigen binding region and an antigen. In a traditional antibody, the CDRs are embedded within a framework in the heavy and light chain variable region where they constitute the regions responsible for antigen binding and recognition. A variable region of an immunoglobulin antigen binding protein comprises at least three heavy or light chain CDRs, see, supra (Kabat et al., 1991, Sequences of Proteins of Immunological Interest, Public Health Service N.I.H., Bethesda, Md.; see also Chothia and Lesk, 1987, J. Mol. Biol. 196:901-917; Chothia et al., 1989, Nature 342: 877-883), within a framework region (designated framework regions 1-4, FR1, FR2, FR3, and FR4, by Kabat et al., 1991, supra; see also Chothia and Lesk, 1987, supra).
[0185] The term antigen refers to a molecule or a portion of a molecule capable of being bound by a selective binding agent, such as an antigen binding protein (including, e.g., an antibody or immunological functional fragment thereof), and additionally capable of being used in an animal to produce antibodies capable of binding to that antigen. An antigen may possess one or more epitopes that are capable of interacting with different antigen binding proteins, e.g., antibodies.
[0186] The term epitope is the portion of a molecule that is bound by an antigen binding protein (for example, an antibody). The term includes any determinant capable of specifically binding to an antigen binding protein, such as an antibody or to a T-cell receptor. An epitope can be contiguous or non-contiguous (e.g., in a single-chain polypeptide, amino acid residues that are not contiguous to one another in the polypeptide sequence but that within the context of the molecule are bound by the antigen binding protein). In certain embodiments, epitopes may be mimetic in that they comprise a three dimensional structure that is similar to an epitope used to generate the antigen binding protein, yet comprise none or only some of the amino acid residues found in that epitope used to generate the antigen binding protein. Most often, epitopes reside on proteins, but in some instances may reside on other kinds of molecules, such as nucleic acids. Epitope determinants may include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl or sulfonyl groups, and may have specific three dimensional structural characteristics, and/or specific charge characteristics. Generally, antibodies specific for a particular target antigen will preferentially recognize an epitope on the target antigen in a complex mixture of proteins and/or macromolecules.
[0187] The term identity refers to a relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the sequences. Percent identity means the percent of identical residues between the amino acids or nucleotides in the compared molecules and is calculated based on the size of the smallest of the molecules being compared. For these calculations, gaps in alignments (if any) must be addressed by a particular mathematical model or computer program (i.e., an algorithm). Methods that can be used to calculate the identity of the aligned nucleic acids or polypeptides include those described in Computational Molecular Biology, (Lesk, A. M., ed.), 1988, New York: Oxford University Press; Biocomputing Informatics and Genome Projects, (Smith, D. W., ed.), 1993, New York: Academic Press; Computer Analysis of Sequence Data, Part I, (Griffin, A. M., and Griffin, H. G., eds.), 1994, New Jersey: Humana Press; von Heinje, G., 1987, Sequence Analysis in Molecular Biology, New York: Academic Press; Sequence Analysis Primer, (Gribskov, M. and Devereux, J., eds.), 1991, New York: M. Stockton Press; and Carillo et al., 1988, SIAM J. Applied Math. 48:1073. For example, sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the amino acids of two polypeptides. Using a computer program such as BLAST or FASTA, two polypeptide or two polynucleotide sequences are aligned for optimal matching of their respective residues (either along the full length of one or both sequences, or along a pre-determined portion of one or both sequences). The programs provide a default opening penalty and a default gap penalty, and a scoring matrix such as PAM 250 [a standard scoring matrix; see Dayhoff et al., in Atlas of Protein Sequence and Structure, vol. 5, supp. 3 (1978)] can be used in conjunction with the computer program. For example, the percent identity can then be calculated as: the total number of identical matches multiplied by 100 and then divided by the sum of the length of the longer sequence within the matched span and the number of gaps introduced into the longer sequences in order to align the two sequences. In calculating percent identity, the sequences being compared are aligned in a way that gives the largest match between the sequences.
[0188] The GCG program package is a computer program that can be used to determine percent identity, which package includes GAP (Devereux et al., 1984, Nucl. Acid Res. 12:387; Genetics Computer Group, University of Wisconsin, Madison, Wis.). The computer algorithm GAP is used to align the two polypeptides or two polynucleotides for which the percent sequence identity is to be determined. The sequences are aligned for optimal matching of their respective amino acid or nucleotide (the matched span, as determined by the algorithm). A gap opening penalty (which is calculated as 3.times. the average diagonal, wherein the average diagonal is the average of the diagonal of the comparison matrix being used; the diagonal is the score or number assigned to each perfect amino acid match by the particular comparison matrix) and a gap extension penalty (which is usually 1/10 times the gap opening penalty), as well as a comparison matrix such as PAM 250 or BLOSUM 62 are used in conjunction with the algorithm. In certain embodiments, a standard comparison matrix (see, Dayhoff et al., 1978, Atlas of Protein Sequence and Structure 5:345-352 for the PAM 250 comparison matrix; Henikoff et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:10915-10919 for the BLOSUM 62 comparison matrix) is also used by the algorithm.
[0189] Recommended parameters for determining percent identity for polypeptides or nucleotide sequences using the GAP program include the following:
[0190] Algorithm: Needleman et al., 1970, J. Mol. Biol. 48:443-453;
[0191] Comparison matrix: BLOSUM 62 from Henikoff et al., 1992, supra;
[0192] Gap Penalty: 12 (but with no penalty for end gaps)
[0193] Gap Length Penalty: 4
[0194] Threshold of Similarity: 0
[0195] Certain alignment schemes for aligning two amino acid sequences may result in matching of only a short region of the two sequences, and this small aligned region may have very high sequence identity even though there is no significant relationship between the two full-length sequences. Accordingly, the selected alignment method (GAP program) can be adjusted if so desired to result in an alignment that spans at least 50 contiguous amino acids of the target polypeptide.
[0196] The term modification when used in connection with proteins of interest (e.g., immunoglobulins, including antibodies and antibody fragments), include, but are not limited to, one or more amino acid changes (including substitutions, insertions or deletions); chemical modifications; covalent modification by conjugation to therapeutic or diagnostic agents; labeling (e.g., with radionuclides or various enzymes); covalent polymer attachment such as PEGylation (derivatization with polyethylene glycol) and insertion or substitution by chemical synthesis of non-natural amino acids. Modified immunoglobulins of the invention will retain the binding (or non-binding) properties of unmodified molecules of the invention. By methods known to the skilled artisan, immunoglobulins, such as antibodies, or other proteins, can be engineered or modified for improved target affinity, selectivity, stability, and/or manufacturability before the coding sequence of the engineered protein is included in the inventive expression cassette.
[0197] The term derivative when used in connection with proteins of interest, such as immunoglobulins (including antibodies and antibody fragments) refers to proteins that are covalently modified by conjugation to therapeutic or diagnostic agents, labeling (e.g., with radionuclides or various enzymes), covalent polymer attachment such as PEGylation (derivatization with polyethylene glycol) and insertion or substitution by chemical synthesis of non-natural amino acids. Derivatives of the invention will retain the binding properties of un-derivatized molecules.
[0198] Within the scope of the invention, proteins of interest can be therapeutic proteins (so-called biologics.) The term therapeutic protein means a pharmacologically active protein applicable to the prevention, treatment, or cure of a disease, disorder, or medical condition of human beings or other mammals. Examples of therapeutic proteins include, but are not limited to, monoclonal antibodies, recombinant forms of a native protein (e.g., a receptor, ligand, hormone, enzyme or cytokine), fusion proteins, peptibodies, and/or a monomer domain binding proteins, e.g., based on a domain selected from LDL receptor A-domain, thrombospondin domain, thyroglobulin domain, trefoil/PD domain, VEGF binding domain, EGF domain, Anato domain, Notch/LNR domain, DSL domain, integrin beta domain, and Ca-EGF domain. The preceding are merely exemplary, and a therapeutic protein can comprise any clinically relevant polypeptide target moiety or polypeptide ligand.
[0199] Treatment or treating is an intervention performed with the intention of preventing the development or altering the pathology of a disorder. Accordingly, treatment refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. Treatment includes any indication(s) of success in the amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient's physical or mental well-being. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination by a physician or other health care provider, self-reporting by a patient, neuropsychiatric exams, and/or a psychiatric evaluation.
[0200] An effective amount of a therapeutic is generally an amount sufficient to reduce the severity and/or frequency of symptoms, eliminate the symptoms and/or underlying cause, prevent the occurrence of symptoms and/or their underlying cause, and/or improve or remediate the damage that results from or is associated with migraine headache. In some embodiments, the effective amount is a therapeutically effective amount or a prophylactically effective amount. A therapeutically effective amount is an amount sufficient to remedy a disease state (e.g., transplant rejection or GVHD, inflammation, multiple sclerosis, cancer, cardiovascular disease, diabetes, neuropathy, pain) or symptom(s), particularly a state or symptom(s) associated with the disease state, or otherwise prevent, hinder, retard or reverse the progression of the disease state or any other undesirable symptom associated with the disease in any way whatsoever (i.e. that provides therapeutic efficacy). A prophylactically effective amount is an amount of a pharmaceutical composition that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of migraine headache or multiple sclerosis symptoms, or reducing the likelihood of the onset (or reoccurrence) of migraine headache, migraine headache symptoms, or multiple sclerosis symptoms. The full therapeutic or prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a therapeutically or prophylactically effective amount may be administered in one or more administrations.
[0201] The protein of interest can be any protein, but in many embodiments the protein is a pharmacologically active protein or peptide.
[0202] In some embodiments of the invention, the protein of interest can be a mimetic or agonist peptide. The terms -mimetic peptide, peptide mimetic, and -agonist peptide refer to a peptide or protein having biological activity comparable to a naturally occurring protein of interest. These terms further include peptides that indirectly mimic the activity of a naturally occurring peptide molecule, such as by potentiating the effects of the naturally occurring molecule.
[0203] In some embodiments of the invention, the protein of interest can be an antagonist peptide or inhibitor peptide. The term -antagonist peptide, peptide antagonist, and inhibitor peptide refer to a peptide that blocks or in some way interferes with the biological activity of a receptor of interest, or has biological activity comparable to a known antagonist or inhibitor of a receptor of interest (such as, but not limited to, an ion channel or a G-Protein Coupled Receptor (GPCR)).
[0204] Examples of pharmacologically active proteins that can be used within the present invention include, but are not limited to, a toxin peptide, an IL-6 binding peptide, a CD3 binding protein, a CD19 binding protein, a CD20 binding protein, a CD22 binding protein, a HER2 binding protein, a HER3 binding protein, a VEGF-A binding protein, a TNF- binding protein, an EGFR binding protein, a RANK ligand binding protein, an IL-1 binding protein, an IL-1 binding protein, an IL-17A binding protein, an EPCAM (CD326) binding protein, a CGRP peptide antagonist, a bradykinin B1 receptor peptide antagonist, a parathyroid hormone (PTH) agonist peptide, a parathyroid hormone (PTH) antagonist peptide, an ang-1 binding peptide, an ang-2 binding peptide, a myostatin binding peptide, an erythropoietin-mimetic (EPO-mimetic) peptide, a FGF21 peptide, a thrombopoietin-mimetic (TPO-mimetic) peptide (e.g., AMP2 or AMPS), a nerve growth factor (NGF) binding peptide, a B cell activating factor (BAFF) binding peptide, and a glucagon-like peptide (GLP)-1 or a peptide mimetic thereof or GLP-2 or a peptide mimetic thereof.
[0205] The term peptide or protein analog refers to a polypeptide having a sequence that differs from a peptide sequence existing in nature by at least one amino acid residue substitution, internal addition, or internal deletion of at least one amino acid, and/or amino- or carboxy-terminal end truncations, or additions). An internal deletion refers to absence of an amino acid from a sequence existing in nature at a position other than the N- or C-terminus. Likewise, an internal addition refers to presence of an amino acid in a sequence existing in nature at a position other than the N- or C-terminus.
[0206] Cloning DNA
[0207] Cloning of DNA is carried out using standard techniques (see, e.g., Sambrook et al. (1989) Molecular Cloning: A Laboratory Guide, Vols 1-3, Cold Spring Harbor Press, which is incorporated herein by reference). For example, a cDNA library may be constructed by reverse transcription of polyA+ mRNA, preferably membrane-associated mRNA, and the library screened using probes specific for human immunoglobulin polypeptide gene sequences. In one embodiment, however, the polymerase chain reaction (PCR) is used to amplify cDNAs (or portions of full-length cDNAs) encoding an immunoglobulin gene segment of interest (e.g., a light or heavy chain variable segment). The amplified sequences can be readily cloned into any suitable vector, e.g., expression vectors, minigene vectors, or phage display vectors. It will be appreciated that the particular method of cloning used is not critical, so long as it is possible to determine the sequence of some portion of the immunoglobulin polypeptide of interest.
[0208] One source for antibody nucleic acids is a hybridoma produced by obtaining a B cell from an animal immunized with the antigen of interest and fusing it to an immortal cell. Alternatively, nucleic acid can be isolated from B cells (or whole spleen) of the immunized animal. Yet another source of nucleic acids encoding antibodies is a library of such nucleic acids generated, for example, through phage display technology. Polynucleotides encoding peptides of interest, e.g., variable region peptides with desired binding characteristics, can be identified by standard techniques such as panning.
[0209] The sequence encoding an entire variable region of the immunoglobulin polypeptide may be determined; however, it will sometimes be adequate to sequence only a portion of a variable region, for example, the CDR-encoding portion. Sequencing is carried out using standard techniques (see, e.g., Sambrook et al. (1989) Molecular Cloning: A Laboratory Guide, Vols 1-3, Cold Spring Harbor Press, and Sanger, F. et al. (1977) Proc. Natl. Acad. Sci. USA 74: 5463-5467, which is incorporated herein by reference). By comparing the sequence of the cloned nucleic acid with published sequences of human immunoglobulin genes and cDNAs, one of skill will readily be able to determine, depending on the region sequenced, (i) the germline segment usage of the hybridoma immunoglobulin polypeptide (including the isotype of the heavy chain) and (ii) the sequence of the heavy and light chain variable regions, including sequences resulting from N-region addition and the process of somatic mutation. One source of immunoglobulin gene sequence information is the National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Md.
[0210] Isolated DNA can be operably linked to control sequences or placed into expression vectors, which are then transfected into host cells that do not otherwise produce immunoglobulin protein, to direct the synthesis of monoclonal antibodies in the recombinant host cells. Recombinant production of antibodies is well known in the art.
[0211] Nucleic acid is operably linked when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, operably linked means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
[0212] Many vectors are known in the art. Vector components may include one or more of the following: a signal sequence (that may, for example, direct secretion of the antibody; e.g., ATGGACATGAGGGTGCCCGCTCAGCTCCTGGGGCTCCTGCTGCTGTGGCTGAGAG GT GCGCGCTGT//SEQ ID NO:7, which encodes the VK-1 signal peptide sequence MDMRVPAQLLGLLLLWLRGARC//SEQ ID NO:8), an origin of replication, one or more selective marker genes (that may, for example, confer antibiotic or other drug resistance, complement auxotrophic deficiencies, or supply critical nutrients not available in the medium), an enhancer element, a promoter, and a transcription termination sequence, all of which are well known in the art.
[0213] By way of further illustration, the following numbered embodiments are encompassed by the present invention:
Embodiment 1
[0214] A hybrid promoter (or control sequence) comprising: [0215] (i) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1 alpha intron sequence; [0216] (ii) an intervening first leader sequence operably linked, 3 to the CMV promoter sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and [0217] (iii) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence.
Embodiment 2
[0218] The hybrid promoter of Embodiment 1, wherein the CMV promoter sequence at the 3 end of the mCMV enhancer sequence comprises a segment having the nucleotide sequence of SEQ ID NO:24 or SEQ ID NO:26.
Embodiment 3
[0219] The hybrid promoter of any of Embodiments 1-2, wherein the rat EF-1alpha intron sequence comprises the nucleotide sequence of SEQ ID NO:4.
Embodiment 4
[0220] The hybrid promoter of any of Embodiments 1-3, wherein the mCMV enhancer sequence comprises the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:33; and the rat EF-1alpha intron sequence comprises the nucleotide sequence of SEQ ID NO:4.
Embodiment 5
[0221] The hybrid promoter of any of Embodiments 1-4, wherein the first leader sequence comprises the nucleotide sequence of SEQ ID NO:3.
Embodiment 6
[0222] The hybrid promoter of any of Embodiments 1-5, wherein the second leader sequence comprises the nucleotide sequence of SEQ ID NO:5.
Embodiment 7
[0223] The hybrid promoter of any of Embodiments 1-6, further comprising one or more TetO sequences inserted within the CMV promoter sequence.
Embodiment 8
[0224] The hybrid promoter of any of Embodiments 1-7, comprising a nucleotide sequence having at least 95% sequence identity to the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:32.
Embodiment 9
[0225] An expression cassette, comprising: [0226] the hybrid promoter (or control sequence) of any of Embodiments 1-8, operably linked 5 to an open reading frame encoding an exogenous protein of interest; and a polyadenylation site operably linked 3 to the open reading frame.
Embodiment 10
[0227] A recombinant expression vector comprising the expression cassette of Embodiment 9.
Embodiment 11
[0228] A mammalian host cell comprising the recombinant expression vector of Embodiment 10.
Embodiment 12
[0229] The mammalian host cell of Embodiment 11, further being capable of expressing TetR.
Embodiment 13
[0230] The mammalian host cell of any of Embodiments 11-12, being derived from a Chinese Hamster Ovary (CHO) cell.
Embodiment 14
[0231] The mammalian host cell of any of Embodiments 11-13, selected from the group consisting of a CHO-K1 cell, a DXB11 cell, and a DG44 cell.
Embodiment 15
[0232] A method of producing a protein of interest, comprising: [0233] (a) culturing the mammalian host cell of any of Embodiments 11-14, in an aqueous medium under physiological conditions permitting expression of the protein of interest; and [0234] (b) recovering the protein of interest from the medium.
Embodiment 16
[0235] A method of producing a protein of interest, comprising: [0236] (a) culturing a mammalian host cell that comprises an expression vector comprising the hybrid promoter (or control sequence) of any of Embodiments 7-8, in an aqueous medium under physiological conditions, wherein the mammalian host cell is capable of expressing TetR, whereby, in the absence of tetracycline in the medium, the expression of the protein of interest is repressed; [0237] (b) adding tetracycline to the aqueous medium in an amount sufficient to bind TetR in the host cell, whereby expression of the protein of interest by the host cell is derepressed; and [0238] (c) recovering the protein of interest from the medium.
Embodiment 17
[0239] The method of any of Embodiments 15-16, wherein the aqueous medium is serum-free.
Embodiment 18
[0240] The method of any of Embodiments 15-16, wherein culturing the mammalian host cell is in a suspension in liquid aqueous medium.
Embodiment 19
[0241] The method of any of Embodiments 15-16, wherein culturing the mammalian host cell is in an adhesion layer on a solid or semisolid substrate.
Embodiment 20
[0242] A recombinant expression vector, comprising: [0243] (a) a 5 PiggyBac ITR comprising the nucleotide sequence of SEQ ID NO:45; [0244] (b) a first expression cassette, comprising: [0245] (i) a control sequence comprising: [0246] (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence; [0247] (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and [0248] (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence; [0249] (ii) an open reading frame encoding a protein of interest operably linked to the control sequence; and [0250] (iii) a polyadenylation site operably linked 3 to the open reading frame; [0251] (c) a second expression cassette, comprising: [0252] (i) a weak constitutive promoter, operably linked to an open reading frame encoding a selectable marker; and [0253] (ii) a polyadenylation site operably linked 3 to the open reading frame; and [0254] (d) a 3 PiggyBac ITR comprising the nucleotide sequence of SEQ ID NO:47.
Embodiment 21
[0255] The vector of Embodiment 20, further comprising: [0256] (e) a third expression cassette comprising: [0257] (i) a control sequence comprising a promoter; [0258] (ii) an open reading frame encoding a protein of interest (different or the same as the protein of interest encoded by the open reading frame of the first expression cassette) operably linked to the control sequence; and [0259] (iii) a second polyadenylation site operably linked 3 to the open reading frame.
Embodiment 22
[0260] The vector of Embodiment 21, wherein the control sequence (i) of the third expression cassette comprises: [0261] (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence; [0262] (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and [0263] (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence.
Embodiment 23
[0264] The recombinant expression vector of any of Embodiments 20-22, wherein the weak constitutive promoter is a deleted SV40 promoter.
Embodiment 24
[0265] The recombinant expression vector of any of Embodiments 20-23, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:53.
Embodiment 25
[0266] The recombinant expression vector of any of Embodiments 20-24, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:46.
Embodiment 26
[0267] The recombinant expression vector of any of Embodiments 20-25, wherein the selectable marker is glutamine synthetase, puromycin resistance, neomycin resistance, zeomycin resistance, or dihydrofolate reductase.
Embodiment 27
[0268] The recombinant expression vector of any of Embodiments 20-26, wherein the selectable marker is glutamine synthetase.
Embodiment 28
[0269] The recombinant expression vector of any of Embodiments 20-27, wherein the selectable marker is encoded by the nucleotide sequence of SEQ ID NO:49, or a degenerate DNA sequence.
Embodiment 29
[0270] A recombinant expression vector, comprising: [0271] (a) a first expression cassette, comprising: [0272] (i) a control sequence comprising: [0273] (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence; [0274] (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and [0275] (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence; [0276] (ii) an open reading frame encoding a first immunoglobulin subunit operably linked to the control sequence; and [0277] (iii) a first polyadenylation site operably linked 3 to the open reading frame; [0278] (b) a second expression cassette 3 to the first expression cassette, comprising: [0279] (i) a control sequence comprising a promoter; [0280] (ii) an open reading frame encoding a second immunoglobulin subunit operably linked to the promoter; and [0281] (iii) a second polyadenylation site operably linked 3 to the open reading frame; and [0282] (c) a transcription termination sequence 3 to the first expression cassette and 5 to the second expression cassette.
Embodiment 30
[0283] The vector of Embodiment 29, wherein the control sequence (i) of the second expression cassette comprises:
[0284] (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence;
[0285] (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and
[0286] (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence.
Embodiment 31
[0287] The vector of any of Embodiments 29-30, further comprising: [0288] (d) a third expression cassette comprising: [0289] (i) a weak constitutive promoter, operably linked to an open reading frame encoding a selectable marker; and [0290] (ii) a polyadenylation site operably linked 3 to the open reading frame.
Embodiment 32
[0291] The vector of Embodiment 31, wherein the weak constitutive promoter is a deleted SV40 promoter.
Embodiment 33
[0292] The vector of Embodiment 32, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:53.
Embodiment 34
[0293] The vector of any of Embodiments 32-33, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:46.
Embodiment 35
[0294] The vector of any of Embodiments 31-34, wherein the selectable marker is glutamine synthetase, puromycin resistance, neomycin resistance, zeomycin resistance, or dihydrofolate reductase.
Embodiment 36
[0295] The vector of any of Embodiments 31-35, wherein the selectable marker is glutamine synthetase.
Embodiment 37
[0296] The vector of any of Embodiments 31-36, wherein the selectable marker is encoded by the nucleotide sequence of SEQ ID NO:49, or a degenerate DNA sequence.
Embodiment 38
[0297] A mammalian host cell, comprising the recombinant expression vector of any of Embodiments 20-37.
Embodiment 39
[0298] The mammalian host cell of Embodiment 38, wherein the mammalian host cell is a CHO cell.
Embodiment 40
[0299] The mammalian host cell of Embodiment 39, wherein the CHO cell is a CHO-K1 cell, a DXB11 cell, or a DG44 cell.
Embodiment 41
[0300] A method of producing a protein of interest, in vitro, comprising culturing the mammalian host cell of any of Embodiments 38-40 in an aqueous medium under physiological conditions permitting expression of the protein of interest; and recovering the protein of interest from the medium.
Embodiment 42
[0301] A recombinant expression vector, comprising:
(a) a 5 PiggyBac ITR comprising the nucleotide sequence of SEQ ID NO:45;
(b) a first expression cassette, comprising: [0302] (i) a control sequence comprising: [0303] (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence, comprising one or more TetO sequences inserted within the CMV-P sequence; [0304] (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and [0305] (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence; [0306] (ii) an open reading frame encoding a protein of interest operably linked to the control sequence; and [0307] (iii) a polyadenylation site operably linked 3 to the open reading frame;
(c) a second expression cassette, comprising: [0308] (i) a weak constitutive promoter, operably linked to an open reading frame encoding a selectable marker; and [0309] (ii) a polyadenylation site operably linked 3 to the open reading frame; and
(d) a 3 PiggyBac ITR comprising the nucleotide sequence of SEQ ID NO:47.
Embodiment 43
[0310] The recombinant expression vector of Embodiment 42, further comprising:
(e) a third expression cassette comprising: [0311] (i) a control sequence comprising an inducible promoter comprising one or more TetO sequences; [0312] (ii) an open reading frame encoding a protein of interest (different or the same as the protein of interest encoded by the open reading frame of the first expression cassette) operably linked to the control sequence; and [0313] (iii) a second polyadenylation site operably linked 3 to the open reading frame.
Embodiment 44
[0314] The recombinant expression vector of Embodiment 43, wherein the control sequence (i) of the third expression cassette comprises:
[0315] (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence, comprising one or more TetO sequences inserted within the CMV-P sequence;
[0316] (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and
[0317] (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence.
Embodiment 45
[0318] The recombinant expression vector of any of Embodiments 42-44, wherein the weak constitutive promoter is a deleted SV40 promoter.
Embodiment 46
[0319] The recombinant expression vector of any of Embodiments 42-45, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:53.
Embodiment 47
[0320] The recombinant expression vector of any of Embodiments 42-46, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:46.
Embodiment 48
[0321] The recombinant expression vector of any of Embodiments 42-47, wherein the selectable marker is glutamine synthetase, puromycin resistance, neomycin resistance, zeomycin resistance, or dihydrofolate reductase.
Embodiment 49
[0322] The recombinant expression vector of any of Embodiments 42-48, wherein the selectable marker is glutamine synthetase.
Embodiment 50
[0323] The recombinant expression vector of any of Embodiments 42-49, wherein the selectable marker is encoded by the nucleotide sequence of SEQ ID NO:49, or a degenerate DNA sequence.
Embodiment 51
[0324] A method of selecting a stable production cell line for manufacturing a protein of interest, comprising the following steps:
[0325] (a) culturing a mammalian host cell stably transfected with the recombinant expression vector of any of Embodiments 42-44, under selective pressure with respect to a selectable marker constitutively expressed from the weak constitutive promoter, in an aqueous medium under physiological conditions, wherein the mammalian host cell is capable of expressing TetR, in the absence of tetracycline or a tetracycline analog in the medium, whereby expression of protein from the first expression cassette and, if present in the vector, from the third expression cassette, is repressed;
[0326] (b) selecting a viable cell line from the host cell(s) cultured in step (a);
[0327] (c) culturing the viable cell line from step (b) in an aqueous medium containing tetracycline or a tetracycline analog in an amount sufficient to bind TetR in the host cell(s), whereby expression of the protein of interest by the host cell is derepressed; and
[0328] (d) detecting the protein of interest in the culture medium;
[0329] (e) selecting a stable production cell line from step (c) that produces a greater amount of the protein of interest relative to a control transfectant in which the aqueous medium in steps (a) and (c) contained tetracycline or a tetracycline analog in an amount sufficient to bind TetR in the host cell, whereby the expression of the protein of interest was derepressed in the control transfectant.
Embodiment 52
[0330] The method of Embodiment 51, wherein the mammalian host cell is a CHO cell.
Embodiment 53
[0331] The method of any of Embodiments 51-52, wherein the CHO cell is a CHO-K1 cell, a DXB11 cell, or a DG44 cell.
Embodiment 54
[0332] A recombinant expression vector, comprising:
[0333] (a) a first expression cassette, comprising: [0334] (i) a control sequence comprising: [0335] (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence, comprising one or more TetO sequences inserted within the CMV-P sequence; [0336] (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and [0337] (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence; [0338] (ii) an open reading frame encoding a first immunoglobulin subunit operably linked to the control sequence; and [0339] (iii) a first polyadenylation site operably linked 3 to the open reading frame;
[0340] (b) a second expression cassette 3 to the first expression cassette, comprising: [0341] (i) a control sequence comprising a promoter; [0342] (ii) an open reading frame encoding a second immunoglobulin subunit operably linked to the promoter; and [0343] (iii) a second polyadenylation site operably linked 3 to the open reading frame; and
[0344] (c) a transcription termination sequence 3 to the first expression cassette and 5 to the second expression cassette.
Embodiment 55
[0345] The recombinant expression vector of Embodiment 54, wherein the control sequence (i) of the second expression cassette comprises:
[0346] (1) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3 end, operably linked 5 to a rat EF-1alpha intron sequence, comprising one or more TetO sequences inserted within the CMV-P sequence;
[0347] (2) an intervening first leader sequence operably linked, 3 to the CMV-P sequence of the mCMV enhancer sequence, and 5 to the rat EF-1alpha intron sequence; and
[0348] (3) a second leader sequence operably linked 3 to the rat EF-1alpha intron sequence.
Embodiment 56
[0349] The recombinant expression vector of any of Embodiments 54-55, further comprising:
[0350] (d) a third expression cassette comprising: [0351] (i) a weak constitutive promoter, operably linked to an open reading frame encoding a selectable marker; and [0352] (ii) a polyadenylation site operably linked 3 to the open reading frame.
Embodiment 57
[0353] The recombinant expression vector of Embodiment 56, wherein the weak constitutive promoter is a deleted SV40 promoter.
Embodiment 58
[0354] The recombinant expression vector of any of Embodiments 56-57, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:53.
Embodiment 59
[0355] The recombinant expression vector of any of Embodiments 56-58, wherein the deleted SV40 promoter comprises the nucleotide sequence of SEQ ID NO:46.
Embodiment 60
[0356] The recombinant expression vector of any of Embodiments 56-59, wherein the selectable marker is glutamine synthetase, puromycin resistance, neomycin resistance, zeomycin resistance, or dihydrofolate reductase.
Embodiment 61
[0357] The recombinant expression vector of any of Embodiments 56-60, wherein the selectable marker is glutamine synthetase.
Embodiment 62
[0358] The recombinant expression vector of any of Embodiments 56-61, wherein the selectable marker is encoded by the nucleotide sequence of SEQ ID NO:49, or a degenerate DNA sequence.
Embodiment 63
[0359] A mammalian host cell, comprising the recombinant expression vector of any of Embodiments 42-50 and 54-62.
Embodiment 64
[0360] The mammalian host cell of Embodiment 63, wherein the mammalian host cell is a CHO cell.
Embodiment 65
[0361] The mammalian host cell of Embodiment 64, wherein the CHO cell is a CHO-K1 cell, a DXB11 cell, or a DG44 cell.
Embodiment 66
[0362] A method of producing a protein of interest, in vitro, comprising culturing the mammalian host cell of any of Embodiments 63-65 in an aqueous medium under physiological conditions permitting expression of the protein of interest; and recovering the protein of interest from the medium.
[0363] The following working examples are illustrative and not to be construed in any way as limiting the scope of the invention.
EXAMPLES
Example 1. Materials and Methods
[0364] Vector Construction.
[0365] All vectors C, D, E, F, and G included a DNA sequence encoding an exogenous protein of interest Fc-A (or FC-A; an exemplary Fc fusion with a therapeutic anti-inflammatory antibody), an IRES derived from EMCV virus, the murine dihydrofolate reductase gene, and a 221-bp late polyadenylation derived from SV40 virus as described previously (Kaufman, R. J. et al., Improved vectors for stable expression of foreign genes in mammalian cells by use of the untranslated leader sequence from EMC virus, Nucl. Acids Res. 19(16): 4485-4490 (1991); Schek, et al., Definition of the upstream efficiency element of the simian virus 40 late polyadenylation signal by using in vitro analyses, Mol. Cell. Biol. 12(12):5386-93 (1992)). The junction between the IRES and DHFR was aaaaacacgatTGCTCGAGAGTTGCCACCCATCatg//SEQ ID NO:6, where the lower case letters represent the endogenous IRES sequence and the ATG transcription start site of DHFR is italicized lower case. A single transcript is initiated from these various constructs, which then includes the Fc-A gene, the EMCV IRES, the murine DHFR gene and terminates at the SV40 polyadenylation site.
[0366] Various transcription promoting sequences were included either 5 or both 5 and 3 to the sequence described above. This allowed all plasmids to be selected using the DHFR gene and Fc-A as a marker for relative expression. The plasmid backbone for all plasmids was pUC57-simple Genscript (Piscataway, N.J.).
[0367] Several exemplary plasmids are represented schematically in
[0368] Electroporation and Culture of Cells.
[0369] Long duration electroporation were performed as described previously (Bodwell, et al., Long Duration electroporation for achieving high level expression of glucocorticoi receptors n mammalian cell lines, J. Steroid Biochem. and Mol. Biol., 68(e 8), 77-82 (1999)). Briefly, 210.sup.7 cells were resuspended in 0.3 mL of HBS buffer (0.01 M HEPES pH 7.4, 0.15 M NaCl, 3 mM EDTA, 0.005% v/v Polysorbate20), 25 mg of DNA was added, and electroporated in a 4 mm gap cuvette using a BTX EM 600 with a capacitance of 3175 F, 720 ohms, and 200 volts.
[0370] DXB11 and DG44 cells were cultured in either PowerCHO2 (Lonza), ProCHO4 (Lonza) or Ex-cell 302 (Sigma) according to the manufacturer's instructions. Cells were cultured every 3-4 days and seeded at 410.sup.5 cells/ml for a 3-day culture or 310.sup.5 cells/ml for a 4-day culture.
[0371] Protein titer was determined by affinity High Performance Liquid Chromatography (HPLC) using POROS A/20 Protein A column.
Example 2. Transfection of CHO Cells
[0372] CHO cells were transfected with various constructs expressing the Fc-A fusion protein. These constructs are shown in
[0373] Transfection of DXB11 Cells.
[0374] The various Fc-A expression plasmids were used to transfect DXB11, a DHFR mutant CHO cell line, using electroporation. These cells were grown in ProCHO4 and were first selected for growth in culture medium lacking hypoxanthine and thymidine and then selected at 150 nM methotrexate (MTX). Pools of cells selected with 150 nM MTX were seeded at 110.sup.6 cells/ml and fed Ex-cell Advanced CHO Feed 1 (SAFC) and glucose on days 2, 4 and 7. Supernatant fluid was harvested on day 8 and analyzed by poros protein A as described above.
[0375] The Fc-A protein titer and specific productivity (picograms per cell per day) are shown in
[0376] Transfection of DXB-11 with Vectors D, F, and G.
[0377] Vectors D, F, and G (
[0378] Transfection of DG44 and DXB-11 with Vectors D and F.
[0379] CHO cells were transfected with Vectors D and F expressing Fc-A fusion protein. DXB11 cells growing in Ex-cell 302 were transfected as described above. DG44, another DHFR mutant cell line, was grown in PowerCHO2 and transfected identically to the DXB11 cells. Transfected pools of cells were compared for their expression of Fc-A. Cells were transfected using electroporation, selected for growth in culture medium lacking hypoxanthine and thymidine, and then amplified to 150 nM MTX. The DXB11 were further amplified to 500 nM MTX and the DG44 cells were further amplified to 1 uM MTX. Pools of cells were then seeded by a 1:5 dilution into growth medium supplemented with Ex-cell Advanced CHO Feed 1, fed on days 3, 6 and 8 with Ex-cell Advanced CHO Feed 1 and glucose. Supernatant fluid was harvested on day 10 and analyzed by poros protein A as described above. The titer and specific productivity are shown in
[0380] DXB11 Pools transfected with Vector D expressed nearly twice as much Fc-A fusion protein as those pools transfected with Vector F. Pools of DG44 cells transfected with Vectors D and F expressed at similar levels. However, the pools transfected with the Vector D had slightly higher specific productivity. The lower specific productivity of DG44 cells compared to DXB11 cells implies that DG44 cells are less sensitive to the MTX than DXB11 cells.
[0381] Vector D also included a 5 untranslated (5UTR) leader sequence derived from adenovirus tripartite leader (TPL). The TPL has been shown to enhance expression of proteins under stress conditions (Logan & Shenk, Adenovirus tripartite leader sequence enhances translation of mRNAs late after infection, Proc. Natl. Acad. Sci. USA 81(12): 3655-59 (1984)). Whether the TPL is enhancing expression in these studies is unclear, but other studies have shown that the exact nucleotide sequences of the 5UTR that one may use in this position varies as long, as they do not contain extensive secondary structures or initiator codons prior to the authentic initiator codon (Mignone, F. et al., Untranslated regions of mRNAs. Genome Biology, 3(3):reviews0004.1-0004.10 (2002)).
Example 3. Tetracycline-Inducible Expression from the Inventive Hybrid Promoter (Control Sequence)
[0382] In cells expressing the Tet repressor (TetR), tetracycline can be used to regulate expression from promoters containing the Tet operator sequence (Yao et al.). Introduction of the Tet operator (TetO) sequence just 3 of the TATA box prevents transcription from this promoter in the presence of the TetR. Presumably, TetR binds to TetO and prevents transcription factors from interacting with the transcription start site or interfere with the transcription initiation complex formation (Yao et al). Notably, positioning of the TetO sequences is critical in determining if TetR can effectively modulate transcription. (See, Yao et al., Tetracycline repressor, tetR, rather than the tetR-mammalian cell transcription factor fusion derivatives, regulates inducible gene expression in mammalian cells, Hum. Gene Ther. 9(13):1939-50 (1998)).
[0383] Yao et al. hypothesized that positioning the TetO sequence 10 bp downstream of the TATATAA sequence allows binding of the TetR to the same surface as the TATA binding protein. Consistent with this hypothesis, Kim et al. found that insertion of TetO sequences at position 0 or 15 downstream of the hCMV US11 TATAAG sequence failed to preserve repression in the presence of TetR. (See, Kim et al., Tetracycline repressor-regulated gene repression in recombinant human cytomegalovirus, J. Virol. 69: 2565-257 (1995)).
[0384] Tetracycline (Tet), when added to the culture, will bind TetR and inhibit binding to the TetO sequence, thus allowing transcription. To create a powerful Tet-regulated promoter based on the inventive mCMV enhancer sequence/rat EF-1 intron hybrid promoter sequences, we first generated a plasmid driving LacZ (beta-galactosidase protein) expression, JV56_pJV39_pJV10_pUC57S (herein abbreviated as pJV56;
TABLE-US-00014 SEQIDNO:12 ATGGGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGACTG GTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGTACCT AAGGATCAGCTTGGAGTTGATCCCGTCGTTTTACAACGTCGTGACTGGGA AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG TTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGA AGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTG TCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTAC ACCAACGTAACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGA GAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGC TACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTT CATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTT GCCGTCTGAATTTGACCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCC TCGCGGTGATGGTGCTGCGTTGGAGTGACGGCAGTTATCTGGAAGATCAG GATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAA ACCGACTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATG ATTTCAGCCGCGCTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTG CGTGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGT CGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTG GTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAACTG TGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACAC CGCCGACGGCACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCG AGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGCTG ATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCAT GGATGAGCAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGAACAACT TTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTACACG CTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAAC CCACGGCATGGTGCCAATGAATCGTCTGACCGATGATCCGCGCTGGCTAC CGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCGTAATCAC CCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAA TCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCCGG TGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATATTATTTGC CCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAA ATGGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGA TCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCT AAATACTGGCAGGCGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGT CTGGGACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAACGGCAACC CGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACGATCGCCAG TTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCT GACGGAAGCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGC AAACCATCGAAGTGACCAGCGAATACCTGTTCCGTCATAGCGATAACGAG CTCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGA AGTGCCTCTGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTG AACTACCGCAGCCGGAGAGCGCCGGGCAACTCTGGCTCACAGTACGCGTA GTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCAGCGCCTG GCAGCAGTGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGT CCCACGCCATCCCGCATCTGACCACCAGCGAAATGGATTTTTGCATCGAG CTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCACA GATGTGGATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGT TCACCCGTGCACCGCTGGATAACGACATTGGCGTAAGTGAAGCGACCCGC ATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCA GGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGATGCGG TGCTGATTACGACCGCTCACGCGTGGCAGCATCAGGGGAAAACCTTATTT ATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTAC CGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGCGGATTGGCC TGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGGATTA GGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCG CTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCG AAAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACCAG TGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACT GATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGC TGAATATCGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGC CCGTCAGTATCGGCGGAGTTCCAGCTGAGCGCCGGTCGCTACCATTACCA GTTGGTCTGGTGTCAAAAATAA//.
[0385] The basic idea was to exchange part of the mCMV promoter (mCMV-P) element sequence with the human CMV promoter (hCMV-P) element that includes the TetO binding sites responsible for regulation by tetracycline (Tet). This construct, JV57_JV56_pJV39_pJV10 (herein abbreviated as pJV57;
[0386]
[0387] We expressed beta-galactosidase from various constructs to monitor the level of protein expression. This inserted substitute sequence, which includes muCMV enhancer element (mCMV-E)/(partial) huCMV promoter/TetO/ratEF-1alpha intron, was indeed regulated by tetracycline in the medium (See, e.g.,
[0388] Materials and Methods
[0389] T-REx-CHO Cells.
[0390] T-REx-CHO cell line (Thermo Fisher Scientific, Product No. R71807) were cultured in Ham's F12 medium+glutamine+10 g/ml Blast per manufacturer's protocol. T-REx-CHO cells were electroporated using the long duration electroporation (LDE) method as described by Bodwell et al. (Bodwell et al., Long Duration Electroporation for Achieving High Level Expression of Glucocorticoid Receptors in Mammalian Cell Lines, J. Steroid Biochem. Molec. Biol. 68:77-82 (1999)), with various constructs pJV56, pJV57, pJV59, and pJV60, expressing the beta-galactosidase protein, as shown in
[0391] CHO-K1/TetR Cells.
[0392] In separate experiments, tetracycline repressor (TetR) was subcloned by Genscript (Piscataway, N.J.) into pcDNA3.1+expression vector to yield vector pJV40_pcDNA3.1+tetR (abbreviated herein, as pJV40;
[0393] To screen for clones expressing high levels of TetR, CHO-K1/TetR clones were transfected with pJV57 using the ExpiFectamine CHO transfection kit (Thermo Fisher Scientific, Product No. A29130) per manufacturer's protocol. From those highly expressing TetR clones, some clones were subsequently chosen to be transfected with vector pJV56, pJV57, pJV59, or pJV60, using the ExpiFectamine CHO transfection kit (Thermo Fisher Scientific, Product No. A29130), again transfected per manufacturer's protocol. Transfected clones were allowed to recover for 24 hours and then were treated with 1 g/ml tetracycline for 24 hours. To measure expression of the LacZ protein product, cells were lysed, and beta-galactosidase activity was assayed using a -Gal Assay Kit per manufacturer's protocol (Thermo Fisher Scientific, Product No. K1455-01).
[0394] Briefly, lysates were diluted 10-fold and 10-l aliquots were assayed using a BCA protein assay kit (Thermo Fisher Scientific, Product No. 23227) to determine protein concentration of the lysate. Ten (10) l of undiluted lysate was assayed for beta-galactosidase activity. All samples were transfected at least in duplicates. Specific beta-galactosidase activity was normalized to the amount of protein assayed and background activity of mock-transfected cells was subtracted from transfected samples. Results were graphed with standard deviation shown (e.g.,
[0395]
Results
[0396] T-REx CHO Cells.
[0397] In experiments using T-RExCHO cells (Thermo Fisher Scientific), a commercial cell line that stably expresses TetR, we measured beta-galactosidase (beta-gal) activity as a readout to test the ability of pJV57 to be regulated by tetracycline (Tet). As shown in
[0398] In an attempt to further improve upon pJV57, we hypothesized that the TetO sequences could reduce expression from pJV57 as previous studies showed that changes around the transcription start site reduced expression from the hCMV promoter (Patwardhan et al., High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis, Nat Biotechnol. 27(12): 1173-1175 (2009)). The TetO sequences in pJV57 were changed to match the sequences that increased expression surrounding the transcription start site in the study by Patwardhan et al. (pJV60,
[0399] The optimized hCMV promoter (hCMV-P) sequences replaced the mCMV promoter (mCMV-P) sequences in the mCMV enhancer sequence/rat EF-1 intron hybrid promoter of the invention (see, sequence comparison in
[0400] CHO-K1/TetR Cells.
[0401] In separate experiments, a CHO-K1 cell line stably expressing TetR was generated by transfection of pJV40 (see,
[0402] As shown in
[0403] Interestingly, total expression of LacZ was increased in all three pJV59-transfected CHO-K1/TetR clones, although as expected there was essentially no tetracycline-sensitive regulation of expression (Tet comparison: 0.99-, 1.06-, 1.00-fold difference), as shown in
[0404] Overall, all of the pJV56, pJV57, pJV59, and pJV60 constructs in CHO/TetR cells demonstrated increased LacZ expression compared to CHO cells expressing from pcDNA5/TO/LacZ (i.e., positive controls) in the presence of tetracycline, and CHO cells bearing the inventive hybrid promoter with hCMV-P/TetO sequences had beta-galactosidase expression up-reregulated by tetracycline (1.56- to 9.30-fold differences), compared to (Tet), as shown in
Example 4. Limiting the Metabolic Burden of Recombinant Protein Expression During Selection Yields Pools with Higher Expression Levels
[0405] We sought to test the idea that the metabolic burden of any recombinant protein expression, if high enough, would impact the selection process during CHO cell line development. We first developed an inducible expression system by isolating tetracycline repressor (TetR) expressing CHO cell lines (see, Example 3 hereinabove), and then transfected these TetR cell lines with expression vectors expressing either a Fc fusion protein or a recombinant antibody. Neither of the proteins displayed obvious toxicity in constitutive expression systems. For these two proteins, we show that pools that were induced to express a recombinant protein expression during cell line selection had lower titers than pools that were uninduced during cell line selection. These data are consistent with the hypothesis that the metabolic burden of protein expression selects against the higher expressing clones during selection of cell pools.
[0406] Materials and Methods
[0407] Cell Culture.
[0408] CHOK1 GS KO cells (Horizon Discovery) were maintained in CD OptiCHO (Gibco)+4 mM glutamine (Q). Cells were passaged every 3-4 days at a seed density of 0.3-0.410.sup.6/mL. A codon optimized tetracycline repressor (TetR) was synthesized (Genscript) and subcloned into an expression vector with human CMV driving TetR expression. GS KO cells were electroporated using the LDE method as described (Bodwell et al., Long Duration electroporation for achieving high level expression of glucocorticoi receptors n mammalian cell lines, J. Steroid Biochem. Mol. Biol. 68(8):77-82 (1999)) with TetR vector. Transfected pools were selected for about 12 days in CD OptiCHO+glutamine+400 g/ml G418 (Gibco). Pools were then transfected (as described below in the transient transfection section) with pcDNA5/TO/LacZ (ThermoFisher), allowed to recover for 24 hours and then treated with or without tetratcycline (Tet, 1 g/mL) for 24 hours to identify the pool with high Tet-dependent induction of the target gene. Cells were lysed, and beta-galactosidase activity was assayed using a -Gal Assay Kit per manufacturer's protocol (ThermoFisher Scientific) and read on Spectra Max 5 plate reader (Molecular Devices). Briefly, lysates were diluted 10-fold and 10 l was assayed using a BCA protein assay kit (ThermoFisher) to determine protein concentration of the lysate. Ten microliters (10 L) of undiluted lysate was assayed for beta-galactosidase activity. Tet and a more stable derivative, doxycycline (Dox), were used to induce cultures, as described herein.
[0409] The selected pool was then serially diluted and plated in 96-well microplates (Corning CellBIND) at 0.75 cells per well in cloning medium (EX-CELL 302 Serum-Free Medium for CHO Cells)+15% conditioned medium in the presence of G418). Clonal populations were identified after 11-12 days (CloneSelect Imager, Molecular Devices) and transferred to 12-well plates in 50/50 cloning medium/CD OptiCHO medium for an additional 3-4 days. Finally, clones were transferred to 24 deep-well plates (VWR) with constant shaking (220 rpm) in CD OptiCHO medium+glutamine+400 g/ml G418.
[0410] To screen for clones expressing high levels of TetR, clones were transfected with pcDNA5/TO/LacZ or an in-house plasmid expressing LacZ using the HCN protocol (see, Transient transfection section, below). Transfected clones recovered for 24-48 hours and then were treated with 1 g/mL Tet for 24 hours. Cells were lysed, and beta-galactosidase activity was assayed using a -Gal Assay Kit per manufacturer's protocol as described above. All samples were transfected at least in duplicate. Specific beta-galactosidase activity was normalized to the amount of protein assayed and background activity of mock-transfected cells was subtracted from transfected samples.
[0411] Transient Transfection.
[0412] Cells were passaged to 110.sup.6/mL the day before transfection. On the day of transfection, cells were counted on a Vi-Cell XR (Beckman Coulter) and electroporated using the high copy number (HCN) protocol (see, Barsoum J., Introduction of stable high-copy-number DNA into Chinese hamster ovary cells by electroporation, DNA Cell Biol. 9(4):293-300 (1990)) in duplicate or triplicates. Briefly, 110.sup.6 cells were used per transfection. Cells were spun down and resuspended in 150 l of PF CHO medium (Sigma Aldrich) and aliquoted into one well of a 55 electroporation plate (BTX). Ten micrograms (10 g) of plasmid DNA and 10 g of salmon sperm DNA (Sigma Aldrich) were used per transfection. PF CHO medium was used to bring final transfection volume up to 50 L, and aliquots were placed into appropriate wells in the 55 electroporation plate. For mock-transfected samples, salmon sperm DNA was used only. Cells were electroporated under these conditions: 290V voltage, 950 F capacitance, 950 ohm resistance in an ECM 630 electro manipulator coupled to a HT-100 high throughput adaptor (BTX). After electroporation, cells were transferred to a 24 deep well plate containing 1 mL of fresh growth medium without antibiotics and were allowed to recover for 2 days. Two days post-transfection, a duplicate 24 deep well plate was generated from half of the cells in each well and treated with 1 g/mL tetracycline (Tet; Sigma Aldrich). On days 4, 6 and 8, cells were fed with 10% CD Efficient Feeds (Thermo Fisher Scientific) A+B+C (3.3% each) and 1 g/mL Tet.
[0413] Stable Transfection.
[0414] Cells were passaged to 110.sup.6/mL the day before transfection and counted on a Vi-Cell the day of transfection, as described above. Cells were electroporated using the long-duration method (Bodwell et al., Long Duration electroporation for achieving high level expression of glucocorticoi receptors n mammalian cell lines, J. Steroid Biochem. Mol. Biol. 68(8):77-82 (1999)) in, at least, duplicate cultures. For each transfection 2010.sup.6 cells were used. Cells were spun down, resuspended in 300 L PF CHO medium (Sigma) and aliquoted into a 4-mm electroporation cuvette (VWR International). Meanwhile, a DNA/RNA mixture was prepared. For each transfection, a total of 25 g DNA/RNA was mixed with PF CHO to a final volume of 50 L. For the transposon experiments, 22.5 g of transposon and 2.5 g of transposase RNA (10%) was used. For mock-transfected cells, DNA/RNA were omitted from the PF CHO mixture. Cells were electroporated under these conditions: 200V voltage, 725 F capacitance, 3175 ohm resistance in an ECM 630 electro manipulator coupled to a 630B safety stand (BTX; See, Barsoum J., Introduction of stable high-copy-number DNA into Chinese hamster ovary cells by electroporation, DNA Cell Biol. 9(4):293-300 (1990)). After electroporation, cells were resuspended in 15 mL of fresh growth medium, +glutamine, without antibiotics and allowed to recover for 2 days in a stationary T75 flask. After this recovery period, cells were counted on a Vi-Cell and were seeded for selection at 0.75 to 110.sup.6/mL in CD OptiCHO medium (Gibco), Q+antibiotics (as needed) in a 24 deep well plate shaking at 220 rpm. Cells were counted and passaged every 3-4 days on a Guava easyCyte flow cytometer (MilliporeSigma). In some cases, cells were treated with doxycycline (Dox; Sigma D9891) to a final concentration of 0.5 g/mL. In all cases, there was a replicate culture plate without Dox as a control for +Dox cultures.
[0415] Fed Batch Production.
[0416] Cells were seeded by dilution into a CD OptiCHO or CD FortiCHO (Gibco) production medium to a density of 0.7-1.510.sup.6/mL. On day 0, production medium was frontloaded with 30% CD Efficient Feeds A, B and C (10% of each feed). On days 3, 6 and 8 of production, cells were fed with 10% CD Efficient Feeds A, B and C (3.3% of each feed) and glucose was added as necessary to a final concentration of about 10 g/L. Growth profiles (viable cell density and viability) were also measured on days 3, 6 and 8 on a Guava easyCyte flow cytometer (MilliporeSigma). Glucose was measured using a colorimetric assay (Stanbio Laboratory) on a Spectra Max 5 plate reader (Molecular Devices). The measurement of titer measurements was performed by affinity High Performance Liquid Chromatography (HPLC) using POROS A/20 Protein A column. For the interval between days [m, n], Specific productivity (qP) was calculated according to the formula: qP=titer.sub.n/VCDdt/(t.sub.nt.sub.m), where and time (t) is expressed in days.
[0417] Quantitative PCR (qPCR).
[0418] On day 3 of production, anywhere from 200,000 to 210.sup.6 cells were isolated, spun down and resuspended vigorously in 300 L RA 1 buffer (Macherey-Nagel)+1% B-ME (Sigma). Cell lysates were frozen at 70 C. until ready for automated purification on a BioRobot (Qiagen) using a NucleoSpin RNA kit (Macherey-Nagel). The concentration of RNA was measured on a Nanodrop spectrophotometer (Thermo Fisher) before qPCR set up. Once concentrations were determined on the Nanodrop, RNA was diluted to 5-10 ng/L. Two microliters (2 L) was used as a template in a 20-L reaction. qScript XLT 1-step RT-PCR kit (Quanta) or the Luna Universal 1-step RT-qPCR kit (New England Biolabs) was used according to manufacturer's protocol. Transcripts of interest were normalized to GAPDH and beta-actin. Ratios of LC/HC were calculated by dividing the relative fold-change of LC by the relative fold-change of HC. The primer sequences used are listed below in Table 1, in a 5 to 3 orientation.
TABLE-US-00015 TABLE1 Primersequencesemployed. GAPDHForward CCTGGAGAAACCTGCCAAGTATGA//SEQIDNO:36 GAPDHProbe:5 AGAAGGTGGTGAAGCAGGCATCTGAGGGCC//SEQID Cy5-labeled NO:37 GAPDHReverse ACTGTTGAAGTCGCAGGAGACAA//SEQIDNO:38 Beta-actinForward CCCAGCACCATGAAGATCAA//SEQIDNO:39 Beta-actinProbe:5 CATTGCTCCTCCTGAGCGCAAGTA//SEQIDNO:40 Fluorescein(6- FAM)-labeled Beta-actinReverse TGCTTGCTGATCCACATCTC//SEQIDNO:41 Glutamine GGGAACAGATGGGCACCCTTT//SEQIDNO:42 synthetase(GS) Forward GSProbe:5 TTGGCCTTCCAATGGCTTTCCTGGGC//SEQIDNO:43 Hexachloro- Fluorescein(Hex)- labeled GSReverse ACGATATCCCTGCCATAGGCTTTGT//SEQIDNO:44
[0419] Results
[0420] Generation of a TetR-Expressing CHO-K1 (GS KO) Clone.
[0421] A CHO-K1 glutamine synthetase (GS) knock out (GS KO, Horizon Discovery) cell line stably expressing TetR was generated by transfection of a plasmid that has the TetR gene subcloned into a vector with human CMV driving expression of TetR. (Yao, F. et al., Tetracycline Repressor, tetR, rather than the Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells, Hum Gene Ther. 9:1939-1950 (1998)). Geneticin-resistant CHO-K1 (GS KO) pools (TetR-GS KO) were serially diluted to obtain single-cell colonies and screened to have high expression of TetR. This was achieved by transient transfection of TetR-GS KO clones with pcDNA5/TO/LacZ, a vector expressing the reporter enzyme beta-galactosidase under the control of a Tet-regulatable hCMV promoter. The top clones were selected based on their ability to repress expression of LacZ by more than two-fold (data not shown).
[0422] Regulation of an Fc-Fusion Protein Expression in a TetR-GS KO Clone.
[0423] A representative TetR-GS KO clone, 9G1, was selected for further analysis (
[0424] Description of Inducible Transposon-Based System.
[0425] Next, we sought to determine the relationship between recombinant protein production and cellular growth. We expressed an Fc-fusion protein, Fc-A, by using an inducible transposon-based vector system. As described in
[0426] The Relationship Between Growth and CHO-K1 Cell Productivity Levels.
[0427] To test the inducible transposon-system, 9G1 cells were stably transfected with pJVec_2 or pJVec_3, constitutive or Dox-regulatable, respectively, transposon vectors expressing Fc-A protein (
[0428] Cell pools derived as described above were put into a small-scale 10-day fed-batch process once recovered from selection. Cell lysates and supernatants were harvested on days 3 and 10 for mRNA analysis and Fc-A titer quantification, respectively.
[0429] Next, we evaluated whether pools selected without the pressure of producing a recombinant product (culture medium lacking Dox) would have increased proportions of inherently high-producing cells within the population due to their ability to grow as well as low producers, which do not have the metabolic burden of producing as much recombinant protein as high producers. To this end, pJVec_3 () cells that had Fc-A expression turned off during selection were induced with Dox during production (lanes 5 and 10,
[0430] Relationship of Fc-Fusion Recombinant Message Levels to CHO Cell Productivity.
[0431] Previous reports have shown qP to have a strong positive linear relationship with recombinant protein transcript levels in the cell. (See, Fomina-Yadlin, D. et al., Transcriptome analysis of a CHO cell line expressing a recombinant therapeutic protein treated with inducers of protein expression, J. Biotechnol. 212:106-115 (2015); Lee, C. J. et al., A clone screening method using mRNA levels to determine specific productivity and product quality for monoclonal antibodies, Biotechnol. Bioeng. 2009. doi:10.1002/bit.22126). In order to determine whether mRNA levels correlated to qP under different selection conditions, RNA was purified from cells on day 3 of production from the experiment shown in
[0432] Regulatable Expression of a Monoclonal Antibody (mAb).
[0433] We then tested whether this regulated expression system would have any advantages when used to express mAbs. The schematic representation of the plasmid as depicted in
[0434] Differential mAb LC and HC Transcript Levels During Production.
[0435] To gain a deeper understanding of mAb production with the pJVec_4 expression vector, levels of LC and HC mRNA expression was analyzed by qPCR. One replicate of the pJVec_4 pools that did not receive Dox was used as a control sample. When we looked at relative expression of LC or HC mRNA as a function of qP, we saw two distinct populations, separated by mAb_A expression being turned on or off, i.e. +Dox or Dox, respectively (
[0436] To test this hypothesis, the polyA sequence downstream of LC in pJVec_4 was replaced with a human -globin polyA/terminator sequence. (Dye, M J and Proudfoot, N J, Multiple transcript cleavage precedes polymerase release in termination by RNA polymerase II, Cell 105(5):669-681 (2001)). This construct, pJVec_5 (
[0437] Improved Productivity in pJVec 5 Pools Selected and Maintained in the Absence of Doxycycline (Dox).
[0438] Pools of pJVec_5-transfected cells were then subjected to a 10-day fed-batch production assay. Pools that were selected in the presence of Dox were maintained in that fashion throughout the production assay (
[0439] Balanced LC/HC Ratios Correlates to Increased Titers and Specific Productivity (qP).
[0440] The mAb_A LC and HC transcript levels were analyzed by qPCR to gain insight into the increased titer and qP we observed when we utilized pJVec_5 compared to pJVec_4. We focused on 6F5 pools because that cell line gave us the highest titers and qP among the ones that were tested (
[0441] Discussion.
[0442] We found that limiting recombinant protein expression during cell line selection yielded higher expressing pools compared to pools that were selected with constitutive protein expression. This effect was observed for both an Fc-fusion protein and a mAb. In addition, four different TetR expressing clones displayed similar results. The magnitude of this effect was up to approximately 1.8 fold for the mAb pools to over 2-fold for the Fc-fusion molecule. These data are consistent with data from microbial systems where the metabolic burden of unnecessary protein expression can result in selection of lower expressing clones.
[0443] Even innocuous proteins such as beta-galactosidase and green fluorescent protein limit growth when expressed at sufficiently high levels in microbial systems. Scott et al., Interdependence of cell growth and gene expression: origins and consequences, Science 330(6007):1099-1102 (2010); Miroux, B et al., Over-production of proteins in Escherichia coli mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels, J. Mol. Biol. 260:289-298 (1996)).
[0444] For mammalian cells this effect has been described for toxic proteins. (See, Misaghi, S. et al., It's time to regulate: Coping with product-induced nongenetic clonal instability in CHO cell lines via regulated protein expression, Biotechnol Frog. 2014; 30(6):1432-1440 (2014); Jones, J. et al., Optimization of tetracycline-responsive recombinant protein production and effect on cell growth and ER stress in mammalian cells, Biotechnol Bioeng. 91(6):722-732 (2005)).
[0445] Neither of the proteins utilized in this paper had obvious toxicity, and stable cell lines with constitutive promoters have been isolated with both molecules (data not shown). A recent report using a cumate-inducible system showed a similar result to those described in this report where restricting expression to only the production phase yielded pools expressing higher levels of protein compared to constitutive expression. (Poulain, A. et al., Rapid protein production from stable CHO cell pools using plasmid vector and the cumate gene-switch, J Biotechnol. 255:16-27 (2017)). However, their results can potentially be explained by the observation that their inducible promoter appeared to be significantly more powerful than the constitutive promoters they used for comparison.
[0446] We observed a close correlation between qP and recombinant protein mRNA levels (
[0447] We did not observe substantial differences in growth during production phase between pools selected while constitutively expressing recombinant protein compared to those only expressing recombinant protein during production phase. In fact, some of the cultures selected in the presence of Dox achieved higher VCDs and viability in production. The increase in titer observed for cultures that were only treated with Dox during production was primarily associated with an increase in specific productivity. This phenomenon is similar to that observed with E. coli expression, where constitutive expression leads to expression instability and outgrowth of mutants with reduced expression or mutations that allow the cells to tolerate high levels of protein expression. (Miroux, B et al., Over-production of proteins in Escherichia coli mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels, J. Mol. Biol. 260:289-298 (1996); Baneyx F., Recombinant protein expression in Escherichia coli, Curr. Opin. Biotechnol. 10(5):411-21 (1999)). In the pools selected in the presence of Dox, we hypothesize that outgrowth of lower expressing clones during the selection phase accounts for the lower expression compared with those selected in the absence of Dox. This is consistent with the observation that the doubling time of cultures selected in the absence of Dox increases when those cultures are treated with Dox. Two practical advantages of inducible systems were apparent from this work including higher titers and more rapid generation of recombinant protein expressing pools by way of faster recovery during selection.