Single nucleotide polymorphisms associated with bull fertility
10323284 ยท 2019-06-18
Assignee
Inventors
Cpc classification
C12Q1/6888
CHEMISTRY; METALLURGY
A61K35/54
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
A61K35/54
HUMAN NECESSITIES
C12Q1/6888
CHEMISTRY; METALLURGY
Abstract
Single nucleotide polymorphic sites of the bovine MAP1B, PPP1R11, and DDX4 genes are associated with improved bull fertility as measured by e.g. sire conception rates. Nucleic acid molecules, arrays, kits, methods of genotyping and marker-assisted bovine breeding methods based on these SNPs are disclosed.
Claims
1. A method for implanting an embryo comprising: in vitro fertilizing cattle eggs to obtain fertilized eggs, culturing fertilized eggs into developing embryos detecting the identity of a nucleotide of a MAP1B gene of an embryo at a position corresponding to position 1986 of SEQ ID NO: 1, wherein the MAP1B gene comprises the nucleotide sequence of SEQ ID NO: 1, and identifying an embryo that has an adenine at said position, and implanting said identified embryo into a suitable female bovine.
2. The method of claim 1, wherein the identity of both copies of the gene in the embryo is determined.
3. A method according to claim 1, wherein the nucleotide is detected by sequencing the gene or a relevant fragment thereof.
4. A method according to claim 3, wherein the gene or a relevant fragment thereof is isolated from the animal's nucleic acid sample via amplification by a polymerase chain reaction.
5. A method of selecting a bull bovine animal as a breeder, the method comprising: obtaining a sample of the animal's nucleic acid, wherein the nucleic acid comprises at least a partial MAP1B gene comprising SEQ ID NO: 1, detecting an adenine nucleotide at a position of the MAP1B gene of the animal corresponding to position 1986 of SEQ ID NO: 1, selecting the bull bovine animal that has an adenine at said position, and using bovine cell or tissue from the selected bull animal in a breeding procedure.
6. The method according to claim 5, wherein the bovine cell or tissue is sperm.
7. A method according to claim 5, wherein the nucleotide is detected by sequencing the MAP1B gene or a relevant fragment thereof.
8. A method according to claim 7, wherein the gene or a relevant fragment thereof is isolated from the animal's nucleic acid sample via amplification by a polymerase chain reaction.
9. The method of claim 5, wherein the identity of both copies of the gene in the bovine bull animal is determined.
Description
DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION OF THE INVENTION
(7) The present inventor has found that the spermatogenesis genes MAP1B, PPP1R11 and DDX4 showed significant associations with SCR. Table 1 below summarizes the SNPs demonstrated to be significantly associated with sire conception rates according to the present invention.
(8) TABLE-US-00001 TABLE 1 Genetic markers significantly associated with sire conception rate Nucleotide Nucleotide Identity of Identity of Preferred Polymorph SNP ID Location/Position Allele in GenBank SNP1.MAP1B Position 3066 of FIG. 1 A A SNP3.MAP1B Position 3323 of FIG. 1 T T SNP5.MAP1B Position 87071 of FIG. 3 C C SNP1.PPP1R11 Position 112 of FIG. 4 G T SNP1.DDX4 Position 61646 of FIG. 6 A A SNP2.DDX4 Position 34239 of FIG. 5 G G
(9) Three SNPs in MAP1B, in low to moderate linkage disequilibrium (LD), were significantly associated with SCR. After correction for multiple testing, only one SNP in intron 5, SNP 5, showed the most significant association with SCR.
(10) The MAP1B gene belongs to the microtubule-associated protein family and is known to affect neuronal development such as axon growth (Tymanskyj et al., 2012), development of dendritic spine and synaptic maturation (Tortosa et al., 2011), and regulation of the interaction between microtubules and actin microfilaments for axonal development (Montenegro-Venegas et al., 2010). Recent reports on the expression of MAP1B in the male reproductive tract in both rat and human (Queirz et al., 2006) and in testis of fruit fly and mouse (Bonilla and Xu, 2008) suggest important functions of this gene in the regulation of male fertility. The finding by the present inventor, disclosed herein, that the MAP1B gene is associated with SCR, supports the conclusion that MAP1B plays a role in male fertility across a wide range of species.
(11) The present inventor also found that a SNP in the 5UTR of PPP1R11 was associated with SCR in the bull population examined in this study. This is the first report of association between male fertility in cattle and PPP1R11, which is consistent with previous reports on the roles of this gene in spermatogenesis in mouse and human. For example, the different isoforms of PPP1R11 (also known as TCTEX5) were found to be expressed in most mouse tissues with high expression in testis, epididymis, and in the head and tail regions of spermatozoa (Han et al., 2007). In a subsequent study, it was shown that mutations in the long transcript of PPP1R11 were associated with normal sperm function (Han et al., 2008). The authors concluded that PPP1R11 plays important roles in sperm motility and spermatogenesis. A recent study reported that an isoform of protein phosphatase 1 (PP1 2), which has an essential role in spermatogenesis, forms a complex with PPP1R11 in the testis (Cheng et al., 2009). Given that PP1 2 is regulated by PPP1R11, these results further support the idea that PPP1R11 has important functions in spermatogenesis.
(12) The spermatogenesis genes investigated in this study were selected from a pool of genes whose expression is highly conserved in testis of both fruit fly and mouse (Bonilla and Xu, 2008). The protein sequence identities between cattle and human and between cattle and fly are 91% and 32%, respectively for MAP1B and 99% and 47%, respectively for PPP1R11. As such, the association of these genes with bull fertility testifies to the usefulness of the comparative genomics approach in selecting candidate male fertility genes.
(13) To further explore involvement of male fertility genes identified in this study in female fertility, we tested the association of the SNPs in MAP1B, with fertilization and embryo survival rates using data from the IVF system. MAP1B genotypes of the cows, from which oocytes were extracted and used for fertilization and embryo culture, were significantly associated with differential fertilization rate and embryo survival rate. Recently, the expression of MAP1B was found to be downregulated in follicular cystic follicles compared to normal follicles, suggesting that alteration in MAP1B expression may be involved in reproduction failure in cattle (Choe et al., 2010). The instant disclosure again demonstrates the significance of both parental genomes to embryonic development and fertility.
(14) Accordingly, the present invention provides nucleic acid-based genetic markers for identifying bovine animals, especially bulls, with superior fertility, specifically, sire conception rate as a measure of male fertility. In general, for use as markers, isolated oligonucleotide or polynucleotide molecules, or isolated nucleic acid fragments, preferably DNA fragments, as used. Such markers will be of at least 10 nucleotides (nt), preferably at least 11, 12, or 15 nt, usually at least 20 nt, often at least 50 nt. Such small DNA fragments are useful as primers for the polymerase chain reaction (PCR), and probes for hybridization screening, etc.
(15) In one embodiment, the isolated nucleic acid molecule comprises not more than 1,500 nt, or not more than 1000 nt, or not more than 900 nt, or not more than 800 nt, or not more than 700 nt, or not more than 600 nt, or not more than 500 nt, or not more than 400 nt, or not more than 300 nt, or not more than 200 nt., or not more than 150 nt., or not more than 100 nt., or not more than 75 nt.
(16) In the context of the present invention, the term isolated refers to a nucleic acid molecule purified to some degree from endogenous materials with which the nucleic acid molecule may naturally occur or exist. At the least, the term isolated refers to a nucleic acid molecule separated from chromatin or other protein or components of the genomic DNA. Preferably, the isolated oligonucleic acid molecule or polynucleic acid molecule of the present invention comprises a fragment that is shorter than that which is naturally occurring.
(17) In the context of the present invention, the provided sequences also encompass the complementary sequence corresponding to any of the provided polymorphisms. Where appropriate, and in order to provide an unambiguous identification of the specific site of a polymorphism, the numbering of the original nucleic sequences in the GenBank may be used; alternatively, the numbering may simply refer to the specific sequence in the Sequence Listing accompanying this disclosure.
(18) The term primer refers to a single-stranded oligonucleotide capable of acting as a point of initiation of template-directed DNA synthesis under appropriate conditions (i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization, such as, DNA or RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. The appropriate length of a primer depends on the intended use of the primer but typically ranges from 15 to 30 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template. The term primer site, or priming site, refers to the area of the target DNA to which a primer hybridizes. The term primer pair means a set of primers including a 5 upstream primer that hybridizes with the 5 end of the DNA sequence to be amplified and a 3, downstream primer that hybridizes with the complement of the 3 end of the sequence to be amplified. One of these two primers is often referred to as the forward primer, while the other the reverse primer.
(19) The term probe or hybridization probe denotes a defined nucleic acid segment (or nucleotide analog segment) which can be used to identify by hybridization a specific polynucleotide sequence present in samples, said nucleic acid segment comprising a nucleotide sequence complementary of the specific polynucleotide sequence to be identified. Probes or hybridization probes are nucleic acids capable of binding in a base-specific manner to a complementary strand of nucleic acid.
(20) An objective of the present invention is to determine which embodiment of the polymorphisms a specific sample of DNA has. For example, it is desirable to determine whether the nucleotide at a particular position is A or G. An oligonucleotide probe can be used for such purpose. Preferably, the oligonucleotide probe will have a detectable label, and contains an A at the corresponding position. Experimental conditions can be chosen such that if the sample DNA contains an A, they hybridization signal can be detected because the probe hybridizes to the corresponding complementary DNA strand in the sample, while if the sample DNA contains a G, no hybridization signal is detected.
(21) Similarly, PCR primers and conditions can be devised, whereby the oligonucleotide is used as one of the PCR primers, for analyzing nucleic acids for the presence of a specific sequence. These may be direct amplification of the genomic DNA, or RT-PCR amplification of the mRNA transcript of the gene of interest. The use of the polymerase chain reaction is described in Saiki et al. (1985) Science 230:1350-1354. Amplification may be used to determine whether a polymorphism is present, by using a primer that is specific for the polymorphism. Alternatively, various methods are known in the art that utilize oligonucleotide ligation as a means of detecting polymorphisms, for examples see Riley et al (1990) Nucleic Acids Res. 18:2887-2890; and Delahunty et al (1996) Am. J. Hum. Genet. 58:1239-1246. The detection method may also be based on direct DNA sequencing, or hybridization, or a combination thereof. Where large amounts of DNA are available, genomic DNA is used directly. Alternatively, the region of interest is cloned into a suitable vector and grown in sufficient quantity for analysis. The nucleic acid may be amplified by PCR, to provide sufficient amounts for analysis.
(22) Hybridization may be performed in solution, or such hybridization may be performed when either the oligonucleotide probe or the target polynucleotide is covalently or noncovalently affixed to a solid support. Attachment may be mediated, for example, by antibody-antigen interactions, poly-L-Lys, streptavidin or avidin-biotin, salt bridges, hydrophobic interactions, chemical linkages, UV cross-linking baking, etc. Oligonucleotides may be synthesized directly on the solid support or attached to the solid support subsequent to synthesis. Solid-supports suitable for use in detection methods of the invention include substrates made of silicon, glass, plastic, paper and the like, which may be formed, for example, into wells (as in 96-well plates), slides, sheets, membranes, fibers, chips, dishes, and beads. The solid support may be treated, coated or derivatized to facilitate the immobilization of the allele-specific oligonucleotide or target nucleic acid. For screening purposes, hybridization probes of the polymorphic sequences may be used where both forms are present, either in separate reactions, spatially separated on a solid phase matrix, or labeled such that they can be distinguished from each other.
(23) Hybridization may also be performed with nucleic acid arrays and subarrays such as described in WO 95/11995. The arrays would contain a battery of allele-specific oligonucleotides representing each of the polymorphic sites. One or both polymorphic forms may be present in the array. Usually such an array will include at least 2 different polymorphic sequences, i.e. polymorphisms located at unique positions within the locus, and may include all of the provided polymorphisms. Arrays of interest may further comprise sequences, including polymorphisms, of other genetic sequences, particularly other sequences of interest. The oligonucleotide sequence on the array will usually be at least about 12 nt in length, may be the length of the provided polymorphic sequences, or may extend into the flanking regions to generate fragments of 100 to 200 nt in length. For examples of arrays, see Ramsay (1998) Nat. Biotech. 16:4044; Hacia et al. (1996) Nature Genetics 14:441-447; Lockhart et al. (1996) Nature Biotechnol. 14:1675-1680; and De Risi et al. (1996) Nature Genetics 14:457-460.
(24) The identity of polymorphisms may also be determined using a mismatch detection technique, including but not limited to the RNase protection method using riboprobes (Winter et al., Proc. Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al., Science 230:1242, 1985) and proteins which recognize nucleotide mismatches, such as the E. coli mutS protein (Modrich, P. Ann. Rev. Genet. 25:229-253, 1991). Alternatively, variant alleles can be identified by single strand conformation polymorphism (SSCP) analysis (Orita et al., Genomics 5:874-879, 1989; Humphries et al., in Molecular Diagnosis of Genetic Diseases, R. Elles, ed., pp. 321-340, 1996) or denaturing gradient gel electrophoresis (DGGE) (Wartell et al., Nucl. Acids Res. 18:2699-2706, 1990; Sheffield et al., Proc. Natl. Acad. Sci. USA 86:232-236, 1989).
(25) A polymerase-mediated primer extension method may also be used to identify the polymorphism(s). Several such methods have been described in the patent and scientific literature and include the Genetic Bit Analysis method (WO92/15712) and the ligase/polymerase mediated genetic bit analysis (U.S. Pat. No. 5,679,524). Related methods are disclosed in WO91/02087, WO90/09455, WO95/17676, U.S. Pat. Nos. 5,302,509, and 5,945,283. Extended primers containing a polymorphism may be detected by mass spectrometry as described in U.S. Pat. No. 5,605,798. Another primer extension method is allele-specific PCR (Ruao et al., Nucl. Acids Res. 17:8392, 1989; Ruao et al., Nucl. Acids Res. 19, 6877-6882, 1991; WO 93/22456; Turki et al., J. Clin. Invest. 95:1635-1641, 1995). In addition, multiple polymorphic sites may be investigated by simultaneously amplifying multiple regions of the nucleic acid using sets of allele-specific primers as described in Wallace et al. (WO 89/10414).
(26) A detectable label may be included in an amplification reaction. Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2,4,7,4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N,N-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive labels, e.g. .sup.32P, .sup.35S, .sup.3H; etc. The label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label. The label may be conjugated to one or both of the primers. Alternatively, the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.
(27) It is readily recognized by those ordinarily skilled in the art that in order to maximize the signal to noise ratio, in probe hybridization detection procedure, the polymorphic site should at the center of the probe fragment used, whereby a mismatch has a maximum effect on destabilizing the hybrid molecule; and in a PCR detection procedure, the polymorphic site should be placed at the very 3-end of the primer, whereby a mismatch has the maximum effect on preventing a chain elongation reaction by the DNA polymerase. The location of nucleotides in a polynucleotide with respect to the center of the polynucleotide are described herein in the following manner. When a polynucleotide has an odd number of nucleotides, the nucleotide at an equal distance from the 3 and 5 ends of the polynucleotide is considered to be at the center of the polynucleotide, and any nucleotide immediately adjacent to the nucleotide at the center, or the nucleotide at the center itself is considered to be within 1 nucleotide of the center. With an odd number of nucleotides in a polynucleotide any of the five nucleotides positions in the middle of the polynucleotide would be considered to be within 2 nucleotides of the center, and so on. When a polynucleotide has an even number of nucleotides, there would be a bond and not a nucleotide at the center of the polynucleotide. Thus, either of the two central nucleotides would be considered to be within 1 nucleotide of the center and any of the four nucleotides in the middle of the polynucleotide would be considered to be within 2 nucleotides of the center, and so on.
(28) In some embodiments, a composition contains two or more differently labeled oligonucleotides for simultaneously probing the identity of nucleotides or nucleotide pairs at two or more polymorphic sites. It is also contemplated that primer compositions may contain two or more sets of allele-specific primer pairs to allow simultaneous targeting and amplification of two or more regions containing a polymorphic site.
(29) Alternatively, the relevant portion of the gene of the sample of interest may be amplified via PCR and directly sequenced, and the sequence be compared to the wild type sequence shown in the figures. It is readily recognized that, other than those disclosed specifically herein, numerous primers can be devised to achieve the objectives. PCR and sequencing techniques are well known in the art and reagents and equipments are readily available commercially.
(30) Alternatively, an invasive signal amplification assay, as described in e.g. U.S. Pat. No. 5,422,253 and Lyamichev et al., 2000, Biochemistry 39:9523-9532, both incorporated herein by reference in their entirety, may be used for detecting the SNP of interest. This assay takes advantage of enzymes such as the 5 nuclease activity of a DNA polymerase or the gene 6 product from bacteriophage T7 in their ability to cleave polynucleotide molecules by recognizing specific structures instead of specific sequences. A single-stranded target molecule is annealed to a pilot oligonucleotide such that the 5 end of the pilot forms a duplex with the target molecule. If the 3 end of the pilot oligonucleotide does not pair with the target, a 3 arm is formed. When exposed to a cleavage agent such as a DNA polymerase having a 5 nuclease activity or the gene 6 product from bacteriophage T7, the target molecule is cleaved in the 5 region, one nucleotide into the duplex adjacent to the unpaired region of the target. If a cut in a double-stranded molecule is required, the double-stranded molecule is denatured. Because this unpaired 3 arm can be as short as one nucleotide, this assay can be used for detecting a single-nucleotide difference, e.g. in the context of SNP detection. The pilot oligonucleotide is designed such that it pairs perfectly with one allele, but has a 3, single nucleotide mismatch with another allele. Cleavage only occurs if there is a mismatch between the target molecule and the pilot. To achieve signal amplification, the above invasive reaction is modified such that cleavage occurs on the pilot oligonucleotide. Two oligonucleotides are annealed in an adjacent manner to the target molecule. The resulting adjacent duplexes overlaps by at least one nucleotide to create an efficient substrate, called the overlapping substrate, for the 5 nucleases. The 5 end of the downstream oligonucleotide, also called the probe, contains an unpaired region termed the 5 arm (Lyamichev et al., 1993, Science 260:778-783.) or flap (Harrington and Lieber, 1994, EMBO J 13: 1235-1246) that is not required for the enzyme activity; however, very long arms can inhibit cleavage (Lyamichev et al., 1993, Science 260:778-783). Specific cleavage of the probe, termed invasive cleavage (Lyamichev et al., 1999, Nat. Biotechnol. 17 292-296; Kwiatkowski et al., 1999, Mol. Diagn. 4, 353-364.), occurs at the position defined by the 3 end of the upstream oligonucleotide, which displaces or invades the probe. If the overlap between the adjacent oligonucleotides is only one nucleotide, cleavage takes place between the first two base pairs of the probe, thus releasing its 5 arm and one nucleotide of the base paired region (Lyamichev et al., 1999, Proc. Natl. Acad. Sci. USA. 96: 6143-6148, and Kaiser et al., 1999, J Biol. Chem. 274:21387-21394). If the upstream oligonucleotide and the probe are present in large molar excess over the target nucleic acid, and invasive cleavage is carried out near the melting temperature of the probe, a cut probe can rapidly dissociate, and an intact probe will anneal to the target more frequently than will a cut probe, thus initiating a new cycle of cleavage. This allows multiple probes to be cut for each target molecule under isothermal conditions, resulting in linear signal amplification with respect to target concentration and time (Lyamichev et al., 1999, Nat. Biotechnol. 17: 292-296).
(31) DNA markers have several advantages; segregation is easy to measure and is unambiguous, and DNA markers are co-dominant, i.e., heterozygous and homozygous animals can be distinctively identified. Once a marker system is established selection decisions could be made very easily, since DNA markers can be assayed any time after a blood sample can be collected from the individual infant animal, or even earlier by testing embryos in vitro if very early embryos are collected. The use of marker assisted genetic selection will greatly facilitate and speed up cattle breeding problems. For example, a modification of the multiple ovulation and embryo transfer (MOET) procedure can be used with genetic marker technology. Specifically, females are superovulated, eggs are collected, in vitro fertilized using semen from superior males and implanted into other females allowing for use of the superior genetics of the female (as well as the male) without having to wait for her to give birth to one calf at a time. Developing blastomeres at the 4-8 cell stage may be assayed for presence of the marker, and selection decisions made accordingly.
(32) In one embodiment of the invention an assay is provided for detection of presence of a desirable genotype using the markers.
(33) The term genotype as used herein refers to the identity of the alleles present in an individual or a sample. In the context of the present invention a genotype preferably refers to the description of the polymorphic alleles present in an individual or a sample. The term genotyping a sample or an individual for a polymorphic marker refers to determining the specific allele or the specific nucleotide carried by an individual at a polymorphic marker.
(34) The present invention is suitable for identifying a bovine, including a young or adult bovine animal, an embryo, a semen sample, an egg, a fertilized egg, or a zygote, or other cell or tissue sample therefrom, to determine whether said bovine possesses the desired genotypes of the present invention, some of which are indicative of improved reproduction traits.
(35) Further provided is a method for genotyping the bovine genes identified in Table 1, comprising determining for the two copies of the gene in a diploid genome present the identity of the nucleotide pair at the relevant SNP position (see below).
(36) One embodiment of a genotyping method of the invention involves examining both copies of the gene, or a fragment thereof, to identify the nucleotide pair at the polymorphic site in the two copies to assign a genotype to the individual. In some embodiments, examining a gene may include examining one or more of: DNA containing the gene, mRNA transcripts thereof, or cDNA copies thereof. As will be readily understood by the skilled artisan, the two copies of a gene, mRNA or cDNA, or fragment thereof in an individual may be the same allele or may be different alleles. In another embodiment, a genotyping method of the invention comprises determining the identity of the nucleotide pair at the polymorphic site.
(37) The present invention further provides a kit for genotyping a bovine sample, the kit comprising in a container a nucleic acid molecule, as described above, designed for detecting the polymorphism, and optionally at least another component for carrying out such detection. Preferably, a kit comprises at least two oligonucleotides packaged in the same or separate containers. The kit may also contain other components such as hybridization buffer (where the oligonucleotides are to be used as a probe) packaged in a separate container. Alternatively, where the oligonucleotides are to be used to amplify a target region, the kit may contain, preferably packaged in separate containers, a polymerase and a reaction buffer optimized for primer extension mediated by the polymerase, such as PCR.
(38) In one embodiment the present invention provides a breeding method whereby genotyping as described above is conducted on a bovine animal, especially a bull, and based on the results, certain cattle are either selected or dropped out of the breeding program.
(39) Through use of the linked marker loci, procedures termed marker assisted selection (MAS) may be used for genetic improvement within a breeding nucleus; or marker assisted introgression for transferring useful alleles from a resource population to a breeding nucleus (Soller 1990; Soller 1994).
(40) A method is further provided for determining whether an individual bovine animal is suitable as a gamete donor for natural mating, artificial insemination or in vitro fertilization, the method comprising determining the identity of one or more SNPs according to the present invention using a method of the present invention, and excluding as gamete donor an individual which does not have the preferred allele identity at the respective SNP position as described in Table 1.
(41) Specifically, an individual bovine animal, especially a bull, is excluded as a gamete donor, if its genome does not have at least: 1) adenine (A) at the position of its MAP1B gene corresponding to position 3066 of
(42) In one embodiment, the individual is excluded as a gamete donor if the gene type of the individual is not homozygous of the preferred allele with regard to the respective SNP position.
(43) The present invention additionally provides a method of selecting a bovine embryo for planting in a uterus, the method comprising genotyping the embryo according to the present invention, while preserving the viability of the embryo, and excluding from planting an embryo which does not have the preferred allele identity at the respective SNP position as described in Table 1.
(44) In another embodiment, the present invention further provides a method for selectively breeding cattle using a multiple ovulation and embryo transfer procedure (MOET), the method comprising superovulating a female animal, collecting eggs from said superovulated female, in vitro fertilizing said eggs from a male animal which has at least one preferred allele identity at the respective SNP position as described in Table 1 and above, implanting said fertilized eggs into other females allowing for an embryo to develop.
(45) In another embodiment, the method for selectively breeding cattle using MOET may further comprise a step of genotyping the male animal according to the method of the present invention.
(46) In another embodiment, the method for selectively breeding cattle using MOET may further comprise a step of genotyping the developing embryo, and allowing pregnancy to proceed only if the genotype of the embryo comprises at least one preferred allele identity at the respective SNP position as described in Table 1.
(47) The following examples are intended to illustrate preferred embodiments of the invention and should not be interpreted to limit the scope of the invention as defined in the claims.
EXAMPLES
(48) Materials and Methods
(49) Associations of candidate fertility genes examined were carried out in two experiments. In the first part, single nucleotide polymorphisms (SNPs) in the spermatogenesis genes were tested for associations with sire conception rate (SCR) in a large bull population. In the second part, genes found significantly associated with SCR were tested for association with female fertility traits (fertilization and blastocyst rates). Male fertility genes that play roles in female fertility can be used to improve reproductive performance in cattle using genetic information from both males and females in breeding schemes.
(50) Gene Selection, SNP Identification, and Genotyping for Bull Fertility
(51) A total of 58 spermatogenesis genes, with conserved testicular expression from fly to human, were reported in Bonilla and Xu (2008). Of those genes, only 22 were annotated in the bovine genome. For SNP identification and genotyping, genomic DNA was extracted from semen samples of 268 Holstein bulls (Genex Cooperative/CRI, Shawano, Wis.) using standard phenol/chloroform protocols. One DNA pool was constructed from 20 random semen samples with equal amounts of DNA. The DNA pool was amplified using primers designed in the 22 candidate genes to amplify 5 untranslated regions (UTRs), exons, introns, and 3 UTRs. The PCR products were sequenced, and SNPs were identified by visually inspecting sequence traces. PCR amplification and sequencing were performed as described in Khatib et al. (2008). Table 2 shows the primer sets used to amplify the nine candidate spermatogenesis genes found to be polymorphic in the bull population.
(52) TABLE-US-00002 TABLE2 Primersusedtoamplify theninespermatogenicgenes SEQID SEQID Product Gene ForwardPrimer NO: ReversePrimer NO: Size DCUN1D1 ATACCCTTAGGCAGTTAG 7 AATTGTAAACCCTGAGAC 5 536 DDX4(1) AAACACGGAACAGAGGGT 9 AGGCAGGATTAGCAAGTATG 10 404 DDX4(2) AACCAAGTGGCTGGGATG 11 CAGACTCAAATGCGACAA 12 354 DNA11(1) CGGTAAGTGAGCAGCATC 13 ACTGAAGCCTTTGCCCTA 14 495 DNA11(2) CCCAGTGCTCCAAATCCT 15 ATGGCTCATCTTGTCTTCAGTA 16 413 DAN11(3) CGTGACTGGGTTTAGGAT 17 CTGGTGGCTGCTGTCTAT 18 602 GAPDHS(1) CCAGGAAACGGCATCACC 19 ACACGCAGCAGGGCAACT 20 414 GAPDHS(2) GTGAAGGCCAGGGACTATGA 21 ACATGAACAAGAGGGCTGCT 22 541 GSTM3 TTCTCTTCCCTGCAAGTCGT 23 TGAGAACAGCTGCCATCATC 24 664 MAP1B(1) CCATTTCCTAAGGCACAG 25 TTCCGCCATCTTCCTACA 26 504 MAP1B(2) CTTATGGTCGTGATTATGAA 27 AAGGCTAACACTGCTGGT 28 502 MAP1B(3) GGCTGTGACATACCTACC 29 CAGACCTTCCCTACTTATT 30 645 PPP1R11(1) CACATTACGGCGGAACTA 31 ATCCCAAGCAGTATCACCTA 32 591 PPP1R11(2) ACCTGTTCTATCTCCTCCCA 33 GTCACCTACCCACCTTGC 34 543 SPATA20 TTGGAGAAGAAACCCACCAG 35 CCTCACAAGCAAGGCTAAGG 36 459 UBC TCGCTCAGTCGTGTCTTAC 37 TCAACCAACGCCTAATGT 38 420
(53) A total of 24 SNPs located in the nine spermatogenic genes were genotyped in the Genex population (268 animals) by MALDI-TOF MS (GeneSeek Inc., Lincoln, Nebr.).
(54) Imputation of SNPs for Validation of Significant SNPs Found in Genex Population in a Larger Bull Population Obtained from the USDA
(55) Solely for the purpose of validating the conclusions drawn from the results using the Genex population, and to increase the sample size and improve the statistical power of the study, the 24 SNPs identified in the 9 candidate genes and genotyped in 268 bulls (from here forward, the reference population) were imputed in a total of 1,720 bulls (from here forward, the imputed population) so that a final dataset of 1,988 bulls with genotypic data was generated for subsequent statistical analyses. Bulls in the reference and imputed populations have been previously genotyped with the Illumina BovineSNP50 Bead Chip, and hence shared SNP were used to infer the genotypes of the unshared SNP in the imputed population. Genotypes of the reference (n=268) and the imputed populations (n=1,720) for the 50K SNP Chip were provided by Genex Cooperative/CRI (Shawano, Wis.) and the Animal Improvement Programs Laboratory of the United States Department of Agriculture (AIPL, USDA; Beltsville, Md.), respectively. SNP with minor allele frequencies below 5% were removed. After data editing, 38,265 SNP spanning the entire bovine genome were available in both populations for the imputation process.
(56) Imputation of SNPs was carried out for each candidate gene separately. In each case, a total of 100 SNP on each side of the gene were used to infer the genotypes of the ungenotyped SNP. Imputation was performed using the population-based haplotype clustering algorithm of Scheet and Stephens (2006), which was implemented via the fastPHASE version 1.2 software using the default settings for all parameters (University of Washington TechTransfer Digital Ventures Program, Seattle, Wash.).
(57) Phenotypic Data for Bull Fertility
(58) The 1,988 bulls genotyped with the 50K SNP Chip were evaluated for sire conception rate (SCR), a phenotypic evaluation of bull fertility provided to dairy producers by AIPL-USDA as described in Peagaricano et al. (2012). Briefly, SCR is the expected difference in conception rate of a sire compared with the mean of all other evaluated sires (Kuhn and Hutchison, 2008; Kuhn et al., 2008).
(59) In this study, SCR values ranged from 10.66% to +6.80%, and the number of breedings per bull ranged from 303 to 111,402. SCR data were obtained from seven consecutive evaluations provided by AIPL-USDA between August 2008 and December 2010. For bulls with multiple evaluations, the most recent SCR evaluation was used in the analysis.
(60) Statistical Analysis for Bull Fertility
(61) The association between each SNP and SCR was evaluated using the following mixed linear model,
SCR.sub.ijkl=+EVAL.sub.j+SNP.sub.k+sire.sub.l+e.sub.ijkl
where is the general mean, EVAL.sub.j is the fixed effect of the j.sup.th AIPL-USDA SCR evaluation (j=1, 2, . . . , 7), SNP.sub.k is the number of copies of one allele of the SNP (corresponding to 0, 1 or 2 copies) carried by the i.sup.th animal (i=1, 2, . . . , 1988), is the regression coefficient for the SNP considered (also known as the allele substitution effect), sire.sub.l represents the random additive genetic effect of the l.sup.th sire (l=1, 2, . . . , 246) of the i.sup.th animal, and e.sub.ijkl, represents the random residual for each observation. To detect possible deviations from the additive model, associations between genotype and SCR were evaluated using SNP as a categorical variable.
(62) Random effects were assumed to follow the multivariate normal distribution,
(63)
where s and are the vectors of sire and residual effects, respectively: .sub.s.sup.2 and .sub..sup.2 are the sire and residual effect variances, respectively; A represents the matrix of additive relationships between sires in the pedigree (1,5581,558) and W is a diagonal matrix of order 1,988 with its elements representing reliabilities of SCR values. The A matrix was calculated based on a five-generation pedigree of sires downloaded from AIPL-USDA. The association between each SNP and SCR was tested using a likelihood ratio test by comparing to a reduced model without the SNP effect.
(64) Phenotypic and Genotypic Data for Cow Fertility
(65) The most significant SNP for SCR (rs109423562 located in MAP1B) was further investigated for association analysis with fertilization and blastocyst ratesthe main cow fertility traitsusing an IVF system. The procedures of in vitro fertilization and subsequent embryo culture were described in Khatib et al. (2008). To generate fertilization and blastocyst rate data, a total of 6,282 in vitro fertilizations were performed, and a total of 4,207 embryos were produced using oocytes from 359 ovaries collected from 359 Holstein cows and semen samples from 12 Holstein bulls. For 74 ovaries, oocytes were fertilized by two different bulls each. Fertilization rate was calculated as the number of cleaved embryos at Day 2 post-fertilization divided by the total number of fertilized oocytes collected from one ovary. Blastocyst rate was calculated as the number of embryos that reached the blastocyst stage (Day 8) and appeared normal out of the total number of embryos produced.
(66) The 359 ovaries were genotyped for SNP rs109423562 (G/A) using PCR-RFLP. A 171 bp fragment was amplified using the primers 5-GCAGCTCTTTTAGGAGTGTTAGCGTCTGAT-3 (SEQ ID NO: 39) (forward) and 5-CTCACAGAGGGCATTTGACA-3 (SEQ ID NO: 40) (reverse). The PCR product was then digested by the restriction enzyme HinfI and electrophoresed on a 2.0% agarose gel. Allele G was cut while allele A was uncut.
(67) Statistical Analysis for Cow Fertility
(68) Association between SNP rs109423562 (G/A) in MAP1B and fertilization and blastocyst rates were analyzed using the following mixed linear model,
y.sub.ijk=+ovary.sub.i+sire.sub.j+SNP.sub.ijk+e.sub.ijk
where y.sub.ijk represents the fertilization or blastocyst rate of oocyte k from ovary i fertilized with semen from bull j, represents a general mean for the trait considered, ovary.sub.i represents the random effect of the individual ovary from which oocytes were harvested, sire.sub.j represents the random effect of the sire used in the fertilization, SNP.sub.ijk represents the fixed effect of the ovary genotype for the SNP considered, and e.sub.ijk represents the residuals, assumed normal, independent and identically distributed with mean 0 an variance I.sub.e.sup.2. Ovaries and bulls were assumed uncorrelated with variance structures I.sub.o.sup.2 and I.sub.s.sup.2, respectively. Association between the SNP and fertilization or blastocyst rate was tested again using a likelihood ratio test by comparing with a reduced model without the SNP effect. All the statistical analyses were performed using the pedigreemm package (Vazquez et al. 2010) of the R language/environment (R Development Core Team 2009).
Results
(69) SNP Identification and Association of Candidate Genes with SCR
(70) Sequencing analysis revealed 24 SNPs in 9 spermatogenesis genes (DCUN1D1, DNAI1, DDX4, GAPDHS, GSTM3, MAP1B, PPP1R11, SPATA20 and UBC) in the bull population using the pooled DNA sequencing approach. All 24 SNPs located in 9 candidate genes were tested for association with sire conception rate first in Genex population and then in a larger population of 1,988 bulls for validation.
(71) Association Analysis in Genex Population
(72) SNPs in the genes MAP1B, PPP1R11, and DDX4 are associated with SCR
(73) For MAP1B gene, a SNP C/T in intron 5 at position 9331992 (University of Maryland bovine version 3.1; UMD3.1) showed significant association with sire conception rate. Primers used to amplify the gene and SNP location are shown in
(74) For PPP1R11, one SNP (T/G) in in the 5UTR region at position 28710268 (UMD3.1) was significantly associated with SCR in the Genex population, with allele G associated with increased SCR. SEQ ID NO:6 shows SNP location and primers used to identify the SNP.
(75) For DDX4, two SNPs located at positions 23382814 (SNP1; A/G) and 23410221 (SNP2; G/A) were identified in the gene. For SNP locations see
(76) Association of Spermatogenesis Genes in the Combined Genex and USDA Populations
(77) Three SNPs located in MAP1B and one SNP in PPP1R11 showed significant associations with SCR (Table 3). The SNP with the most significant association with SCR is SNP5.MAP1B located in intron 5 with an allele substitution effect of 0.24 and a P-value of 0.001. The other two significant SNPs were SNP1.MAP1B and SNP3.MAP1B, both located in intron 1 with an allele substitution effect of 0.15 and P-values of 0.025 and 0.039, respectively. After Bonferroni correction for multiple testing, only SNP5.MAP1B remained significant (P-value=0.024). Pair-wise linkage disequilibrium (LD) tests of MAP1B SNPs showed a moderate LD (r.sup.2=0.38) between SNP1.MAP1B and SNP3.MAP1B and SNP5.MAP1B. The LD between SNP3.MAP1B and SNP5.MAP1B was relatively low (r.sup.2=0.14).
(78) SNP1.PPP1R11 located in the 5UTR region of PPP1R11 showed significant association with SCR with an allele substitution effect of 0.15 and a P-value of 0.046.
(79) TABLE-US-00003 TABLE 3 Genetic markers significantly associated with sire conception rate Genotype Allele substitution SNP ID Gene (N) effect SE P-value SNP1.MAP1B M4P1B GG (463) 0.15 0.01 0.025 GA (987) AA (538) SNP3.MAP1B M4P1B CC (972) 0.15 0.01 0.039 CT (847) TT (169) SNP5.MAP1B MAP1B CC (1081) 0.24 0.01 0.001 TC (763) TT (144) SNP1.PPP1R11 PPP1R11 TT (1033) 0.15 0.01 0.046 TG (821) GG (134)
(80) Association of MAP1B with Fertilization Rate and Embryo Survival Rate
(81) SNP5.MAP1B located in intron 5 of MAP1B showed the most significant association with sire conception rate in the bull population analyzed above. To characterize its impact on female fertility, we tested the association of this SNP with fertilization rate and blastocyst rate in the IVF system. SNP5.MAP1B showed significant associations with both fertilization rate (P-value=0.027) and blastocyst rate (P-value=0.029) (Table 4). Oocytes collected from genotype CT cows showed the lowest fertilization rate (59.9%) compared with that from CC (66.4%) and TT (66.3%) cows (Table 4). For blastocyst rate, the CT genotype again showed the lowest rate (27.1%) while homozygous CC and TT individuals showed blastocyst rates of 31.0% and 41.8%, respectively (Table 4).
(82) TABLE-US-00004 TABLE 4 Association between SNP5 of MAP1B gene and fertilization rate and blastocyst rate Fertilization rate Blastocyst rate Genotype (N) Estimate SE P-value Estimate SE P-value CC (321) 0.664 0.03 0.027 0.310 0.02 0.029 CT (84) 0.599 0.03 0.271 0.03 TT (28) 0.663 0.04 0.418 0.05
REFERENCES
(83) Amann, R. P., J. M. Dejarnette. 2012. Impact of genomic selection of AI dairy sires on their likely utilization and methods to estimate fertility: A paradigm shift. Theriogenology 77:795-817. Barton, S. C., M. A. Surani, and M. L. Norris. 1984. Role of paternal and maternal genomes in mouse development. Nature. 311:374-376. Bonilla, E., and E. Y. Xu. 2008. Identification and characterization of novel mammalian spermatogenic genes conserved from fly to human. Mol. Hum. Reprod. 14:137-142. Cheng, L., S. Pilder, A. C. Nairn, S. Ramdas, and S. Vijayaraghavan. 2009. PPlgamma2 and PPP1R11 are parts of a multimeric complex in developing testicular germ cells in which their steady state levels are reciprocally related. PLoS One. 4:e4861. Choe, C., Y. W. Cho, C. W. Kim, D. S. Son, J. Han, and D. Kang. 2010. Identification of differentially expressed genes in bovine follicular cystic ovaries. Korean J. Physiol. Pharmacol. 14:265-272. Dobson, H., R. Smith, M. Royal, Ch. Knight, and I. Sheldon. 2007. The high-producing dairy cow and its reproductive performance. Reprod Domest Anim. 42 Suppl 2:17-23. Druet, T., S. Fritz, E. Sellem, B. Basso, O. Grard, L. Salas-Cortes, P. Humblot, X. Druart, and A. Eggen. 2009. Estimation of genetic parameters and genome scan for 15 semen characteristics traits of Holstein bulls. J. Anim. Breed. Genet. 126:269-277. Feugang, J. M., A. Kaya, G. P. Page, L. Chen, T. Mehta, K. Hirani, L. Nazareth, E. Topper, R. Gibbs, and E. Memili. 2009. Two-stage genome-wide association study identifies integrin beta 5 as having potential role in bull fertility. BMC Genomics. 10:176. Han, Y. B., H. L. Feng, C. K. Cheung, P. M. Lam, C. C. Wang, and C. J. Haines. 2007. Expression of a novel T-complex testis expressed 5 (Tctex5) in mouse testis, epididymis, and spermatozoa. Mol. Reprod. Dev. 74:1132-1140. Han, Y., X. X. Song, H. L. Feng, C. K. Cheung, P. M. Lam, C. C. Wang, and C. J. Haines. 2008. Mutations of t-complex testis expressed gene 5 transcripts in the testis of sterile t-haplotype mutant mouse. Asian J Androl. 10:219-226. Imumorin, I. G., E. H. Kim, Y. M. Lee, D. J. De Koning, J. A. van Arendonk, M. De Donato, J. F. Taylor, and J. J. Kim. 2011. Genome Scan for Parent-of-Origin QTL Effects on Bovine Growth and Carcass Traits. Front. Genet. 2:44. Khatib, H., R. L. Monson, W. Huang, R. Khatib, V. Schutzkus, H. Khateeb, and J. J. Parrish. 2010. Short communication: Validation of in vitro fertility genes in a Holstein bull population. J. Dairy. Sci. 93:2244-2249. Khatib, H., W. Huang, X. Wang, A. H. Tran, A. B. Bindrim, V. Schutzkus, R. L. Monson, and B. S. Yandell. 2009. Single gene and gene interaction effects on fertilization and embryonic survival rates in cattle. J. Dairy Sci. 92:2238-2247. Khatib, H., R. L. Monson, V. Schutzkus, D. M. Kohl, G. J. M. Rosa, and J. J. Rutledge. 2008. Mutations in the STAT5A gene are associated with embryonic survival and milk composition in cattle. J. Dairy Sci. 91:784-793. Kuhn, M. T., and J. L. Hutchison. 2008. Prediction of dairy bull fertility from field data: use of multiple services and identification and utilization of factors affecting bull fertility. J. Dairy Sci. 91:2481-2492. Kuhn, M. T., J. L. Hutchison, and H. D. Norman. 2008. Modeling nuisance variables for prediction of service sire fertility. J. Dairy Sci. 91:2823-2835. Magee, D. A., D. P. Berry, E. W. Berkowicz, K. M. Sikora, D. J. Howard, M. P. Mullen, R. D. Evans, C. Spillane, and D. E. MacHugh. 2011. Single nucleotide polymorphisms within the bovine DLK1-DIO3 imprinted domain are associated with economically important production traits in cattle. J. Hered. 102:94-101. Magee, D. A., K. M. Sikora, E. W. Berkowicz, D. P. Berry, D. J. Howard, M. P. Mullen, R. D. Evans, C. Spillane, and D. E. MacHugh. 2010. DNA sequence polymorphisms in a panel of eight candidate bovine imprinted genes and their association with performance traits in Irish Holstein-Friesian cattle. BMC Genet. 11:93. Memili, E., and N. L. First. 2000. Zygotic and embryonic gene expression in cow: A review of timing and mechanisms of early gene expression as compared with other species. Zygote. 8:87-96. Montenegro-Venegas, C., E. Tortosa, S. Rosso, D. Peretti, F. Bollati, M. Bisbal, I. Jausoro, J. Avila, A. Cceres, and C. Gonzalez-Billault. 2010. MAP1B regulates axonal development by modulating Rho-GTPase Rac activity. Mol. Biol. Cell. 21:3518-3528. Peagaricano, F., K. A. Weigel, and K. Khatib. 2012. Genome-wide association study identifies candidate markers for bull fertility in Holstein dairy cattle. Anim. Genet. (In press). Queirz, D. B., A. M. Silva, G. Gutirrez-Ospina, C. S. Porto, G. Grossman, P. Petrusz, and M. C. Avellar. 2006. Cells positive for microtubule-associated protein 1B (MAP 1B) are present along rat and human efferent ductules and epididymis. Cell Tissue Res. 325:125-133. R Development Core Team. 2009. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. Santos, J. E. P., W. W. Thatcher, R. C. Chebel, R. L. A. Cerri, and K. N. Galvao. 2004. The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs. Anim. Reprod. Sci. 83:513-535. Scheet, P., and M. Stephens. 2006. A fast and flexible statistical model for large-scale population genotype data: Applications to inferring missing genotypes and haplotypic phase. Am. J. Hum. Genet. 78:629-644. Shook G. E. 2006. Major advances in determining appropriate selection goals. J. Dairy Sci. 89:1349-1361. Telford, N. A., A. J. Watson, and G. A. Schultz. 1990. Transition from maternal to embryonic control in early mammalian development: A comparison of several species. Mol. Reprod. Dev. 26:90-100. Tortosa, E., C. Montenegro-Venegas, M. Benoist, S. Hrtel, C. Gonzalez-Billault, J. A. Esteban, and J. Avila. 2011. Microtubule-associated protein 1B (MAP1B) is required for dendritic spine development and synaptic maturation. J. Biol. Chem. 286:40638-40648. Tymanskyj, S. R., T. M. Scales, and P. R. Gordon-Weeks. 2012. MAP1B enhances microtubule assembly rates and axon extension rates in developing neurons. Mol. Cell Neurosci. 49:110-119. Vazquez, A. I., D. M. Bates, G. J. M. Rosa, D. Gianola, and K. A. Weigel. 2010. Technical Note: An R package for fitting generalized linear mixed models in animal breeding. J. Anim. Sci. 88:497-504. Weigel, K. A. 2006. Prospects for improving reproductive performance through genetic selection. Anim. Reprod. Sci. 96: 323-330.