LncRNA and oncolytic adenovirus, and application thereof

10323244 ยท 2019-06-18

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are an LncRNA and oncolytic adenovirus, and application thereof. The oncolytic adenovirus is used as a carrier to express the LncRNA, so as to express the LncRNA in a cancer cell; competitively binding a target gene of OncomiRs, and consuming the OncomiRs, thus protecting a cancer suppressor gene from interference and suppression of the OncomiRs, and achieving target intervention therapy of the cancer cell.

Claims

1. An LncRNA that competitively consumes the carcinogenic microRNAs, wherein the LncRNA comprises n copies of SEQ ID NO.4 or is encoded by a coding sequence of n copies of SEQ ID NO.1, and wherein the n is an integer greater than or equal to 1.

2. An oncolytic adenovirus comprising an oncolytic adenovirus genome, wherein the oncolytic adenovirus genome comprises an expression cassette comprising the sequence of n copies of SEQ ID NO.1 of claim 1.

3. The oncolytic adenovirus of claim 2, wherein the expression cassette further comprises a promoter that regulates the expression of the LncRNA, wherein the promoter that regulates the expression of the LncRNA is inserted before transcriptional start sites of the LncRNA coding sequence.

4. The oncolytic adenovirus of claim 3, wherein the oncolytic adenovirus genome further comprises an essential virus proliferation gene and a tumor-selective promoter, wherein the tumor-selective promoter can regulate expression of the essential virus proliferation gene.

5. The oncolytic adenovirus of claim 4, wherein the oncolytic adenovirus is based on human adenovirus type 5, wherein the promoter that regulates the expression of the LncRNA comprises the sequence of SEQ ID NO.6, wherein the essential virus proliferation gene comprises the sequence of SEQ ID NO.8, and wherein the tumor-selective promoter comprises the sequence of SEQ ID NO.7.

6. The oncolytic adenovirus of claim 2, wherein the oncolytic adenovirus genome comprises the sequence of SEQ ID NO.10.

7. A drug preparation comprising the LncRNA of claim 1, or the oncolytic adenovirus of claim 2, wherein the drug preparation is used in treatment of tumor.

8. The drug preparation of claim 7, wherein expression of miR-21, miR-221/222, miR-224, miR-17-5p, miR-10b, miR106b, miR-151-5p, miR-155, miR-181a/181b, miR-184, miR-1 and miR-449a in the tumor is high.

9. A reagent preparation comprising the LncRNA of claim 1, or the oncolytic adenovirus of claim 2, wherein the reagent preparation is used in study of molecular mechanism of liver cancer cells and treatment of liver cancer.

Description

FIGURE DESCRIPTION

(1) FIG. 1 AdSVPE1a-lcnR replication in different cells at different time points.

(2) FIG. 2 AdSVPE1a-lcnR-midiated LncRNA expression at different cells.

(3) FIG. 3 The effect of AdSVPE1a-lcnR-midiated LncRNA expression on the cell viability.

(4) FIG. 4 The effect of AdSVPE1a-lcnR-midiated LncRNA expression on the cell migration and invasion.

(5) FIG. 5 The effect of AdSVPE1a-lcnR-midiated LncRNA expression on the expression profiles of HCC gene.

(6) FIG. 6 AdSVPE1a-lcnR expression inhibits tumor growth of Huh-7 HCC cell xenografts in nude mice.

IMPLEMENTATION

(7) The embodiments of the present invention are described in details with figures.

(8) The inventors of the present application use tumor-selective Survivin promoter to regulate E1a, the essential gene of adenovirus replication, and make virus replicate selectively in tumor cells. The artificial-designed LncRNA coding sequence is expressed based on the oncolytic adenovirus, and contains a group of seed sequences which are complementary to OncomiRs sequences that promote the occurrence and progression of tumor cells. LncRNA can be highly expressed and copy in a large number by the selectively replication of adenovirus in tumor cells. LncRNA can bind with and consume OncomiRs by competing with OncomiRs target gene. Thus, the tumor suppressor gene can be protected from the interference and inhibition of OncomiRs. And the targeted intervention therapy for tumor can be achieved. The selectively replication of virus vector in tumor cells and the selectively interfere targeting OncomiRs assure, therefore, that the anticancer therapeutic efficacy of this strategy is increased and the safety is improved.

(9) The LncRNA Coding Sequence

(10) The LncRNA coding sequence is the DNA sequence that codes LncRNA. As an optimum embodiment of the present invention, the LncRNA coding sequence is SEQ ID NO.1. As a specific embodiment of the present invention, the LncRNA coding sequence is SEQ ID NO.2. In order to make the LncRNA coding sequence get strong transcription activity and not to be translated, CACCATGC is introduced into 5-end and AG is introduced into 3-end of SEQ ID NO.2. The introduced LncRNA coding sequence is SEQ ID NO.3. The aim of the introduced sequence is to add stop codon into the beginning and ending position of the LncRNA coding sequence. The stop codon can be TAG, TGA, or TAA.

(11) The optimum LncRNA coding sequence of the present invention can be synthetic.

(12) As a specific embodiment of the present invention, the LncRNA coding sequence contains a group of seed sequences which are complementary to OncomiRs sequences. The OncomiRs sequences can highly express and promote the occurrence and development of HCC cells by a variety of mechanisms. The OncomiRs sequences contain miR-21, miR-221/222, miR-224, miR-17-5p, miR-10b, miR-106b, miR-151-5p, miR-155, miR-181a/181b, miR-184, miR-1 and miR-449a. These sequences play different roles by acting on different target genes and signal pathways in the occurrence and development of HCC. For example, studies have found that high-expression of miR-21 in HCC can inhibit the expression of tumor-suppressor gene PTEN. PTEN is an important inhibitory protein of the phosphoinositide 3-kinase (PI3K)/serine threonine protein kinase (AKT) pathway. Therefore, the consequence of the inhibition of PTEN by miR-21 is the activation of the PI3K/AKT pathway, which promotes cancer cell proliferation and metastasis. miR-221/222 acts on many key tumor suppressors, including Bmf, p27.sup.kip1, p57.sup.kip216, PTEN, tissue inhibitors of metalloproteinases (TIMP-3), and DNA damage-inducible transcript 4 (DDIT4), to mediate the occurrence and progression of tumors. These miRNAs can be categorized according to their functions as follows: the high expression of miR-21, miR-221/222, miR-224, miR-17-5p, miR-10b, miR106b, miR-151-5p, miR-155, miR-181a/181b and miR-184 can promote the proliferation, invasion and metastasis of cancer cells; the high expression of miR-221/222, miR-224, miR-10b and miR-155 can inhibit cancer cell apoptosis; and the high expression of miR-21, miR-221/222, miR-143, miR-1 and miR-449a can promote the replication of HBV, induce carcinogenesis and enhance cancer cell proliferation. To inhibit the occurrence and development of HCC, the expression and function of these carcinogenic and tumor-promoting miRNAs should be inhibited by a variety of methods.

(13) The present invention is not limited to the above examples. The LncRNA coding sequence can also contain a single or a group of sequences which are complementary to seed sequences of OncomiRs. The OncomiRs can be either a single or a group of OncomiRs in tumors cells other than HCC which can highly express and promote the occurrence and development of theses tumor cells by a variety of mechanisms, or a single or a group of OncomiRs in HCC cells except miR-21, miR-221/222, miR-224, miR-17-5p, miR-10b, miR-106b, miR-151-5p, miR-155, miR-181a/181b, miR-184, miR-1 and miR-449a.

(14) LncRNA

(15) LncRNA, long non-coding RNA, is a RNA molecule with a length between 200 and 100000 nt. LncRNA does not encode proteins, but regulates many progresses in cells.

(16) LncRNA of the present invention can be encoded by the DNA sequence which contains a group of sequences complementary to seed sequences of OncomiRs that can promote the occurrence and development of HCC cells by a variety of mechanisms. As an optimum embodiment of the present invention, the encoded LncRNA sequence is SEQ ID NO.4. As a specific embodiment of the present invention, the copy number of the LncRNA coding sequence in the virus genome is 6. The encoded LncRNA sequence is SEQ ID NO.5. The effect of this LncRNA on competitively binding with OncomiRs is improved.

(17) The Promoter of LncRNA Coding Sequence

(18) The promoter of LncRNA coding sequence is used to start the transcription of LncRNA coding sequence. It contains other cis-acting elements that have the same function. The LncRNA coding sequence of the present invention in the virus genome can be regulated by any one of the following promoters or cis-acting elements including carcinoembryonic antigen promoter, AFP promoter, receptor tyrosine kinase (EGFR, Her-2, Her-3 and Her-4) promoter of human epidermal growth factor receptors (EGFRs), breast cancer associated antigen DF3/MUC1 promoter, vascular endothelial growth factor (VEGF) receptor KDR promoter, herpes simplexvirus promoter, E2F promoter, prostaglandin specific antigen promoter. As an optimum embodiment of the present invention, the LncRNA coding sequence is regulated by cytomegalovirus (CMV) promoter. This cis-acting element is introduced into the transcription beginning position of the LncRNA coding sequence, and can make sure that LncRNA is highly expressed in tumor cells infected by virus and exert biological activity. The sequence of CMV promoter is preferably as shown in SEQ ID NO.6.

(19) Tumor-Selective Promoter

(20) Tumor-selective promoter is a tumor-selective regulatory sequence. Many tumors have their own specific tumor markers. The expression of tumor markers is regulated by tumor-selective cis-acting or trans-acting elements. Thus, virus proliferation gene can be regulated by tumor-selective regulatory sequences, and virus can selectively proliferate in corresponding tissue cells but not in other tissue cells.

(21) Tumor-selective promoter of the present invention can be composed by any one of the following promoters or enhancers, including (a) promoter, enhancer and mutant sequences of carcinoembryonic antigen, (b) promoter, enhancer and mutant sequences of AFP, (c) promoter, enhancer and mutant sequences of receptor tyrosine kinase of EGFRs, such as EGFR, Her-2, Her-3 and Her-4, (d) promoter, enhancer and mutant sequences of breast cancer associated antigen DF3/MUC1, (e) promoter, enhancer and mutant sequences of receptor KDR of VGEF, (f) promoter, enhancer and mutant sequences of L-plastin, (g) promoter, enhancer and mutant sequences of the members of inhibitor of apoptosis family of protein (IAP), (h) promoter, enhancer and mutant sequences of prostaglandin specific antigen, (i) hypoxic response element conserved sequences regulated by hypoxia inducible factor-1 (HIF-1), (j) promoter, enhancer and mutant sequences of transcription factor E2F.

(22) Survivin, the apoptosis inhibitor, belongs to IAP. Survivin regulates the development of embryonic cell and cell cycle, inhibits apoptosis through a variety of ways and promotes cell proliferation and cell cycle progress. Survivin is only expressed in embryonic tissue and most tumor tissues, but not in normal adult tissues. The expression of Survivin in malignant tumors is highly selective. Survivin is expressed highly in most tumor tissues, such as lung cancer, colon cancer, pancreatic cancer, prostate cancer, breast cancer and non-Hodgkin's lymphoma. In addition, Survivin is related to the tumor recurrence and metastasis, as well as poor prognosis in patients. Thus, it becomes a broad spectrum of tumor diagnostic markers. In a word, virus that regulated by Survivin promoter is expected to achieve the broad spectrum of anti-cancer effect against most human tumors.

(23) As an optimum embodiment of the present invention, the core sequence of Survivin promoter is introduced as cis-acting element between transcription beginning position and the ATG translation initiation sites of E1a, the essential gene of adenovirus replication. This method can regulate the transcription of E1a, make E1a be selectively expressed only in Suvivin-positive tumor cells, and have weak or no effect on normal cells. The regulation has more security and reliability. The sequence of Survivin promoter in this invention is SEQ ID NO.7.

(24) The Essential Virus Replication Gene

(25) The essential virus replication gene can provide the necessary proteins for virus replication. The essential adenovirus replication gene contains E1a, E1b-55 kDa, E1b-19 kDa, E3 and E4. E1b-55 kDa is the necessary protein for adenovirus replication in normal cells, but not in tumor cells. The selective deletion of E1b-55 kDa coding gene can keep the adenovirus replication in tumor cells but not in normal cells. E1b-55 kDa can inactivate and degrade P53 protein. The selective deletion of E1b-55 kDa coding gene has benefit in keeping the anti-tumor activity of P53 protein and improving the targeting of the virus vector. Adenovirus E1b-19 kDa coding gene is homologous to apoptosis-suppressing gene Bcl-2. E1b-19 kDa can bind with Bax or Bak and start the downstream apoptosis inhibitor procedure. In addition, E1b-19 kDa can destroy the apoptosis progress mediated by Fas to protect infected cells from killing effect mediated by TNF-.

(26) As an optimum embodiment of the present invention, the E1a sequence is SEQ ID NO.8.

(27) Recombinant Oncolytic Adenovirus

(28) The present invention uses recombinant virus vector to mediate the selective expression of the LncRNA coding sequence in tumor cells, which can exert anti-cancer effects. The recombinant virus vector contains existing virus vector, tumor-selective promoter and the expression cassette of the LncRNA. The expression cassette of the LncRNA contains the LncRNA coding sequence and the promoter of the LncRNA coding sequence.

(29) Human oncolytic adenoviruses have six different subgenera, containing A, B, C, D, E and F. Their tropism, tumorigenesis and diseases history in host cells are different. As an optimum embodiment of the present invention, the oncolytic adenovirus is subgenus C type 5.

(30) As an optimum embodiment of the present invention, the recombinant oncolytic adenovirus contains human adenovirus type 5, tumor-selective promoter and the expression cassette of the LncRNA. Using backbone plasmid pBHGloxdeltaE1,3Cre which contains adenovirus type 5 genome and adenovirus shuttle plasmid which contains the LncRNA coding sequence to produce the recombinant oncolytic adenovirus by Cre-loxP recombinant enzyme cutting system in 293 cell. The sequence of outside the recombinant region in the recombinant oncolytic adenovirus is consistent with the sequence of outside the recombinant region in pBHGloxdeltaE1,3Cre adenovirus vector. The sequence of inside the recombinant region in the recombinant oncolytic adenovirus is SEQ ID NO.9.

(31) The SEQ ID NO.9 are as follows: 1-6 bp, XbaI restriction enzyme site; 7-996 bp, the sequence of Survivin promoter; 997-1002 bp, EcoRI restriction enzyme site; 1003-1991 bp, the cDNA sequence of E1a; 1992-2301 bp, SV40 PolyA tail sequence; 2302-2307 bp, BamHI restriction enzyme site; 2308-2338, the sequence of CMV promoter; 2339-2844 bp, SalI restriction enzyme site; 2845-2851, the LncRNA transcription beginning site; 2852-4030 bp, 6 duplicate copies of the LncRNA coding sequence; 4031-4190 bp, the LncRNA addition sequence; 4191-4196, SalI restriction enzyme site.

(32) The whole genome sequence of the recombinant oncolytic adenovirus is SEQ ID NO.10. The whole genome sequence of the final recombinant oncolytic adenovirus subjects to SEQ ID NO.10 in the embodiment.

(33) Embodiment.1 the Construction of Adenovirus Plasmid that Tumor-Selective Survivin Promoter Regulates E1a

(34) First step: The tumor-selective Survivin promoter was artificially synthesized. XbaI site was introduced in 5-end, EcoRI site was introduced in 3-end. To construct the plasmid pDC315-SVP that contains the Survivin promoter, the tumor-selective Survivin promoter was inserted between XbaI and EcoRI site of the plasmid pDC315 (PD-01-27, Microbix Biosysytems Inc., Canada). The length of the artificial-synthesis Survivin promoter was 1002 bp. The sequence of the artificial-synthesis Survivin promoter was based on SEQ ID NO.7, in which XbaI restriction enzyme site (TCTAGA) was introduced in 5-end and EcoRI restriction enzyme site (GAATTC) was introduced in 3-end.

(35) Second step: The E1a sequence that contains PolyA tail sequence was attained by cloning. EcoRI site and ACC were introduced in 5-end, BamHI site was introduced in 3-end. To construct the plasmid pDC315-SVPE1a that the Survivin promoter regulates the expression of E1a, the E1a sequence was inserted between EcoRI and BamHI site of the plasmid pDC315-SVP. The length of E1a containing PolyA tail sequence was 1311 bp. In E1a, 1-6 bp, EcoRI restriction enzyme site (GAATTC); 7-9 bp, ACC; 10-995 bp, the cDNA sequence of E1a gene (SEQ ID NO.8); 996-1305 bp, SV40 PolyA tail sequence (SEQ ID NO.11); 1306-1311 bp, BamHI restriction enzyme site (GGATCC).

(36) Embodiment.2 the Construction of Adenovirus Packaging Plasmid that Expresses the Artificial-Synthesis Long Non-Coding RNA (LncRNA)

(37) First step: The CMV promoter sequence was attained by cloning. BamHI site was introduced in 5-end, and SalI site was introduced in 3-end. To construct the plasmid pDC315-mCMV that contains the mCMV promoter, the CMV promoter sequence was inserted between BamHI site and SalI site of the plasmid pDC315. The length of mCMV was 543 bp. In mCMV, 1-6 bp, BamHI restriction enzyme site (GGATCC); 7-537 bp, the CMV promoter sequence (SEQ ID NO.6); 538-543 bp, SalI restriction enzyme site (GTCGAC).

(38) Second step: 6 copies of the DNA sequence encoding LncRNA that contains PolyA tail sequence were artificially synthesized. SalI site was introduced in 5-end and 3-end. To construct the expression plasmid pDC315-mCMVLncR that contains the LncRNA coding sequence, 6 copies of the DNA sequence encoding LncRNA was inserted between two SalI sites of the plasmid pDC315-mCMV. The length of the DNA sequence was 1348 bp. In the DNA sequence, 1-6 bp, SalI restriction enzyme site (GTCGAC); 7-13 bp, the transcription beginning site (CACCATG); 14-1192 bp, 6 duplicate copies of the LncRNA coding sequence (SEQ ID NO.12); 1193-1352 bp, the LncRNA addition sequence (SEQ ID NO.13); 1353-1358 bp, SalI restriction enzyme site (GTCGAC).

(39) Third step: To construct the tumor-selective proliferation adenovirus packaging plasmid pDC315-SVPE1a-mCMVLncR that contains the LncRNA coding sequence, the pDC315-mCMVLncR fragment that contains whole LncRNA expression cassette was recycled by restriction enzyme digestion of BamHI and SalI, and inserted between BamHI and SalI site of the plasmid pDC315-SVPE1a. The length of whole LncRNA expression cassette was 1895 bp. In whole LncRNA expression cassette, 1-6 bp, BamHI restriction enzyme site; 7-537 bp, the CMV promoter sequence (SEQ ID NO.6); 538-543 bp, SalI restriction enzyme site; 544-550 bp, the transcription beginning site (CACCATG); 551-1729 bp, 6 duplicate copies of the LncRNA coding sequence (SEQ ID NO.12); 1730-1889 bp, the LncRNA addition sequence (SEQ ID NO.13); 1890-1895 bp, SalI restriction enzyme site.

(40) Embodiment.3 the Recombination, Amplification and Purification of Tumor-Selective Replication Adenovirus Containing the LncRNA Coding Sequence

(41) First step: The constructed type 5 adenovirus left arm packaging plasmid pDC315-SVPE1a-mCMVLncR and type 5 adenovirus right arm packaging plasmid pBHGloxdelE13cre (Microbix Biosysytems Inc., Canada) were cotransfected into HEK293 cells (Microbix Biosysytems Inc., Canada) by LipoFectamine2000. The cotransfection method was referred to Invitrogen's LipoFectamine2000 kit operation instructions. The recombinant enzyme system Cre/Loxp of pBHGloxdelE13cre that contains type 5 adenovirus right arm and lacks of E1 and E3, can ensure efficient restructure of virus. HEK293 cells were transformed by sheared type 5 adenovirus DNA containing type5 adenovirus E1. Adenovirus DNA had high transfection efficiency on HEK293 cells, that can promote the recombination and packaging of adenovirus. 14 days after cotransfection, virus plaques appear. Adenovirus AdSVPE1a-LncR was restructured after 3 times virus plaque purification referring to the literature: GeneTransfer and Expression Protocols, Murray E J, Humana Press, Clifton, N.J.

(42) The whole adenovirus AdSVPE1a-LncR gene sequence was SEQ ID NO.10. In the sequence, 1-85 bp, type 5 adenovirus ITR sequence; 86-437 bp, type 5 adenovirus gene sequence; 438-443 bp, XbaI restriction enzyme site; 444-1433 bp, the Survivin promoter sequence; 1434-1439 bp, EcoRI restriction enzyme site; 1440-2428 bp, the cDNA sequence of E1a gene; 2429-2738 bp, SV40 PolyA tail sequence; 2739-2744 bp, BamHI restriction enzyme site; 2745-3275 bp, the CMV promoter sequence; 3276-3281 bp, SalI restriction enzyme site; 3282-3288 bp, the LncRNA transcription beginning site; 3289-4467 bp, 6 duplicate copies of the LncRNA coding sequence; 4468-4627 bp, the LncRNA addition sequence; 4628-4633 bp, SalI restriction enzyme site; 4634-4668 bp, the LoxP sequence; 4669-34339 bp, type 5 adenovirus genome sequence; 34340-34441 bp, type 5 adenovirus ITR sequence.

(43) Second step: The adenovirus AdSVPE1a-LncR replicated in a large number in HEK293 cells. The adenovirus was purified using the cesium chloride gradient centrifugation method referring to the literature: GeneTransfer and Expression Protocols, Murray E J, Humana Press, Clifton, N.J.

(44) Embodiment.4 the Identification of Recombinant Adenovirus AdSVPE1a-LncR

(45) The inserted sequence of the recombinant adenovirus AdSVPE1a-LncR was identified by sequencing and PCR. AdSVPE1a-LncR was type 5 adenovirus. The inserted sequence contained 6 duplicate copies of the LncRNA coding sequence, mCMV promoter, Survivin promoter and E1a sequence. The other DNA sequence was the same with type 5 adenovirus. PCR primers for identification were listed in table. 1.

(46) TABLE-US-00001 TABLE1 PCRprimersofidentifyingtherecombinantadenovirusAdSVPE1a- LncR Fragmentlength Primersequence(5-3) SEQIDNO. (BP) LncR-F:CTGCACTGTCAGCACTTTA 14 196,392,588, LncR-R:ACATTCATTGCTGTCGGTG 15 784,784,980, 1176;copy numberratiois 7:6:5:4:3:2:1 mCMV-F:GATATACTGAGTCATTAGGGAC 16 445 mCMV-R:CCAATAGAATGAGTGCCAATAT 17 SurvPro-F:ATGGCACAATCTCAGCTCACT 18 149 SurvPro-R:ATCACGGTGAAACCTTGTCTCT 19 E1a-F:TATGTGTTCGCTTTGCTATATGAG 20 188 E1a-R:TCAGGCTCAGGTTCAGACACA 21

(47) Results: The target bands with the same theoretical lengths were amplified by PCR using these primers sequence, and the sequences were correct by sequencing.

(48) Embodiment.5 the Recombinant Adenovirus AdSVPE1a-LncR Proliferation and Gene Expression in HCC Cells

(49) First step: The selective proliferation experiment of the recombinant adenovirus AdSVPE1a-LncR. The HCC cells (HepG2, Hep3B, SMMC-7721, MHCC97H, MHCC97L, Huh-7 and PLC/PRF/5) and normal liver cells (L02 and WRL-68) were harvested, counted and seeded into 96-well plates (110.sup.4 cells/well). After cell attachment, the medium was changed to serum-free medium. The AdSVPE1a-LncR virus was added at a multiplicity of infection (MOI) of 1 pfu/cell. 2 h after virus infection, cells were re-fed with medium containing 5% serum and cultured for 0, 24, 48 and 72 h. Cells were harvested, and the viral titer was detected with the TCID50 method. The specific replication ability of AdSVPE1a-LncR was strong in HepG2, Hep3B, MHCC97H, Huh-7 and PLC/PRF/5 cells, with the highest value reaching to 68465.66-fold (Huh-7). The specific replication ability reached to several hundred folds in SMMC-7721 and MHCC97L cells, whereas the replications in the normal cells, L02 and WRL-68, were not significant (FIG. 1).

(50) Second step: The selective and high expression of LncRNA. The abovementioned cells were infected with the AdSVPE1a-LncR adenovirus (MOI=1 pfu/cell). After culture for 48 h, cells were harvested. The quantitative real-time PCR (qRT-PCR) was used to detect LncRNA expression. The following LncRNA-specific PCR primers were used: LncR-F (5-CTGCACTGTC AGCACTTTA-3); LncR-R (5-ACATTCATT GCTGTCGGTG-3). AdSVPE1a-LncR-mediated LncRNA expression levels were high in Huh-7, Hep3B, and HepG2 cells, followed by PLC/PRF/5, MHCC97H, BEL-7402, MHCC97L and SMMC-7721 cells. The LncRNA expression in the normal liver cells, WRL-68 and L02, was very low (FIG. 2).

(51) Embodiment.6 the Effect of the Recombinant Adenovirus AdSVPE1a-LncR on the Biological Behavior of HCC Cells

(52) First step: The effect of LncRNA expression on the proliferation of cells. The effects of virus AdSVPE1a-LncR on HCC cells and normal cells were detected by the tetrazolium colorimetric assay (MTT assay). Cell Proliferation Kit I (MTT) was purchased from Roche Diagnostics GmbH. The cells in logarithmic growth phase were harvested and counted. The cells were diluted with 10% serum-containing culture medium, seeded in 96-well plates (110.sup.4 cells/well in 100 l). After cell attachment, virus was diluted with serum-free culture medium, and 100 l of corresponding virus was added (MOI=1, 2, 5, 10, 20, 50 and 100 pfu/cell). For each MOI value, eight replicate wells were prepared. The cells were incubated for 2 h, and the cell culture medium was then changed to serum-containing medium (100 l/well). After culture for 48 h, the medium was discarded, and 100 l of 0.1 mol/L PBS was added to each well. The MTT labeling reagent (10 l/well) was then added at a final concentration of 0.5 mg/ml, and the cells were incubated in an incubator for 4 h. Solubilization solution (10% SDS in 0.01 mol/L HCl) was then added (100 l/well), and the plate was incubated overnight in an incubator. The absorbance at 570 nm wavelength was measured by Model 550 Microplate Reader (BIO-RAD), and the calibration wavelength was 655 nm. Then curve was drew. The experiments showed that AdSVPE1a-LncR had the strongest killing activity in Hep3B and Huh-7 cells. The viability of Hep3B cells was decreased to less than 50% when the adenovirus was added at an MOI of 0.5 pfu/cell and further decreased to less than 10% when the MOI was equal to 2 pfu/cell. The viability of Huh-7 cells was decreased to less than 50% when the MOI was equal to 1 pfu/cell and further decreased to less than 10% when the MOI was equal to 100 pfu/cell. AdSVPE1a-LncR had a stronger killing activity in HepG2 and MHCC97L cells, as their viabilities were all less than 50% when the virus was added at an MOI of 20 pfu/cell. AdSVPE1a-LncR had a stronger killing activity in PLC/PRF/5 cell, as its viability was less than 50% when the virus was added at an MOI of 50 pfu/cell. AdSVPE1a-LncR had a stronger killing activity in MHCC97H and SMMC-7721 cells, as their viabilities were all less than 50% when the virus was added at an MOI of 100 pfu/cell. AdSVPE1a-LncR had a weaker killing activity in BEL-7402 cells, as it decreased the viability to less than 50% at an MOI of 200 pfu/cell. AdSVPE1a-LncR did not have a significant impact on the proliferation of normal liver cells because the cell viability was greater than 80% when the MOI was equal to 500 pfu/cell.

(53) Second step: The effect of LncRNA expression on cell migration and invasion ability. There were four experiment groups, including: the tumor cells infected by AdSVPE1a-LncR at a MOI of 10 pfu/cell (ER1), the tumor cells infected by AdSVPeGFP-LncR which was used as positive virus (ER2, non-proliferative virus that expressed LncRNA), the tumor cells infected by Ad5-eGFP which was used as negative virus (CR2, non-proliferative virus that did not express LncRNA), the parental cells cultured at the same time as a blank control (CR2). Cells were added to the top chamber of Transwell plate (410.sup.5 cells/200 l). Medium containing 10% FBS (500 l) was added to the bottom chamber. If cell invasion ability was monitored, Matrigel (polycarbonate membrane) was added to the top chamber. After culture for 24 h, the cells in the top chamber were removed and stained with 0.1% crystal violet for 20 min. Three fields (200) were randomly imaged using the light microscope for counting. The experiment was repeated three times. The experiments showed that AdSVPE1a-LncR had a significant inhibitory effect on the cell migration and invasion ability of HCC cells. AdSVPeGFP-LncR also inhibited HCC cell migration and invasion, but its activity was significantly weaker than that of AdSVPE1a-LncR. AdSVPE1a-lncR and AdSVPeGFP-LncR did not significantly inhibit the mobility of normal liver cells (FIG. 4).

(54) Embodiment.7 the Effect of the Recombinant Adenovirus AdSVPE1a-LncR on the HCC Cell Gene Expression Profile

(55) The Huh-7 cells in logarithmic growth phase were harvested and seeded in a 24-well plate (110.sup.6 cells/well in 100 l). After cell attachment, the virus was diluted with serum-free medium, and 100 l of AdSVPE1a-LncR was added (MOI=10 pfu/cell). The Ad5-eGFP was used as a negative virus control, while the parental cells were synchronously cultured as a blank control. Th cells were cultured in an incubator for 2 h and then re-fed with 100 l/well of serum-containing medium. After culture for 48 h, the cells were harvested and total cellular protein was extracted for gene expression analysis using gene expression profile chip. The blank control was labeled with green fluorescence signal cy3, and the experiment group was labeled with red fluorescence signal cy5. Two fluorescence signal were superimposed. It was green when cy3 signal was stronger, and genes were down-regulated when the difference was less than 0.5 fold. It was red when cy5 signal was stronger, and genes were up-regulated when the difference was up to 2 fold. It was yellow when cy3 and cy5 signal was similar, and genes expression difference were between 0.5 and 2 fold. The expression profile of genes in Huh-7 infected with AdSVPE1a-LncR was significantly different. 708 genes were up-regulated, including, 13 proto-oncogenes and anti-oncogenes, 11 ion channel and transport protein relative genes, 12 cyclin relative genes, 13 cytoskeleton and movement protein relative genes, 5 apoptosis-related protein relative genes, 6 DNA-synthesis, -repair and -recombiant protein relative genes, 30 DNA-binding and -transcription factor relative genes, 10 cell receptor relative genes, 27 immune-related protein relative genes, 74 cell signal transduction protein relative genes, 61 metabolism molecular relative genes, 48 protein translation and synthesis factor relative genes, 9 differentiation and development relative genes, and 389 other relative genes. 628 genes were down-regulated, including 12 proto-oncogenes and anti-oncogenes, 14 ion channel and transport protein relative genes, 21 cyclin relative genes, 32 cytoskeleton and movement protein relative genes, 5 apoptosis-related protein relative genes, 7 DNA-synthesis, -repair and -recombiant protein relative genes, 17 DNA-binding and -transcription factor relative genes, 12 cell receptor relative genes, 31 immune-ralated protein relative genes, 59 cell signal transduction protein relative genes, 63 metabolism molecular relative genes, 48 protein translation and synthesis factor relative genes, 8 differentiation and development relative genes, and 299 other relative genes. The expression of PTEN, p27.sup.ki1, TIMP3 and RECK was increased significantly, and the expression of p38/MAPK, Survivin, CDK4 and c-myc was decreased significantly (FIG. 5).

(56) Embodiment.8 the Inhibitory Effect of the Recombinant Adenovirus AdSVPE1a-LncR on HCC Cell Line Xenograft Models in Nude Mice

(57) Forty healthy purebred five-week old male BALB/C nude mice were provided by Shanghai SLAC Laboratory Animal Co., Ltd (Chinese Academy of Sciences, Shanghai, China), the certificate number was SCXK (Shanghai) 2012-0002. The Huh-7 cells in logarithmic growth phase were injected subcutaneously into the right axilla (510.sup.6 cells/100 l/mouse), ten days after inoculation, the tumor formation rate was 100%, and the diameter of the xenograft tumors was approximately 0.8-1.0 cm. The mice in every cell model were randomly divided into four groups (AdSVPE1a-LncR, AdSVPeGFP-LncR, Ad5-eGFP and blank control group), n=10 in each group. The virus treatment groups received the corresponding viruses via intratumoral injection at a dose of 210.sup.8 pfu/100 l/mouse, once every other day for a total of five times. The blank control group received saline injections at the same time (100 l/mouse). After treatments, the tumor size was measured every week and the tumor volume was calculated as follows: maximum diameterminimum diameter.sup.20.5. A growth curve was then plotted.

(58) The tumor growth rate of the AdSVPE1a-lncR treatment group was significantly slower than that of the blank control group at 14 days after treatment. At 21 days, the tumor volume started to decrease. The AdSVPeGFP-LncR group also had some growth inhibition at 28 days after treatment, and the difference was significant compared with the blank control group even though the tumor continued to grow. The Ad5-eGFP group did not show growth inhibition during the experiment (Table. 2). The observation continued to 42 days after treatment, and the tumor volume in the AdSVPE1a-lncR group was significantly smaller than that before treatment (FIG. 6). After finishing the observation, nude mice were euthanized.

(59) TABLE-US-00002 TABLE 2 Antitumor effect of AdSVPE1a-LncR on Huh-7 xenografts in nude mice Time AdSVPE1a-LncR AdSVPeGFP-LncR Ad5-eGFP Blank Control (day) Tumor Volume *P Tumor Volume *P Tumor Volume *P Tumor Volume 0 306.76 44.68 0.9270 305.51 43.35 0.9777 293.77 50.18 0.5914 304.98 41.08 7 550.54 70.89 0.1761 582.99 97.13 0.4813 552.11 140.25 0.2837 622.92 146.28 14 918.83 143.89 0.0153 1125.08 256.37 0.4663 1103.17 216.12 0.5774 1061.35 87.18 21 903.50 147.11 0.0000 1342.52 352.92 0.2535 1408.94 321.97 0.4407 1526.48 344.44 28 813.20 130.20 0.0000 1444.41 504.63 0.0017 2120.32 208.38 0.8118 2150.77 339.68 35 470.10 116.57 0.0000 1973.86 355.62 0.0022 2624.40 457.67 0.9621 2614.68 443.41 42 241.20 95.66 0.0000 2208.91 560.62 0.0037 2969.63 456.18 0.3482 3174.69 495.17 Ps: *Compared with the control group at the same time, T-test.

(60) The present invention has been described with some preferred embodiments thereof and it is understood that many changes and modifications in the described embodiments can be carried out without departing from the scope and the spirit of the invention that is intended to be limited only by the appended claims.