CXCR4 RECEPTOR-BINDING COMPOUNDS USEFUL FOR INCREASING INTERFERON LEVEL

20190175549 · 2019-06-13

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to a CXCR4 receptor-binding compound for use for increasing or restoring interferon (IFN) level in an individual, wherein the interferon is a type-I interferon (IFN-I).

    Claims

    1. A CXCR4 receptor-binding compound for use for increasing or restoring interferon (IFN) level in an individual, wherein the interferon is a type-I interferon (IFN-I).

    2. The CXCR4 receptor-binding compound for use according to claim 1, wherein the CXCR4 receptor-binding compound is selected from the group consisting of: a compound of the following formula (I):
    ZR-A-RY(I) wherein: Z and Y, which are identical or different, represent: an alkyl group having from 1 to 6 carbon atoms, optionally substituted by a hydroxyl group, an ethylene, a halogen atom, a CN group, a CF.sub.3 group, a SO group, a NO.sub.2 group, an amine group, a difluor or an alkyl, S-alkyl or O-alkyl group having from 1 to 6 carbon atoms, or an aryl or heteroaryl group having from 3 to 6 carbon atoms, optionally substituted by a hydroxyl group, an ethylene, a halogen atom, a CN group, a CF.sub.3 group, a SO group, a NO.sub.2 group, an amine group, a difluor or an alkyl, S-alkyl or O-alkyl group having from 1 to 6 carbon atoms, or a cyclic or heterocyclic polyamine group having from 9 to 32 ring members and from 3 to 8 amine groups in the ring spaced by 2 or more carbon atoms from each other, optionally comprising an aryl or heteroaryl group having from 3 to 6 carbon atoms, a heteroatom or a heteroelement, and optionally substituted by a halogen atom, a hydroxyl group, a heteroatom, a heteroelement an alkyl, S-alkyl or O-alkyl group having from 1 to 6 carbon atoms or an aryl or heteroaryl group having from 3 to 6 carbon atoms, and A represents an aryl or heteroaryl group having from 3 to 12 carbon atoms, and R and R, which are identical or different, represent an alkyl group having from 1 to 6 carbon atoms or a R.sub.1NR.sub.2R.sub.3 group, and R.sub.1 represents a single bond or an alkyl group having from 1 to 6 carbon atoms, and R.sub.2 and R.sub.3, which are identical or different, represent a hydrogen atom, an amine group, an alkyl group having from 1 to 6 carbon atoms or an aryl or heteroaryl group having from 3 to 6 carbon atoms, optionally substituted by an alkyl group having from 1 to 6 carbon atoms, or a pharmaceutically acceptable salt and/or hydrate thereof; a compound of the following formula (II): ##STR00010## wherein: D.sub.1 and D.sub.2, which may be identical or different, represent: an alkyl group having from 1 to 6 carbon atoms optionally substituted by at least one hydroxyl group, a halogen atom, a CF.sub.3 group, a CN group, an amine group, or an alkyl, O-alkyl or S-alkyl group having from 1 to 12 carbon atoms, or an aryl, an heteroaryl, a cycloalkyl, a heterocycloalkyl, alkylaryl, alkylheteroaryl or alkylheteropolyaryl group having from 3 to 12 carbon atoms, optionally substituted by at least one hydroxyl group, halogen atom, CF.sub.3 group, CN group, amine group, or alkyl, O-alkyl or S-alkyl group having from 1 to 12 carbon atoms, or D.sub.1 and D.sub.2 are linked together to from a N-containing aryl or heteroaryl group having from 3 to 12 carbon atoms and optionally substituted by at least one amine group optionally substituted by an alkylheteroaryl, group having from 3 to 12 carbon atoms, and X represents: an alkyl group having from 1 to 6 carbon atoms, or R.sub.4YR.sub.5 wherein, R.sub.4 and R.sub.5 which are identical or different represent an alkyl group having from 1 to 6 carbon atoms and Y represents an aryl or heteroaryl group having from 3 to 6 carbon atoms, optionally substituted by a halogen atom, a hydroxyl group, an amide group, an amine group, an alkoxy group, an ester group, a CF.sub.3 group, a CN group or an alkyl, O-alkyl or S-alkyl group having from 1 to 6 carbon atoms optionally substituted by a hydroxyl group, an amine group or an O-alkyl group having from 1 to 6 carbon atoms, or a pharmaceutically acceptable salt and/or hydrate thereof.

    3. The CXCR4 receptor-binding compound of formula (I) for use according to claim 2, wherein: Z and Y are identical and represent cyclic polyamine moieties having from 9 to 20 ring members and from 3 to 6 amine groups in the ring spaced by 2 or more carbon atom from each other, and A represents an aryl or heteroaryl group having from 3 to 8 carbon atoms, and R and R, which are identical or different, represent a methylene linked to a nitrogen atom of Z or Y, the nitrogen atoms being otherwise unsubstituted.

    4. The CXCR4 receptor-binding compound for use according to claim 1, wherein the CXCR4 receptor-binding compound interacts with at least 6 amino acids of a CXCR4 receptor represented by SEQ ID NO: 1, wherein the amino acids are selected from the group consisting of alanine 175, aspartic acid 171, aspartic acid 262, phenylalanine 174, valine 196, glycine 207, tyrosine 255, tyrosine 256, isoleucine 259, serine 263 and glutamic acid 288.

    5. The CXCR4 receptor-binding compound for use according to claim 1, wherein the CXCR4 receptor-binding compound is selected from the group consisting of plerixafor and AMD070.

    6. The CXCR4 receptor-binding compound for use according to claim 1, wherein the interferon (INF) is IFN-a and/or IFN-.

    7. The CXCR4 receptor-binding compound for use according to claim 1, for increasing or restoring IFN secretion by immune cells.

    8. The CXCR4 receptor-binding compound for use according to claim 1, for increasing or restoring IFN secretion by immune cells selected from the group consisting of plasmacytoid dendritic cells, monocytes and NK cells.

    9. The CXCR4 receptor-binding compounds for use according to claim 1, in the prevention or treatment of a disease selected from the group consisting of a viral infection, an opportunistic infection, allergy, rheumatoid arthritis, multiple sclerosis, a cancer with an overproduction of spermine, depression-induced immunosuppression and diabetes.

    10. The in vitro use of a CXCR4 receptor-binding compound as defined in claim 1, for increasing or restoring type-I IFN secretion by immune cells.

    11. An in vitro screening method for identifying compounds for increasing or restoring IFN secretion in an individual from candidate compounds, wherein the candidate compounds are CXCR4 receptor-binding compounds as defined in claim 1.

    12. The in vitro screening method according to claim 11, comprising the steps of: contacting blood cells with a candidate compound; determining the level of secretion of IFN by the contacted blood cells; selecting the candidate compound which increases the level of secretion of IFN with respect to the level of secretion of IFN before the blood cells have been contacted by the candidate compound, thereby identifying a compound for increasing or restoring IFN level.

    13. The in vitro screening method according to claim 11, wherein blood cells are selected form the group consisting of peripheral blood mononuclear cells (PBMC) and plasmacytoid dendritic cells, monocytes and NK cells.

    14. An in vitro screening method for identifying compounds for increasing or restoring type-I IFN secretion in an individual from candidate compounds, comprising: binding a CXCR4 receptor with a detectable CXCR4 receptor-binding compound as defined in claim 1; contacting the CXCR4 receptor bound to the detectable CXCR4 receptor-binding compound with a candidate compound; selecting the candidate compound which decrease the binding of the detectable CXCR4 receptor-binding compound to the CXCR4 receptor, thereby identifying a compound for increasing or restoring IFN level.

    15. An in silico method for screening compounds from candidate compounds, or for designing compounds, for increasing or restoring type-I IFN level in an individual, comprising determining if a designed compound or a candidate compound interacts with at least 6 amino acids of a CXCR4 receptor represented by SEQ ID NO: 1, wherein the amino acids are selected from the group consisting of alanine 175, aspartic acid 171, aspartic acid 262, phenylalanine 174, valine 196, glycine 207, tyrosine 255, tyrosine 256, isoleucine 259, serine 263 and glutamic acid 288.

    Description

    DESCRIPTION OF THE FIGURES

    [0116] FIG. 1

    [0117] FIG. 1 represents the measure of mRNA levels of TRAIL (first bar), IFN-a (second bar) and IFN- (third bar) from purified pDC pre-incubated with AMD 3100 (20 M) then histamine or CB (10 M) and stimulated overnight with HIV-X4 by RT-qPCR and normalized to RPL13A.

    [0118] FIG. 2

    [0119] FIG. 2 represents the measure of IFN-a (ng/ml) by ELISA in supernatants of isolated pDC pre-treated with AMD3100 (20 M), then CB and stimulated with HIV overnight.

    [0120] FIGS. 3A, 3B and 3C

    [0121] FIGS. 3A-3C represent the measure of mRNA levels of ISG56 (FIG. 3A), IFN-a/ (FIG. 3B) and IL-6 (FIG. 3C) from purified pDC pre-incubated with AMD-3100 (20 M) then CB (10 M) and stimulated overnight with HIV, by RT-qPCR and normalized to RPL13A.

    EXAMPLE

    A. Materials and Methods

    1. Blood Samples, Isolation and Culture of Blood Leukocytes.

    [0122] Blood was obtained from healthy HIV-1-seronegative blood bank donors. Experimental procedures with human blood were done according to the European Union guidelines and the Declaration of Helsinki. In vitro experiments were performed using human peripheral blood mononuclear cells (PBMC) isolated by density centrifugation from peripheral blood leukocyte separation medium (Cambrex, Gaithersburg, Md.). pDC were purified by negative selection with the Human plasmacytoid DC enrichment kit (StemCell Technologies). Cells were cultured in RPMI 1640 (Invitrogen, Gaithersburg, Md.) containing 10% fetal bovine serum (Hyclone, Logan, Utah). After purification, the purity obtained was higher than 91% for pDC.

    2. Viral Stimulation and Infection.

    [0123] PBMC were seeded at 1.10.sup.6/1 mL or purified pDC were seeded at 5.10.sup.4/100 l and then stimulated with the following viruses: inactivated AT-2 HIV-1.sub.MN (CXCR4 co-receptor specific) or AT-2 HIV-1.sub.ADA (CCR5 co-receptor specific) at 60 ng/mL p24.sup.CA equivalent (provided by J.D. Lifson (SAIC-NCI, Frederick, Md.)), Infectious human Influenza A/PR/8/34 virus (Flu), titer 1:8192 at dilution 1:1000 or DENV-2 16681 at MOI 10. Infectious HIV-1.sub.MN [tissue culture 50% infective dose (TCID50)=106] and HIV-1.sub.ADA (TCID50=1,000) were used at the same concentration. Purified pDC were pre-treated with amino compounds for 1 hour, following overnight stimulation with virus. Supernatants were collected for cytokine detection. Microvesicles isolated from uninfected cell cultures matched to the culture to produce the virus were used as negative control (Mock).

    3. Chemical Compounds.

    [0124] Histamine dihydrochloride and clobenpropit dihydrobromide (Sigma-Aldrich, Mo., USA) were diluted in pure water. The compounds were added in pDC cultures at 10 M (or other if specified) 1 hour before stimulation or not of the different viruses. For histamine, X-vivo culture media (Lonza) was used in order to avoid histaminases. Cells were pre-incubated 1 hour with AMD3100 (20 M) (Sigma-Aldrich, Mo., USA) prior to CB or histamine incubation. pDC were cultured in the presence of 5 mM of the oligodinucleotide A151 (TTAGGG) ODN (Integrated DNA Technologies, Coralville, Iowa).

    4. Cytokine Detection.

    [0125] pDC's supernatants were tested for multispecies soluble IFN-a by ELISA (PBL Assay Science, NJ, USA) according to the manufacturer's instructions.

    5. RT-qPCR Analysis.

    [0126] Total RNA was extracted using RNeasy Micro kit and was submitted to DNase treatment (Qiagen), following manufacturer's instructions. RNA concentration and purity were evaluated by spectrophotometry (Biophotometer, Eppendorf). Five hundred ng of RNA were reverse-transcribed using PrimeScript RT Reagent Kit (Perfect Real Time, Takara) in a 10 l reaction. Real-time PCR reactions were performed in duplicates using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec) on a 7900HT Fast Real-Time PCR System (Applied Biosystems). Transcripts were quantified using the following program: 3 min at 95 C. followed by 35 cycles of 15 s at 95 C., 20 s at 60 C. and 20 s at 72 C. Values for each transcript were normalized to expression levels of RPL13A (60S ribosomal protein L13a) using the 2-Ct method. Primers used for quantification of transcripts by real time quantitative PCR are indicated below:

    TABLE-US-00001 Size Gene Forwardprimersequence(5.fwdarw.3) ReversePrimersequence(5.fwdarw.3) (bp) TRAIL GCTGAAGCAGATGCAGGACAA TGACGGAGTTGCCACTTGACT 135 (SEQIDNO:2) (SEQIDNO:3) IFN- CCAGTTCCAGAAGGCTCCAG TCCTCCTGCATCACACAGGC 174 1/13.sup.1 (SEQIDNO:4) (SEQIDNO:5) IFN- CCCACAGCCTGGGTAATAGGA CAGCAGATGAGTCCTCTGTGC 210 4/10.sup.2v (SEQIDNO:6) (SEQIDNO:7) IFN- TGCATTACCTGAAGGCCAAGG AGCAATTGTCCAGTCCCAGTG 152 (SEQIDNO:8) (SEQIDNO:9) IFN- GGCAGCCAACCTAAGCAAGAT CAGGGTCACCTGACACATTCA 17 (SEQIDNO:10) (SEQIDNO:11) IL6 TAACCACCCCTGACCCAACC ATTTGCCGAAGAGCCCTCAG 14 (SEQIDNO:12) (SEQIDNO:13) ISG56 AGGACAGGAAGCTGAAGGAG AGTGGGTGTTTCCTGCAAGG 19 (SEQIDNO:14) (SEQIDNO:15) .sup.1Primers amplify both IFN-1 and IFN-13 transcripts .sup.2Primers amplify both IFN-4 and IFN-10 transcripts
    6. Molecular Modelling of CXCR4 with Various Ligands.

    [0127] The molecular docking program cDOCKER was used for automated molecular docking simulations and various scoring function were used to rank poses: Jain, cDocker Interaction optimized, Ludi. PDB files were cleaned using the prepare protein protocol of Discovery Studio 4.1, membrane was added according to Im. W algorithm Ligands and their conformer were prepared using prepare ligand protocol after conformation generation. Complexes were selected on the basis of criteria of interacting energy combined with geometrical matching quality as well as compromise of scoring function Figures were generated with Discovery studio 4.1 graphics system. The 2D representations of molecular structures interaction of Discovery Studio was used for delineation of the detailed interactions between ligands and CXCR4 (PDB code: 3ODU). An interaction was considered a hydrophobic interaction if the Van der Walls fraction was 0.7 and was considered a hydrogen bond if it was between a listed donor and acceptor and the angles and distances formed by the atoms surrounding the hydrogen bond lay within the default criteria. RMSD were calculated using Discovery studio 4.1 and with ITlt in CXCR4/ITlt co-crystal as reference (PDB code 3ODU).

    7. Statistical Analysis.

    [0128] P values (P) were determined using a two-tailed Student's t test. P<0.05 was considered statistically significant. *=P<0.05; **=P<0.01 and ***=P<0.001. Univariate distributions of flow cytometry data were performed by probability binning, in 300 bins using FlowJo software.

    [0129] Data sets were analysed by two-way ANOVA with Bonferroni post-tests (cytokine concentration time courses). GraphPad Prism 5 (GraphPad Software, San Diego, Calif.) was used for data analysis and preparation of all graphs. P-values less than 0.01 were considered to be statistically significant.

    RESULTS

    1. AMD3100 Prevents Type I Interferon Production Inhibition Induced by Amines

    [0130] 1.1. AMD3100 was tested for inhibition of type I interferon production by HIV-stimulated pDC. AMD3100 alone did not block type I IFN nor TRAIL expression by HIV-activated pDC.
    1.2. AMD3100 was then tested for its ability to block the action of amine-type compounds, i.e. histamine and clobenpropit (CB), which bind at the ITlt pocket on CXCR4 (ITlt is a CXCR4 antagonist) and notably inhibit the production of IFN-I by HIV-stimulated pDC.

    [0131] The expressions of TRAIL, IFN-a and IFN- in pDC treated or not with AMD3100 were thus quantified.

    [0132] Purified cells were pre-incubated with AMD3100 for 1 hour and then by histamine or CB for 1 hour and finally exposed to HIV-1 overnight.

    [0133] AMD3100 drastically abolished biological activities of histamine and CB on HIV activated-pDC. Indeed, the inventors observed that AMD3100 treatment could restore IFN-a, IFN- and TRAIL mRNA expression (FIG. 1) and IFN-a production (FIG. 2) inhibited by histamine or CB in HIV-activated pDC. These results were confirmed for the expression of IFN-, IL-6 and IFN-stimulated gene 56 (ISG56) mRNA expression in HIV-activated pDC (FIGS. 3A-3C).

    2. Identification of a Binding Pocket for AMD3100 on CXCR4 Extracellular Domain

    [0134] To understand the molecular interaction between AMD3100 and CXCR4, in silico docking experiments were performed.

    [0135] ITlt, a CXCR4 antagonist, was used as an internal control to validate the molecular modelling protocol. ITlt and AMD3100 were thus docked in the ITlt binding pocket of CXCR4.

    [0136] It has been first confirmed that ITlt was replaced properly compared to the crystal structure. Indeed, RMSDs of ITlt heavy atoms resolved in crystal structure (PDB code 3ODU) and ITlt docking poses after scoring are around 1 (equivalent to the variation observed when comparing ITlt in 3ODU co-crystal with other co-crystallized structures (PDB codes 3OE6-3OE8-3OE9)) (Table 1).

    TABLE-US-00002 TABLE 1 Validation of docking protocol. Scoring of IT1t poses after docking in CXCR4 (PDB code: 3ODU) using cDocker. Poses were ranked depending on their scores calculated either with Jain, cDocker Interaction Optimized or Ludi as scoring function. RMSD between each top poses and crystallized IT1t as reference was calculated in . RMSD: Root-mean-square deviation. Scoring Function X-ray cDocker IT1t (PDB code 3ODU) vs IT1t in Interaction other structures (PDB codes: Jain Optimized Ludi 3OE6-3OE8-3OE9) RMSD RMSD RMSD RMSD Top heavy heavy heavy PDB heavy pose atoms atoms atoms code atoms #1 1.0603 1.0603 1.0603 3OE6 0.3887 #2 0.7775 0.9667 0.7775 3OE8 0.6986 #3 0.9667 3.8033 0.9667 3OE9 0.6739

    [0137] The 2D representation was used for delineation of the detailed interactions between ligands and CXCR4 (Table 2).

    [0138] The molecular docking of AMD3100 and CXCR4/ITlt co-crystallization allowed the identification of two distinct binding pockets on CXCR4; AMD3100 pocket covers up superficially the two subpockets of CXCR4 while the ITlt pockets is located more deeply in the minor subpocket of CXCR4. Thus, the access of ITlt or amine-type compounds, such as histamine or CB, to the binding pocket could be blocked by AMD3100.

    TABLE-US-00003 TABLE 2 Residues involved in ligand binding in IT1T and AMD3100 pockets IT1T Binding pocket AMD3100 Binding pocket IT1T CB AMD3100 AMD3100 CB IT1t W94 X X D171 X D97 X X F174 X W102 X X A175 X V112 X V196 X Y116 X X G207 X R183 X X Y255 X X X I185 X X Y256 X C186 X X I259 X X D187 X X D262 X Y190 X S263 X E288 X X X E288 X X X